CN108795882A - The method for adjusting Hepatitis E virus assembling and capsid protein ORF2 stability - Google Patents

Abstract

The present invention relates to the methods formed by the production of HDAC6 inhibitor improvement Hepatitis E virus, HEV virus replications, virus O RF2 protein stabilities and HEV virus-like particles.The invention further relates to the cell culture systems and cell culture for Hepatitis E virus, virus-like particle and ORF2 protein productions.In addition, the present invention also relates to by increasing the expression of HDAC6 and/or activity in cell, the method for the treatment of HEV viruses infection.

Description

The method for adjusting Hepatitis E virus assembling and capsid protein ORF2 stability

Technical field

The present invention relates to molecular biology and field of virology.In particular it relates to acetylation Hepatitis E virus (Hepatitis E virus, HEV) capsid protein ORF2, and adjust the Acetylation Level of Hepatitis E virus ORF2 polypeptides Method.The invention further relates to the inhibitor of HDAC6 improve ORF2 polypeptide stabilities, HEV viruses formed, HEV virus replications and HEV virus-like particles formed in purposes.The present invention also relates to controlled by changing the Acetylation Level of HEV ORF2 in cell The method for treating the infection of HEV viruses.

Background technology

Hepatitis E virus (HEV) infects humans and animals in the world, causes intestinal transmitted virus hepatitis, Lethality reaches 25% in pregnant woman.Report within 1989 the Hepatitis E virus sequence from the intestinal transmitted non-B hepatitis of non-A Row, the sequence are similar to the sequence detached from pig, rabbit, rat, deer and wild boar.The capsid protein ORF2 of HEV is the virus Major antigen specifically binds 5 ' ends of HEV geneome RNAs, in virus infection and assembling and viral genome integrality Play an important roll in maintenance.However, ORF2 polypeptide stabilities in HEV infection cells and viral inclusion body (IB) are formed It adjusts, it is current known very few.

Hepatitis E virus (HEV) encodes three kinds of albumen as nonenveloped virus containing 7.2kb single-stranded positive RNA ORF1, ORF2 and ORF3 (1).It is existing to cause about 20,000,000 people to infect in the whole world every year in four kinds of main HEV genotype, Including (2,3) dead caused by 3.3 million symptomatic Hepatitis E cases and 56600 Hepatitis Es.1 and 2 genotype HEV are main Infection people simultaneously causes popular outburst, genotype 3 and 4 to have infecting both domestic animals and human in development and in developed country in developing country Property.

ORF2 is the major antigen of HEV, including 660 amino acid residues, play a major role in virus infects, can induce Host immune response (5).Truncated ORF2 (aa112-660) segment can be self-assembled into virus-like particle (VLP) (6). ORF2VLP can immunogenicity approach identical as natural viral induction, study and production of vaccine in for simulate HEV (7, 8).Meanwhile HEV ORF2 also can be in conjunction with 5 ' ends of HEV geneome RNAs, in the maintenance of virus assembly and genomic integrity On work (9).The N-terminal signal sequence of ORF2 common translation in endoplasmic reticulum (ER), and realize that N- connections glycosylation is repaiied in ER It adorns (10).In addition, 52 amino acid residues of the C-terminal of ORF2 also assist in the stabilisation (11) of HEV packaging and capsid particles.Although ORF2 is extremely important in HEV life cycles, but its how to be conditioned in host it is still unknown.

Lysine acetylation is a kind of important posttranslational modification (PTM), by lysine acetyltransferase dynamic catalysis, and It is removed by lysine deacetylase.The acetylation of lysine is related to a variety of critical events of viral lifecycle, including dyeing Matter remodeling, gene expression and protein stability are adjusted, and the cracking-of intracellular transport and virus is Latent transforming (13).HDAC6 is IIb class HDAC enzyme family members, to such as alpha-tubulin, the nonhistones progress deacetylation (14- such as HSP90 and p300 17).HDAC6 adjust cellular morphology, adhesion and migration, the degradation of misfolded protein and stress reaction, tumor cell invasion, It plays an important role in angiogenesis and drug resistance (18-30).Recent studies have shown that HDAC6 is also in virus infection and hair It plays an important role in Anttdisease Mechanism (13).However, HDAC6 seems with double action (13).On the one hand, HDAC6 is participated in antiviral The host defense (31-35) of infection.On the other hand, HDAC6 is utilized by virus, helps cell entry host cell or viral RNA It synthesizes (36-38).So far, only HIV-1Tat albumen has been identified as HDAC6 substrates (35) in virus.

In view of current Hepatitis E is to the serious harm of human health and incidence is in rapid ascendant trend in recent years, because This, needs exist for the new method for improving the production of HEV viral vaccines and treatment HEV viruses infection.By in-depth study, this hair A person of good sense has found that HEV maintains HEV capsid protein ORF2 stability and inclusion body (IB) shape using the posttranslational modification system of host At new mechanism.Based on this discovery, present inventors have proposed by targeting adjust host cell in ORF2 Acetylation Level come Improve HEV production of vaccine and treats the new method and new compositions of HEV infection.

Summary of the invention

Therefore, on the one hand, the present invention provides a kind of improvement HEV viruses, virus-like particle (VLP) or capsid proteins The method and cell culture system of ORF2 productions are included in the positions the K411 acetyl that HEV capsid protein ORF2 is adjusted in production cell Change horizontal.In one embodiment, production HEV viruses.In further embodiment, production cell can be used for HEV The mammalian cell of viral in vitro culture and production, preferably A549 cells and PLC/PRF/5 cells.Further implementing In scheme, the method includes the steps：The cell is infected with HEV viruses.In another embodiment, HEV virus-likes are produced Particle (VLP) or ORF2 polypeptides.In a further embodiment, production cell is the cell for including ORF2 code nucleic acids, example Such as mammalian cell (including but not limited to HeLa cells and 293T cells), insect cell (including but not limited to sf9 cells). The present invention in this respect, it is preferable that adjust ORF2 Acetylation Levels be enhancing ORF2 Acetylation Levels.In an embodiment In, ORF2 Acetylation Levels are adjusted by HDAC6 expression in inhibition cell and/or activity to realize.In further embodiment In, strike HDAC6 expressions in low cell using HDAC6RNAi molecules (such as siRNA).In further embodiment, use HDAC6 chemical inhibitors reduce HDAC6 activity in cell.In another embodiment, pass through the positions the K411 acetyl of adjusting ORF2 Change horizontal, the stability of ORF2 in increase cell, and/or increases the amount of ORF2 in cell, the especially amount of ORF2 polymers.? In another embodiment, by adjusting the positions the K411 Acetylation Level of ORF2, increase duplication viral in cell.In another implementation In scheme, by adjusting the positions the K411 Acetylation Level of ORF2, increase the assembling of VLP and/or VLP yield in cell.

On the other hand, present invention provides the K411 acetylation HEV ORF2 polypeptides of separation.The ORF2 polypeptides packet The 1-4 of genotype containing HEV wild type ORF2 sequences or its homologue or variant.In another further aspect, the present invention, which provides, increases K411 Acetylation HEV ORF2 polypeptides production method and cell culture, which is characterized in that inhibit cell in HDAC6 expression and/ Or activity, wherein relative to HDAC6 expression and/or active control cell is not inhibited, K411 acetylation ORF2 polypeptides are in cell In yield increase.In one embodiment, the cell is that HDAC6 strikes low cell.In another embodiment, to Cell uses HDAC6 chemical inhibitors.In one embodiment, method of the invention further includes：Collect the acetylation generated The mixture of HEV ORF2 polypeptides or the K411 acetylations HEV ORF2 polypeptides and non-acetylation ORF2, is used to prepare immune combination Object or vaccine or HEV virus-like particles.In one embodiment, present invention provides acetylation HEV ORF2 polypeptides use In the purposes for promoting ORF2 multimerizations and/or virus or virus-like particle to be formed.

In another aspect, the present invention provides treatment HEV infection method, include to infection HEV individual apply HEV ORF2 polypeptide K411 acetylation conditioning agents.In one embodiment, the conditioning agent reduces the acetylation of ORF2 polypeptides K411 It is horizontal.In a further embodiment, the conditioning agent increases the expression of HDAC6 and/activity in cell.Further implementing In scheme, the conditioning agent is HDAC6 express nucleic acids.

Brief description

Fig. 1:Acetylations of the HEV capsid protein ORF2 in conserved residues K411.

(A) the 293T cells of expression GFP-1-ORF2 (112-660) or GFP-4-ORF2 (112-660) are exempted from GFP antibody Epidemic disease precipitates, and passes through Coomassie blue stain.

(B-D) acetylation of the positions Mass Spectrometric Identification K411.Pass through the GFP-1- expressed in mass spectral analysis 293T cells ORF2 (112-660) (figure C) and GFP-4-ORF2 (112-660) albumen (figure D).EPTVK⁴¹¹LYTSVEN peptides are in different HEV bases Because being conservative (Figure 1B) between type.

(E) acetylation of GFP-1-ORF2 and GFP-4-ORF2 are determined by immunoblotting in 293T cells.By anti- GFP antibody mediated immunities are deposited in the GFP-1-ORF2 (112-660) being overexpressed in 293T cells, GFP-4-ORF2 (112-660) or GFP carries out western with anti-acetyl-l-lysine (acetyl group-Lys) antibody (left hand view) and anti-GFP antibody (right part of flg) later Trace detects.

(F) immunoblotting is shown, K411 is the main of GFP-1-ORF2 (112-660) and GFP-4-ORF2 (112-660) Acetylation sites.It is overexpressed GFP-1-ORF2 in 293T cells^K411R(112-660),GFP-4-ORF2^K411R(112-660) and Wild plasmid.After using anti-GFP antibody mediated immunities precipitation, by anti-acetyl-l-lysine antibody (above) and anti-GFP antibody (under Figure) determine immunoprecipitate.WT：Wild type；K411R：K411R mutant.

Fig. 2：The K411R mutation of ORF2 hinder HEV inclusion bodys to be formed.

(A) GFP-1-ORF2 (112-660) wild type (top figure) and K411R mutant (lower section figure) in HeLa cells Representative immunofluorescence figure.GFP (green) and immunofluorescence dyeing alpha-tubulin (red).With DAPI dyeing DNA (blue). It is noted that GFP-1-ORF2 is positioned in viral inclusion body and cytoplasm.(engineer's scale：10μm).

(B) GFP-4-ORF2 (112-660) is carried out and identical experiment described in A.

(C) to GFP-1-ORF2 (1-660), GFP-1-ORF2 (112-660), GFP-1-ORF2^K411R(112-660) is carried out The identical experiment with described in A.

(D) the HeLa cells for fixing transient expression HA- labels or Flag labels 1-ORF2 (112-660), are used in combination anti- HA or Flag antibody (green), anti alpha-tubulin antibody (red) and DAPI (blue) carry out immunostaining.(engineer's scale：10 μm)。

(E) statistical analysis contains in the cell of Transfection of GFP -1-ORF2 (112-660) and GFP-4-ORF2 (112-660) There is the cell of viral inclusion body.Three independent experiments, n=200 cell/group are carried out.Spot cells：Have in cytoplasm (GFP's cell number of inclusion body counts>3/ cell)

(F) in GFP-1-ORF2 (1-660) full-length molecule, GFP-1-ORF2 (112-660) and GFP-1-ORF2^K411R Statistical analysis contains the cell of inclusion body in the cell of (112-660) transfection.Three independent experiments have been carried out, it is n=200 thin Born of the same parents/group；**p<0.01.Data are average value ± SD, are examined using Student t.Spot cells：Have in cytoplasm and forgives (GFP's cell number of body counts>3/ cell).

Fig. 3：The influence that dynamic evaluation K411R forms inclusion body.

(A-B) to the GFP-1-ORF2 (112-660) and GFP-1-ORF2 in HeLa cells^K411RThe work of (112-660) is thin Born of the same parents are imaged.

GFP-1-ORF2 plasmids transfect together with the histone 2B plasmids that RFP- is marked.After transfection 12 hours, obtain respectively Along 5 tomographic images of living cells z-axis, and pass through, Flatten Image obtains final image.It is noted that viral inclusion body gradually appears In wild type group, and start early.And GFP-1-ORF2^K411R(112-660) is not effectively form disease in the time-histories Malicious inclusion body.

Fig. 4：HDAC6 makes ORF2 deacetylations and influences IB to be formed.

(A) Flag-HDAC6 and GFP-1-ORF2 and GFP-4-ORF2 interacts.With GFP-ORF2 (112-660) plasmid With Flag plasmids or Flag-HDAC6 plasmid transfection 293T cells, be used in combination Flag antibody mediated immunities precipitate, later use GFP antibody and Flag antibody carries out westen traces.Also show the westen Blot results of cell lysate.In figure, " Flag " indicates transfection Flag plasmids；" Flag-HDAC " indicates transfection Flag-HDAC6 plasmids；" 1-ORF2 " indicates Transfection of GFP -1-ORF2 (112- 660) plasmid；" 4-ORF2 " indicates Transfection of GFP -4-ORF2 (112-660) plasmid.

(B) GFP-1-ORF2 and GFP-4-ORF2 and endogenous HDAC6 interacts.With GFP, GFP-1-ORF2 (112- 660) or GFP-4-ORF2 (112-660) plasmid transfection 293T cells, rabbit GFP antibody is used in combination to be immunoprecipitated, with HDAC6 spies Heterogenetic antibody and mouse GFP antibody carry out western traces.Also show the westen Blot results of cell lysate.

(C) HDAC6 strikes the low acetylation for increasing GFP-1-ORF2 and GFP-4-ORF2.Low 293T cells are struck in HDAC6 Middle expression GFP-1-ORF2 (112-660), GFP-4-ORF2 (112-660) plasmid.After being immunoprecipitated using GFP antibody, Acetylation ORF2 is detected by western traces using anti-acetyl-l-lysine antibody.It also shows, using anti-HDAC6 antibody, resists The western traces detection that GAPDH antibody and anti-GFP antibody carry out on cell lysate and immunoprecipitate.In figure " con " Indicate transfection non-specificity siRNA as a contrast "；" HDAC6i " indicates transfection HDAC6siRNA.

(D) immunoblotting is shown, the acetylation of GFP-1-ORF2 and GFP-4-ORF2 increase as TBSA is handled.? GFP-1-ORF2 (112-660), GFP-4-ORF2 (112-660) plasmid, with DMSO or TBSA processing are overexpressed in 293T cells. After being immunoprecipitated using GFP antibody, detected by anti-acetyl-l-lysine antibody (above) and anti-GFP antibody (figure below) immune Sediment.

(E) HDAC6 inhibitor processing under GFP-1-ORF2 (112-660) representative immunofluorescence figure.It is added Trichostatin A (TSA, 0.5 μM) or Tubastatin A (TBSA, 3 μM) are handled 8 hours.

(F) HDAC6 inhibitor processing under GFP-4-ORF2 (112-660) representative immunofluorescence figure.It is added Trichostatin A (TSA, 0.5 μM) or Tubastatin A (TBSA, 3 μM) are handled 8 hours.

(G) in GFP-1-ORF2 (112-660) transfectional cell handled with DMSO, TSA or TBSA, statistical analysis contains There is the cell of 10 or more viral inclusion bodies.Carry out independent experiment three times, n=200 cell/group.**p<0.01,***p< 0.001.Data are average value ± SD, are examined using Student t.

(H) in GFP-4-ORF2 (112-660) transfectional cell handled with DMSO, TSA or TBSA, statistical analysis contains There is the cell of 10 or more viral inclusion bodies.Carry out independent experiment three times, n=200 cell/group.**p<0.01,***p< 0.001.Data are average value ± SD, are examined using Student t.

Fig. 5：HDAC6 is inhibited to promote the stability of HEV ORF2.

(A) HDAC6RNAi has raised HEV ORF2 peptide levels.With HDAC6siRNA or control siRNA (Santa Cruz) transfection 293T cells 48 hours, are used in combination GFP-1-ORF2 or GFP-4-ORF2 (112-660) to transfect 24 hours.It collects thin Cellular lysate object, and detected by western traces using anti-HDAC6 antibody, anti-GFP antibody and anti-GAPDH antibody.

(B) mutant for being unable to acetylation of HEV ORF2 reduces the protein of ORF2 by proteasome Dependent Stability.With GFP-1-ORF2 (112-660) WT (wild type), GFP-1-ORF2^K411R(112-660),GFP-4-ORF2(112- 660) WT (wild type), and GFP-4-ORF2^K411R(112-660) transfects 293T cells 24 hours.Cell lysate is collected, is used in combination Anti- GFP antibody and anti-GAPDH antibody are detected by western traces.MG132 is added, handles 4 hours.It is noted that ORF2 is not The fast degradation of energy acetylation mutant can be saved by the way that proteasome inhibitor MG132 is added.Difference is shown in figure The result that the western traces development time for exposure obtains.

(C) Tubastatin A increase GFP-ORF2 polypeptide stabilities.With GFP-1-ORF2 (112-660) and GFP-4- ORF2 (112-660) transfects 293T cells 24 hours.Tubastatin A (TBSA, 3 μM) are added, handle 8 hours.Non-reduced The sample concentration used in PAGE is twice used in reproducibility SDS-PAGE, but comes from identical source.

Fig. 6：The acetylation of ORF2K411 can adjust the stability of ORF2 and HEV IB are formed.

(A) Tubastatin A increase the HEV antigen levels in PLC/PRF/5 cell culture supernatants.It is infected in HEV After 3 weeks, it is thin that PLC/PRF/5 is added in DMSO, Trichostatin A (TSA, 0.5 μM) or Tubastatin A (TBSA, 3 μM) Born of the same parents collect cell culture supernatant after 3 days, and HEV antigens are detected by ELISA.***p<0.001.Data be average value ± SD is examined using Student t.In figure, " HEV Ag S/Co " is the unit used when ELISA is detected, is indicated：Sample OD values/ Cut off detection line numerical value.

(B) ORF2VLP expressed in coomassie orchid dyeing detection sf9 cells in Native PAGE, and pass through mass spectrum point Analysis.

(C-E) TSA, TBSA and CAY improve expression of the ORF2 in sf9 cells.DMSO, Trichostatin A is added (TSA, 1 μM), Tubastatin A (TBSA, 6 μM) or CAY10603 (CAY, 0.2 μM) are handled 5 days.Collect sf9 cell culture Object supernatant, and 40000rpm ultracentrifugations 2 hours, full cell culture supernatant and free fraction and VLP are detected by ELISA Fraction.*p<0.05,**p<0.01,***p<0.001.Data are average value ± SD, are examined using Student t.

(F) transmission electron microscope detection wild type (WT) 0GFP-1-ORF2 in the cell of TBSA or DMSO processing, GFP-1-ORF2 and mutant GFP-1-ORF2^K411R.Red circle points out the regions VLP.

(G) transmission electron microscope detection wild type (WT) GFP-4-ORF2 in the cell of TBSA or DMSO processing, GFP-4-ORF2, and mutant GFP-4-ORF2^K411R.Red circle points out the regions VLP.

Fig. 7：The sequence of 1-ORF and 4-ORF and its truncated segment and HDAC6.

Fig. 8：The representative immunofluorescence image of HEV ORF2 in A549 cells.GFP-1-ORF2 (112- in A549 cells 660) (green) wild type and K411R mutant are in the representative immunofluorescence image for adding or being not added under TSA processing.DNA is used DAPI dyes (blue).It is noted that when TSA is handled, since the deacetylation of ORF2 is suppressed, for wild type ORF2, carefully The inclusion body quantity formed in born of the same parents increases.On the contrary, under TSA processing, ORF2 mutant is unaffected, still main uniformly dispersing In cytoplasm.

Fig. 9：The ratio of the spot living cells of statistical analysis GFP-ORF2 transfections.GFP-1-ORF2 (112-660) is calculated, GFP-1-ORF2^K411R(112-660), GFP-4-ORF2 (112-660) and GFP-4-ORF2^K411RThe spot of (112-660) transfection HeLa cells.Carry out three independent experiments, n=200 cell/group；**p<0.01,***p<0.001.Data be average value ± SD is examined using Student t.Spot cells：(GFP's cell in cytoplasm with inclusion body counts>3/ cell).

Figure 10：The living cells of GFP-4-ORF2 (112-660) and GFP-4-ORF2 (112-660) K411R in HeLa cells Imaging.(A-B) GFP-4-ORF2 (112-660) and GFP-4-ORF2 in HeLa cells^K411RThe living cells of (112-660) is imaged. The histone 2B plasmids of GFP-4-ORF2 plasmids and RFP- labels transfect together.12 hours after transfection, obtained along living cells z-axis 5 tomographic images, Flatten Image are taken to obtain final image.It is noted that viral inclusion body occurs gradually in wild type group, start It is early.GFP-4-ORF2^K411R(112-660) fails to be effectively formed viral inclusion body in time-histories.

Figure 11：With the 293T cells of DMSO, TBSA or TSA processing after being transfected 24 hours with GFP-1-ORF2.293T cells DMSO, Trichostatin A (TSA, 0.5 μM) or Tubastatin A (TBSA, 3 μ is added in middle transfection GFP-1-ORF2 plasmids M), handle 8 hours, in microscopically observation.The results show that Trichostatin A or Tubastatin A processing groups are cellular State is compared with DMSO control groups without marked difference.

Figure 12：With TSA processing, GFP-1-ORF2 (112-660) and GFP-4-ORF2 (112-660) protein level is raised.

Figure 13：The degradation of GFP-1-ORF2 depends on proteasome pathway.With cycloheximide (CHX, 10 μM) and (50 μM) of MG132 handles 293T cells 0-9 hours for having transfected GFP-1-ORF2.Immune-blotting method GFP-1-OFR2 and flesh are dynamic The amount of albumen.ORF2 polypeptides extend with drug treating time in CHX and DMSO processing groups, and protein content reduces.At CHX and MG132 ORF2 polypeptides increase with drug treating time in reason group, and protein content is without significant changes.

Detailed description of the invention

The inventors discovered that in the Hepatitis E virus (HEV) of genotype 1 and 4, ORF2 is in conservative amino acid residues 411 are acetylation (embodiment 1).It is mutated the delay living cells imaging of ORF2 to wild type and acetylation, shows K411 acetyl Change plays a crucial role (embodiment 2 and 3) in Hepatitis E inclusion body (IB) self assembly.Also, the inventors discovered that K411 second Acylation can enhance the repellence that HEV ORF2 polypeptides degrade to proteasome dependence, increase the stability of HEV ORF2 polypeptides (embodiment 5).Further, present inventors have shown that, HDAC6 (histon deacetylase (HDAC) 6) is catalyzed the HEV of K411 acetylations Deacetylated (embodiment 4) of ORF2 negatively adjusts viral inclusion body (IB) and forms (embodiment 4) and ORF2 polypeptide stabilities (embodiment 5).Also, present inventors have shown that the inhibition of HDAC6 can increase the formation of HEV virus replications and virus-like particle (embodiment 6).These discoveries of the present inventor provide direct evidence, it was demonstrated that HEV viruses utilize finishing machine after host translational The new mechanism that system is formed with the stability and enhanced virus inclusion body that maintain capsid protein ORF2 prompts HDAC6 to play anti-HEV senses The host defense mechanism of dye.

It is based on above-mentioned discovery as a result, present inventors have proposed：

(a) the K411 acetylation ORF2 polypeptides detached and its purposes for promoting virus or virus-like particle assembling.

(b) by adjusting acetylations of the ORF2 at K411, improvement Hepatitis E virus, virus-like particle (VLP) and The method of ORF2 polypeptides production；With the method for improving HEV OFR2 protein stabilities；

(c) the K411 Acetylation Level conditioning agents of ORF2, especially HDAC6 inhibitor, HEV viruses are multiple in increasing cell System and virus-like particle are formed and the purposes in ORF2 stability；

(d) a kind of new HEV therapies, drug including the K411 acetylations that will adjust HEV ORF2 and/or Means (for example, reducing or inhibit ORF2 acetylations, or enhancing HDAC6 to the deacetylation of ORF2) are applied to HEV patient, such as Seriously ill patient and chronic HEV infected patients, or the non-human animal of infection HEV (are such as applied to pig, to reduce the animal to environment The HEV virus quantities of middle discharge).

At any of the above-described aspect, preferably HEV viruses are 1-4 genotype, the HEV viruses of more preferable genotype 1 or 4.It is preferred that Ground, ORF2 polypeptides include peptide sequence E (P/L) TVK⁴¹¹LYTSVEN, and in the conserved residues K411 position acetylations of peptide.It is preferred that Ground, in the cell for production, by inhibiting HDAC6, Acetylation Levels of the increase ORF2 in K411.It is not bound by the pact of opinion The K411 acetylations of beam, ORF2 can be in favor of ORF2 multimerizations, and/or increase HEV ORF2 polypeptides confrontation proteasome degradation way The resistance of diameter and the stability of ORF2.It is without being bound by any theory, by increasing the K411 acetylations of ORF2, can increase thin The ORF2 polypeptide amounts assembled for virus assembly or VLP in born of the same parents, and correspondingly increase virus or the yield of VLP.

Each aspect of the present invention will be described in further detail in each trifle below.

In the present invention, unless otherwise stated, Science and Technology noun used herein has art technology The normally understood meaning of personnel institute.Also, cell culture used herein, molecular genetics, nucleic acid chemistry, immunological experiment Room operating procedure is widely used conventional steps in corresponding field.Meanwhile for a better understanding of the present invention, it is provided below The definition and explanation of relational language.

Definition：

In the present invention, term " Hepatitis E virus " (" HEV ") refers to virus, Virus Type or viral classification.HEV returns In the single strand positive strand RNA icosahedron viruses that hepatitis virus belongs to, Genome Size 7.2kb, including three open reading frame (ORF), wherein ORF2 encoding capsid proteins.There are four types of main genotype, i.e. 1,2,3 and 4 genotype by HEV.In the present invention, The ORF2 polypeptides of HEV viruses preferably comprise peptide sequence EPTVK⁴¹¹LYTSVEN, preferably HEV viruses are the virus of genotype 1-4, The virus of more preferable genotype 1 or 4.

In the present invention, term " HEV ORF2 " or " ORF2 polypeptides " or " ORF2 " are used interchangeably, and are referred to from penta type liver The capsid protein of the ORF-2 open reading frame coding of scorching virus (HEV) genome or its segment or its homologue or variant.This The ORF2 polypeptides of invention are characterized in that including consensus sequence：E(P/L)TVK⁴¹¹LYTSVEN preferably includes consensus sequence： EPTVK⁴¹¹LYTSVEN can be acetylation at K411.

The capsid ORF2 albumen and its sequence of HEV viruses are well known in the art.The ORF2 of the present invention can include to come from The ORF2 sequences of 1-4 genotype HEV, such as the ORF2 sequences (also referred to as 1-ORF2) of genotype 1 or the ORF2 sequences of genotype 4 Row (also referred to as 4-ORF2).The exemplary ORF2 of the present invention is the base provided at GenBank accession number JQ655734 Because (sequence is shown in SEQ ID NO for the HEV ORF2 albumen of type 1:In 1).The another exemplary ORF2 of the present invention is in GenBank (sequence is shown in SEQ ID NO to the 4 type HEV ORF2 albumen of genotype provided under accession number JQ655736:In 2).It is other to be suitable for The HEV ORF2 of the present invention include, for example, the sequence provided under following accession number：P29326；P33426；Q6J8F7； Q9IVZ8；Q9YLQ9；Q03500；Q04611；Q68985；Q81871.

In the present invention, statement " ORF2 segments " or " ORF2 truncated segments " refers to relative to ORF2 full-length proteins, in N-terminal And/or the truncated ORF2 segments of C-terminal.In an exemplary arrangement, HEV ORF2 segments of the invention are by SEQ ID NO:1 or The 112-660 amino acids residues composition of ORF2 albumen under 3 or aforementioned any accession number, or by 112-607 or 112-608 Amino acid residue forms.ORF2 segments retain consensus sequence：E(P/L)TVK⁴¹¹LYTSVEN, and the property in K411 acetylations Matter, and preferably retain multimerization and be assembled into the ability of viral capsid or virus-like particle.Preferably, segment has immunogene Property.

According to the present invention, when in the background in protein/polypeptide in use, term " variant " refers to such albumen, ammonia Base acid sequence and the amino acid sequence tool with reference to the protein/polypeptide HEV capsid protein ORF2 of the present invention (for example) there are one or it is more A (such as 1-10 or 1-5 or 1-3) amino acid of differences (for example, conserved amino acid substitution), or have at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% homogeneity, and its remain with reference to albumen/ The necessary characteristic of polypeptide.In the present invention, protein/polypeptide (for example, for the present invention HEV capsid protein variant for) Necessary characteristic can refer to, and in K411 acetylations and preferably multimerization and be assembled into viral capsid or virus-like particle Ability.

In the present invention, when referring to amino acid position, by reference to SEQ ID NO:1, that is, accession number JQ655734's The amino acid sequence of HEV ORF2 albumen (also referred to as 1-ORF2), is determined.It can be by carrying out amino acid alignment (example Such as use BLAST；It can be fromhttp://blast.ncbi.nlm.nih.gov/Blast.cgi？PROGRAM=blastp&PAGE_ TYPE=BlastSearch&LINK_LOC=blasthomeThe Basic Local Alignment Search Tool of acquisition, Using default parameters, it is compared), identify the correspondence amino on other ORF2 polypeptides (including full length sequence or ORF2 segments) Sour position.Therefore, in the present invention, refer to SEQ ID NO when referring to " K411 ":1 the 411st amino acids residue, or warp Compare the amino acid residue of the corresponding position in other HEV ORF2 sequences.Correspondingly, in the present invention, " corresponding when referring to Refer to when carrying out optimal comparison to sequence, i.e., when sequence is compared to obtain highest when sequence fragment " or " respective segments " When percentage homogeneity, the segment of equivalent site (i.e. orresponding amino acid position) is located in the sequence being compared.

In the present invention, when referring to ORF2 polypeptides, statement " K411 acetylations " is used interchangeably with " acetylation ", and indicating should Polypeptide is in the positions K411 (that is, with SEQ ID NO are referred to:The corresponding position in the positions K411 of 1 sequence) the bad ammonia with acetylation Sour residue.Correspondingly, when referring to ORF2 polypeptides, statement " non-K411 acetylations " is used interchangeably with " non-acetylation ", and indicating should Polypeptide does not have acetylation in the positions K411.It can be determined on ORF2 polypeptides by various ways well known by persons skilled in the art The acetylation of K411, such as mass spectrum, western traces etc..

In the present invention, HDAC6 refers to the histon deacetylase (HDAC) 6 of histon deacetylase (HDAC) IIb families.HDAC6 There are two catalyst structure domain and a Zinc finger domains for tool.HDAC6 can be catalyzed K411 acetylations HEV ORF2 polypeptides (such as SEQ ID NO:It is 1-4) deacetylated, generate the ORF2 polypeptides in K411 deacetylations.The sequence of HDAC6 is known in the art , it can be obtained from GenBank.A HDAC6 Exemplary Proteins sequence and its coded sequence (SEQ ID are listed in the figure 7 NO:5 and 6).

According to the present invention, term " homogeneity " be used to refer between two polypeptides or between two nucleic acid sequence matching feelings Condition.When the sequence that two are compared when some position is all occupied by identical base or amino acid monomer subunit (for example, Two ORF2 polypeptides are all occupied by lysine in the positions K411), then each molecule is same on the position.In two nucleic acid In the case of sequence or polypeptide sequence are compared, percentage " homogeneity " refers to, in relatively window or in specified region, When using one of following sequence comparison algorithm or comparing and compare by comparing and visually inspecting progress most homogeneous manually, two Sequence have prescribed percentage identical nucleotide or total number of atnino acid (for example, at least 60% same in specified region Property, optionally at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97% or at least 99% homogeneity).Optionally, percentage identity can be 60% to 100% any integer.

" Percentage of sequence identity " can be determined by comparing the sequence of two optimal comparisons in relatively window, wherein After two sequences optimal comparison, the part of polynucleotide sequence or polypeptide sequence in the relatively window, (no with reference sequences Including addition or missing) part compare, may include add or lack (i.e. vacancy).The percentage is calculated by following： The position number of identical nucleic acid base present in two sequences or amino acid residue is determined to generate the number of matching position, By the number of matching position divided by compares the sum of position in window and result is multiplied by 100 to generate the percentage of sequence identity Than.

Sequence alignment method for comparing is well known in the art.It is suitble to determine percentage of sequence identity and sequence The example of the algorithm of similitude is 2.0 algorithm of BLAST and BLAST (referring to Altschul etc., Nuc.Acids Res.25: The J.Mol.Biol.215 such as 3389-402,1977 and Altschul:403-10,1990.Software for carrying out BLAST analyses can Pass through National Center for Biotechnology Information (National Center for Biotechnology Information) public affairs Crowd obtains (http://www.ncbi.nlm.nih.gov/).For purposes of this application, homogeneity percentage is usually with setting It is determined for the BLAST2 algorithms of default parameter.

As used in this article, term " conservative substitution " means to influence or change comprising amino acid sequence The amino acid substitution of the biological function of protein/polypeptide.It is lured for example, can for example be pinpointed by standard technique known in the art Become and the mutagenesis of PCR mediations introduces conservative substitution.It is tool that typical Conservative amino acid substitution, which refers to by a kind of amino acid substitution, There is another amino acid of similar chemical property (such as charge or hydrophobicity).It respectively contains below and can carry out allusion quotation each other for six groups The amino acid of type conservative substitution：1) alanine (A), serine (S), threonine (T)；2) aspartic acid (D), glutamic acid (E)；3) Asparagine (N), glutamine (Q)；4) arginine (R), lysine (K)；5) isoleucine (I), leucine (L), first sulphur ammonia Sour (M), valine (V)；With 6) phenylalanine (F), tyrosine (Y), tryptophan (W).

Term " separation " or " purifying substantially ", it is intended that be substantially free of the Chemical composition that of other cellular components.Purity The technology such as polyacrylamide gel electrophoresis or high performance liquid chromatography or matter of analytical chemistry can be usually utilized with homogeneity It composes to determine.In general, the albumen for substantially purifying or detaching should include all macromolecular substances present in preparation 70% or more.In some embodiments, purifying protein account for existing all macromolecular substances 90% or more, 95% or more or It is purified to basic homogeneous, wherein not detecting other macromolecular substances types by routine techniques.Separation for the present invention Acetylation ORF2 albumen, in some embodiments, the albumen be at least about 70%, at least about 80%, at least about 90%, until Few about 95% or at least about 99% or higher purity, and K411 non-acetylations preferably can't detect by routine techniques ORF2 albumen.

According to the present invention, term " virus-like particle (VLP) " refer to without viral nucleic acid, in structure with natural disease The similar hollow shell structure of malicious particle, is usually made of viral capsid proteins or its variant or segment.Due to VLP in structure with Natural virion is quite similar, therefore, with very strong immunogenicity and immunoreactivity.Simultaneously as VLP is free of Therefore the inhereditary material of virus does not have infectivity.Due to above-mentioned advantage, VLP has been developed that as vaccine.In addition, VLP Allow the insertion of foreign gene or genetic fragment in structure and form mosaic type VLP, and exogenous antigen can be shown On its surface.In addition, major part VLP also have package nucleic acid or other small molecules ability, therefore, be alternatively arranged as gene or The delivery vehicle of drug.

According to the present invention, term " assembling " refer to virus structural proteins (such as capsid protein) between or structural proteins with By various interactions between nucleic acid, the process of well-regulated nutty structure is formed comprising the group of natural viral particle The assembling of dress and virus-like particle.ORF2 can be assembled automatically in insect cell and mammalian cell generates VLP particles.It is right In the ORF2 of E. coli system production, VLP particles can be generated by being assembled from ORF2 in assembling solution in VLP.For from It is known in the art that ORF2, which is assembled and to be formed the assembling solution of HEV virus-like particles,.

In the present invention, " expression construct " is to refer to the recombinant nucleic acid molecules of expression desired polypeptides.For example, " recombination ORF2 expression constructs " are can to express the recombinant nucleic acid molecules of ORF2 polypeptides.It should be understood that expression construct covers vector construction Body.

Acetylation HEV ORF2 albumen and application thereof

Natural HEV ORF2 protein is the protein for including 660 amino acid.Cells of the natural ORF2 in infection HEV It is middle to be synthesized as precursor and be cut into the mature protein for capableing of self assembly by signal sequence.When using baculoviral When system expresses ORF2 coded sequences in Sf9 insect cells, it can generate with estimation molecular weight 72kDa and 59-62kDa Stable protein product.Including the truncated protein matter of amino acid can between position 125-601 and 112-607 and post-11.2-660 With assembling assembly virus-like particle (Surjit, M. etc., Journ.Virol, 78：320-328 (2004), Li, TC etc. Journ.Virol.79,12999-13006(2005)).In having between the amino acid residue aa458-aa607 of HEV ORF2 With structural domain (Zhou, YH etc., Vaccine 22：2578-2585 (2004), Ahmad, I.Deng Virus Res.161：47-58 (201))。

The present invention, which is based in part on, observes that HEV ORF2 albumen in the positions K411 is acetylation, and the second of the position Acylation can promote the stability of ORF2 and the dimerization of ORF2 and multimerization, and promote the assembling of virion and VLP particles.

Therefore, in one aspect, the present invention provides the HEV ORF2 polypeptides of separation, it is characterised in that the positions K411 have second It is acylated.In one embodiment, ORF2 polypeptides of the invention include peptide sequence E (P/L) TVK⁴¹¹LYTSVEN is preferably included Peptide sequence：EPTVK⁴¹¹LYTSVEN.In a further embodiment, ORF2 polypeptides of the invention are ORF2 segments, including starting Between post-11.2-125 and terminate at the amino acid sequence between the 601-660 of position or between 607-660.In another reality It applies in scheme, HEV ORF2 polypeptides of the invention are ORF2 segments, include 458-607 C-terminal amino acid residues, and include 125-457 N-terminal amino acid residues so as to form VLP, and have immunogenicity.In a preferred embodiment In, HEV ORF2 segments of the present invention include at least 125-601, preferably 125-607 amino acid residue.Another preferred real It applies in scheme, the -terminal amino acid sequence of HEV ORF2 fragment deletions aa1-111 of the present invention.Fig. 1 is exemplary to show one Full length sequence (the SEQ ID NO of 1 albumen of HEV ORF2 genotype:And its aa112-660 truncated segments (SEQ ID NO 1):2), With full length sequence (the SEQ ID NO of a HEV ORF2 genotype 4:And its aa112-660 truncated segments (SEQ ID NO 3): 4)。

It will be appreciated by those skilled in the art that in the HEV ORF2 polypeptides (including full length sequence and truncated segment) of the present invention, Can be naturally-produced or it be artificially introduced mutation or variation (include but not limited to, substitution, lack and or add), without influencing its life Object function.Therefore, in another aspect, the present invention provides the HEV ORF2 polypeptides of separation, wherein the HEV ORF2 polypeptide packets Containing natural (that is, wild type) HEV ORF2 polypeptides (foregoing full length sequence or segment), or the sequence homologous with it, and it is excellent Selection of land is of equal value biologically with natural HEV ORF2 polypeptides.In the present invention, " biologically of equal value " refer to the polypeptide can It is acetylation in the positions K411, and can assemble and to form viral capsid or virus-like particle, and preferably have immunogenicity.By This, in some embodiments, when the epidemic disease of the present invention of the HEV ORF2 polypeptides and optionally pharmaceutical acceptable carrier that will include the present invention Seedling composition, is injected into mammal, can stimulate generation protection antibody, these antibody can protect mammal from wild The invasion of type HEV.In the present invention, it is preferred to which homologous sequence and the homogeneity of natural HEV ORF2 polypeptide sequences are preferably 70% or more, more preferably 80% or 90% or more, particularly preferably 95% or more are for example, 95%, and 96%, 97%, 98%, 99% or more.It is highly preferred that homologous sequence differs only by 1-10 amino acid change with natural HEV ORF2 polypeptide sequences, and it is excellent Selection of land 1-5 or 1-3 amino acid change, it is more preferably described to change into conserved amino acid substitution.

It assembles to form VLP virus-likes it is known to those skilled in the art that a variety of ORF2 segments can be used in vitro and in vivo Grain is (referring to WO2010099547 and Expression and self-assembly of empty virus-like particles of hepatitis E virus.Li TC,Yamakawa Y,Suzuki K,Tatsumi M,Razak MA, Uchida T,Takeda N,Miyamura T.,J Virol.1997Oct；71(10):7207-13.Essential elements of the capsid protein for self-assembly into empty virus-like particles of hepatitis E virus.Li TC,Takeda N,Miyamura T,Matsuura Y,Wang JC, Engvall H,Hammar L,Xing L,Cheng RH.J Virol.2005Oct；79(20):12999-3006.).These ORF2 segments are also applied in the present invention.Therefore, in some embodiments, the present invention provides the ORF2 in K411 acetylations Segment.In some embodiments, ORF2 segments have the missing of at least continuous 25 amino acid of N-terminal, preferably at least lack 50 A amino acid, at least 100 amino acid preferably lack N-terminal 1-111 amino acids sequences.In some embodiments, ORF2 Segment is lacked with C-terminal region, such as the missing continuous C-terminal amino acid residue of at least ten, for example, at least 20, preferably lack C-terminal 602-660,603-660,604-660,605-660,606-660,607-660,608-660, or 609-660 amino acids Sequence.

In some preferred embodiments, the present invention provides a kind of acetylation Hepatitis E virus open reading frame of separation 2 (HEV ORF2) polypeptides, it is characterised in that include peptide sequence E (P/L) TVK⁴¹¹LYTSVEN, and there is acetylation at K411. Preferably, the polypeptide includes sequence selected from the following：(a) full length sequence of wild type HEV virus Os RF2 albumen, preferred gene Type 1-4, the full length sequence of the HEV ORF2 albumen of more preferable genotype 1 and 4；(b) truncated segment of (a), the segment include E (P/L)TVK⁴¹¹LYTSVEN peptide sequences preferably retain multimerization and are assembled into the ability of viral capsid or virus-like particle, excellent Selection of land, segment have immunogenicity；(c) (a) or homologue (b) or variant.In some embodiments, the ORF2 segments To have truncated the amino acid sequence of N-terminal a1-aa111, at least aa125 to 601 or 125 of overall length ORF2 sequences is preferably included To the regions aa607, preferably it is made of the amino acid sequence of aa112 to aa660.

In a preferred embodiment, the ORF2 polypeptides include the natural HEV ORF2 overall length sequences from genotype 1 Row or its truncated segment, or the sequence homologous with it.In still another embodiment, the ORF2 albumen includes to come from gene The natural ORF2 full length sequences of type 4 or its truncated segment, or the sequence homologous with it.In still other preferred embodiment, institute It includes to be selected from SEQ ID NO to state ORF2 polypeptides:The sequence of 1-4, or the sequence homologous with it.Preferably, the homologous sequence with SEQ ID NO:1 or 2 sequence has at least 90%, 95%, 96%, 97%, 98%, and 99% or more homogeneity is more excellent Selection of land, with SEQ ID NO:1 or 2 sequence differs only by 1-10 amino acid change, and preferably 1-5 or 1-3 amino acid Change, it is more preferably described to change into conserved amino acid substitution.Preferably, the homologous sequence and SEQ ID NO:3 or 4 sequence Row have at least 90%, 95%, 96%, 97%, 98%, 99% or more homogeneity, it is highly preferred that with SEQ ID NO:3 Or 4 sequence differs only by 1-10 amino acid change, and preferably 1-5 or 1-3 amino acid change, it is more preferably described Change into conserved amino acid substitution.In these embodiments, it is preferred to ground, the truncated segment is N-terminal truncated segment, such as is lacked Lose the aa1-aa111 amino acid sequences of N-terminal.It is highly preferred that the segment includes at least amino acid 1 25 of overall length ORF2 sequences To 601 regions of amino acid, the preferably region of amino acid 1 12 to 660.

The HEV ORF2 acetylated polypeptides of the present invention can be by the cell with acetylation system, such as mammal In cell, insect cell and Escherichia coli, expression encodes the DNA fragmentation of these albumen and its segment and is readily available.It closes Suitable expression system, such as expression system based on baculoviral, based on mammalian cell is known in the art.It is such Expression system is widely described in the art and they are commercially available.In view of ease for use and relatively high Yield, be preferred system based on baculoviral.In some embodiments, the albumen of expression lacks the ends N- of ORF2 111 amino acid, are soluble.In some other embodiments, ORF2 polypeptides, such as ORF2 segments aa112-aa607 are recombinated Or aa112-660 secretes in the medium as soluble protein, but exist in cell precipitation.

Never in the albumen of acetylation the method for separating acetyl albumen it is known in the present invention (see, for example, CN103930433A and US2004247614), including such as chromatography, HPLC, exclusion chromatography, gel electrophoresis, affinity chromatography or its Its purification technique.For example, in order to purify and detach the acetylated protein of the present invention, can be first enriched with ORF2 antibody all ORF2 albumen, then it is enriched with the ORF2 albumen with acetylation modification with acetylated lysine antibody.Furthermore, it is possible to pass through N-terminal or C It holds label (such as Flag) to design and is convenient for protein purification.In addition it is also possible to which preparing specificity is directed to K411 acetylation ORF2 eggs White antibody is purified using the specific antibody.In one embodiment, present invention provides include purifying The composition of K411 acetylation ORF2 albumen.

The inventors discovered that when producing the acetylation ORF2 polypeptides of the present invention in cell, polypeptide of the present invention is in K411 Acetylation Level on position by cell the active influence of HDAC6 deacetylases.As a result, on the one hand, the present invention also carries A kind of method that increase acetylation HEV ORF2 polypeptides generate has been supplied, including：The nucleic acid for encoding HEV ORF2 polypeptides is introduced into place Chief cell, wherein the cell, which is HDAC6, strikes low cell；Cell is cultivated under conditions of the suitable expression of nucleic acid.It is preferred that Ground, it is that HDAC6 conditions strike low cell that the HDAC6, which strikes low cell,.In another aspect, the present invention provides a kind of increase acetyl Change the method that HEV ORF2 polypeptides generate, including：The nucleic acid for encoding HEV ORF2 albumen or its segment is introduced into host cell；? Cell is cultivated under conditions of the suitable expression of nucleic acid；HDAC6 inhibitor, which is applied, to cell inhibits HDAC6 activity.Preferably, HDAC6 inhibitor is HDAC6 chemical inhibitors, such as non-selective inhibitor such as TSA or selective depressant such as TBSA, more preferably Ground HDAC6 selective depressants.In one embodiment, cell is the cell of HEV viruses infection.In an embodiment In, cell is the introduction of the recombinant cell of ORF2 expression constructs.In one embodiment, relative to not inhibiting HDAC6 tables It reaches and/or active control cell, yield of the K411 acetylation ORF2 albumen in cell increases.In one embodiment, The method of the present invention further includes：Collect generate acetylation HEV ORF2 albumen or the K411 acetylations HEV ORF2 albumen with not The mixture of acetylation ORF2.In one embodiment, HEV ORF2 polypeptides assemble in cell generates VLP.In some realities Apply in scheme, will separation K411 acetylation ORF2 polypeptides the K411 acetylation ORF2 polypeptides obtained according to the method for the present invention or its With the mixture of non-acetylation ORF2, it is used to prepare immune composition or vaccine, or is used to prepare virus-like particle VLP.

On the other hand, the present invention is provided to produce the cell culture of K411 acetylations ORF2 polypeptides of the present invention, Including HDAC6 strikes low cell, the cell includes the nucleic acid of expression ORF2 polypeptides.In one embodiment, the cell It is the cell of HEV viruses infection.In one embodiment, the cell is the introduction of the thin of recombination ORF2 expression constructs Born of the same parents.In some embodiments, the cell is for producing acetylation ORF2 polypeptides, virus or virus-like particle.

In addition, the present invention also provides the dimer or polymer of K411 acetylations ORF2 albumen of the present invention.It is not bound by opinion Constraint, it is believed that the acetylation of K411 has the ability of the aggregation and the assembling that promote ORF2 albumen.Therefore, in another aspect, this hair It is bright also to provide K411 acetylations ORF2 albumen of the present invention for promoting ORF2 multimerizations or virus or VLP particles being promoted to assemble Purposes.In one embodiment, the purposes includes that K411 acetylation ORF2 albumen is added to the assembling solution of VLP particles In, wherein the solution includes non-acetylation ORF2 albumen, wherein compared with the control that K411 acetylation ORF2 albumen is not added, The packaging efficiency of VLP particles improves.

HDAC6 inhibitor：

HDAC6 inhibitor includes that can reduce HDAC6 expression and/or active molecule in cell herein.For example, HDAC6 inhibitor can be combined or interacted when with HDAC6 protein (for example, SEQ ID NO.5) or its function fragment When, the molecule of the bioactivity (including the intensity of bioactivity or duration) of the protein is reduced or eliminated (herein In be referred to as " HDAC6 chemical inhibitors ").For another example HDAC6 inhibitor can also be prevention or reduction coding HDAC6 protein Gene expression, that is, prevent or reduce genetic transcription, mRNA is ripe, and the nucleic acid molecules of mRNA translations and posttranslational modification are (at this It is referred to as " HDAC6 inhibitions nucleic acid molecules " in text).HDAC6 inhibitor will reduce or eliminate HDAC6 albumen in cell and take off as a result, Deacetylation activity of the acetyl enzyme to the K411 acetylated lysines of ORF2.

HDAC6 inhibition nucleic acid molecules

The example of HDAC6 inhibition nucleic acid molecules includes but not limited to, for example, to HDAC6 protein genes or mRNA sequences Arrange special antisense base sequences；The ribozyme special to HDAC6 protein mRNA；Special to HDAC6 protein mRNA is suitable Body (aptamer)；With to the special RNA interfering of HDAC6 protein mRNAs (RNAi)；Or its expression construct (can express generation Any nucleic acid molecules of RNAi molecule, including expression vector).These inhibition nucleic acid molecules can be by genetic engineering field technology Personnel build and generate according to the knowledge about transgenosis and gene expression inhibition in this field.(Clarke,A.R. (2002)Transgenesis Techniques.Principles and Protocols,2nd Ed.Humana Press, Cardiff University；US patent 20020128220.Gleave,Martin.TRPM-2antisense therapy；Puerta-Ferández E et al.(2003)Ribozymes:recent advances in the development of RNA tools.FEMS Microbiology Reviews 27:75-97；Kikuchi et al., 2003.RNA aptamers targeted to domain II of Hepatitis C virus IRES that bind to its apical loop region.J.Biochem.133,263-270；Reynolds A.et al., 2004.Rational siRNA design for RNA interference.Nature Biotechnology 22(3): 326-330).

In some embodiments, HDAC6 inhibitor is the process instruction acetylation of histone enzyme by being referred to as RNA interference The RNAi molecule of sequence-specific degradation occurs for HDAC6mRNA molecules.

It is well known that expression of target gene and target gene is inhibited to strike low RNAi means.RNAi includes but not limited to siRNA And shRNA.SiRNA is small or short disturbance RNA molecule, and the transfection of lipophilicity transfection reagent can be applied to enter cell, realized To the instantaneous knockout of target gene.SiRNA can be the double stranded rna molecule of for example long 19-25 nucleotide, be carried in its 3 ' end The protrusion residue of 2nt.In use, the single siRNA molecule for single target site may be used, multipair example can also be used Such as the mixture of three pairs of siRNA double-strand molecular compositions.ShRNA is bobby pin and short hairpin RNA.It can be by the coding core of shRNA Sour plasmid introduces cell by the penetrating transfection of fat.ShRNA molecule expression and target can instantaneously or be steadily realized using shRNA Gene inhibits.ShRNA plasmids can be such as the 3-5 kind plasmids mixing composition by one or more, each plasmid can be such as The stem ring area of 19-25nt shRNA and 6bp containing target gene specific.ShRNA code nucleic acids can be placed in and for example be formed Under type or inducible promoter control.After transfection, the cell for stablizing expression shRNA can be screened.Slow virus can also be passed through ShRNA encoding plasmids are delivered in target cell by grain, the expression for instantaneously or steadily striking low target gene.

In one embodiment of the invention, inhibit target gene by introducing the siRNA synthesized in vitro to cell The expression of HDAC6.In another embodiment, shRNA expression vectors are built in vitro, and carrier is then transferred to intracellular turn Record generates shRNA, to realize the inhibition of HDAC6 gene expressions.In still another embodiment, shRNA express nucleic acids are in cell Middle constitutive expression, to realize the composing type of target gene HDAC6 is struck it is low.In some embodiments, in the HEV of the present invention In virus or virus-like particle or ORF2 production methods, low cell is struck using HDAC6 composing types.In still another embodiment, ShRNA express nucleic acids are under inducible promoter control, it is possible thereby to induce shRNA expression and HDAC6 to strike by inducer It is low, obtain the conditional knockdown cell of HDAC6.In some embodiments, the present invention HEV virus or virus-like particle or In ORF2 production methods, using the conditional knockdown cell of HDAC6, and is preferably being infected with HEV viruses or introducing or express Before ORF2 code nucleic acids, the expression of HDAC6 is induced to reduce.

Therefore, be directed to HDAC6 in some embodiments of the present invention and strike low cell, including HDAC6 composing types strike it is low Cell or HDAC6 conditionitys knock out the purposes that cell is used for the method for the present invention.Herein, HDAC6 composing types strike low cell Refer to that the expression of HDAC6 is stablized and strikes low/cell for inhibiting, for example, since inhibition nucleic acid molecules are for example in cell Caused by the constitutive expression of HDAC6RNAi molecules.The cell of HDAC6 conditional knockdowns refers to the expression of HDAC6 by conditionity Ground strikes the cell of low/inhibition, for example, due to the inhibition nucleic acid molecules such as RNAi molecule for inhibiting HDAC6 expression in cell Inducible expression so that the cell that the expression of HDAC6 reduces in the presence of inducer.It is known in the art to be used for Production conditions Property strikes a variety of methods of low cell, see, for example, Wang Ting etc., conditional RNAi Research progress, modern biomedical into Exhibition, the 3rd phase of volume 15 in 2015, p547-549；Pfeiffenberger E etc., Conditional RNAi Using the Lentiviral GLTR System.Methods Mol Biol.2016；1448:121-38(doi:10.1007/978-1- 4939-3753-0_10)；Fewell GD etc., Vector-based RNAi approaches for stable, inducible And genome-wide screens, Drug Discov Today.2006Nov；11(21-22):975-82.Epub 2006Sep 26；US20130096370A1.

In one embodiment, the present invention relates to there is the active siRNA molecules of RNAi to target HDAC6RNA, wherein should SiRNA molecule includes the sequence with HDAC6RNA sequence complementations.The nucleotide sequence of HDAC6 is known in the art.In the figure 7 Give an exemplary HDAC6 nucleotide sequences (SEQ ID NO:6).Based on these sequence informations, those skilled in the art Methods known in the art can be used, suitable HDAC6 inhibitions siRNA molecule is generated.The siRNA of the present invention can be not It is modification or chemical modification.SiRNA can for example be increased to nuclease degradation in vivo by the chemical modification to siRNA The intake of resistance and/or improvement cell to siRNA.

There is sugar in this field, the example description of alkali and phosphoric acid modification be directed into nucleic acid molecules, enhance it Nuclease-resistant stability and effect.For example, introducing nuclease resistant group, such as 2' amino, 2'-C- allyls into oligonucleotides Base, 2'- fluorine, the modifications such as 2'-O- methyl, enhance its stability and/or enhance its bioactivity (see, for example, Usman and Cedergren, 1992, TIBS.17,34；Usman etc., 1994, Nucleic Acids Symp.Ser.31,163；Burgin Deng 1996, Biochemistry, 35,14090).The sugar-modified of nucleic acid molecules has also been widely described (ginseng in the art See Eckstein etc., PCT international publications WO92/07065；Perrault etc., Nature, 1990,344,565,568；Pieken Deng, Science, 1991,253,314-317；Usman and Cedergren, Trends in Biochem.Sci., 1992,17, 334-339；Usman etc., PCT international publication WO 93/15187；Sproat, U.S. Patent number 5,334,711 and Beigelman Deng 1995, J.Biol.Chem.270,25702；Beigelman etc., PCT International Publication WO 97/26270；Beigelman etc., U.S. Patent number 5,716,824).

In some embodiments, the present invention relates to have the active shRNA molecules of RNAi to target HDAC6RNA.shRNA Molecule can the transgenosis by genome conformity or the expression vector codes based on plasmid and by its expression.Therefore, in some realities It applies in scheme, it is the transgenosis for encoding small RNA or the expression vector based on plasmid that can inhibit the molecule that mRNA is expressed. Such transgenosis and expression vector can drive the expression of these shRNA simultaneously using polymerase II or polymerase III promoter Lead to the functional siRNA in cell.It can also drive these shRNA's using induction type and tissue specific expression system Expression.In some embodiments, transgenosis and expression vector are controlled by tissue-specific promoter.In other embodiments In, transgenosis and expression vector are controlled by inducible promoter, such as tetracycline-inducible expression system.A variety of use known in the art In the carrier of shRNA deliverings, including viral carrier, such as lentiviral particle (see, for example, summary Manjunath N etc., Lentiviral delivery of short hairpin RNAs, Adv Drug Deliv Rev.2009Jul 25；61 (9):732-45.doi:10.1016/j.addr.2009.03.004.Epub 2009Mar 31)。

It, can also chemical synthesis or the other RNAi molecule such as dsRNA of recombination generation other than siRNA and shRNA molecule.If It counts the method for RNAi molecule and is well known in the art the method that RNAi molecule is transfected into cell and animal, and (Verma N.K. etc., J.Clin.Pharm.Ther., 28 (5) can be obtained from commercial channels:395-404(2004),Mello C.C. equal .Nature, 431 (7006) 338-42 (2004), the such as Dykxhoorn D.M., Nat.Rev.Mol.Cell.Biol.4 (6):457-67 (2003), Santa cruz biotechnology (Dallas, USA)).

Other than RNAi, the other inhibition nucleic acid molecules that can be used include antisense nucleic acid, ribozyme, aptamer (aptamer) etc..Antisense and ribozyme inhibit strategy by reduce gene outcome expression or by specifically cutting transcript come Play a role (Carter and Lemoine Br.J.Cancer.67 (5):869-76,1993；Lange et al., Leukemia.6(10:1786-94,1993；Valera et al.,J.Biol.Chem.269(46):28543-6,1994； Dosaka-Akita et al.,Am.J.Clin.Pathol.102(5):660-4,1994；Feng et al.,Cancer Res.55(10):2024-8,1995；Quattrone et al.,Cancer Res.55(1):90-5,1995；Lewin et al.,Nat.Med.4(8):967-71,1998).These molecules are in the consideration of the present invention.

HDAC6 chemical inhibitors

HDAC chemical inhibitors suitable for the method for the present invention can be any HDAC6 inhibitor known in the art, packet It includes selective HDAC6 inhibitor and inhibits the non-specific hdac inhibitor of HDAC6 and other HDAC enzymes, such as TSA, but preferably HDAC6 selective depressants, such as TBSA.

Some selectivity HDAC6 inhibitor can with nanomole even picomole HDAC6 inhibitory activity, and relative to Other HDAC enzymes show apparent HDAC6 selectivity.As used herein, " HDAC6 selectivity " refer to, with any other class HDAC the enzymes such as HDAC1 or HDAC2 of type are compared, the notable bigger of the degree that compound is combined with HDAC6, such as high by 10, and 50,100, 500 or more times, that is, the compound all has selectivity to HDAC6 than the HDAC enzymes of any other type.Relative to other HDAC isotypes can reduce the selective depression of HDAC6 toxicity or side effect to cell or tissue.

Have studied various HDAC6 inhibitor.See, e.g., Butler etc., " Rational Design and Simple Chemistry Yield a Superior, Neuroprotective HDAC6Inhibitor, Tubastatin A, " J Am Chem Soc 2010,132 (31)：10842-10846；Kalin etc., " Second-Generation Histone Deacetylase 6Inhibitors Enhance the Immunosuppressive Effects of Foxp3+T- Regulatory Cells,"J Med Chem 2012,55(2):639-651；West and Johnstone, J.Clin.Invest.2014,124,30-39；Mottamal et al.Molecules 2015,20,3898-3941. Batchu etc. provides being discussed in detail (Clinical Science (2016) 130,987-1003) about HDAC6 inhibitor. Referring also to WO2018039581A1；WO2018034801A1；Sabrina Dallavalle,Claudio Pisano,and Franco Zunino,"Development and therapeutic impact of HDAC6-selective inhibitors,"Biochemical Pharmacology,84(6),2012,p756-76.Above-mentioned document is completely incorporated to this Text is as reference.

The non-limiting examples of HDAC6 inhibitor include rocilinostat (ACY-1215), ACY-241, Tubacin, Tubastatin A (TBSA), CAY10603, Nexturastat A, HPOB, ACY-738 (N-hydroxy-2- (1- Phenylcycloproylamino) pyrimidine-5-carboxamide), ACY-775 (2- ((1- (3- Fluorophenyl) cyclohexyl) amino)-N-hydroxypyrimidine-5-carboxamid e), and ACY- 1083.Other HDAC6 inhibitor include Vorinostat, LBH589, ITF2357, PXD-101, Trichostatin A (TSA).These inhibitor are commercially available.

In one embodiment, HDAC6 inhibitor of the invention is HDAC6 selective depressants selected from the following：

Rocilinostat(ACY-1215)

Citarinostat(ACY-241)

CAY10603

Tubastatin A

Tubac in

ACY-1083

Or its officinal salt.

In one embodiment, HDAC6 inhibitor is TSA.In one embodiment, HDAC6 inhibitor is TBSA. In another embodiment, HDAC6 inhibitor is CAY10603.

HDAC6 activator

HDAC6 activator includes that can improve HDAC6 expression and/or active molecule in cell herein.For example, HDAC6 activator can be combined or interacted when with HDAC6 albumen (for example, SEQ ID NO.5) or its function fragment When, increase the intensity of the biological activity of the albumen or extends the molecule of its duration.HDAC6 activator can also be, Allow to increase those of the gene expression of coding HDAC6 albumen compound.

The present invention is related in one aspect, the medicine using the exploitation of HDAC6 activator for preventing and treating the infection of HEV viruses Purposes in object or therapeutic combination.In one embodiment, the compound is made of gene construct, the gene structure Build the nucleotide sequence (such as SEQ ID NO.6) that body includes coding HDAC6, allow in mammalian cell, for example, people or In nonhuman mammalian cells, preferably in liver cell, HDAC6 protein (such as SEQ ID NO.5) is expressed.

In one embodiment, the present invention provides the method using the HEV infection of HDAC6 activators for treating, wherein described HDAC6 activator is genophore or expression vector, and the carrier can be in mammalian cell, preferably in liver cell, table The peptide or protein matter of HDAC6 albumen deacetylase biological activities is enough simulated or reproduced to Danone, and the carrier includes selected from following Nucleotide sequence：

A) nucleotide sequence of HDAC6 albumen is encoded

B) a) segment of nucleotide sequence, and

C) and a) and b) homologous sequence.

It can be for example by introducing conservative or non-conservative substitutions, including the one or more nucleotide of insertion, in appointing for molecule What one or more nucleotide of end addition is same in any end of sequence or the one or more nucleotide constructions of internal missing Source sequence, wherein there is the active albumen of HDAC6 albumen deacetylases, the albumen to retain to ORF2 eggs for homologous sequence expression White K411 acetylated lysines carry out the effect of deacetylation.

In some embodiments, homologous sequence has at least 80%, preferably at least 85%, or more preferably at least 95% Homogeneity degree.In other embodiments, homologous sequence is the variant of canonical sequence, such as 1-10 amino acid change Variant, the change especially conserved amino acid change.

As previously mentioned, these constructs and carrier can according to conventional methods be built by those skilled in the art (Sambroock etc., Molecular Cloning；A Laboratory Manual, the second edition, Cold Spring Harbor Publications, cold spring Port, New York (1989)).

Screening technique

In another aspect of this invention, the present invention also provide identification HDAC6 conditioning agents (including inhibitor and activator) and It is assessed to the activation of ORF2 acetylations and HEV virus replications and/or the method for inhibition comprising following steps：

I) cell comprising ORF2 code nucleic acids is contacted with potential compound and is incubated under suitable conditions,

Ii the parameter that the level of ORF2 acetylations or indicator virus are replicated or assembled in cell i)) is determined, and

Iii) when observing that instruction ORF2 protein acetylation levels increase and/or indicator virus replicates increased parameter change When, or when observing the parameter change that instruction ORF2 Acetylation Levels reduce and/or virus replication reduces, identify the compound It is HDAC6 protein actives inhibitor or immunomodulator compound.

ORF2 protein acetylation levels can use methods known in the art, such as immunoblotting or western traces, Or in embodiment example method, be detected.Virus replication level can use in methods known in the art or embodiment The method of example is detected.

The present invention also includes that will screen the HDAC6 conditioning agents obtained for the purposes in the method and composition of the present invention.

The production method and cell culture system of the present invention

Based on aforementioned discovery, present inventors have proposed improve HEV viruses, disease by adjusting HDAC6 expression and/activity Malicious sample particle or ORF2 albumen (can be used for preparing HEV viral vaccines) method of production.The present inventor also proposed for institute State the cell culture system of production.HEV viruses, virus-like particle or the ORF2 albumen produced by the method for the present invention and culture systems It can be used for preparing anti-HEV virus drugs, such as immune composition or vaccine.

Cell culture system

On the one hand, the present invention is provided to HEV viruses, the cell culture systems of virus-like particle or ORF2 protein productions System, the system comprises：(i) cell of the nucleic acid comprising coding ORF2 polypeptides；(ii) HDAC6 inhibitor.Implement at one In scheme, the inhibitor is the HDAC6 inhibition nucleic acid molecules being introduced into the cell, especially RNAi such as siRNA or ShRNA or its expression construct.In one embodiment, the inhibitor is added in the culture of the cell HDAC6 chemical inhibitors, especially HDAC6 selective depressants.In one embodiment, the cell is HEV virus senses The cell of dye.In another embodiment, the cell is the introduction of the recombinant cell of ORF2 expression constructs.Implement at one In scheme, before cell infection HEV viruses or before cell expresses ORF2, the HDAC6 expression in cell is inhibited by HDAC6 Property nucleic acid molecules strike low.It can be used for the production method of the present invention in the cell culture system of the present invention.

HEV viral production process

On the one hand, the present invention provides the method for improving HEV virus productions in the cultured cell in vitro of HEV viruses.? In one embodiment, the method for the present invention includes：In the presence of HDAC6 inhibitor, the cell of in vitro culture HEV infection.? In another embodiment, the method for the present invention includes：Low cell is struck with HEV infection HDAC6, and the in vitro culture cell.? In another embodiment, the method for the present invention includes：With the cell of HDAC6 chemical inhibitors processing HEV infection.In another embodiment party In case, the present invention includes harvest HEV virions.In further embodiment, the HEV virions of harvest are configured to epidemic disease Seedling or immune composition.In another aspect, the present invention also relates to the HEV virions of harvest or it is formulated at vaccine or immune Purposes of the composition in treatment HEV infection.

As will be understood by the skilled person in the art, any to allow the cell culture of HEV virus replications (i.e. to HEV diseases The susceptible cell of poison) it may be incorporated in the method for the present invention.It is known in the art HEV to be supported to replicate thin after virus infects Born of the same parents system, including but not limited to, A549 (human pneumonocyte's cancer) and PLC/PRF/5 (human hepatocellular carcinoma).In addition, pig renal epithelial cell system LLC-PK1, which also has confirmed, can support HEV plants of duplications.In addition, also report using HepG2 (ATCC HB-8065) or HepG2/C3A (ATCC CRL-10741) produce in cell culture medium high titre Hepatitis E virus (referring to CN106367397A)。

In some embodiments of the present invention, the cell for HEV virus productions is mammalian cell, for example, people or Pig cell system, such as hepatic cell line or pneumonocyte system or kidney cell line, such as PLC/PRF/5 human liver cancer cells or A549 human pneumonocytes Or HepG2/C3A Bel7402s or LLC-PK1 porcine kidney cell lines.In other embodiments of the present invention, preferred institute It is A549 cells or PLC/PRF/5 cells to state cell.

In some embodiments, the cell relative to the processing of unused HDAC6 inhibitor, in the processing of HDAC6 inhibitor Virus replication increases in cell.Increased virus replication refers to, when the hepatic cell line or lung of HEV virus infected cells, such as people Cell line, when such as PLC/PRF/5 liver cancer cells or A549 pneumonocytes, compared to unused HDAC6 inhibitor processing control cell, Greater amount of HEV viruses are generated with the cell that HDAC6 inhibitor is handled.Virus replication level can be referring for example to embodiment 6 Described in measure, such as after virus infected cell a period of time, with HDAC6 processing, collect cell culture supernatant later, HEV amount of antigen is checked with ELISA to determine.Furthermore, it is possible to measure the generation of ORF2 using method well known in the art to assess The production level of virus detects for example, flow cytometry or the methods of fluorescence microscopy or immunoblotting can be applied on cell ORF2 amounts in clear liquid and/or cell lysate.

In some preferred embodiments, the present invention provides for produce include virus drug (such as immunogene Property composition or vaccine) method, this method based on virus Cell culture invitro, the method includes：With HEV virus senses Cell is contaminated, and after replicating in cell and produce viral time enough, from cell purification virus.In an embodiment In, the method includes：Low cell is struck with HEV viruses infection HDAC6 and cultivates the cell of infection.In still another embodiment In, the method includes：On cell produce virus while, or can be after infection the different virus production phase, to The virus adds HDAC6 chemical inhibitors.Preferably, after virus infected cell, such as about 3 weeks, with HDAC6 Chemical Inhibitions Agent handles cell (such as handling 3 days).

In some preferred embodiments, the present invention provides a kind of methods improving HEV virus productions, including：? In cell for external HEV Virus cultures, HDAC6 expression and/or the activity of cell are adjusted.Preferably, the cell is to feed Newborn zooblast, preferably people or pig cell system, especially A549 pneumonocytes and PLC/PRF/5 liver cancer cells.It is preferably described Method includes：In the presence of HDAC6 inhibitor, the cell is cultivated, wherein relative to the thin of unused HDAC6 inhibitor processing Born of the same parents, virus replication increases in the cell.Preferably, the method includes the steps：With the HEV viruses infection cell and optionally Ground harvests HEV viruses.

In a preferred embodiment, the method includes：(i) HDAC6RNAi molecules are introduced (especially into cell SiRNA or shRNA) or its code nucleic acid, it generates HDAC6 and strikes low cell, (ii) infects HDAC6 with HEV viruses and strike low cell； (iii) harvest is viral for a period of time and optionally for culture cell.

In a preferred embodiment, the method includes：(i) HEV virus infected cells are used；(ii) apply to cell HDAC6 chemical inhibitors, such as HDAC6 selective depressants, (iii) harvest is sick for a period of time and optionally with culture cell Poison.

Preferably, the method further includes：The virus of harvest is configured to immune composition or vaccine for treating or pre- Anti- HEV infection.

Virus-like particle production method

On the one hand, the present invention provides a kind of methods that improvement HEV virus-like particles (VLP) produce, including：Comprising In the cell for encoding the nucleic acid of ORF2 polypeptides, inhibit HDAC6 expression and/or the activity of cell.Preferably, side through the invention Method can improve the assembling of HEV VLP and/or VLP yield in cell.Obtaining virus-like particle by the method for the invention can use In the drug for preparing anti-HEV viruses infection, such as immunogenic composition or vaccine.

It is without being bound by theory, it is believed that inhibit HDAC6 deacetylation enzymatic activitys in cell, ORF2 can be increased at K411 Acetylation Level；Compared with the ORF2 albumen of non-acetylation, there is acetylation ORF2 albumen the degradation of higher proteasome to support Anti- ability and the ability for promoting ORF2 dimerizations and multimerization formation VLP.It is without being bound by theory, it is believed that：By inhibiting HDAC6 Processing can increase the ORF2 amounts in cell, and reduce existing ORF2 in a free form, increase the ORF2 assemblings of cell expression At the efficiency of VLP.

Therefore, in one embodiment, the present invention relates to promote VLP by increasing the amount of acetylation ORF2 in cell The method of packaging efficiency.In one embodiment, the method for the present invention includes：In the presence of HDAC6 chemical inhibitors, in vitro The cell of nucleic acid of the culture comprising coding HEV ORF2 polypeptides.In another embodiment, the method for the present invention includes：It will coding The nucleic acid of ORF2 polypeptides is transferred to HDAC6 and strikes in low cell, and the in vitro culture cell.In the method for the invention, one In a little embodiments, cell is the cell for itself having acetylation-deacetylation system, such as mammalian cell, insect are thin Born of the same parents, preferably insect cell, especially sf9 cells.

It is known in the art, the ORF2 structural proteins of HEV can be obtained by various expression systems, then in vivo or in vitro Structural proteins are assembled into virus-like particle (VLP), to obtain the virus-like particle of HEV.Such as it is known in the art, it can be with Utilize baculoviral/insect cell expression HEV ORF2 segments (such as aa112-aa607 or aa14-aa608 or aa112- 660) the HEV VLP of self assembly, are obtained in cell lysates or in cell supernatant.In addition, it has already been proven that, it is truncating The C-terminal of ORF2 is inserted into the chimeric ORF2 capsid proteins that the B cell epitope tag of 11 amino acid generates, and still can form 20 Face body particle.After oral administration, which can stimulate immune response (the Niikura et for the insertion epitope al.,2002.Virology 293,273-280).These expression systems and ORF segments are suitable for the present invention.

In some embodiments, the expression system for virus-like particle of the present invention production includes, but are not limited to use The expression system of insect cell and mammalian cell.Preferred expression system includes the baculovirus expression using insect cell System.Method for handling and preparing baculovirus vector and baculovirus DNA and Insect cellculture, be this field Know.See, for example, A Manual of Methods for Baculovirus Vectors and Insect Cell Culture Procedures.For example, can baculovirus vector be cloned in by HEV capsid protein ORF2 or its truncated segment In, for infecting suitable host cell.(see, e.g., O'Reilly et al., " Baculovirus Expression Vectors:A Lab Manual,"Freeman&Co.1992).The polynucleotides for including coding ORF2 polypeptides of the present invention can be used Transfer vector, conversion insect cell line (such as sf9 or Tn5).Transfer vector include for example, linearisation baculovirus DNA and Plasmid containing desired polynucleotides.Host cell line can use linearisation baculovirus DNA and plasmid co-transfection, to generate weight Group baculoviral.

In a preferred embodiment, the present invention carries out the life of VLP using baculoviral/insect cell expression system Production.In a further embodiment, VLP productions are carried out using truncated ORF2 segments, the ORF2 segments preferably comprise Aa125-601, aa112-aa607 or aa112-660 sequence, but lack the 1-111 amino acids sequences of N-terminal.Implement at one In scheme, the ORF2 segments are in C-terminal fusogenic peptide antigen, such as B cell epitope tag.

The method of production known in the art and purified virus sample particle is (see, e.g. Expression and self- assembly of empty virus-like particles of hepatitis E virus.Li TC,Yamakawa Y, Suzuki K,Tatsumi M,Razak MA,Uchida T,Takeda N,Miyamura T.,J Virol.1997Oct；71 (10):7207-13.Essential elements of the capsid protein for self-assembly into empty virus-like particles of hepatitis E virus.Li TC,Takeda N,Miyamura T, Matsuura Y,Wang JC,Engvall H,Hammar L,Xing L,Cheng RH.J Virol.2005Oct；79(20): 12999-3006.Niikura M et al,Chimeric recombinant hepatitis E virus-like particles as an oral vaccine vehicle presenting foreign epitopes.Virology 2002；293:273-280).These documents are incorporated herein by reference.

In some preferred embodiments, the present invention provides a kind of method of improvement HEV virus-like particles production, packets It includes：In the cell comprising coding ORF2 or the nucleic acid of its segment, HDAC6 expression and/or the activity of cell are adjusted.It is excellent at one It selects in embodiment, the cell is insect cell, mammalian cell, especially insect cell, such as sf9 cells.One In a preferred embodiment, ORF2 segments be can self assembly be VLP ORF2 segments, preferably truncated N-terminal aa1-111 sequences The ORF2 segments of row；Preferably ORF2 segments include aa125-601 or 125-607 amino acid residues, more preferably ORF2 segments It is aa112-660 segments.In one embodiment, ORF2 segments merge amino acid Antigenic Peptide, such as B cell table in C-terminal Position label.In a preferred embodiment, the method includes：In the presence of HDAC6 inhibitor, the cell is cultivated, In cell relative to the processing of unused HDAC6 inhibitor, the assembling of VLP and/or yield increase in the cell.Preferably at one In embodiment, the method includes：(i) into cell introduce HDAC6RNAi molecules (especially siRNA or shRNA) or its Code nucleic acid generates HDAC6 and strikes low cell, and the nucleic acid for encoding ORF2 or its segment is introduced the HDAC6 and strikes low cell by (ii)； (iii) culture cell harvests virus-like particle for a period of time and optionally.In a preferred embodiment, the method packet It includes：(i) nucleic acid for encoding ORF2 or its segment is introduced into cell；(ii) apply HDAC6 chemical inhibitors to cell, such as The selective depressant of HDAC6, (iii) culture cell harvest virus-like particle for a period of time and optionally.Preferably, the side Method further includes：The virus-like particle of harvest is configured to immune composition or vaccine for treating or preventing HEV infection.

ORF2 production process of polypeptide

In another aspect, the present invention provides it is a kind of improvement HEV ORF2 polypeptides production method, including：Including coding In the cell of the nucleic acid of HEV ORF2 polypeptides, HDAC6 expression and/or the activity of cell are adjusted.Preferably, the cell is insect Cell such as sf9 cells, mammalian cell such as 293T cells and HeLa cells.Preferably, the cell is that HEV ORF2 turn base The cell infected by cell or HEV viruses.

In one embodiment, the ORF2 polypeptides can be such as the present invention any ORF2 full length sequences above-mentioned or cut Short-movie section and its homologue or variant.Preferably, ORF2 segments are to have truncated the ORF2 segments of N-terminal aa1-111 sequences；Preferably ORF2 segments include aa125-607 amino acid residues, and more preferably ORF2 segments are aa112-660 segments.Preferably, described Section keeps K411 acetylations and by the feature of HDAC6 deacetylations, and retains and be self-assembly of viral capsid or virus-like particle Ability, it is therefore preferred to have immunogenicity.

In a preferred embodiment, the method includes：In the presence of HDAC6 inhibitor, the cell is cultivated, In cell relative to the processing of unused HDAC6 inhibitor, the stability of ORF2 increases in cell, and ORF2 preferably in cell Amount increases, and the amount of ORF2 polymers increases more preferably in cell.

In a preferred embodiment, the method includes：(i) HDAC6RNAi molecules are introduced (especially into cell SiRNA or shRNA) or the RNAi molecule code nucleic acid, generate HDAC6 and strike low cell, (ii) will encode ORF2 or its piece The nucleic acid of section introduces the HDAC6 and strikes low cell；(iii) culture cell harvests the ORF2 of generation for a period of time and optionally.One In a preferred embodiment, the method includes：(i) nucleic acid for encoding ORF2 or its segment is introduced into cell；(ii) to cell Apply HDAC6 chemical inhibitors, such as the selective depressant of HDAC6, (iii) culture cell harvests for a period of time and optionally The ORF2 of generation.ORF2 can be harvested from cell supernatant and/or cell lysate.Preferably, the method further includes：It will The ORF2 of harvest is configured to immune composition or vaccine for treating or preventing HEV infection.

The purposes of HDAC6 inhibitor

On the one hand, the present invention provides HDAC6 inhibitor, such as HDAC6 inhibitions nucleic acid or HDAC6 chemical inhibitors, Purposes, (a) are used to increase the K411 Acetylation Levels of HEV ORF2, (b) are used to increase the stability and/or ORF2 of HEV ORF2 Yield (c) is used to increase HEV virus replications and/or viral yield, or (d) is used to increase assembling and/or the VLP productions of HEV VLP The purposes of amount.Preferably, the application includes：In the presence of HDAC6 inhibitor, cell or introduce weight that culture HEV infects The cell of group ORF2 expression constructs.

In another aspect, the present invention provides a kind of cell culture striking low cell comprising HDAC6, wherein the cell includes Encode the nucleic acid of HEV ORF2.Preferably, the cell is the cell of HEV infection, or introduces recombination ORF2 expression structures The cell of body.The cell culture can be used for producing HEV viruses, virus-like particle or ORF2 polypeptides.

In any of the above-described production method of the present invention and HDAC6 inhibitor on the way, in a preferred embodiment, use HDAC6 inhibitor strikes the expression of HDAC6 in low cell, it is preferred to use HDAC6siRNA or shRNA.Further implementing In scheme, it is the cell for including siRNA or shRNA express nucleic acids that HDAC6, which strikes low cell,.In one embodiment, cell It is that HDAC6 composing types strike low cell, wherein siRNA or shRNA express nucleic acids constitutive expression in cell.Further implementing In scheme, cell is that HDAC6 conditions strike low cell, and wherein siRNA or shRNA express nucleic acids are controlled in inducible promoter Under, and expressed in the presence of inducer and reduce HDAC6 activity.In one embodiment, siRNA or shRNA express nucleic acids Stable integration is in the genome of cell.

In any of the above-described production method of the present invention and HDAC6 inhibitor on the way, in another preferred embodiment, make The activity of HDAC6 in cell is reduced with HDAC6 inhibitor, wherein the HDAC6 inhibitor is chemical inhibitor, such as TSA, TBSA or CAY10603, especially TBSA.In one embodiment, a concentration of 0.2 μM -5 of Trichostatin A (TSA) μM, for example, 0.5 μM, 1 μM, 2 μM, 5 μM.In one embodiment, a concentration of 1 μM of -10 μ of Tubastatin A (TBSA) M, for example, 3 μM, 6 μM, 10 μM.In one embodiment, a concentration of 0.1 μM -1 μM of CAY10603, for example, 0.2 μM, 0.5 μM, 1 μM.Preferred concentration is TSA, 1 μM, TBSA, 6 μM or CAY10603,0.2 μM.

It is used on the way, in one embodiment, in HDAC6 in any of the above-described production method of the present invention and HDAC6 inhibitor After inhibitor handles a period of time, virus or virus-like particle or ORF2 are harvested by collecting cell culture medium；And/or pass through Lytic cell harvests virus or virus-like particle or ORF2.It is optionally possible to purify harvest virus or virion or ORF2.Purifying may include at least one selected from following steps：Clarification, ultrafiltration/diafiltration, ultracentrifugation (such as density hypervelocity Centrifugation, specifically, sucrose density gradient ultracentrifugation) and chromatography or their arbitrary combination.Depending on desired purity water It is flat, above-mentioned steps can be combined in any way.

In some preferred embodiments, by inhibiting HDAC6 expression and/or activity, HEV ORF2 albumen in cell K411 Acetylation Levels increase and/or cell in ORF2 stability increase and/or cell in ORF2 amount increase, especially It is the amount increase of ORF2 polymers in cell.In some preferred embodiments, by inhibit cell in HDAC6 expression and/ Or active, the formation increase of viral inclusion body in cell.In some preferred embodiments, by inhibiting HDAC6 in cell Expression and/or active, the duplication increase of HEV viruses in cell.In some preferred embodiments, by inhibiting in cell HDAC6 is expressed and/or activity, and the assembling of VLP and/or VLP yield generate in cell.

Hepatitis E virus, ORF2 albumen and the virus-like particle generated using the method for the present invention, can pass through this field Method known to technical staff is purified from the cell or culture supernatants for producing it or partial purification, is used as the present invention later Pharmaceutical composition and vaccine in immunogene.Therefore the present invention also relates to be produced from the present invention HEV acetylation ORF2 albumen, Virus and virus-like particle are used to prepare the purposes of immune composition and vaccine.For example, virus can be formulated as live vaccine or Inactivated vaccine (such as vaccine of Formalin inactivation), to prevent or treat the Hepatitis E of mammal.For example, can be by second Acylated ORF2 albumen or virus-like particle are prepared in the immune composition comprising adjuvant, for preventing or treating mammal Hepatitis E.Alternatively, immunogene can be the recombinant protein or virus-like particle partially or substantially purified.

Therapy

In another aspect, the method that the present invention also provides treatment HEV viruses infection, includes the individual to infection HEV viruses Using HEV ORF2 albumen K411 acetylation conditioning agents, wherein the conditioning agent reduces the Acetylation Level of ORF2 albumen K411. Preferably, the conditioning agent increases the expression of HDAC6 and/activity in cell, and the preferably described conditioning agent is HDAC6 expression cores Acid.Preferably, the individual is mammal, such as people or pig.

In the either side of the aforementioned present invention, it is preferable that HEV viruses are genotype 1-4, preferred gene type 1 and 4 HEV viruses.

In the either side of the aforementioned present invention, it is preferable that HEV ORF2 polypeptides include sequence selected from the following：

(a) genotype 1-4, the full length sequence of the HEV ORF2 albumen of preferred gene type 1 and 4；

(b) truncated segment of (a), the segment include peptide sequence E (P/L) TVK⁴¹¹LYTSVEN peptide sequences, preferably comprise The sequence of aa125-601, especially aa125-607 are particularly preferably made of the sequence of aa112-660；

(c) (a) or homologue (b) or variant.

In terms of the these and other of the present invention and embodiment is in attached drawing (followed by brief description) and hair below It is described and is illustrated in following embodiment in bright detailed description.In above and entire the application it is discussed any or all Feature can combine in the various embodiments of the present invention.Following embodiment further illustrates the present invention, it should be understood, however, that real It applies example and illustrates and not to the mode limited to describe, and those skilled in the art can carry out a variety of modifications.

Embodiment

The following abbreviations used in embodiment and attached drawing have following meaning：

ORF2 indicates the ORF2 polypeptides of HEV viruses, including full length sequence or its truncated segment；

ORF2 (112-660) indicates the ORF2 truncated segments aa112-660 of HEV；

Number 1 and 4 before ORF2, such as 1-ORF2 or 4-ORF2 indicate that the ORF2 polypeptides come from HEV genotype 1 Or genotype 4.

Add GFP or FLAG before ORF2, such as " GFP-ORF2 " or " FLAG-ORF2 ", indicate N-terminal with GFP or The ORF2 polypeptides or segment of FLAG labels.

K411R after ORF2, for example, ORF2^K411ROr ORF2^K411R(112-660) indicates the ORF2 polypeptides or piece Section in the positions K411 there is lysine to arginine to be mutated.Therefore for example, 1-ORF2^K411R(112-660) indicates HEV genotype 1 Type ORF2 truncated segments aa112-660's is unable to acetylation mutant, and wherein K411 lysine mutation is arginine；And 4- ORF2^K411R4 type ORF2 truncated segments of (112-660) expression HEV genotype are unable to acetylation mutant, wherein K411 bad ammonia Acid mutation is arginine.

TSA：HDAC6 inhibitor Trichostatin A；

TBSA：HDAC6 inhibitor Tubastatin A；

CAY：HDAC6 inhibitor Cs AY10603；

Anti- Acetyl-Lys:Anti- acetylated lysine antibody；

IP：It immunoprecipitates；

IB：Immunoblotting；

In embodiment and attached drawing, when referring to ORF2, ORF2 polypeptides used are full-length proteins unless stated otherwise, otherwise Refer to the aa112-660 segments of ORF2.

Conventional method and material

Plasmid construction

From 1 plant of W2-1 of HEV genotype, the overall length and 112-660aa segments (GenBank accession number of PCR amplification 1-ORF2: JQ655734).From 4 plants of W2-5 of HEV genotype, (GenBank is logged in for the overall length and 112-660aa segments of PCR amplification 4-ORF2 Number:JQ655736).The segment of amplification is cloned in pAcGFP1-C carriers (Clontech, Mountain View, CA).For The ORF2 for generating HA- labels, HEV ORF2 are cloned in pCMV-HA (Clontech).By PCR, from HEK293T CDNA clone HDAC6, and it is inserted into pCMV-Flag (Clontech).Use KOD Neo DNA polymer and following primer, site Mutagenesis generates the mutant for being unable to acetylation：

Primer GCGAGCCGACTGTTAGGCTGTATACATCTG is used for 1-ORF2^K411R,

Primer CGAGCCGACAGTACGACTTTACACCTCAGT is used for 4-ORF2^K411R。

Cell culture, drug-treated and plasmid transfection

By HeLa (American type culture collection [ATCC], CCL-2), HEK 293T (ATCC, CRL-1573) and A549 (ATCC, CCL-185) cell, in 37 DEG C and 5%CO₂In, it cultivates with 10% fetal calf serum, 100U/ml penicillin In the DMEM (Hyclone, Logan, UT) of 100 μ g/ml streptomysins.In order to be enriched with acetylated protein, with 0.5 μM Trichostatin A (Sigma, St.Louis, MO.) or 3 μM of Tubastatin A (Selleck, Houston, TX, Cat#: S8049) processing HEK 293T cells, HeLa cells and PLC/PRF5 cells (ATCC, CRL-8024) 8 hours.With 1 μM Trichostatin A or 6 μM of Tubastatin A or 0.2 μM of CAY10603 (Selleck Cat#:S7596) processing sf9 is thin Born of the same parents 5 days.For transfection, 293T cell growths to about 70% are converged, using polyethyleneimine (PEI, Alfa Aesar, Cat#:43896) plasmid transfection is carried out.HeLa cells or A549 cells 2000 (Life of lipofectamine Technologies, Grand Island, NY) it is transfected according to the scheme of manufacturer's offer.

Antibody and immunofluorescence

Rabbit-anti HDAC6 polyclonal antibodies (Cat#:12834-1-AP) and the anti-GAPDH monoclonal antibodies (Cat# of mouse: 60004-1-Ig,Clone No.:1E6D9) it is purchased from Proteintech (Proteintech Group, Rosemont, IL). Flag(Cat#:F3165,Clone No.:) and alpha-tubulin (Cat# M2:T9026,Clone No.:DM1A mouse) is single Clonal antibody is purchased from sigma.Rabbit-anti acetylated lysine polyclonal antibody (Cat#:9441) cell signal are purchased from technology(Cell Signaling Technology,Boston,MA).The anti-GFP antibody (Cat# of mouse:AI10151 it) purchases From Abgent (Abgent, San Diego, CA), rabbit-anti GFP polyclonal antibodies are laboratory self-controls.All fluorescent dyes are conjugated Secondary antibody be purchased from Invitrogen.

The cell of culture on the cover slip is fixed 15 minutes with 10%TCA room temperatures in PBS, in PBS buffer solution Permeabilization 5 minutes in 0.1%Triton X-100.Cell and the dilution (1 in the PBS with 3%BSA:100) primary antibody, 37 DEG C be incubated 1 hour, or at 4 DEG C be incubated overnight.Then, cell 3 times is washed in PBS, and in the PBS with 3%BSA 1: The conjugated secondary antibody of 500 diluted fluorescent dyes, is incubated 1 hour at 37 DEG C.After washing cell 3 times with PBS, with mowiol mounting mediums (Sigma) cell is locked on glass slide, the mounting medium contains the DAPI for being useful for DNA dyeing.Pass through UltraView VoX Systerm (PerkinElmer, Waltham, MA) obtains living cells imaging data.For the fixed sample of microexamination, pass through Zeiss LSM710 microscopes obtain image.

It immunoprecipitates (IP)

In lysis buffer (20mM Tris-HCL, pH 7.5,150mM NaCl, 10mM with 0.5%NP40 NaVO₃, 10mM NaF and 0.5mM EGTA) in crack HeLa or 293T cells on ice, and 4 DEG C are collected by centrifugation supernatant.It is anti- GFP or anti-Flag antibody is incubated 1 hour with albumin A pearl (GE Healthcare, Fairfield, CT) at 4 DEG C.Pearl is detached, Washing, and be incubated 2 hours with 4 DEG C of cell lysate, then washed 4 times with lysis buffer.Finally, the albumen on pearl uses Sample buffer elutes, and passes through western engram analysis.

RNAi is tested

Cell is grown after 24 hours, using lipofectamine 2000, according to the scheme that manufacturer describes, with HDAC6's siRNA(Santa cruz biotechnology,Dallas,TX,Cat#:Sc-35544 it) transfects.After transfection in 72 hours, harvest Cell is used for western traces.

Mass spectral analysis

With GFP-1-ORF2 or GFP-4-ORF2 plasmid-transfected cells 24 hours, cracked on ice in cell lysis buffer solution Cell 20 minutes.Cell lysate is incubated 2 hours at 4 DEG C, is mixed with 20 μ l albumin A-Sepharose pearls and rabbit-anti GFP antibody. After washing pearl with lysis buffer, GFP-ORF2 polypeptides are resuspended in sample buffer.SDS-PAGE is carried out to sample It isolates and purifies, and carries out acetyl-MS using gel slice and analyze.

HEV is cultivated in PLC/PRF/5 cells

Adding 10% fetal calf serum (FBS), the minimum basic culture of 100U/ml penicillin and 100 μ g/ml streptomysins Base (MEM；Hyclone in), in 37 DEG C and 5%CO2, PLC/PRF/5 cells are grown.By Hepatitis E virus (viral accession number:AJ272108, genotype 4) and it is added in the PLC/PRF/5 cells with 2%FBS, a culture supernatants are collected every three days (45)。

HEV ORF2 polypeptides are quantified by ELISA

HEV in the PLC/PRF/5 cell culture supernatants of HEV infection and from sf9 cells (ATCC CRL-1711) ORF2 (112-660) albumen of expression, after dilution, with HEV antigens enzyme-linked immunosorbent assay (ELISA) (Wantai, Beijing, China) (45) be detected.

Electron microscope observation

The 293T cells of culture are fixed with 2.5% glutaraldehyde in 0.1M Sodium Cacodylate buffer solutions, then with identical buffering It is fixed after 1% somuum oxide in liquid.After replacing it with propylene oxide with graded ethanol dehydration, sample is embedded in 812 trees of Pon In fat.With uranyl acetate and lead citrate, poststaining is carried out to ultra-thin section.Use JEM-1400 transmission electron microscopes (JEOL, Japan) and specific image system (830.10U3CCD camera, Gatan, USA) for EM are observed.

Embodiment 1：HEV capsid protein ORF2 is in conservative amino acid residues K411 acetylations.

The N-terminal of ORF2 is not required (39) its antigenicity and virion assembling.ORF2 (112-660) with it is wild Type virus shares identical biological characteristics (40).Therefore, using truncation ORF2, the phase of HEV ORF2 and host protein are studied Interaction, and successfully identify multiple molecules (12) with ORF2 interactions.In order to test after whether ORF2 translate Modification, including acetylation, by the genotype 1 and 4 type ORF2 truncated segments (GFP-1-ORF2 (112-660) and GFP- of GFP labels 4-ORF2 (112-660)) it is introduced into 293T cells.Then, ORF2 is precipitated using GFP antibody mediated immunities, carries out acetylation mass spectrum point It analyses (Figure 1A, 1C, 1D).Mass spectral results show that GFP-1-ORF2 and GFP-4-ORF2 are in identical peptide EPTVK⁴¹¹LYTSVEN's The acetylation of the positions K411 is very conservative sequence in the ORF2 polypeptide sequences (including genotype 1-4) that the peptide is checked at 9 kinds (Figure 1B).

Using the antibody of anti-acetylated lysine, further verifies acetylation and be happened at GFP-1-ORF2 and GFP-4-ORF2 In, but (Fig. 1 E) is not happened on individual GFP.In order to verify the acetylation sites that K411 is ORF2, K411 is sported into essence Propylhomoserin and the mutant that GFP labels are expressed in 293T cells.Compared with wild type ORF2, the acetylation of mutant is significantly Ground reduces (Fig. 1 F), illustrates that K411 is the main acetylation sites of ORF2.

Embodiment 2：K411 acetylation of the formation of HEV inclusion bodys dependent on ORF2

Since lysine acetylation plays an important role in the life cycle of virus, therefore determine the K411 of assessment HEV ORF2 The function of acetylation.The wild type 1-ORF2 (112-660), 4-ORF2 (112-660), mutant 1- merged is marked with GFP ORF2^K411R(112-660), or 4-ORF2^K411R(112-660), transfection HeLa cell.Fixed cell with anti-GFP antibody and resists Tubulin antibody carries out immunofluorescence dyeing, and dyes DNA by DAPI.Fluorescence microscope determines that ORF2 determines in cell Position.It has surprisingly been found that GFP-1-ORF2^K411R(112-660) and GFP-4-ORF2^K411R(112-660) mainly equably divides In disseminated cell matter, and the wild type GFP-ORF2 (112-660) of genotype 1 and genotype 4 all shows and strong forgives the bodily form At (Fig. 2A, 2B).Whether the inclusion body in order to detect enhancing is formed caused by N-terminal truncates, and overall length ORF2 (ORF2 (1- are had detected 660) result (Fig. 2 C) similar with above-mentioned truncation ORF2), is obtained.Enhancing in order to exclude inclusion body formation is drawn by GFP labels This possibility is played, GFP labels are replaced with into HA or FLAG, as a result still obtain similar result (Fig. 2 D).With inclusion body Cell (GFP count>3/ cell) account for expression wild type GFP-1-ORF2's (112-660) and GFP-4-ORF2 (112-660) 80% of total cell number and 75% or more (Fig. 2 E).(GFP's cell number in cytoplasm with inclusion body counts>3/ cell) it is right It is comparable (Fig. 2 F) in being taken a fancy to overall length and truncation ORF2.However, GFP-1-ORF2^K411RMutant has significantly reduced packet Contain body quantity (Fig. 2 F).

In order to verify the above results, with the ORF2 wild types and K411R mutant of GFP labels (that is, wild type 1-ORF2 (112-660),4-ORF2(112-660),1-ORF2^K411R(112-660), or 4-ORF2^K411R(112-660)), transfect A549 Cell (a kind of cell (41) for HEV cultures).These cells show and the similar result (Fig. 8) in HeLa cells.

To sum up, these statistics indicate that, the inclusion body that K411 is mediated in ORF2 is formed and is played an important role.

Embodiment 3：The influence that dynamic evaluation mutation K411R forms inclusion body

Seem, the acetylation of HEV ORF2 participates in adjusting the formation (Fig. 2) of inclusion body.However, HEV ORF2's forgives Body forming process is still unknown.In order to determine influence of the K411 acetylations to the process, wild type ORF2 and acetylation are lacked ORF2 carries out living cells imaging in HeLa cells, analyzes ORF2 inclusion bodys and is formed.Living cells imaging starts from GFP-1- After ORF2 (112-660) is transfected 12 hours, and continue as many as 8 hours.When being imaged beginning, cell is almost without detectable packet Contain body, forms a small number of inclusion bodys (Fig. 3 A) that can be examined after about 30-90 minutes.Later, with the extension of time, assembling generation is got over Carry out stronger large volume inclusion body (Fig. 3 A).These results illustrate that the acetylation of K411 greatly influences oneself of ORF2 inclusion bodys Assembling.In order to detect whether acetylation is one of determinant that inclusion body is formed, in GFP-1-ORF2^K411R(112-660) turns Dye carries out living cells imaging after 8 hours, checkable point (Fig. 3 B) is not as a result formed in cell.

Pass through high intension cytoanalyze ImageXpress Micro XL system meters in 3,000 or more living cells Number, progress inclusion body statistical analysis, SPOT cell calculations,>1 point/cell.The results show that GFP-1-ORF2^K411RWith open country Raw type GFP-1-ORF2 is compared forms (Fig. 9) with the inclusion body substantially reduced.In addition, also in GFP-4-ORF2 and GFP-4- ORF2^K411RSame result (Figure 10) is obtained in expression cell.

Therefore, present ORF2 forms the dynamic process of inclusion body to these data in cell for the first time, and shows K411 Acetylation defect can interfere inclusion body forming process.

Embodiment 4：HDAC6 causes ORF2 deacetylations and influences inclusion body to be formed

The acetylation of lysine and deacetylation are dynamic regulations.Before by histon deacetylase (HDAC) HDAC6 It is accredited as the molecule (12) that protein-protein interaction occurs with ORF2.It is poly- that studies have shown that HDAC6 before can influence albumen Collection and virus infection.It is therefore proposed that hypothesis：HDAC6 may be sent out by the acetylation of adjusting ORF2 in inclusion body is formed Wave adjustment effect.Here, confirmed by immunoprecipitation experiment, the ORF2 of genotype 1 and 4 all with external source and endogenous HDAC6 Physical interaction (Fig. 4 A and 4B) occurs.In addition, when knocking out HDAC6 with siRNA, the amount of HDAC6 is reduced, and acetylation The amount of ORF2 significantly increases, this illustrates that HDAC6 causes ORF2 deacetylations, and inhibits HDAC6 expression that can increase acetylation The amount (Fig. 4 C) of ORF2.Further, using the micromolecular inhibitor Trichostatin A (TSA) of 2 HDAC6 and Tubastatin A (TBSA) also have detected and block whether HDAC6 activity can influence the acetylation of ORF2 and inclusion body is formed.To the greatest extent Pipe TSA is non-specific hdac inhibitor, but TBSA has high selectivity (42,43) to HDAC6.As a result, it has been found that at 8 hours After TBSA processing, compared with DMSO control treatments, the GFP-1-ORF2 and GFP-4-ORF2 of acetylation increase (Fig. 4 D).Use TSA Processing, has also raised GFP-1-ORF2 (112-660) and GFP-4-ORF2 (112-660) protein level (Figure 12).Importantly, Compared with DMSO control treatments, the cell handled with HDAC6 inhibitor forms the inclusion body significantly increased, and the body of inclusion body Product bigger (Fig. 4 E, 4G).It is distributed it is worth noting that, the cell of TBSA processing shows inclusion body in more dense cell (Fig. 4 E, 4G), this may be caused by TBSA inhibits the efficient of HDAC6.After TSA and TBSA processing, GFP-4- ORF2 also shows similar cell phenotype (Fig. 4 F, 4H).With GFP-1-ORF2 transfect 24 hours after use DMSO, TBSA or The cell image of the 293T cells of TSA processing, display is in fig. 11.

Those above result illustrates that HDAC6 causes ORF2 deacetylations, and negatively adjusts ORF2 and form inclusion body.

Embodiment 5：Acetylation promotes the protein stability of HEV ORF2

An important biomolecule function of HDAC6 is to promote protein degradation (13).It is to study lysine acetylation No influence HEV ORF2 peptide levels, have used siRNA to strike low HDAC6.In fact it has been found that the exhaustion of HDAC6 greatly increases The level of ORF2 (Fig. 5 A).In order to disclose ORF2 degradation processes, protein translation inhibitor cycloheximide (CHX) is used Blocks protein synthesizes, and is degraded using proteasome inhibitor MG132 blocks proteins.The GFP- in the 293T cells of CHX processing The protein level of 1-ORF2 is reduced at any time, especially after 6 hours CHX are handled (Figure 13).On the contrary, using CHX and The cell of both MG132 processing shows comparable GFP-1-ORF2 peptide levels, illustrates the abundance of ORF2 polypeptides by albumen The adjusting of enzyme body dependence degradation pathway.These results prompt, and ORF2 may be stablized by acetylation, prompt the acetyl of ORF2 The stability that ORF2 resists the ability of proteasome degradation and thus improves ORF2 may be increased by changing.This is demonstrate,proved by following result It is real：GFP-1-ORF2, GFP-4-ORF2, GFP-1-ORF2 are assessed in 293T cells^K411RAnd GFP-4-ORF2^K411RAlbumen It is horizontal；Compared with wild type ORF2, the amount of K411 mutant greatly reduces (Fig. 5 B, left hand view).Furthermore with proteasome Inhibitor MG132 handled cell after 6 hours, the protein content difference of wild type and mutation ORF2 largely eliminated (Fig. 5 B, Right part of flg).

To sum up, these statistics indicate that：The acetylation of K411 can enhance what ORF2 polypeptides degraded to proteasome dependence Repellence increases the stability of ORF2 polypeptides；And K411 acetylations can be short of money by HDAC6 institutes to this stabilization of ORF2 It is anti-.

Relationship between being formed for the protein stability and inclusion body of studying HEV ORF2, with HDAC6 inhibitor The cell of TBSA processing expression GFP-1-ORF2 or GFP-4-ORF2 8 hours, and monomer is had detected by non-reduced SDS-PAGE With polymer ORF2 polypeptides (Fig. 5 C).Compared with DMSO control groups, monomer ORF2 polypeptides do not increase significantly as TBSA is handled Add.On the contrary, polymer ORF2 polypeptides sharp raise (Fig. 5 C) as TBSA is handled.The reason of leading to this increase may be high Acetylation Level is conducive to ORF2 inclusion bodys and is formed.It is detected by reproducibility SDS-PAGE, also having evaluated TBSA, treated ORF2 polypeptides total amount (Fig. 5 C).These statistics indicate that, the high Acetylation Level of ORF2 can have by promoting ORF2 multimerizations Conducive to the protein stability of HEV ORF2.

Embodiment 6：Inhibiting HDAC6 that can enhance, HEV is replicated and VLP is formed

Have in terms of being formed with ORF2 polypeptide matter stability due to the inclusion body that K411 acetylations are mediated in adjusting ORF2 important Effect, therefore determine whether assessment acetylation influences HEV virus replications.Recently, it is had developed in PLC/PRF/5 cells The effective cell culture systems (44) of HEV genotype 4.Therefore, it using specific HDAC6 inhibitor, is lived by adjusting HDAC6 Property, have studied influence of the acetylation to HEV virus replications using the cell culture system.For this purpose, infecting PLC/PRF/5 with HEV Cell 3 weeks, uses HDAC6 inhibitor processing cell 3 days later.Later, cell culture supernatant is collected, is inhaled using enzyme linked immunological Adhesion test (ELISA) checks HEV antigens.The results show that compared with DMSO processing, the amount of HEV antigens (ORF2) is in TBSA processing Afterwards by up-regulation (Fig. 6 A).This result is consistent (Fig. 5 C) with the obtained results of the ORF2 marked using GFP, illustrates that HDAC6 is inhibited to live Property can enhance HEV virus replications.

In view of the ORF2 polypeptides expressed from sf9 can also be effectively formed VLP and the insect cell also have its from The acetylation of body-deacetylation system (45), therefore the HEV 1- purified from sf9 cell supernatants are had evaluated by mass spectrum The acetylation of ORF2VLP, and confirm that ORF2K411 is acetylation (Fig. 6 B).The micromolecular inhibitor TSA of targeting HDAC6, TBSA and CAY (CAY10603) is added into the sf9 cells of expression ORF2.After 5 days, ELISA detects cell culture supernatant ORF2 in liquid.The results show that all three inhibitor significantly improve ORF2 expression (Fig. 6 C), illustrate that HDAC6 inhibits Agent enhancing VLP is formed.In fact, although CAY processing increases the level of free ORF2, compared with DMSO control treatments, After being handled with all three HDAC6 inhibitor, the VLP purified from sf9 cell culture supernatants by ultracentrifugation is shown Go out to dramatically increase (Fig. 6 D, 6E).

In addition, the influence formed to VLP using transmission electron microscope assessment acetylation.It was found that GFP-1-ORF2 successes Self assembly is VLP (concentrating on black region) (Fig. 6 F).After handling cell with TBSA, with ORF2^K411RVLP is compared, The regions ORF2VLP seem much bigger, further demonstrate the acetylation of K411 and can be stabilized in ORF2VLP assemblings or ORF2VLP On play an important roll.In GFP-4-ORF2 and GFP-4-ORF2^K411RThese in expression cell are as a result, with genotype 1ORF2 Result it is similar (Fig. 6 G).

To sum up, these statistics indicate that, the high Acetylation Level of ORF2 promotes HEV to replicate and VLP assemblings, and HDAC6 can rise The host defense mechanism formed with virion is replicated to confrontation HEV.

It discusses：

Viral inclusion body be suggested be effective virus replication duplication factory or platform (31).Generally, inclusion body can To be spontaneously formed by HEV virions or the aggregation of capsid protein ORF2 and cell protein.However, being unaware of host protein such as What adjusts capsid protein ORF2 self assemblies and viral inclusion body is formed.HEV viruses have limited Genome Size, thus at this It needs to utilize host cell proteins in the life cycle of virus.The present inventor reports HEV ORF2 stability maintenances and packet herein Contain body and forms a kind of new mechanism being based on.The inventors discovered that conserved aminos of the HEV ORF2 in genotype 1 and genotype 4 The positions sour residue K411 are acetylation.When K411 is sported arginine, ORF2 forms the ability and the protein of inclusion body Stability be significantly attenuated, illustrate lysine acetylation participate in adjust inclusion body formed and ORF2 antigen abundance.

Lysine acetylation plays an important roll in the adjusting of viral lifecycle.For example, when the second of alpha-tubulin When acylated suppressed, the fusion of HIV-1 coating dependent cells and infection are greatly suppressed (46,47).In view of α-micro-pipe egg It is acetylation in mammalian cell in vain and micro-pipe participates in the fusion (31) of human 3-type parainfluenza virus inclusion body, therefore exist Such possibility, that is, the increase of HEV ORF2 inclusion bodys may be partly by alpha-tubulin under TSA and TBSA processing Acetylation be suppressed caused by.However, the ORF2 of acetylation missing^K411RMutant loss is collected as the ability of inclusion body, Illustrate that ORF2 acetylations are required for the process.

Delay living cells imaging discloses, and the K411 acetylations of ORF2 have significant shadow for from the beginning inclusion body self assembly It rings.Moreover, the acetylation of K411 significantly facilitated HEV ORF2 fights proteasome dependence drop by forming polymer The resistance of solution approach promotes the stability of HEV ORF2.Therefore, the discovery of the present inventor discloses one kind and by host relies ammonia Sour acetylation system adjusts the new mechanism (Fig. 7) that HEV ORF2 stability and IB are formed.Although responsible for acetylation ORF2's The transacetylase of K411 residues is also to be identified, but current discovery illustrate that HDAC6 seems can be with antagonism ORF2 acetyl Change.Known to the present inventor, HEV ORF2 are second virus protein target spots of the HDAC6 identified so far.Second is gone with ORF2 Acylated result is consistent, inhibits HDAC6 greatly to enhance ORF2 polypeptide stabilities, inclusion body is formed, HEV is replicated and virus-like Particle shape at.This explanation, HDAC6 can play the host defense mechanism of confrontation HEV infection by antagonism ORF2 acetylations.Cause This, the acetylation for adjusting ORF2 can be the new method for HEV treatments in seriously ill patient and chronic HEV infected patients.This Outside, the application of HDAC6 inhibitor can improve HEV production of vaccine effect.

Bibliography

1.Cao D,Meng XJ.Molecular biology and replication of hepatitis E virus.Emerg Microbes Infect.2012；1(8):e17.

2.Lozano R,Naghavi M,Foreman K,Lim S,Shibuya K,Aboyans V,et al.Global and regional mortality from 235causes of death for 20age groups in 1990and 2010:a systematic analysis for the Global Burden of Disease Study2010.Lancet.2012；380(9859):2095‐128.

3.Rein DB,Stevens GA,Theaker J,Wittenborn JS,Wiersma ST.The global burden of hepatitis E virus genotypes1and 2in 2005.Hepatology.2012；55(4):988‐ 97.

4.Perez‐Gracia MT,Garcia M,Suay B,Mateos‐Lindemann ML.Current Knowledge on Hepatitis E.J Clin Transl Hepatol.2015；3(2):117‐26.Epub 2015/09/ 12.

5.Li SW,Zhao Q,Wu T,Chen S,Zhang J,Xia NS.The development of a recombinant hepatitis E vaccine HEV239.Hum Vaccin Immunother.2015；11(4):908‐ 14.Epub 2015/02/26.

6.Li TC,Suzaki Y,Ami Y,Dhole TN,Miyamura T,Takeda N.Protection of cynomolgus monkeys against HEV infection by oral administration of recombinant hepatitis E virus‐like particles.Vaccine.2004；22(3‐4):370‐ 7.Epub2003/12/13.

7.Li SW,Zhang J,Li YM,Ou SH,Huang GY,He ZQ,et al.A bacterially expressed particulate hepatitis E vaccine:antigenicity,immunogenicity and protectivity on primates.Vaccine.2005；23(22):2893‐901.Epub 2005/03/23.

8.Li SW,Zhang J,He ZQ,Gu Y,Liu RS,Lin J,et al.Mutational analysis of essential interactions involved in the assembly of hepatitis E virus capsid.J Biol Chem.2005；280(5):3400‐6.Epub 2004/11/24.

9.Surjit M,Jameel S,Lal SK.The ORF2protein of hepatitis E virus binds the 5'region of viral RNA.J Virol.2004；78(1):320‐8.Epub 2003/12/13.

10.Ahmad I,Holla RP,Jameel S.Molecular virology of hepatitis E virus.Virus Res.2011；161(1):47‐58.Epub2011/02/25.

11.Shiota T,Li TC,Yoshizaki S,Kato T,Wakita T,Ishii K.The hepatitis E virus capsid C‐terminal region is essential for the viral life cycle: implication for viral genome encapsidation and particle stabilization.J Virol.2013；87(10):6031‐6.Epub 2013/03/08.

12.Tian Y,Huang W,Yang J,Wen Z,Geng Y,Zhao C,et al.Systematic identification of hepatitis E virus ORF2interactome reveals that TMEM134engages in ORF2‐mediated NF‐kappaB pathway.Virus Res.2017；228:102‐ 8.Epub 2016/12/03.

13.Zheng K,Jiang Y,He Z,Kitazato K,Wang Y.Cellular defence or viral assist:the dilemma of HDAC6.J Gen Virol.2017；98(3):322‐37.Epub 2016/12/14.

14.Chen PB,Hung JH,Hickman TL,Coles AH,Carey JF,Weng Z,et al.Hdac6regulates Tip60‐p400function in stem cells.Elife.2013；2:e01557.

15.Hubbert C,Guardiola A,Shao R,Kawaguchi Y,Ito A,Nixon A,et al.HDAC6is a microtubule‐associated deacetylase.Nature.2002；417(6887):455‐8.

16.Kovacs JJ,Murphy PJ,Gaillard S,Zhao X,Wu JT,Nicchitta CV,et al.HDAC6regulates Hsp90acetylation and chaperone‐dependent activation of glucocorticoid receptor.Mol Cell.2005；18(5):601‐7.

17.Zhang Y,Kwon S,Yamaguchi T,Cubizolles F,Rousseaux S,Kneissel M,et al.Mice lacking histone deacetylase6have hyperacetylated tubulin but are viable and develop normally.Mol Cell Biol.2008；28(5):1688‐701.

18.Kawaguchi Y,Kovacs JJ,McLaurin A,Vance JM,Ito A,Yao TP.The deacetylase HDAC6regulates aggresome formation and cell viability in response to misfolded protein stress.Cell.2003；115(6):727‐38.

19.Kwon S,Zhang Y,Matthias P.The deacetylase HDAC6is a novel critical component of stress granules involved in the stress response.Genes Dev.2007； 21(24):3381‐94.

20.Zhang X,Yuan Z,Zhang Y,Yong S,Salas‐Burgos A,Koomen J,et al.HDAC6modulates cell motility by altering the acetylation level of cortactin.Mol Cell.2007；27(2):197‐213.

21.Lafarga V,Aymerich I,Tapia O,Mayor F,Jr.,Penela P.A novel GRK2/ HDAC6 interaction modulates cell spreading and motility.EMBO J.2012；31(4): 856‐69.

22.Arsenault D,Brochu‐Gaudreau K,Charbonneau M,Dubois CM.HDAC6 deacetylase activity is required for hypoxia‐induced invadopodia formation and cell invasion.PLoS One.2013；8(2):e55529.

23.Yang PH,Zhang L,Zhang YJ,Zhang J,Xu WF.HDAC6:physiological function and its selective inhibitors for cancer treatment.Drug Discov Ther.2013；7(6):233‐42.

24.Seidel C,Schnekenburger M,Dicato M,Diederich M.Histone deacetylase 6 in health and disease.Epigenomics.2015；7(1):103‐18.

25.Kaluza D,Kroll J,Gesierich S,Yao TP,Boon RA,Hergenreider E,et al.Class IIb HDAC6 regulates endothelial cell migration and angiogenesis by deacetylation of cortactin.EMBO J.2011；30(20):4142‐56.

26.Lwin T,Zhao X,Cheng F,Zhang X,Huang A,Shah B,et al.A microenvironment‐mediated c‐Myc/miR‐548m/HDAC6 amplification loop in non‐ Hodgkin B cell lymphomas.J Clin Invest.2013；123(11):4612‐26.

27.Hideshima T,Qi J,Paranal RM,Tang W,Greenberg E,West N,et al.Discovery of selective small‐molecule HDAC6 inhibitor for overcoming proteasome inhibitor resistance in multiple myeloma.Proc Natl Acad Sci U S A.2016；113(46):13162‐7.

28.Wang Q,Tan R,Zhu X,Zhang Y,Tan Z,Su B,et al.Oncogenic K‐ras confers SAHA resistance by up‐regulating HDAC6 and c‐myc expression.Oncotarget.2016；7(9):10064‐72.

29.Wang Z,Hu P,Tang F,Xie C.HDAC6‐mediated EGFR stabilization and activation restrict cell response to sorafenib in non‐small cell lung cancer cells.Med Oncol.2016；33(5):50.

30.Wang Z,Tang F,Hu P,Wang Y,Gong J,Sun S,et al.HDAC6 promotes cell proliferation and confers resistance to gefitinib in lung adenocarcinoma.Oncol Rep.2016；36(1):589‐97.

31.Zhang S,Jiang Y,Cheng Q,Zhong Y,Qin Y,Chen M.Inclusion Body Fusion of Human Parainfluenza Virus Type3 Regulated by Acetylated alpha‐Tubulin Enhances Viral Replication.J Virol.2017；91(3).Epub 2016/11/25.

32.Husain M,Cheung CY.Histone deacetylase 6 inhibits influenza A virus release by downregulating the trafficking of viral components to the plasma membrane via its substrate,acetylated microtubules.J Virol.2014；88 (19):11229‐39.

33.Zhu J,Coyne CB,Sarkar SN.PKC alpha regulates Sendai virus‐mediated interferon induction through HDAC6and beta‐catenin.EMBO J.2011；30(23):4838‐ 49.

34.Valera MS,de Armas‐Rillo L,Barroso‐Gonzalez J,Ziglio S,Batisse J, Dubois N,et al.The HDAC6/APOBEC3G complex regulates HIV‐1 infectiveness by inducing Vif autophagic degradation.Retrovirology.2015；12:53.

35.Huo L,Li D,Sun X,Shi X,Karna P,Yang W,et al.Regulation of Tat acetylation and transactivation activity by the microtubule‐associated deacetylase HDAC6.J Biol Chem.2011；286(11):9280‐6.

36.Banerjee I,Miyake Y,Nobs SP,Schneider C,Horvath P,Kopf M,et al.Influenza A virus uses the aggresome processing machinery for host cell entry.Science.2014；346(6208):473‐7.

37.Lu CY,Chang YC,Hua CH,Chuang C,Huang SH,Kung SH,et al.Tubacin,an HDAC6 Selective Inhibitor,Reduces the Replication of the Japanese Encephalitis Virus via the Decrease of Viral RNA Synthesis.Int J Mol Sci.2017；18(5).

38.Kozlov MV,Kleymenova AA,Konduktorov KA,Malikova AZ,Kochetkov SN.Selective inhibitor of histone deacetylase 6(tubastatin A)suppresses proliferation of hepatitis C virus replicon in culture of human hepatocytes.Biochemistry(Mosc).2014；79(7):637‐42.

39.Li TC,Yamakawa Y,Suzuki K,Tatsumi M,Razak MA,Uchida T,et al.Expression and self‐assembly of empty virus‐like particles of hepatitis E virus.J Virol.1997；71(10):7207‐13.Epub 1997/10/06.

40.Taherkhani R,Makvandi M,Farshadpour F.Development of enzyme‐linked immunosorbent assays using 2truncated ORF2 proteins for detection of IgG antibodies against hepatitis E virus.Ann Lab Med.2014；34(2):118‐26.Epub 2014/ 03/14.

41.Takahashi H,Tanaka T,Jirintai S,Nagashima S,Takahashi M,Nishizawa T,et al.A549 and PLC/PRF/5 cells can support the efficient propagation of swine and wild boar hepatitis E virus(HEV)strains:demonstration of HEV infectivity of porcine liver sold as food.Arch Virol.2012；157(2):235‐46.Epub 2011/11/04.

42.Wang B,Rao YH,Inoue M,Hao R,Lai CH,Chen D,et al.Microtubule acetylation amplifies p38 kinase signalling and anti‐inflammatory IL‐10 production.Nat Commun.2014；5:3479.Epub 2014/03/19.

43.Bartholomeeusen K,Fujinaga K,Xiang Y,Peterlin BM.Histone deacetylase inhibitors(HDACis)that release the positive transcription elongation factor b(P‐TEFb)from its inhibitory complex also activate HIV transcription.J Biol Chem.2013；288(20):14400‐7.Epub 2013/03/30.

44.Zhang F,Qi Y,Harrison TJ,Luo B,Zhou Y,Li X,et al.Hepatitis E genotype 4 virus from feces of monkeys infected experimentally can be cultured in PLC/PRF/5 cells and upregulate host interferon‐inducible genes.J Med Virol.2014；86(10):1736‐44.Epub 2014/07/22.

45.Qi Y,Zhang F,Zhang L,Harrison TJ,Huang W,Zhao C,et al.Hepatitis E Virus Produced from Cell Culture Has a Lipid Envelope.PLoS One.2015；10(7): e0132503.Epub 2015/07/15.

46.Wang D,Kon N,Lasso G,Jiang L,Leng W,Zhu WG,et al.Acetylation‐ regulated interaction between p53 and SET reveals a widespread regulatory mode.Nature.2016；538(7623):118‐22.Epub 2016/09/15.

47.Valenzuela‐Fernandez A,Alvarez S,Gordon‐Alonso M,Barrero M,Ursa A, Cabrero JR,et al.Histone deacetylase 6 regulates human immunodeficiency virus type 1 infection.Mol Biol Cell.2005；16(11):5445‐54.Epub 2005/09/09.

Claims (23)

1. a kind of method improving HEV virus productions, including：In the presence of HDAC6 inhibitor, the cell of culture HEV infection,

The wherein described inhibitor strikes the HDAC6 expression of low cell and/or reduces HDAC6 activity,

The wherein described HEV viruses are the HEV viruses of genotype 1-4.

2. a kind of method improving the production of HEV virus-like particles, including：In the presence of HDAC6 inhibitor, culture includes expression The cell of the recombinant expression construct body of ORF2 polypeptides,

The wherein described inhibitor strikes the HDAC6 expression of low cell and/or reduces HDAC6 activity,

The wherein described ORF2 polypeptides include to be selected from following sequence：

(a) genotype 1-4, the full length sequence of the HEV ORF2 albumen of preferred gene type 1 and 4；

(b) truncated segment of (a), the segment include peptide sequence E (P/L) TVK⁴¹¹LYTSVEN and include overall length ORF2 sequences The regions aa125-601 are especially made of aa112-660 amino acid sequences；

(c) (a) or homologue (b) or variant.

3. a kind of method improving the production of HEV ORF2 polypeptides, including：In the presence of HDAC6 inhibitor, culture includes coding HEV The cell of the nucleic acid of ORF2 polypeptides,

The wherein described inhibitor strikes the HDAC6 expression of low cell and/or reduces HDAC6 activity,

The wherein described ORF2 polypeptides include to be selected from following sequence：

(a) genotype 1-4, the full length sequence of the HEV ORF2 albumen of preferred gene type 1 and 4；

(b) truncated segment of (a), the segment include peptide sequence E (P/L) TVK⁴¹¹LYTSVEN and include overall length ORF2 sequences The regions aa125-601 are especially made of aa112-660 amino acid sequences；

(c) (a) or homologue (b) or variant.

4. the method for claim 1-3, wherein striking the expression of HDAC6 in low cell, it is preferred to use inhibit HDAC6 expression Nucleic acid molecules, especially siRNA or shRNA or its expression construct come realize HDAC6 it is horizontal strike it is low；Preferably, in disease Low HDAC6 expression is struck before poison infection or ORF2 expression.

5. the method for claim 1-4 strikes low cell wherein the cell is HDAC6, preferably cell is that HDAC6 composing types strike Low cell or HDAC6 conditional knockdown cells.

6. the method for claim 1-3, wherein it is active to reduce HDAC6 in cell to handle cell using HDAC6 chemical inhibitors,

Wherein HDAC6 chemical inhibitors are selected from：Non-selective inhibitor such as TSA, Vorinostat, LBH589, ITF2357, PXD-101 or HDAC6 selective depressants such as rocilinostat (ACY-1215), ACY-241, Tubacin, Tubastatin A (TBSA), CAY10603, Nexturastat A, HPOB, ACY-738, ACY-775 and ACY-1083, or It is arbitrarily combined.

7. the method for claim 6, wherein handling cell using HDAC6 inhibitor selected from the following：

(a) 0.2 μM -5 μM of concentration, preferably 1 μM of Trichostatin A (TSA),

(b) 1 μM -10 μM of concentration, preferably 6 μM of Tubastatin A (TBSA),

(c) 0.1 μM -1 μM of concentration, preferably 0.2 μM of CAY10603.

8. the method for claim 1-7, wherein relative to the cell that unused HDAC6 inhibitor is handled, HEV ORF2 eggs in cell White K411 Acetylation Levels increase.

9. the method for claim 1-8, wherein relative to the cell that unused HDAC6 inhibitor is handled, the stabilization of ORF2 in cell Property increase and/or cell in ORF2 amount increase, especially in cell ORF2 polymers amount increase.

10. the method for claim 1-9, wherein relative to the cell that unused HDAC6 inhibitor is handled, HEV viruses in cell It replicates and/or HEV viral yields increases.

11. the method for claim 1-9, wherein relative to the cell that unused HDAC6 inhibitor is handled, the assembling of VLP in cell And/or VLP yield increases.

12.HDAC6 inhibitor, such as HDAC6 inhibitions nucleic acid or HDAC6 chemical inhibitors, purposes,

(a) it is used to increase the K411 Acetylation Levels of HEV ORF2,

(b) it is used to increase the stability and/or ORF2 yield of HEV ORF2,

(c) it is used to increase HEV virus replications and/or viral yield, or

(d) it is used to increase the assembling of HEV VLP and/or the purposes of VLP yield.

13. a kind of cell culture system comprising：

(i) cell of the nucleic acid comprising coding ORF2 polypeptides；(ii) HDAC6 inhibitor,

The wherein described inhibitor strikes the HDAC6 expression of low cell and/or reduces HDAC6 activity,

The wherein described ORF2 polypeptides include to be selected from following sequence：

(a) genotype 1-4, the full length sequence of the HEV ORF2 albumen of preferred gene type 1 and 4；

(b) truncated segment of (a), the segment include peptide sequence E (P/L) TVK⁴¹¹LYTSVEN and include overall length ORF2 sequences The regions aa125-601 are especially made of aa112-660 amino acid sequences；

(c) (a) or homologue (b) or variant.

14. the cell culture system of claim 13, wherein the inhibitor is the HDAC6 inhibition cores being introduced into the cell Acid molecule, especially siRNA or shRNA or its expression construct；Or the inhibitor is added in the culture of the cell HDAC6 chemical inhibitors, especially HDAC6 selective depressants.

15. the cell culture system of claim 14, wherein the cell is the cell of the HEV viruses infection of genotype 1-4.

16. the cell culture system of claim 14, wherein the cell is the introduction of the expression structure for expressing the ORF2 polypeptides Build the recombinant cell of body.

17. the cell culture system of claim 14-16 is used to produce virus, the purposes of virus-like particle or ORF2 polypeptides.

18. a kind of cell culture striking low cell comprising HDAC6, wherein the cell includes the nucleic acid of coding HEV ORF2,

The wherein described ORF2 polypeptides include to be selected from following sequence：

(a) genotype 1-4, the full length sequence of the HEV ORF2 albumen of preferred gene type 1 and 4；

(b) truncated segment of (a), the segment include peptide sequence E (P/L) TVK⁴¹¹LYTSVEN and include overall length ORF2 sequences The regions aa125-601 are especially made of aa112-660 amino acid sequences；

(c) (a) or homologue (b) or variant,

The preferably wherein described cell is the cell of HEV infection, or includes the cell for the expression construct for expressing ORF2 polypeptides.

19. the cell culture of claim 17 is used to produce HEV viruses, the purposes of virus-like particle or ORF2 polypeptides.

20. virus-like particle that virus or method according to claim 2 that the method according to claim 1 obtains obtain or The ORF2 polypeptides that method according to claim 3 obtains are used to prepare the purposes of immune composition or vaccine.

21. a kind of method for treating the infection of HEV viruses includes applying HEV ORF2 albumen K411 acetyl to the individual of infection HEV Change conditioning agent, wherein the conditioning agent reduces the Acetylation Level of ORF2 albumen K411, wherein HEV viruses are genotype 1-4 HEV viruses.

22. the method for claim 21, wherein the conditioning agent increases the expression of HDAC6 and/activity in cell, it is preferably described Conditioning agent is HDAC6 express nucleic acids.

23. the method for claim 21, wherein the individual is mammal, such as people or pig.