CN113384700B

CN113384700B - Target LY6E capable of effectively inhibiting Ebola virus infection and application thereof

Info

Publication number: CN113384700B
Application number: CN202110345847.3A
Authority: CN
Inventors: 曹诚; 刘曜宁; 靳彦文; 高婷; 朱林; 刘萱; 张部昌
Original assignee: Academy of Military Medical Sciences AMMS of PLA; Anhui University
Current assignee: Academy of Military Medical Sciences AMMS of PLA; Anhui University
Priority date: 2021-03-31
Filing date: 2021-03-31
Publication date: 2022-11-01
Anticipated expiration: 2041-03-31
Also published as: CN113384700A

Abstract

The invention discloses a target LY6E capable of effectively inhibiting Ebola virus infection and application thereof. The experimental results prove that: LY6E interacts with the VP35 protein of the Ebola virus, and the expression of endogenous LY6E protein in cells can be knocked out or knocked down, so that the infection and proliferation of the Ebola virus can be obviously inhibited. Shows that LY6E can be used as a target for inhibiting the Ebola virus infection, and the LY6E protein inhibitor has good research prospect when being used as a candidate drug for controlling the Ebola virus to treat the Ebola virus. The invention provides theoretical basis for using LY6E as the target point of the Ebola virus infection treatment, and has great application value for the development of the treatment of the Ebola virus infection and the medicament for treating the Ebola virus infection.

Description

Target LY6E capable of effectively inhibiting Ebola virus infection and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a target LY6E capable of effectively inhibiting Ebola virus infection and application thereof.

Background

Ebola virus (EBOV) is a highly pathogenic and fatality virus that can cause ebola hemorrhagic fever in humans and primates. Ebola virus-induced ebola virus outbreaks were first reported in 1976 in ebola rivers northern to congo gold (zaire), and are therefore famous, and several decades since it was reported that ebola virus outbreaks occur in africa.

The Ebola virus is an enveloped single-stranded negative-strand RNA virus, the genome size is 19kb, 7 coding genes are provided, and NP, VP35, VP40, GP, VP30, VP24 and L are arranged from the 3 'end to the 5' end in sequence. The ebola virus genome and NP, VP30, VP35, and L proteins make up the nucleocapsid of the virus. VP24 and VP40 are matrix proteins responsible for linking the nucleocapsid to the envelope with GP 1,2 distributed throughout. At present, the research suggests that the structure of the ebola virus inclusion body formed by the participation of the NP, VP35, VP30 and L proteins of ebola is mainly distributed in cytoplasm. The inclusion body structure of the ebola virus can be used as a virus replication and assembly site to store a large amount of virus protein and host cell protein, thereby promoting the transcription and translation of virus genes and the transportation of virus particles from cell to cell in a cell.

Lymphocyte antigen 6E (Lymphocyte antigen 6E, LY6E) was originally found in human promyelocytic leukemia cell lines. The LY6E protein has a molecular weight of 14kDa, and is one of the members of the LY6/uPAR superfamily, and the protein structurally has a three-finger Ly6/uPAR (LU) domain typical of proteins of the family, which is anchored on the cell membrane surface through C-terminal GPI.

Disclosure of Invention

The invention aims to provide a target LY6E capable of effectively inhibiting Ebola virus infection and application thereof in treating Ebola virus.

In order to achieve the above objects, the present invention provides, first, a novel use of a substance inhibiting the activity of a LY6E protein or a substance reducing the content of a LY6E protein.

The invention provides the use of a substance which inhibits the activity of a LY6E protein or a substance which reduces the level of a LY6E protein in any of a 1) to a 6) as follows:

a1 ) preparing a product for treating or adjunctively treating ebola virus disease;

a2 For the treatment or adjuvant treatment of ebola virus disease;

a3 Preparing a product for inhibiting Ebola virus infection;

a4 Inhibit ebola virus infection;

a5 Preparing a product that inhibits ebola virus proliferation;

a6 Inhibit ebola virus proliferation.

In order to achieve the above objects, the present invention further provides a novel use of a substance silencing or knocking out or mutating an LY6E gene or a substance inhibiting the expression of an LY6E gene.

The invention provides the use of a substance which silences or knocks or mutates a LY6E gene or a substance which inhibits the expression of a LY6E gene in any of the following a 1) to a 6):

a1 Preparing a product for treating or adjunctively treating ebola virus disease;

a2 To treat or adjunctively treat ebola virus disease;

a3 Preparing a product for inhibiting ebola virus infection;

a4 Inhibit ebola virus infection;

a5 Preparing a product that inhibits ebola virus proliferation;

a6 Inhibit ebola virus proliferation.

In order to achieve the above object, the present invention also provides a product whose active ingredient is a substance inhibiting the activity of a LY6E protein or a substance reducing the content of a LY6E protein or a substance silencing or knocking out or mutating a LY6E gene or a substance inhibiting the expression of a LY6E gene;

the product has the function of any one of the following b 1) -b 3):

b1 For the treatment or adjuvant treatment of ebola virus disease;

b2 Inhibit ebola virus infection;

b3 Inhibit ebola virus proliferation.

In any of the above uses or products, the substance that inhibits the activity of the LY6E protein or the substance that reduces the level of the LY6E protein can be a protein, polypeptide or small molecule compound that inhibits the synthesis of the LY6E protein or promotes the degradation of the LY6E protein or inhibits the function of the LY6E protein.

The substance inhibiting the expression of the LY6E gene may be siRNA inhibiting the expression of the LY6E gene. Further, the siRNA for inhibiting the expression of the LY6E gene is siRNA formed by annealing two single strands shown in a sequence 3 and a sequence 4 or siRNA formed by annealing two single strands shown in a sequence 5 and a sequence 6.

The substance for knocking out LY6E gene can be CRISPR/Cas9 gene editing system for knocking out LY6E gene. Further, the sgRNA target sequence in the CRISPR/Cas9 gene editing system for knocking out LY6E gene is sequence 7 or sequence 8.

The application of the above LY6E as a target point in any one of the following c 1) to c 7) also belongs to the protection scope of the invention:

c1 Preparing a product for treating or adjunctively treating ebola virus disease;

c2 For the treatment or adjuvant treatment of ebola virus disease;

c3 Preparing a product for inhibiting ebola virus infection;

c4 Inhibit ebola virus infection;

c5 Preparing a product that inhibits ebola virus proliferation;

c6 Inhibit ebola virus proliferation;

c7 To develop or design or screen candidate drugs for the treatment and/or prevention of diseases due to ebola virus infection.

The application of LY6E in the interaction with the Ebola virus protein VP35 also belongs to the protection scope of the invention. In the application, the interaction between LY6E and Ebola virus protein VP35 can also be used, so that the LY6E is used for detecting the Ebola virus protein VP35, or the LY6E is used for detecting Ebola virus.

In order to achieve the above object, the present invention also provides any one of the following d 1) to d 3) biomaterials:

d1 A siRNA formed by annealing two single strands shown in a sequence 3 and a sequence 4 or a siRNA formed by annealing two single strands shown in a sequence 5 and a sequence 6;

d2 A sgRNA whose target sequence is SEQ ID NO. 7 or SEQ ID NO. 8;

d3 LY6E gene editing system comprising a Cas9 protein and the sgrnas of d 2).

The application of the biological material in any one of the following a 1) to a 6) also belongs to the protection scope of the invention:

a2 For the treatment or adjuvant treatment of ebola virus disease;

a3 Preparing a product for inhibiting ebola virus infection;

a4 Inhibit ebola virus infection;

a5 Preparing a product that inhibits ebola virus proliferation;

a6 Inhibit ebola virus proliferation.

In any one of the above applications or products or biomaterials, the amino acid sequence of the LY6E protein is shown as sequence 2 in the sequence table, and the LY6E gene is shown as sequence 1 in the sequence table.

The invention aims to provide a target capable of effectively inhibiting Ebola virus infection. According to the invention, through researching the interaction between the VP35 protein and LY6E protein of Ebola virus and related molecular mechanisms, LY6E is found to be a target point for preventing and treating Ebola virus infection for the first time. First, the present invention confirmed the interaction of the Ebola virus VP35 protein and the foreign LY6E protein in 293 cells by immunoprecipitation and immunoblotting experiments (FIG. 1). And the co-localization of the Ebola virus VP35 protein and the exogenous LY6E protein in 293 cells was found by using an immunofluorescence technique under a laser confocal microscope (FIG. 2). Since the liver is the target organ for ebola virus infection, the role of LY6E in the ebola virus infection process was subsequently further investigated in HepG2 cells. The infection and proliferation process of real Ebola virus in human cells is simulated by using an Ebola virus minimum genome system, and the influence of LY6E protein in host cells on the gene expression and infection of the Ebola virus is researched. Studies found that overexpression of LY6E in HepG2 cells promoted the expression of the Ebola virus gene (FIG. 3A), and knock-down of endogenous LY6E expression in HepG2 cells by siRNA inhibited the expression of the Ebola virus gene (FIG. 3B). In addition, the invention further proves the interaction of the VP35 protein of the Ebola virus and LY6E in the minimal gene set system of the Ebola virus by using a Duo-Link experiment (figure 4), and finds that the VP35 protein of the Ebola virus and LY6E are co-localized during the infection of the Ebola virus (figure 5). Finally, the invention constructs a plurality of LY6E knockout cell lines by Crispr/Cas9 technology (fig. 6A-C), and finds that the gene expression and the infection process of the Ebola virus are remarkably inhibited in the LY6E KO cell line (fig. 6D and 6E). The results show that LY6E plays an important role in the process of Ebola virus infection and proliferation, and the inhibition of the expression or activity of LY6E protein can effectively inhibit the Ebola virus infection and proliferation. LY6E can be used as a target for inhibiting Ebola virus infection, and the LY6E protein inhibitor has good research prospect when used as a candidate drug for preventing and treating Ebola virus to treat Ebola virus. The invention provides theoretical basis for using LY6E as the target point of the Ebola virus infection treatment, and has great application value for the development of the treatment of the Ebola virus infection and the medicament for treating the Ebola virus infection.

Drawings

FIG. 1 shows the interaction of VP35 protein of Ebola virus with LY6E in 293 cells detected by immunoprecipitation and immunoblotting.

FIG. 2 shows immunofluorescence detection of co-localization of Ebola virus VP35 protein and LY6E in 293 cells.

FIG. 3 shows the effect of altering the expression level of LY6E on Ebola virus gene expression in a minimal genome infected cell model of Ebola virus.

FIG. 4 is a Duo-Link assay for detecting the interaction of VP35 protein of Ebola virus with LY6E in a minimal genome infected cell model of Ebola virus.

FIG. 5 shows co-localization of VP35 protein of Ebola virus with LY6E in a minimal genome-infected cell model of Ebola virus by immunofluorescence assay.

FIG. 6 shows Crispr/Cas9 technology to construct LY6E knockout cell lines and detect infection and proliferation of the minimum genome of Ebola virus in LY6E knockout cell lines.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The test methods in the following examples are conventional methods unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.

Cell lines and plasmids referred to in the following examples:

293 cells (resource pool of national biomedical laboratory cells, resource No.: 3111C0001CCC 000010).

HepG2 cell (national resource pool of biomedical laboratory cells, resource number: 3111C0001CCC 000035).

The plasmid pcDNA3.0-Flag-VP35 is a plasmid which is obtained by using pcDNA3.0-Flag plasmid as starting plasmid and constructing the CDS sequence of EBOV VP35 gene (GenBank: MK 044561.1) between the BamH I enzyme cutting site and the EcoR V enzyme cutting site of the pcDNA3.0-Flag plasmid.

Plasmid pEGFP-LY6E is a plasmid obtained by using pEGFP N1 plasmid as a starting plasmid and constructing the CDS sequence of LY6E Gene (Gene ID 4061) between Hind III cleavage site and BamH I cleavage site of pEGFP N1 plasmid.

The plasmid pcDNA3.1-LY6E-HA is a plasmid which is obtained by constructing a LY6E-HA sequence between a Hind III enzyme cutting site and an EcoR I enzyme cutting site of pcDNA3.1+ plasmid by taking pcDNA3.1+ plasmid as a starting plasmid, wherein the LY6E-HA sequence is a sequence obtained by inserting an HA tag sequence (TACCACTACGATGTTGTTCAGTACGCT) between 303 th base and 304 th base of a CDS sequence of a wild type LY6E Gene (Gene ID 4061). The LY6E-HA sequence and the plasmid pcDNA3.1-LY6E-HA were synthesized by general biosystems, inc.

Plasmids pCAGGS-NP, pCAGGS-VP35, pCAGGS-VP30, pCAGGS-L, p4cis-vRNA-Rluc, pCAGGS-T7 and pCAGGS-Tim1 related to the minimal genome system of Ebola virus are all described in the documents "Hoenen T, watt A, mora A, feldmann H.Modeling the life cycle of Ebola virus under biosafety level 2 conditions with virus-like particulate contamination technology.J. Vis exp.2014 Sep 27; (91) 52381.Doi 10.3791/52381.PMID 25285674; PMCID 4828136, "a biological material which is available to the public from the military medical research institute of the national release military scientific institute, is used only for repeating the relevant experiments of the present invention, and is not used for other purposes.

Plasmid pSpCas9-puro is described in "Yaoyao, wang Guangfei, dongjincai, caocheng, liu xuan, construction of stable cell strain [ J ] with Cdc25C gene knockout of HeLa cell by CRISPR/Cas9 System in military medicine, 2017,41 (05): 359-362.

The molecular biology reagent 2 × Rapid Taq Master Mix referred to in the following examples is a product of the organism nu jinomo. Restriction enzymes, T4 DNA ligase and T4 PNK polymerase are all products of NEB corporation. The DNA Marker 2000 and the plasmid minipill kit are both products of Tiangen Biochemical technology limited. The DNA gel recovery kit is a product of QIAGEN. The Renilla-Glo Luciferase Assay System and the Passive lysine 5 × Buffer are both products of Promega. The transfection reagent Lipofectamine3000 is a product of Thermo. Puromycin is a product of MCE corporation. The anti-fluorescence attenuation packaged tablet is a product of Beijing sunshine Enrui Biotech Co. DMEM medium, opti-MEM medium and fetal bovine serum are all products of GIBCO, pancreatin and Duo-Link PLA kit are products of Sigma.

Antibodies referred to in the following examples: the LY6E rabbit polyclonal antibody is a product of Wuhan Sanying Biotechnology GmbH (product number 22144-1-AP, WB used concentration 1. The Anti-LY6E antibody is a product of Abcam company (cat # ab230657, IF used at a concentration of 1. The anti-VP35 antibody is a product of Creative Diagnostics (cat-B292, IF used at a concentration of 1. HRP-labeled ANTI-Flag antibody (cat # A8592, WB used at a concentration of 1. Both the TRITC-labeled goat anti-rabbit antibody (IF used at a concentration of 1 50) and the FITC-labeled goat anti-mouse antibody (IF used at a concentration of 1. The ECL chemiluminescence color developing solution is a product of GE company.

Example 1 immunoprecipitation and immunoblotting detection of interaction of Ebola virus VP35 protein with LY6E in 293 cells

The pcDNA3.0-Flag-VP35 and pEGFP-LY6E plasmids were co-transfected in 293 cells, and the interaction of the Ebola virus VP35 protein and LY6E in 293 cells was detected by immunoprecipitation and immunoblotting. The method comprises the following specific steps:

1. plasmid transfection

The 293 cells were passaged to a 60mm dish, and when the 293 cells were grown to 70% to 90% confluency, pcDNA3.0-Flag-VP35 and pEGFP-LY6E plasmids were transfected using Lipofectamine3000, a transfection reagent from Thermo. The specific steps of plasmid transfection are as follows: according to the plasmid: p3000=1 ratio 2 μ g of pcdna3.0-Flag-VP35 plasmid and 2 μ g of pEGFP-LY6E plasmid, and 8 μ L of P3000 were added to 100 μ L of opti-MEM medium to dilute, resulting in a DNA premix. According to the plasmid: lipofectamine3000=1 ratio 12. Mu.l Lipofectamine3000 was added to 100. Mu.l of the opti-MEM medium to dilute, the opti-MEM diluted Lipofectamine3000 was added to the DNA premix to mix well, and left at room temperature for 10min, and then the mixture was added to the cell culture medium to mix well. Finally, the cells were incubated at 37 ℃ in CO₂Culturing in an incubator. In the control group, pcDNA3.0-Flag-VP35 and pEGFP N1 plasmids were co-transformed, and pcDNA3.0-Flag and pEGFP-LY6E plasmids were co-transformed, respectively, in the same manner.

2. Harvesting cells

Collecting cells 48h after transfection, and discarding the culture medium in the culture dish; then adding 1mL PBS to transfer the cells into a 1.5mL centrifuge tube, and centrifuging for 3min at 4 ℃ and 1000 g; the supernatant was discarded, 1mL of PBS was added to a 1.5mL centrifuge tube to resuspend the cells, and the cells were centrifuged at 1000g for 3min at 4 ℃. Subsequently, a 1.5mL centrifuge tube containing the cells was placed on ice, and about 200. Mu.L of a single detergent lysis solution (150 mmol/L NaCl,50mmol/L Tris-HCl pH 8.0,1% NP40, 1 tablet/50 mL protease inhibitor) was added thereto, and after the solution was blown uniformly, the cells were lysed by placing on ice for 20 min. The lysed cells were centrifuged at 12000rpm for 10min and the supernatant was transferred to a new 1.5mL centrifuge tube. The protein concentration in the cell lysate is then determined and adjusted to be consistent using the single detergent lysate mentioned above. mu.L of cell lysate was taken and 20. Mu.L of 4 × loading (20mL of 0.5M Tris-HCl pH 6.8,4g SDS,25mL glycerol, 0.1g bromophenol blue, 5mL beta-mercaptoethanol, ddH was added₂Supplementing O to the total volume of 50 mL), and uniformly mixing; boiling for denaturation for 5min, and storing at-80 deg.C.

3. Immunoprecipitation

Add 140. Mu.L of cell lysate to 10. Mu.L of Flag antibody coupled beads, rotate 2h at 4 ℃; then adding 750 μ L of single detergent lysate to wash the beads, centrifuging at 4 deg.C for 3min at 1000g, discarding the supernatant, and repeating for 3 times; then 60. Mu.L of 1 × loading was added, and the mixture was boiled for denaturation for 5min and stored at-80 ℃.

4. SDS-PAGE and immunoblotting

Thawing the sample obtained in step 3 on ice, centrifuging at 12000rpm for 5min at 4 deg.C, taking 10 μ L sample, performing electrophoresis with SDS-PAGE electrophoresis buffer (25 mmol/L Tris,250mmol/L Glycine,0.1% (SDS), with initial voltage of 80V, and adjusting voltage to 120V after Marker passes through concentrated gel; activating PVDF membrane with methanol for 30s, and soaking with filter paper in 1 × membrane buffer (24 mmol/L Tris-HCl,5mmol/L Glycine,20% methanol) for 20min; after electrophoresis, placing the membrane on a semi-dry membrane converter in the sequence of filter paper, glue, membrane and filter paper from top to bottom, and converting the membrane at 18V for 1h30min after removing bubbles; sealing the PVDF membrane after the membrane conversion for 1h at room temperature by using 5% skimmed milk powder, and then washing for 5min for 3 times by using 1 × TBST; incubating the sealed PVDF membrane for 1h at normal temperature by using a Flag antibody and a GFP antibody respectively, and then washing for 3 times by using 1 × TBST, wherein each time is 5min; and finally performing ECL development.

The results are shown in FIG. 1, and the interaction between the Ebola virus VP35 protein and the foreign LY6E protein in 293 cells was confirmed by immunoprecipitation and immunoblotting experiments.

Example 2 immunofluorescence detection of Co-localization of Ebola Virus VP35 protein with LY6E in 293 cells

1. Plasmid transfection

293 cells were previously inoculated into 6-well plates containing sterile coverslips and 24 hours later were transfected with pcDNA3.0-Flag-VP35 and pcDNA3.1-LY6E-HA plasmids in the same manner as in example 1. The control group was co-transfected with pcDNA3.0-Flag and pcDNA3.1 plasmid in the same manner. Subsequently, the cells were incubated at 37 ℃ in CO₂Culturing in an incubator.

2. Preparation of cell slide

293 cells seeded with sterile coverslips were transfected 48h before aspiration of old medium, cells rinsed 3 times with PBS and then fixed with 1mL of 4% paraformaldehyde (in 1 XPBS) for 30min at 37 ℃. The fixed cells were washed 3 times with PBS, then the cells were perforated with 2mL of 0.3% Triton X-100 (formulated with 1 XPBS) for 10min at room temperature, followed by washing 3 times with PBS. Add 1.5mL blocking solution (PBS containing 5% goat serum) and block for 30min at 37 deg.C, wash cells 3 times with PBS. Subsequently, 20. Mu.L of a primary antibody dilution containing Anti-VP35 antibody and Anti-LY6E antibody (antibody: blocking solution 1, 50 ratio dilution) was dropped onto the cover slip, the cover slip was covered with a sealing film, incubated at 37 ℃ for 40min, and then the cells were washed 3 times with PBS. 20 μ L of a secondary antibody diluent (antibody: blocking solution 1 diluted at 50 ratio) containing TRITC-labeled goat anti-rabbit antibody and FITC-labeled goat anti-mouse antibody was dropped onto the coverslip, the coverslip was covered with a sealing film, incubated at 37 ℃ for 40min, and then the cells were washed 3 times with PBS. Finally, 10 mul of an anti-fluorescence attenuation blocking tablet (containing DAPI) is dripped on a glass slide, a cell climbing tablet in a 6-hole plate is taken out, one surface with cells is covered on the blocking tablet after being dried, and colorless and transparent nail polish is used for blocking the periphery of the blocking tablet. Thus completing the preparation of the cell climbing sheet.

3. Microscopic examination

And (3) observing the distribution of the VP35 protein and LY6E of the Ebola virus in the cell by using the cell slide prepared in the step (2) under a laser confocal microscope.

The results are shown in fig. 2, and the co-localization of the ebola virus VP35 protein and the exogenous LY6E protein in 293 cells was found under a laser confocal microscope by using an immunofluorescence technique.

Example 3 Effect of varying the expression level of LY6E on Ebola Virus infection and proliferation in a model of Ebola Virus minimal genome infected cells

1. Ebola virus minimal genome system mimicking the infection and proliferation of Ebola virus

The invention can simulate the infection and proliferation of the Ebola virus under the condition of a biological safety level secondary laboratory by using the minimum genome system of the Ebola virus. The system can be divided into two stages of P0 and P1, wherein the P0 stage needs to externally transfer a plurality of plasmids, and the transfected plasmids contain complete genome genes of the Ebola virus, so that the system can be used for researching the gene expression of the Ebola virus in host cells and finally obtaining the Ebola virus pseudovirion in a culture medium (P0 supernatant). The P1 stage is to infect host cells by using P0 supernatant containing Ebola virus pseudovirions and transfect partial plasmids containing Ebola virus genes, thereby completing the research on Ebola virus infection.

Ebola virus minimal genome P0 transfection experiment: the first day, 4X 10 of inoculum was inoculated per well in 6-well plates⁵HepG2 cells, placing the cells at 37 ℃ in CO₂The cells were incubated in an incubator for 24 hours and then transfected. The next day, the plasmids pCAGGS-NP (125 ng), pCAGGS-VP35 (125 ng), pCAGGS-VP30 (75 ng), pCAGGS-L (1000 ng), p4cis-vRNA-Rluc (250 ng) and pCAGGS-T7 (250 ng) were transfected into HepG2 cells per well. On the third day, the medium was changed to DMEM medium containing 5% FBS. And on the sixth day, collecting the P0 supernatant, freezing and storing at-80 ℃, and detecting the expression level of luciferase in the HepG2 cells.

Ebola virus minimal genome P1 infection experiments: the first day, 4X 10 of inoculum was inoculated per well in 6-well plates⁵HepG2 cells, cells were incubated at 37 ℃ in CO₂The cells were incubated in an incubator for 24h and then transfected. The next day, the plasmids pCAGGS-NP (125 ng), pCAGGS-VP35 (125 ng), pCAGGS-VP30 (75 ng), pCAGGS-L (1000 ng), and pCAGGS-Tim1 (250 ng) were transfected into HepG2 cells per well. On the third day, the medium was changed to P0 supernatant. On the fourth day, the medium was changed to DMEM medium containing 5% FBS. And on the seventh day, collecting the P1 supernatant, freezing and storing at-80 ℃, and detecting the luciferase expression quantity in the HepG2 cells.

And (3) luciferase detection: discarding the old culture medium, transferring the cells into a 1.5mL centrifuge tube by using 1mL PBS, centrifuging for 3min by using 1000g, and discarding the supernatant; adding 150 μ L of 1 XPassive lysine Buffer, standing at room temperature for 20min after resuspending cells, and then centrifuging at 12000rpm for 3min; after 40. Mu.L of the supernatant was mixed with an equal volume of Renilla Glo Reagent, the mixture was left at room temperature for 10min, and then the luciferase expression level RLU was measured.

2. Effect of varying the expression level of LY6E on Ebola Virus infection and proliferation

The expression level of LY6E in HepG2 cell is regulated by transfecting pcDNA3.1-LY6E-HA plasmid and LY6E siRNA, so as to study the influence of LY6E in host cell on Ebola virus gene expression. The experiments are divided into two groups:

first group (LY 6E over-expressed): in the case of the Ebola virus minimal genome P0 transfection experiment, the next day the P0-associated plasmid was transfected, while 1. Mu.g of pcDNA3.1-LY6E-HA plasmid was transfected per well. The control group was transfected with an equal amount of pcDNA3.1 plasmid per well. The subsequent experiment is carried out according to the transfection experiment of the minimum genome P0 of the Ebola virus, and the expression quantity of luciferase in the HepG2 cells is detected on the sixth day.

Second panel (LY 6E knockdown): in performing the ebola virus minigenome P0 transfection experiment, the following day 10 μ L of siRNA (siRNA 1 or siRNA 2) per well was transfected at the same time as the P0-associated plasmid. Controls were transfected with equal amounts of NC per well. The subsequent experiment is carried out according to the transfection experiment of the minimum genome P0 of the Ebola virus, and the expression quantity of luciferase in the HepG2 cells is detected on the sixth day.

Wherein, siRNA1 is formed by annealing the following two single strands:

LY6E-siRNA-1: a sense: 5-;

antisense: 5;

siRNA2 was formed by annealing of two single strands as follows:

LY6E-siRNA-2: sense:5 'GGACAAACTACTGCGTGACTTT-3' (SEQ ID NO: 5);

antisense:5 'AGTCACGCAGTAGTTGTCCTG-3' (sequence 6);

NC is formed by annealing of two single strands as follows:

NC：sense：5’-UUCUCCGAACGUGUCACGUTT-3’；

antisense：5’-ACGUGACACGUUCGGAGAATT-3’。

as shown in fig. 3, overexpression of LY6E promoted expression of ebola virus genes in HepG2 cells (fig. 3A), promoting ebola virus proliferation. Knock down endogenous LY6E expression in HepG2 cells with siRNA inhibited ebola virus gene expression (fig. 3B), inhibiting ebola virus proliferation.

Example 4 detection of the interaction of VP35 protein of Ebola Virus with LY6E in a minimal genome-infected cell model of Ebola Virus by the Duo-Link assay

HepG2 cells were previously seeded into 6-well plates containing sterile coverslips and cell treatment was the same as in the Ebola virus minimal genome P0 transfection experiment in example 3. The transfected HepG2 cells were fixed, perforated, blocked and primary antibody incubated according to the procedure in cell slide preparation in example 2; then 10 μ L PLA probe (probe: blocking solution =1 diluted at 50 ratio) was dropped on the coverslip, the coverslip was covered with a sealing film, incubated at 37 ℃ for 1h, cells were washed 2 times with pbs; dropping 10 μ L of ligase solution (ligase: ligase dilution =1, diluted 40) on the cover slip, covering the cover slip with a sealing film, incubating at 37 ℃ for 30min, washing cells with pbs for 2 times; 10 μ L of the amplified polymerase solution (amplified polymerase: amplified polymerase dilution =1, 80 ratio dilution) was dropped onto the coverslip and the coverslip was covered with a sealing film, incubated at 37 ℃ for 100min and washed 3 times with PBS. Finally, mounting was carried out according to the method of example 2, and the prepared cell slide was observed under a confocal laser microscope.

The results are shown in FIG. 4, and the Duo-Link experiments further demonstrate that there is interaction between VP35 protein of Ebola virus and LY6E in the minimal genomic system of Ebola virus.

Example 5 immunofluorescence detection of Co-localization of VP35 protein of Ebola Virus with LY6E in a model of Ebola Virus minimal genome infected cells

HepG2 cells were previously seeded in a 6-well plate containing a sterile cover slip, the cell treatment was the same as in the Ebola virus minimal genome P1 infection experiment in example 3, and cell slide preparation was performed according to the procedure in example 2. The prepared cell slide can be used for observing the co-localization of the Ebola virus VP35 protein and LY6E under a laser confocal microscope.

The results are shown in FIG. 5, where the VP35 protein of Ebola virus co-localizes with LY6E upon infection with Ebola virus.

Example 6 construction of LY6E knockout cell lines and detection of infection and proliferation of the minimum genome of Ebola Virus in LY6E knockout cell lines by Crispr/Cas9 technology

1. Construction of LY6E knockout cell lines

1. Construction of recombinant plasmid pSpCas9-sgRNA

1) According to LY6E gene sequence, a sgRNA target sequence and a corresponding sense strand sequence and antisense strand sequence for synthesizing the sgRNA target sequence are designed, and the specific sequences are as follows:

sgRNA-1 target sequence: 5 'GATCTTCTTGCCAGTGCTGCTGG-3' (SEQ ID NO: 7);

synthetic sense strand sequence: 5' CACCGACTTTCTTGCCAGTGCTGC-;

synthetic antisense strand sequence: 5 'AAACGCAGCACTGGCAAGAAGAAGATC-3';

sgRNA-2 target sequence: 5 'GTTGTCCTGGTCGGAGCAGATGG-3' (SEQ ID NO: 8);

synthetic sense strand sequence: 5 'CACCGTTGTCGGTCGGAGCAGA-3';

synthetic antisense strand sequence: 5 'AAACTCTCTGCTCCGACCAGGACAAC-3'.

2) And carrying out end phosphorylation and annealing reaction on the designed sgRNA of the LY6E KO cell line to obtain an annealed product.

The reaction system is as follows: LY6E-Crispr-sgRNA F (100. Mu.M) 1. Mu.L, LY6E-Crispr-sgRNA R (100. Mu.M) 1. Mu.L, T4 PNK 0.5. Mu.L, T4 Ligase Buffer 1. Mu.L, ddH₂O 6.5μL。

The annealing procedure was as follows: reaction at 37 deg.C for 30min, reaction at 95 deg.C for 5min, and cooling to 30 deg.C every 5min.

3) The pSpCas9-puro plasmid was digested to obtain a Bbs I-digested pSpCas9-puro plasmid.

The enzyme digestion system is as follows: pSpCas9-puro 1. Mu.g, bbs I1. Mu.L, 10 Xcut smart buffer 5. Mu.L, plus ddH₂O to a total volume of 50. Mu.L.

The enzyme digestion conditions were as follows: the cleavage was carried out overnight at 37 ℃.

4) The annealed product was ligated with Bbs I-digested pSpCas9-puro plasmid using T4 ligase to obtain a ligated product. The connection conditions were as follows: ligation was carried out at 16 ℃ for 30min. Then, the ligation product is transformed into escherichia coli DH5 alpha, and is evenly coated on an LB solid plate containing ampicillin for overnight culture at 37 ℃; then, single clone is picked for amplification culture, and amplified bacterial liquid is sent to a sequencing company for sequencing to obtain a recombinant plasmid pSpCas9-sgRNA (recombinant plasmid pSpCas9-sgRNA1, recombinant plasmid pSpCas9-sgRNA 2).

2. Acquisition of LY6E knockout cell lines

Inoculating HepG2 cells into a 100mm culture dish, and transfecting 5 mu g of pSpCas9-sgRNA when the cells grow to 70-90 percent of confluency; after transfection for 48h, the culture medium was changed to DMEM medium containing 4mg/mL puromycin; after about 10 days of culture, single clones were selected and grown in 24-well plates. After genome DNA of the cells subjected to amplification culture is extracted, PCR amplification is carried out by using a pre-designed sequencing primer, and an amplification product is sent to a sequencing company for sequencing to obtain LY6E knockout cell lines A11, A17, A40, B37, B49 and B69. Wherein LY6E knockout cell lines A11, A17 and A40 are obtained from sgRNA-1 target sequences, and LY6E knockout cell lines B37, B49 and B69 are obtained from sgRNA-2 target sequences.

The PCR system was as follows: 2 × Rapid Taq Master Mix 25 μ L, LY6E-Crispr-detect F2 μ L, LY6E-Crispr-detect R2 μ L, template 1.2 μ L, add ddH₂O to a total volume of 50. Mu.L.

The PCR procedure was as follows (LY 6E-Crispr-detect-1): pre-denaturation at 95 ℃ for 5min, amplification (95 ℃ 15s,64.5 ℃ 15s,72 ℃ 5s,35 cycles), final extension at 72 ℃ for 5min. LY6E-Crispr-detect-2 changes 64.5 ℃ to 47 ℃.

LY6E-Crispr-sgRNA-1F：5’-CACCGATCTTCTTGCCAGTGCTGC-3’；

LY6E-Crispr-sgRNA-1R：5’-AAACGCAGCACTGGCAAGAAGATC-3’；

Sequencing primers: LY6E-Crispr-detect-1F:5 'AGGAGTGAGGGCACCCGG + 3' (Tm66.5 ℃, GC 70%);

sequencing primer: LY6E-Crispr-detect-1R: 5-;

LY6E-Crispr-sgRNA-2F：5’-CACCGTTGTCCTGGTCGGAGCAGA-3’；

LY6E-Crispr-sgRNA-2R：5’-AAACTCTGCTCCGACCAGGACAAC-3’；

sequencing primer: LY6E-Crispr-detect-2F:5 'GGGCCTGGTATACAGTAAT-3' (Tm49.0 ℃, GC 47.4%).

Sequencing primer: LY6E-Crispr-detect-2R:5 'AGACGGCTGCAGACAGA-3' (Tm51.3 ℃, GC 58.8%).

The sequencing results are shown in fig. 6A and 6B, and indicate that: the LY6E gene in LY6E knockout cell line a11 was deleted 10 bases after 22 bases compared to the LY6E gene in wild type cells. The LY6E gene in the LY6E knock-out cell line a17 was inserted one C base after the 22 nd base compared to the LY6E gene in wild type cells. Compared with LY6E gene in wild type cells, LY6E gene knockout cell line A40 has a G base inserted after the 22 nd base of LY6E gene. The LY6E gene in LY6E knockout cell line B37 had a deletion of 13 bases after the 118 th base compared to the LY6E gene in wild type cells. The LY6E gene in LY6E knockout cell line B49 had an insertion of one G base after the 122 th base compared to the LY6E gene in wild type cells. The LY6E gene in LY6E knockout cell line B69 had a GC base substitution to 1T base after the 121 th base compared to the LY6E gene in wild type cells.

2. Detection of LY6E protein expression levels in HepG2 wild-type cells and LY6E knockout cell lines

The HepG2 wild-type cell and the LY6E KO cell line were respectively passaged to 60mm dishes, and the cells were incubated at 37 ℃ and CO₂After 48 hours of incubation in the incubator, cells were harvested and subjected to SDS-PAGE and immunoblotting as described in example 1.

As shown in FIG. 6C, the LY6E knockout cell lines A17, A40, B37 and B49 showed substantially no detectable protein expression at 17kDa after SDS-PAGE and immunoblotting compared to wild-type cells. In the A11 and B69 cell lines, a protein band still existed at 17kDa despite the frameshift mutation in the LY6E gene. LY6E knockout cell lines a17 and B49 were selected for the following experiments.

3. Detection of ebola virus minimal genome infection and proliferation in HepG2 wild-type cells and LY6E knockout cell lines

Each well was inoculated with 4X 10 cells in 6-well plates⁵HepG2 cells and LY6E KO cells (LY 6E knockout cell line A17 or B49), followed by Ebola disease according to the method of example 3Viral minigenome P0 transfection experiments and ebola virus minigenome P1 infection experiments. By detecting the expression level of luciferase in the cells, changes in ebola virus infection and proliferation can be known.

Results as shown in fig. 6D and 6E, both the infection and proliferation processes of ebola virus were significantly inhibited in LY6E KO cell line.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the technical principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> military medical research institute Anhui university of China national academy of military sciences

<120> target LY6E capable of effectively inhibiting Ebola virus infection and application thereof

<160> 8

<170> PatentIn version 3.5

<210> 1

<211> 396

<212> DNA

<213> Artificial Sequence

<400> 1

atgaagatct tcttgccagt gctgctggct gcccttctgg gtgtggagcg agccagctcg 60

ctgatgtgct tctcctgctt gaaccagaag agcaatctgt actgcctgaa gccgaccatc 120

tgctccgacc aggacaacta ctgcgtgact gtgtctgcta gtgccggcat tgggaatctc 180

gtgacatttg gccacagcct gagcaagacc tgttccccgg cctgccccat cccagaaggc 240

gtcaatgttg gtgtggcttc catgggcatc agctgctgcc agagctttct gtgcaatttc 300

agtgcggccg atggcgggct gcgggcaagc gtcaccctgc tgggtgccgg gctgctgctg 360

agcctgctgc cggccctgct gcggtttggc ccctga 396

<210> 2

<211> 131

<212> PRT

<213> Artificial Sequence

<400> 2

Met Lys Ile Phe Leu Pro Val Leu Leu Ala Ala Leu Leu Gly Val Glu

1 5 10 15

Arg Ala Ser Ser Leu Met Cys Phe Ser Cys Leu Asn Gln Lys Ser Asn

20 25 30

Leu Tyr Cys Leu Lys Pro Thr Ile Cys Ser Asp Gln Asp Asn Tyr Cys

35 40 45

Val Thr Val Ser Ala Ser Ala Gly Ile Gly Asn Leu Val Thr Phe Gly

50 55 60

His Ser Leu Ser Lys Thr Cys Ser Pro Ala Cys Pro Ile Pro Glu Gly

65 70 75 80

Val Asn Val Gly Val Ala Ser Met Gly Ile Ser Cys Cys Gln Ser Phe

85 90 95

Leu Cys Asn Phe Ser Ala Ala Asp Gly Gly Leu Arg Ala Ser Val Thr

100 105 110

Leu Leu Gly Ala Gly Leu Leu Leu Ser Leu Leu Pro Ala Leu Leu Arg

115 120 125

Phe Gly Pro

130

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 3

agagcaatct gtactgcctt 20

<210> 4

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 4

aggcagtaca gattgctctt c 21

<210> 5

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 5

ggacaactac tgcgtgactt t 21

<210> 6

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 6

agtcacgcag tagttgtcct g 21

<210> 7

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 7

gatcttcttg ccagtgctgc tgg 23

<210> 8

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 8

gttgtcctgg tcggagcaga tgg 23

Claims

1. Use of a substance which inhibits the activity of a LY6E protein or a substance which reduces the amount of a LY6E protein in any one of a 1) to a 3) as follows:

a2 Preparing a product for inhibiting ebola virus infection;

a3 To prepare a product that inhibits ebola virus proliferation.

2. Use according to claim 1, characterized in that: the substance for inhibiting the activity of the LY6E protein or the substance for reducing the content of the LY6E protein is a protein, polypeptide or small molecule compound for inhibiting the synthesis of the LY6E protein or promoting the degradation of the LY6E protein or inhibiting the function of the LY6E protein.

3. Use of a substance which silences or knocks or mutates a LY6E gene or a substance which inhibits the expression of a LY6E gene in any of the following a 1) to a 3):

a2 Preparing a product for inhibiting ebola virus infection;

a3 To prepare a product that inhibits ebola virus proliferation.

4. Use according to claim 3, characterized in that: the substance inhibiting the expression of the LY6E gene is siRNA inhibiting the expression of the LY6E gene.

5. Use according to claim 4, characterized in that: the siRNA for inhibiting the expression of the LY6E gene is siRNA formed by annealing two single strands shown in a sequence 3 and a sequence 4 or siRNA formed by annealing two single strands shown in a sequence 5 and a sequence 6.

6. Use according to claim 3, characterized in that: the substance for knocking out LY6E gene is CRISPR/Cas9 gene editing system for knocking out LY6E gene.

7. Use according to claim 6, characterized in that: the sgRNA target sequence in the CRISPR/Cas9 gene editing system for knocking out LY6E gene is sequence 7 or sequence 8.

The application of LY6E as a target in any one of the following c 1) -c 3):

c1 ) preparing a product for treating or adjunctively treating ebola virus disease;

c2 Preparing a product for inhibiting ebola virus infection;

c3 To prepare a product that inhibits ebola virus proliferation.