CN105435245A - Applications of calcium-and inte-grin-binding protein 1 in preventing and treating enterovirus 71 infection - Google Patents
Applications of calcium-and inte-grin-binding protein 1 in preventing and treating enterovirus 71 infection Download PDFInfo
- Publication number
- CN105435245A CN105435245A CN201510964636.2A CN201510964636A CN105435245A CN 105435245 A CN105435245 A CN 105435245A CN 201510964636 A CN201510964636 A CN 201510964636A CN 105435245 A CN105435245 A CN 105435245A
- Authority
- CN
- China
- Prior art keywords
- cib1
- infection
- calcium
- cell
- sirna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention belongs to the technical field of biomedicine, and relates to a novel target used for preventing enterovirus 71 infection, and applications thereof. According to the invention, SH-SY5Y is taken as the target cell, and RNA interference technology is adopted for down-regulation of expression of target cell host protein so as to search host factors capable of inhibiting EV71 infection of SH-SY5Y cells effectively and protect the functions of central nervous systems. It is fond by experiments that calcium-and inte-grin-binding protein, CIB1 molecular possesses significant importance in EV71 infection of SH-SY5Y, and down-regulation of expression of CIB1 is capable of inhibiting EV71 infection obviously. The invention also provides applications of CIB1 in preparing drugs used for preventing or treating EV71 infection.
Description
Technical field
The present invention relates to field of biomedicine technology, be specifically related to novel targets and the application of the infection of anti-enterovirns type 71.
Background technology
Enterovirns type 71 (enterovirus71, EV71) belongs to Picornaviridae enterovirus genus people intestinal category-A virus, is one of main pathogens causing hand-foot-mouth disease (Hand-foot-mouthdisease, HFMD).At present, hand-foot-mouth disease to be broken out and popular in multiple area in the world, the especially Asian-Pacific area.In China, since 2008 Nian Ji great provinces and cities break out hand-foot-mouth disease epidemic situation, number of the infected and the mortality rate of this disease remain high always, and every annual report morbidity number is more than 1,000,000 examples, and death toll nearly 1000 is routine.Hand-foot-mouth disease principal pathogenetic crowd is 5 years old Infants Below, and clinical manifestation is heating, and the symptoms such as herpes appear in the positions such as hands, foot, buttocks and oral mucosa; Minority infant can develop into patient with severe symptoms, there is central nervous system (centralnervoussystem, CNS) pathological changes, comprise aseptic meningitis, brain stem encephalitis, encephalomyelitis and neurogenic pulmonary edema etc., life and health [the SolomonT of infant in serious threat, LewthwaiteP, PereraD, CardosaMJ, McMinnP, OoiMH.Virology, epidemiology, pathogenesis, andcontrolofenterovirus71.LancetInfectDis.2010Nov; 10 (11): 778-90.].Hand-foot-mouth disease particularly severe cases is many caused by enterovirns type 71 (EV71) infects.But, cause the treatment of hand-foot-mouth disease to there is no the antiviral drugs of differential high efficient about EV71 at present, clinically still based on symptomatic treatment, also come out without effective vaccine in prevention.
EV71 infects and has Neural invasion, easily causes serious CNS disease and complication thereof, and this is also cause hand-foot-mouth disease patient evolution for serious symptom even main causes of death.Wherein, brain stem is the most easily by position [Tee that EV71 infects, K.K., etal.Evolutionarygeneticsofhumanenterovirus71:origin, populationdynamics, naturalselection, andseasonalperiodicityoftheVP1gene.JVirol, 2010.84 (7): p.3339-50.], the position such as brain stem neuron that research confirms EV71 patient with severe symptoms all can detect the existence of EV71 gene and antigen, proves that EV71 can enter CNS.But the mechanism of the central nervous system symptom that EV71 causes is still not clear [SolomonT, LewthwaiteP, PereraD, CardosaMJ, McminnP, OoiMH.Virology, epidemiology, pathogenesis, andcontrolofenterovirus71.LancetInfectDis.2010; 10; 778-90.].Neuroblastoma cell (SH-SY5Y) is nervous tissue source, has certain neurocyte characteristic.Therefore, verify EV71 and infect the mechanism of SH-SY5Y and find new antiviral target spot with this, the central nervous system infection caused for control EV71 is most important.
In order to infection cell effectively, virus must utilize the membrane molecule of host cell and vesicular transport system thereof to complete invasion to host cell, could carry out copying in cell and discharge infective progeny virion.Therefore, as the primary link of viruses infect host cells, cell entry has become the important target of antiviral drugs screening.Research shows, EV71 can utilize different host factor and route of infection to invade different types of target cell, such as EV71 infects endocytic pathway (the caveolar-dependentendocytosis) [LinHY that JurkatT lymphocyte series mainly utilizes alveole to rely on, YangYT, YuSL, etal.CaveolarendocytosisisrequiredforhumanPSGL-1-mediate denterovirus71infection.JVirol.2013,87 (16): 9064-76.].At present, infect the approach of SH-SY5Y about EV71 and mechanism still unclear.
Virus entry target cell mainly by means of the key molecule participating in the transport of host cell Self substances, and these host cell membrane transport molecules, in the cross-film matter transportation of cell, play an important role in the formation of vesicle, endocytosis and secretion.As metalloproteases have adjusted cell adhesion, the degraded of membrane molecule; Caveolin family molecule caveolin-1 (CAV1), caveolin-2 (CAV2), caveolin-3 (CAV3) by matter transportation to Golgi body; Flotillin molecule can interact also with protein molecular in Lipid Rafts and swallow in cell; Calcium integrin Binding Protein 1 (calcium-andinte-grin-bindingprotein, CIB1) participates in the mitosis of cell and the formation of aixs cylinder by regulating the motion of microtubule; Gtpase activating protein molecule GRAF1 has important regulating action in the vesicle transport of clathrin independent form; Interleukin-2 Receptor endocytosis have adjusted signal path and have impact on cell proliferation (JasonMercer, MarioSchelhaas, etal.VirusEntrybyEndocytosis.AnnuRevBiochem.2010; 79:803-833.).Ezrin albumen regulates cellular microtubules system by tyrosine kinase signal, then have adjusted cell adhesion and the physiological process such as to migrate; Ezrin albumen is also proved and take part in the hepatocellular process (BukongTN of infection with hepatitis C virus, KodysK, SzaboG.Humanezrin-moesin-radixinproteinsmodulatehepatiti sCvirusinfection.Hepatology.2013,58 (5): 1569-79.).Coat protein complex COPA (coatomerproteincomplex) take part in vesicle and mediates non-selective transport, and it participates in from endoplasmic reticulum to the transport along face Golgi body.In these molecules, caveolin-1 is proved and take part in the lymphocytic process of EV71 infection JurkatT, and the effect of other molecule in EV71 infects also does not have report.
Calcium integrin associated proteins (calcium-andintegrin-bindingprotein, CIB) is a newfound class calbindin in recent years, extensively distributes in mammal tissue.Take part in Ca in intracellular cell
2+the functions such as the adjustment of stable state, the transduction of cell signal, cell proliferation, apoptosis.The research such as Kostyak confirms that CIB1 is by regulating the motion of microtubule thus the propagation of T suppression cell.(KostyakJC, NaikUP.Calcium-andintegrin-bindingprotein1regulatesendom itosisanditsinteractionwithPolo-likekinase3isenhancedine ndomitoticDamicells [J] PLoSOne, 2011,6 (1): e14513.) also have research to confirm CIB1 is by suppressing Cofilin active simultaneously, retraction ring integrity when destroying cell division and then affect cell cycle.Sobczak etc. study developmental neuron, and result display CIB1 c-terminus, by being combined with SCG10 protein amino-terminus, mediates Ca
2+signal transduction, thus regulate the effect of microtubule in axon growth.(SobczakA,DebowskaK,BlazejczykM,etal.Calmyrin1bindstoSCG10protein(stathmin2)tomodulateneuriteoutgrowth[J].BiochimBiophysActa,2011,1813(5):1025-1037.)
At present also without any the research report about the effect in EV71 infects human neuroblastoma (SH-SY5Y) of CIB1 molecule, CIB1 molecule is carried out furtheing investigate the understanding that can not only promote EV71 infection and mechanism of causing a disease, also can infect for prevention and treatment EV71 the thinking and target spot that provide new.
Summary of the invention
The object of the present invention is to provide the novel targets that a kind of anti-enterovirns type 71 infects.
Another object of the present invention is to the novelty teabag that calcium integrin Binding Protein 1 (CIB1) molecule is provided, the application particularly in anti-enterovirns type 71 infects.
The third object of the present invention is to provide the interference CIB1 siRNA of developed by molecule.
Main technical schemes of the present invention is:
The present invention; using human neuroblastoma (SH-SY5Y) as target cell; adopt RNA perturbation technique to lower the expression of target cell host protein, find the host factor that can effectively suppress EV71 to infect human neuroblastoma (SH-SY5Y), thus neuroprotective system.This experimental selection one group of host cell transmembrane transporter molecules screens, these molecules are in the cross-film matter transportation of host cell, play an important role in the endocytosis of vesicle and secretion, they are also often easily by virus " abductions " and the molecule of utilization in virus infection.These molecules comprise: metalloproteases 10 (ADAM10), calcium integrin Binding Protein 1 (CIB1), caveolin-1 (CAV1), caveolin-2 (CAV2), caveolin-3 (CAV3), Flotillin albumen 1 (FLOT1), gtpase activating protein (GRAF1), Interleukin-2 Receptor (IL2RB), Ezrin albumen, coat protein complex (COPA).Complete sequence and mRNA sequence is obtained by retrieval NCBIGeneBank, existing Internet resources and popular software is utilized to carry out biological analysis to these genes, select the target sequence that coding region is designed as siRNA, then siRNA is designed, by lowering these molecules, observe the impact that EV71 is infected.
We find that calcium integrin Binding Protein 1 (calcium-andintegrin-bindingprotein1, CIB1) infects in SH-SY5Y at EV71 and play an important role, and lower the expression of CIB1, obviously can suppress the infection of EV71.
A first aspect of the present invention, provides the novel targets that calcium integrin Binding Protein 1 (CIB1) infects as a kind of anti-enterovirns type 71.
Described calcium integrin Binding Protein 1 (CIB1), GENBANKID:NM_006384.
A second aspect of the present invention, provides the application of calcium integrin Binding Protein 1 (CIB1) in preparation prevention or treatment enterovirns type 71 infection medicine.
Further, the present invention also provides the application of calcium integrin Binding Protein 1 (CIB1) in preparation prevention or treatment hand-foot-mouth disease medicine.
The application of calcium integrin Binding Protein 1 (CIB1) of the present invention in preparation prevention or treatment enterovirns type 71 infection medicine, this medicine specifically refers to the reagent that can suppress or lower the expression of CIB1.
The reagent that the expression of CIB1 is lowered in described suppression can be siRNA, shRNA, comprise the recombinant vector of siRNA, shRNA (as plasmid) etc.
A third aspect of the present invention, the RNA interfering that the invention provides calcium integrin Binding Protein 1 (CIB1) is preparing in the application prepared in prevention or treatment enterovirns type 71 infection medicine or calcium integrin binding protein-1 the application preventing or treat in hand-foot-mouth disease medicine, described medicine is RNA interfering (siRNA), and its sequence is as follows:
CAGACAUCAAGUCCCAUUAUU(SEQIDNO:4)、
CUUAGUGCGUCUGAGAUGAUU(SEQIDNO:5)、
CUCCGUUUGUGUUUGUACUUU(SEQIDNO:6)。
Wherein, lower the expression best results of CIB1 with the siRNA such as shown in SEQIDNO:5, and it is the most obvious to the infection of SH-SY5Y cell to reduce EV71.
The present invention screens and EV71 can be suppressed to infect the new host cellular molecules CIB1 of of SH-SY5Y cell.After CIB1 gene deregulation, do not affect the normal physiological function of cell, but obviously inhibit EV71 to the infection of SH-SY5Y cell.
Therefore the present invention for clinical prevention and treatment provide new target spot and therapeutic scheme because EV71 infects the nervous system damage caused.
Accompanying drawing explanation
Fig. 1 is that jamming effectiveness after the effective siRNA of transfection and cytotoxicity detect, and in figure, primary axis represents jamming effectiveness, and secondary axis represents Cytotoxic impact;
The SH-SY5Y groups of cells (ghost group) of CTRL: any siRNA of not transfection;
The SH-SY5Y groups of cells (negative control group) of NT: transfection non-targetingsiRNA;
SiRNA: transfection is for the SH-SY5Y groups of cells (experimental group) of the siRNA of each genes of interest.
Fig. 2 is the impact infected EV71 after each host molecule of immuno-fluorescence assay is lowered, and wherein A lowers the fluoroscopic examination figure to viral infection after each molecule, and B lowers the suppression ratio figure to viral infection after each molecule;
The SH-SY5Y groups of cells (ghost group) of CTRL: any siRNA of not transfection;
The SH-SY5Y groups of cells (negative control group) of NT: transfection non-targetingsiRNA;
SiRNA: transfection is for the SH-SY5Y groups of cells (experimental group) of the siRNA of each genes of interest.
Fig. 3 is the impact infected EV71 after CIB1 lowers, and wherein A is the expression figure that WesternBlot detects CIB1 albumen, B is that the cytopathic effect figure observing EV71, C are for detecting EV71 virus spirogram;
The SH-SY5Y groups of cells (ghost group) of CTRL: any siRNA of not transfection;
The SH-SY5Y groups of cells (negative control group) of NT-CTRL: transfection non-targetingsiRNA;
CIB1: transfection is for the SH-SY5Y groups of cells of the siRNA (SEQIDNO:5) of CIB1 gene.
Fig. 4 is jamming effectiveness after the disturbance sequence of transfection CIB1 molecule and to the infective effect diagram of EV71, and A is the mRNA level in-site detection figure of CIB1 gene, B is EV71 virus quantity detection figure;
The SH-SY5Y groups of cells (ghost group) of CTRL: any siRNA of not transfection;
The SH-SY5Y groups of cells (negative control group) of NT-CTRL: transfection non-targetingsiRNA;
CIB1-4: transfection is for the SH-SY5Y groups of cells of the siRNA (SEQIDNO:4) of CIB1 gene;
CIB1-5: transfection is for the SH-SY5Y groups of cells of the siRNA (SEQIDNO:5) of CIB1 gene;
CIB1-6: transfection is for the SH-SY5Y groups of cells of the siRNA (SEQIDNO:6) of CIB1 gene.
Detailed description of the invention
Now in conjunction with the embodiments and accompanying drawing, the present invention is described in detail, but enforcement of the present invention is not limited only to this.
Agents useful for same of the present invention and raw material all commercially maybe can be prepared by literature method.The experimental technique of unreceipted actual conditions in the following example, usual conveniently condition is as the people such as Sambrook " molecular cloning: lab guide " (NewYork:ColdSpringHarborLaboratoryPress, 1989) condition described in, or conveniently condition, or according to the condition that manufacturer advises.Unless otherwise indicated, otherwise percentage ratio and number calculate by weight.
Embodiment 1:
1 design, synthesize the specific siRNA sequence of each host cellular molecules.
1.1 for each genes of interest, and retrieval NCBIGeneBank obtains complete sequence and mRNA sequence, utilizes existing Internet resources and popular software to carry out biological analysis to each genes of interest, selects the target sequence that coding region is designed as siRNA.With reference to siRNA design principle, and contrasted by the blast function of GeneBank data base and human genomic sequence, guarantee without homology; Get rid of 5 ' the potential siRNA holding continuous 8 bases and other gene to match of aitisense chain; Get rid of the potential siRNA that any one section continuous 14 bases and other gene match.And utilize design software to carry out Pre-Evaluation mensuration, select 3 best kinetic parameter target spots to enter subsequent experimental flow process, each gene synthesizes 3 interference sequences altogether, in table 1.
Synthesis and the purification of 1.2 strand siRNA are completed by Invitrogen company.
The design of table 1.siRNA target spot
2siRNA sequence screening and interference effect are identified
2.1RNA transfection
Transfection procedure is with reference to Lipofectamine2000 description
1) within 12-16 hour in advance, to be layered on 24 porocyte culture plates by SH-SY5Y cell (purchased from ATCC, preserving number: ATCCCRL-2266) and to cultivate, when making transfection, cell density is 80%-90%.
2) get 2 μ LLipofectamine2000 and add also soft mixing in 50 μ Lopti-MEM, incubated at room 5 minutes; Separately getting 5 μ L concentration is that the RNA interfering of 5 μMs and 50 μ Lopti-MEM mix.After hatching end, the Lipofectamine2000 transfection reagent of dilution is added in the RNA of dilution, and soft pressure-vaccum mixing.After incubated at room 20min, add in SH-SY5Y cell, add 400 μ Lopti-MEM, make RNA final concentration be 50nM.
3) within after transfection 6-8 hour, change containing dual anti-fresh culture.
2.2 real-time fluorescence quantitative PCRs (RT-PCR) detect the mRNA level in-site of each host molecule
1) TRIzol extracts the total serum IgE of matched group and interference group cell, and concrete steps are as follows:
Transfection, after 48 hours, goes culture supernatant, in cell, add 1mlTRIzol, abundant mixed room temperature cell lysis 3-5 minute.Add the chloroform of 1/5 volume, manually violent mixing 15 seconds.In 4 DEG C, 12,000 leaves the heart 15 minutes.Get upper strata aqueous phase and transfer in new EP pipe, adding equal-volume isopropyl alcohol, fully mix, precipitation at room temperature 10 minutes.In 4 DEG C, 12,000 leaves the heart 10 minutes.Abandon supernatant, add 75% ethanol of 1ml pre-cooling.In 4 DEG C, 12,000 centrifugal 5 minutes.Fully abandon supernatant, room temperature dries RNA precipitation, adds DEPC process water dissolution precipitation, obtains total serum IgE.
2) utilize takara Reverse Transcription box to obtain the cDNA of matched group and interference group cell, concrete steps are as follows:
Following reaction system is added in PCR pipe,
Soft mixing mixing, is placed in 37 DEG C of reactions 15 minutes, is then placed in 85 DEG C of heating deactivation in 5 seconds reverse transcriptases.
3) fluorescence quantitative RT-RCR detects
Utilize the SYBRPremixExTaq test kit of takara to react, reaction system is as follows,
Utilize RotorGene3000A instrument to carry out two-step method amplification, 95 DEG C of denaturation 2min, carry out 40 PCR circulation, 95 DEG C 5 seconds, 60 DEG C 30 seconds.
3 cytotoxicity experiments
The impact of on cell proliferation after employing CCK-8 method detection transfection siRNA, concrete steps are as follows:
Collect exponential phase cell, be inoculated in 96 orifice plates with the density in 3000, every hole.After cell pellet overnight is adherent, each siRNA of transfection, cultivates and detects cell proliferative conditions after 48 hours.Discard original culture medium, every hole adds the fresh culture 110 μ L containing 10 μ LCCK-8, to cultivate after 3h by multi-functional microplate reader at 450nm wavelength detecting each hole absorbance.Experiment is independent to be repeated 3 times, calculating mean value.
4EV71 viral infection SH-SY5Y cell
The EV71 viral infection experiment of 4.1SH-SY5Y cell
After SH-SY5Y cell transfecting RNA 72 hours, carry out the experiment of EV71 viral infection.By culture supernatant sucking-off, with pre-temperature PBS rinse 2 times, with the virus quantity of MOI=0.1 inoculation EV71,37 DEG C hatch 2h after discard virus liquid, and with pre-temperature PBS rinse 3 times, add fresh culture and continue to cultivate.
4.2 immunofluorescence dyeing detects EV71 antigen presentation
Continue after SH-SY5Y cell infection virus to cultivate 48h, adopt the expression of immuno-fluorescence assay virus antigen, concrete steps are as follows:
1) cell is fixed: removed by the culture fluid in 96 orifice plates, and add PBS and clean cell 2 times, every hole adds the pre-cold methanol of 100 μ l, under-20 DEG C of conditions, fix 20min, cleans cell 3 times with the PBS of pre-cooling.
2) permeable membrane: the cell per well after fixing adds 100 μ l0.1%TritonX-100, incubated at room 15min, washs 3 times with pre-cooling PBS.
3) close: every hole adds 100 μ l3%BSA, in incubated at room temperature 1h.
4) primary antibodie is hatched: every hole adds EV71 specific murine source monoclonal antibody 10F0 (1:2000 dilution) 100 μ l, incubated at room 1h, washs 3 times with the PBS of pre-cooling.
5) two anti-to hatch: every hole adds AF488 fluorescent labeling against murine IgG (1:1000 dilution) 100 μ l, and room temperature lucifuge hatches 1h, washs 2 times by the PBS lucifuge of pre-cooling.
6) labeled cell core: every hole adds nucleus fluorescent dye DAPI (1:5000, PBS dilute), and room temperature lucifuge hatches 15min, washs 3 times by the PBS lucifuge of pre-cooling.
7) detect under fluorescence microscope and calculate green AF488 positive cell clone number.
4.3 protein immunoblot.
(1) total protein of matched group and CIB1 interference group SH-SY5Y cell is extracted respectively with protein lysate.
(2) respectively 30ug albumen is added to electrophoresis in the polyacrylamide gel of 12.5% concentration after quantification of protein, and intercepts respective strap electroporation and forward on pvdf membrane.
(3) non-specific sites of albumen is closed with the skim milk of 5%, and then close with CIB1 antibody, 4 DEG C are spent the night, and wash three times, wash away primary antibodie with TBST buffer.
(4) then use two of HRP labelling anti-incubated at room 2 hours, then wash three times with TBST buffer.
(5) last, utilize nitrite ion to develop the color and photographic analysis.
4.4RT-PCR detects EV71 virus quantity in cell
Continue after SH-SY5Y cell infection virus to cultivate 48h, adopt TRIzol to extract the total serum IgE of matched group and interference group cell, and reverse transcription obtains cDNA, detect EV71 virus quantity by RT-PCR.Concrete steps are with shown in 2.2.
Experimental result:
1 design, synthesize and screen effective siRNA
For each genes of interest sequence, we devise multiple RNA interfered target sequence, and utilize design software to carry out Pre-Evaluation mensuration, select 3 best kinetic parameter target spots to enter subsequent experimental flow process, each gene synthesizes 3 interference sequences altogether, as shown in table 1.
Adopt the method for in-vitro transfection, the RNA interfering of each gene is transfected in SH-SY5Y cell and goes, detected the jamming effectiveness of each RNA interfering by RT-PCR method after 48h, the siRNA sequence (in table 2 overstriking sequence) that finishing screen chooses interference effect the best carries out subsequent experimental, and its jamming effectiveness is as shown in table 2.
Table 2RT-PCR method detects siRNA interference sequence to the downward efficiency of relevant host gene
Note: CTRL: the SH-SY5Y groups of cells (ghost group) of any siRNA of not transfection
The SH-SY5Y groups of cells (negative control group) of NT: transfection non-targetingsiRNA
SiRNA: transfection is for the SH-SY5Y groups of cells (experimental group) of the siRNA of each genes of interest.
Jamming effectiveness after 2siRNA interference and cytotoxicity detect
The effective siRNA transfection SH-SY5Y cell for each host molecule picked out, after transfection, 48h detects the jamming effectiveness of each RNA interfering by RT-PCR method, on the Cytotoxic impact of SH-SY5Y after employing CCK8 detection transfection simultaneously.
As shown in Figure 1, the effective siRNA group of transfection, compared with CTRL group, obviously can suppress the expression (P < 0.01) of corresponding gene to result after each siRNA of transfection.The suppression efficiency of transfection CIB1siRNA (SEQIDNO:5) can reach 78%.
Cytotoxicity experiment shows, does not produce obvious cytotoxicity (P > 0.05), do not have an impact, can be used for subsequent experimental to the normal physiological function of cell after each siRNA transfection.
Impact on EV71 viral infection after 3siRNA interference
After effective siRNA of each host molecule of transfection lowers the expression of host cell correlation molecule, infect the EV71 virus of same dose, after infecting 48h, the impact after adopting each host molecule of immuno-fluorescence assay to lower, EV71 infected, find compared with matched group, after transfection CIB1siRNA (SEQIDNO:5) makes CIB1 gene deregulation, significantly reduce the infection (Fig. 2 A) of EV71 to SH-SY5Y cell.Find by calculating virus quantity, after CIB1 gene deregulation, 78.25% is reached to the suppression ratio of virus, and the downward of all the other molecules does not obviously suppress EV71 to infection (P > 0.05) (Fig. 2 B) of SH-SY5Y cell.
For the inhibitory action that clear and definite CIB1 infects EV71, after transfection CIB1 molecule siRNA, detected the expression of CIB1 protein molecular by immunoblotting, and after infection EV71 observation of cell pathological changes situation, and detect EV71 virus quantity by RT-PCR.Result shows, and after transfection CIB1 molecule siRNA (SEQIDNO:5), obviously can suppress the expression (Fig. 3 A) of CIB1 protein molecular.Compared with matched group, after CIB1 protein expression is lowered, can T suppression cell pathological changes and virus quantity in SH-SY5Y cell also significantly decline (Fig. 3 B, C), consistent with immuno-fluorescence assay result.These results show, compared with compared with control cells, after lowering CIB1 gene, the infection ability of EV71 to SH-SY5Y cell obviously declines, and virus quantity reduces.
Further, the siRNA of transfection three CIB1 molecules observes the impact on viral infection respectively.Result shows the downward efficiency difference (Fig. 4 A) of different siRNA to CIB1 molecule, and wherein the jamming effectiveness of siRNA (SEQIDNO:5) is the highest, consistent with result above.After detecting interference, the infective impact of EV71 is found, article three, the siRNA of CIB1 molecule all can reach more than 70% to the suppression ratio of viral infection, and increasing along with the downward efficiency to CIB1 molecule, also raising (Fig. 4 B) to the suppression ratio that EV71 infects, prompting CIB1 molecule infects in SH-SY5Y at EV71 and plays an important role.Therefore, CIB1 can be used as and suppresses EV71 to new host's target spot of SH-SY5Y cell infection.
By above the results show: the present invention screens and EV71 can be suppressed to infect the new host cellular molecules CIB1 of of SH-SY5Y cell.After CIB1 gene deregulation, do not affect the normal physiological function of cell, but obviously inhibit EV71 to the infection of SH-SY5Y cell.Therefore the present invention for clinical prevention and treatment provide new target spot and therapeutic scheme because EV71 infects the nervous system damage caused.
Below the preferred embodiment of the invention is illustrated, but the invention is not limited to described embodiment, those of ordinary skill in the art also can make all equivalent modification or replacement under the prerequisite without prejudice to the invention spirit, and these equivalent modification or replacement are all included in the application's claim limited range.
Claims (8)
1. the application of calcium integrin associated proteins CIB1 in preparation prevention or treatment enterovirns type 71 infection medicine.
2. the application of calcium integrin associated proteins CIB1 in preparation prevention or treatment hand-foot-mouth disease medicine.
3. the application of calcium integrin associated proteins CIB1 according to claim 1 in preparation prevention or treatment enterovirns type 71 infection medicine, it is characterized in that, described medicine refers to the reagent that can suppress or lower CIB1 expression.
4. the application of calcium integrin associated proteins CIB1 according to claim 3 in preparation prevention or treatment enterovirns type 71 infection medicine, it is characterized in that, the described reagent that can suppress or lower CIB1 expression is siRNA, shRNA of CIB1 or comprises the recombinant vector of siRNA, shRNA.
5. the application of calcium integrin associated proteins CIB1 according to claim 1 in preparation prevention or treatment enterovirns type 71 infection medicine, it is characterized in that, described medicine is the RNA interfering of CIB1, and the sequence of described RNA interfering is selected from following arbitrary:
CAGACAUCAAGUCCCAUUAUU(SEQIDNO:4)、
CUUAGUGCGUCUGAGAUGAUU(SEQIDNO:5)、
CUCCGUUUGUGUUUGUACUUU(SEQIDNO:6)。
6. the application of calcium integrin associated proteins CIB1 in preparation prevention or treatment hand-foot-mouth disease medicine according to claim 2, it is characterized in that, described medicine refers to the reagent that can suppress or lower CIB1 expression.
7. the application of calcium integrin associated proteins CIB1 according to claim 6 in preparation prevention or treatment hand-foot-mouth disease medicine, it is characterized in that, the described reagent that can suppress or lower CIB1 expression is siRNA, shRNA of CIB1 or comprises the recombinant vector of siRNA, shRNA.
8. the application of calcium integrin associated proteins CIB1 in preparation prevention or treatment hand-foot-mouth disease medicine according to claim 2, it is characterized in that, described medicine is the RNA interfering of CIB1, and the sequence of described RNA interfering is selected from following arbitrary:
CAGACAUCAAGUCCCAUUAUU(SEQIDNO:4)、
CUUAGUGCGUCUGAGAUGAUU(SEQIDNO:5)、
CUCCGUUUGUGUUUGUACUUU(SEQIDNO:6)。
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510964636.2A CN105435245B (en) | 2015-12-21 | 2015-12-21 | Application of the calcium integrin Binding Protein 1 in prevention and treatment enterovirns type 71 infection |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510964636.2A CN105435245B (en) | 2015-12-21 | 2015-12-21 | Application of the calcium integrin Binding Protein 1 in prevention and treatment enterovirns type 71 infection |
Publications (2)
Publication Number | Publication Date |
---|---|
CN105435245A true CN105435245A (en) | 2016-03-30 |
CN105435245B CN105435245B (en) | 2019-02-01 |
Family
ID=55546161
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201510964636.2A Active CN105435245B (en) | 2015-12-21 | 2015-12-21 | Application of the calcium integrin Binding Protein 1 in prevention and treatment enterovirns type 71 infection |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN105435245B (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113321721A (en) * | 2021-06-11 | 2021-08-31 | 中南大学湘雅二医院 | Extracellular Ezrin protein and application thereof |
-
2015
- 2015-12-21 CN CN201510964636.2A patent/CN105435245B/en active Active
Non-Patent Citations (4)
Title |
---|
ANA GODINHO-SANTOS ET AL.: "CIB1 and CIB2 are HIV-1 helper factors and their modulation influences envelope-mediated viral entry", 《J ANTIVIR ANTIRETROVIR》 * |
惠玲等: "钙整合素结合蛋白1 慢病毒干扰载体的构建及表达", 《解放军医药杂志》 * |
王敏等: "手足口病的研究现状", 《华北国防医药》 * |
郭晓丽等: "EV71入侵人神经母细胞瘤SK-N-SH细胞机制的初步研究", 《重庆医科大学学报》 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113321721A (en) * | 2021-06-11 | 2021-08-31 | 中南大学湘雅二医院 | Extracellular Ezrin protein and application thereof |
CN113321721B (en) * | 2021-06-11 | 2022-06-03 | 中南大学湘雅二医院 | Extracellular Ezrin protein and application thereof |
Also Published As
Publication number | Publication date |
---|---|
CN105435245B (en) | 2019-02-01 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Zhang et al. | Understanding the role of SARS-CoV-2 ORF3a in viral pathogenesis and COVID-19 | |
Fox et al. | Broadly neutralizing alphavirus antibodies bind an epitope on E2 and inhibit entry and egress | |
Chen et al. | The laminin receptor is a cellular attachment receptor for classical swine fever virus | |
Angus et al. | Requirement of cellular DDX3 for hepatitis C virus replication is unrelated to its interaction with the viral core protein | |
Celma et al. | Interaction of calpactin light chain (S100A10/p11) and a viral NS protein is essential for intracellular trafficking of nonenveloped bluetongue virus | |
He et al. | Beta-actin interacts with the E2 protein and is involved in the early replication of classical swine fever virus | |
Melik et al. | Two PDZ binding motifs within NS5 have roles in Tick-borne encephalitis virus replication | |
Xing et al. | Snake cathelicidin derived peptide inhibits Zika virus infection | |
CN105535975A (en) | Applications of vesicle-associated membrane protein 1 in prevention and treatment of enterovirus 71 infection | |
CN105435246A (en) | Applications of autophagy-related protein 12 in preventing and treating enterovirus 71 infection | |
CN105267948A (en) | Applications of hepatocyte growth factor-regulated tyropsine kinasesubstrate in preparation of medicines preventing enterovirus 71-type infection | |
CN105311647A (en) | Application of Cofilin in preventing and treating Japanese encephalitis virus infection | |
CN105435245A (en) | Applications of calcium-and inte-grin-binding protein 1 in preventing and treating enterovirus 71 infection | |
CN105267984A (en) | Application of ADP ribosylation factor 6 in prevention and treatment of enterovirus 71 infection | |
CN105497918A (en) | Application of dynamin 1 in prevention and treatment on enterovirus type 71 infection | |
CN105288655A (en) | Application of vacuolar protein sorting 4A to preparing medicines for preventing or treating enterovirus type 71 infection | |
CN108752435A (en) | Acetylation Hepatitis E Virus Capsid Protein ORF2 and application thereof | |
CN105267985B (en) | Application of the n-ethylmaleimide sensitive factor in prevention japanese encephalitis virus infection | |
Wang et al. | Inhibition of lysosome-tethered Ragulator-Rag-3D complex restricts the replication of Enterovirus 71 and Coxsackie A16 | |
CN105497874A (en) | Application of sorting nexin 1 in prevention and treatment on enterovirus type 71 infection | |
CN105311646A (en) | Application of Ezrin in preventing and treating Japanese encephalitis virus infection | |
CN105288654A (en) | Application of protein tyrosine kinase FYN proto-oncogene in controlling enterovirus 71 infections | |
Pan et al. | 14-3-3 is a VP3-binding protein involved in Macrobrachium rosenbergii Taihu virus infection in shrimp | |
WO2013138670A1 (en) | Yellow fever virus ns5 mutants as flavivirus vaccine candidates | |
CN108795882A (en) | The method for adjusting Hepatitis E virus assembling and capsid protein ORF2 stability |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |