KR20170106473A - Enterovirus 71 animal model - Google Patents

Abstract

The present invention relates to the development of enterovirus 71 (EV71), animal models and screening for candidate anti-EB71 compounds. More specifically, the present invention relates to the discovery that enterovirus 71 (EV71) strains adapted to infect rodent cell lines or clone-derived viruses containing mutations in VP1 can cause disease in immune-competent rodents.

Description

Enterovirus 71 animal model

Cross-reference to related application

This application is related to and claims priority to U.S. Provisional Patent Application No. 62 / 114,880, filed February 11, 2015, and U.S. Provisional Patent Application No. 62 / 108,828, filed January 28, 2015, . Each application is incorporated herein by reference.

Submission of Sequence Listing

The present application has been filed with a sequence listing in electronic form. This sequence listing is named 2577243PCTSequenceListing.txt and was created on December 29, 2015, with a size of 32 kb. The electronic form of the sequence listing is herein incorporated by reference in its entirety.

The present invention relates to Enterovirus 71 (EV71), the development of animal models and the screening of candidate anti-EV71 compounds.

Publications and other materials have been used herein to describe the background of the present invention, and in particular, examples providing additional details relating to implementation are incorporated by reference, and for convenience reference, the author and date are referenced, The authors are listed in alphabetical order.

Enterovirus 71 (EV71) is a small non-enveloped virus with a diameter of about 30 nm. The viral capsids represent icosahedral symmetry and consist of 60 identical units (protomers), each consisting of four viral structural proteins VP1-VP4. The capsid encapsulates the core of a single-stranded positive-sense RNA genome of 7,450 nucleotides (nt) in length. The genome contains a single open reading frame encoding 2193 amino acids (aa) of polyprotein and contains 745 nt long 5 'untranslated A tract that is flanked by the untranslated region (UTR) and a shorter 3 'UTR of 85 nt and variable in its 3'terminus, Respectively. The polyprotein is divided into three regions: P1, P2 and P3. P1 encodes the four viral structural proteins 1A-1D (VP4, VP2, VP3 and VP1); P2 and P3 encode seven non-structural proteins 2A-2C and 3A-3D [1-3]. The phylogenetic analysis of the major capsid protein (VP1) gene divides EV71 into six genotypes (denoted as A to F) [66] and genotypes B and C are subgenotypes B1 To B5 and C1 to C5 [3].

EV71 has been used in infants and children, including hand, foot and mouth disease (HFMD), aseptic meningitis, encephalitis and poliomyelitis-paralysis. Resulting in various clinical diseases [4, 5]. First, the virus has been isolated from children suffering from acute encephalitis in California in 1969, followed was characterized by a new serotype (serotype) in 1974 enterovirus genus (genus Enterovirus) [6]. The incidence and mortality of HFMD with or without neurological complications has been reported worldwide [7-20]. Since 1997, EV71 infection has become a major burden on public health in the Asia-Pacific region and has created sustained epidemic concerns. Highly neurovirulent EV71 caused HFMD in Malaysia, resulting in 48 deaths in 1997 [21, 22], followed by more than 129,000 cases of HFMD in Taiwan in 1998, 405 severe infections, And 78 cases of death due to acute brainstem encephalomyelitis with neurogenic cardiac failure and pulmonary edema [23-26]. In China, 488,955 HFMD cases, including 126 deaths, were reported in 2008 [27] and increased to 1,155,525 cases in 2009, including 353 deaths [28]. In 2010, China experienced more than 1,700,000 more HFMD outbreaks, 27,000 patients had severe neurological complications, and 905 died [29].

Similar to other human enteroviruses, although rhesus monkeys and cynomolgous monkeys can be infected experimentally [30-32], EV71 can not infect non-human animals. This is because EV71 binds inefficiently to its receptors for entry into uncoated and mouse cells. It has recently been identified as a Scavenger Receptor Class B Member-2 (SCARB2) protein [47]. Since human and murine SCARB2 proteins exhibit only 84% amino acid sequence identity, they exhibit significant structural differences [49, 67], and therefore, non-human cells for EV71 infection Trigger virus-receptor incompatibility based on natural tolerance. Once the virus successfully binds to the SCARB2 receptor on the cell surface and removes the coating on the cytoplasm, the viral RNA is translated and various viral non-structural proteins are expressed. The viral RNA is then replicated, packaged in capsids, and released into the environment to re-infect healthy cells.

Understanding the pathogenesis of these viruses and the development of specific therapeutic agents has been hampered by the lack of suitable small animal models because EV71 can not naturally infect small rodents. Attempts to establish a mouse model with EV71 infection and disease have been made primarily through virus adaptation by serial passages in young infant mice [33-39]. Some models have been able to reproduce the symptoms of clinical disease, but none have been reported to cause disease in immuno-competent mice over two weeks of age. Moreover, the clinical features of the disease and pathology of EV71 infection in human and experimental monkeys can not be replicated in mice, except for immunocompromised interferon receptor-deficient AG129 mice [35] . More recently, transgenic mice expressing human PSGL-1 [68] and human SCARB2 [69, 70] proteins have been used, but they have shown only minimal improvement in susceptibility to EV71 infection .

RNA virus replication as a bunch (swarm) of mutant sequences associated with similar known species (quasispecies) by error-prone replication (error-prone replication) and a high mutation rate (mutation rates) to the [40-42] 43, 44]. This consists of a mutant spectrum consisting of a closely related variant sequence ensemble with a certain probability distribution and a master species representing the highest fitness in a particular environment [44, 45]. They confer genome plasticity on the RNA virus, reflecting the ability to adapt quickly to changing environments.

Experiments involving Rhesus monkeys and Filipino monkeys [114-120], laboratory mice [112, 121-129], and other mammals [130-133], as the mechanism by which EV71 infection causes a fatal neurological disease is not fully understood Several studies have attempted to reproduce the pathology of human infections in animals. Unfortunately, none of the above models showed any spectrum of neurological characteristics due to acute brain encephalitis accompanied by neurogenic pulmonary edema (NPE) observed in humans [21,22, 134-137]. Indeed, even in experimental systems that more accurately replicate the signs and symptoms of EV71 infection in humans, the underlying mechanism is substantially different from the mechanism that causes disease in human patients. To date there has been no single animal model that replicates EV71-induced NPE reliably. The main difference is that EV71 is restricted to CNS tissues in human patients [92-94, 111], whereas in animal models, the virus is associated with non-neurons including skeletal muscles [33-36, 38, 98] and liver [119] Tissue. ≪ / RTI > Efforts have been made to create transgenic mice expressing the human EV71 receptor protein PSGL-1 (P-selectin glycoprotein ligand-1) and SCARB2 (S 66 cavenger Receptor Class B, member 2) [68-70, 47, , None of the models presented NPE, and therefore its usefulness in identifying new interventions for human patients is limited.

There was no suitable animal model that could be used to study infection and disease progression in EV71 infected animals or to screen for anti-viral compounds or anti-viral vaccines. It was required to develop an animal model for this purpose.

The present invention relates to Enterovirus 71 (EV71), development of animal models, and screening for candidate anti-EV71 compounds. More specifically, the invention relates to an enterovirus 71 (EV71) strain adapted to infect rodent cell lines, or a clone-derived virus comprising a mutation in VP1, capable of causing disease in immune-competent rodents and immune-compromised rodents .

The present invention also relates to a method of treating EV71- induced neurological diseases clinically by infecting BALB / c mice with a modified strain (e.g., EV71: TLLmv ) adapted to infect NIH / 3T3 mouse fibroblasts To the development of a clinically authentic model. Using this approach, the modified EV71 is used in mice to induce acute encephalomyelitis associated with neurogenic pulmonary edema, which results in lung swelling and increased organ weights, as compared to mock-infected lungs (organ weight). Despite the absence of pulmonary or cardiac tissue inflammation, focal hemorrhage and proteinaceous fluid in alveoli, catecholamines at high serum levels, and brain stem, especially medulla oblongata, Extensive tissue damage was observed. It has been demonstrated in the data that the model correctly reproduces the symptoms and symptoms of human EV71-induced neurogenic pulmonary edema.

Therefore, in one aspect, the present invention relates to an animal model comprising a rodent infected with enterovirus 71 that is capable of infecting rodents, sometimes referred to herein as the modified Enterovirus 71. In one embodiment, the Enterovirus 71 is a rodent cell line adapted Enterovirus 71. In another embodiment, the Enterovirus 71 is a clone derived virus (CDV) comprising a mutation in VP1. In some embodiments, the mutation in VP1 allows the CDV to use the rodent SCARB2 protein to infect rodent cells. In one embodiment, the rodent is an immunologically-qualifying rodent. In another embodiment, the rodent is an immuno-compromised rodent. Suitable animals for use as models are preferably mammalian animals, most preferably convenient laboratory animals such as rabbits, rats, mice, and the like. In one embodiment, the animal is a mouse. In some embodiments, the mouse is a BALB / c mouse. In another embodiment, the rodent cell line is a mouse cell line. In a further embodiment, the mouse cell line is a mouse NIH / 3T3 cell line. In another embodiment, the mouse cell line is a mouse Neuro-2a cell line. In one embodiment, the rodent cell line adapted adenovirus 71 is EV71: TLLm . In another embodiment, the rodent cell line adapted enterovirus 71 is EV71: TLLmv . In one embodiment, the clone-derived virus comprising a mutation in said VP1 CDV: BS _VP1 [K98E / E145A / L169F] . The animal model is useful for studying systemic spread of virus and human disease spectrum in animal models. The animal models are also useful for screening antiviral drugs and vaccines.

In another aspect, the invention provides a method of producing an animal model having a full-spectrum EV 71 -induced neural system infection, disease and pathology observed in humans. In some embodiments, the method comprises infecting the rodent disclosed herein with the modified Enterovirus 71 disclosed herein, and raising the infected rodent for up to about 4 weeks. In some embodiments, the age of the infected rodent is from about one week old to about four weeks old. In another embodiment, the infected rodent is bred for about 1 week to about 4 weeks. In some embodiments, the rodent is the mouse disclosed herein. In another embodiment, the rodent is infected with the modified Enterovirus 71 by inoculating the rodent. In one embodiment, the inoculation is intraperitoneal (IP) inoculation. In another embodiment, the inoculation is intramuscular (IM) inoculation. In some embodiments, it said viral dose (dose) of about 10 ³ to the middle cell culture infective dose of about 10 ⁷ inoculated with the rodents: the _{(median cell culture infectious dose CCID 50} ).

In a further aspect, the invention provides a method of screening for an antiviral drug. According to this aspect, the method comprises the following steps: providing a control group of animals and a control group of animals, wherein each group of animals is an animal of the animal models disclosed herein; Administering the antiviral drug candidate to the test group; Monitoring a disease progression in the test group and the control group; Comparing the disease progression in the test group with the disease progression in the control group; And selecting an antiviral drug candidate that reduces disease progression in the test group compared to the control group. In one embodiment, the antiviral drug is first screened in a test rodent cell line infected with rodent cell line adapted adenovirus 71, before screening in the animal. In another embodiment, the antiviral drug is first screened in a test rodent cell line infected with a clone-derived virus (CDV) containing a mutation at VP1, prior to screening in the animal.

In a further aspect, the invention provides a method of screening for an effective antiviral vaccine. According to this aspect, the method comprises the steps of: providing a test group of animals and a control group of animals, wherein each group of animals is an animal of the animal models disclosed herein; Administering the antiviral vaccine candidate to the test group; Monitoring disease progression in the test group and the control group; Comparing the disease progression with the disease progression in the control group in the test group; And selecting an antiviral vaccine candidate that reduces disease progression in the test group compared to the control group. In one embodiment, the antiviral vaccine candidate is first screened in a test rodent cell line infected with rodent cell line adapted adenovirus 71, before being screened in the animal. In another embodiment, the anti-viral vaccine candidate is first screened in a test rodent cell line infected with a clone-derived virus (CDV) containing a mutation at VP1, prior to screening in the animal.

1A-1O show cytopathic effects (CPE) observed after viral infection of various primate cell lines. 1B, 1E, 1H, 1K and 1N) or EV71: TLLmv (Figures 1C, 1F, 1I, 1L and 1O) 1D), HEO-2 cells (Fig. 1G-1I), Vero cells (Fig. 1J-1L), and COS-7 cells (Fig. 1M-10) was observed at 48 hpi for the cytopathic effect or death of the cell monolayer. The images show the results in three independent experiments.
Figures 2A-2O show viral antigen detection in cell lines infected with EV71: BS, EV71: TLLm and EV71: TLLmv. 2E-2L, NRK (Fig. 2J-2L), and TCMK (Fig. 2M-2F), CHO- 2O) were infected with 1 MOI of each virus. Cells were harvested at 48 hpi, coated on Teflon slides, and fixed in cold acetone. Cells were incubated with pan-enterovirus antibody Probed and stained with FITC-conjugated anti-mouse IgG. The images represent two independent experiments.
Figures 3A-3D show the growth kinetics of EV71: BS , EV71: TLLm , and EV71: TLLmv determined in NIH / 3T3 and Vero cells. Supernatants from various mammalian cells infected with 1 MOI of each virus were harvested at various time points, titrated, and enumerated using the Reed and Muench method. Figure 3A: EV71: BS virus titer determined in Vero cells. Figure 3B: EV71: TLLmv viral titers determined in NIH / 3T3 cells. Figures 3C and 3D: EV71: TLLm virus titers determined in NIH / 3T3 cells. Growth curves were not initiated from cell lines that did not exhibit productive infection.
Figures 4A-4O show the cytopathic effect (CPE) observed with viral infection of various rodent cell lines. EV71: BS (Fig. 4A, 4D, 4G, 4J and 4M), EV71: the TLLmv (Fig. 4C, 4F, 4I, 4L and 4O) virus: TLLm (Fig. 4B, 4E, 4H, 4K and 4N), or EV71 (Fig. 4A-4C), Neuro-2A cells (Fig. 4D-4F), TCMK cells (Fig. 4G-4I), CHO-K1 cells NRK cells (Fig. 4M-4O) were observed at 48 hpi for cytotoxic effects or death of cell monolayers. The images show the results in three independent experiments.
Figures 5A-5D show the virus assessment fitness of EV71: BS , EV71: TLLm , and EV71: TLLmv in NIH / 3T3 determined by the titer ratio. Virus titers determined individually in NIH / 3T3 and Vero cells were used to calculate virus adaptation to log [(titer at NIH / 3T3 cells) / (titer at Vero cells)]. (Fig. 5A) EV71: BS , (Fig. 5B) EV71: TLLmv and (Fig. 5C and 5D) EV71: TLLm were calculated from the virus titers shown in Figs. 3A-3D. No virus adaptation assays obtained from cell lines that do not exhibit proliferative infection have been disclosed.
Figures 6A and 6B show transfection of NIH / 3T3 by EV71: BS viral RNA to induce a proliferative infection. Overnight seeded NIH / 3T3 and Vero cells were inoculated with virus supernatants harvested from NIH / 3T3 cells already transfected with viral RNA extracted from EV71: BS , EV71: TLLm , and EV71: TLLmv . 6A: Cells were imaged at 24 hpi using an inverted light microscope and induced CPE was observed. Figure 6B: Cells were harvested at 7 dpi, coded on a Teflon slide, probed with plate-enterovirus antibody, and stained with anti-mouse FITC-conjugated antibodies.
Figures 7A and 7B show virus adaptability ratings of EV71: BS , EV71: TLLm , and EV71: TLLmv in NIH / 3T3 and Vero cells at 30 ° C. EV71: BS (Fig. 7A) NIH / 3T3 and (Fig. 7B) seeded infected with the viruses (panels a, d, g), EV71: TLLm (panel b, e, h), or EV71: TLLmv Vero cells were incubated at 30 ° C and observed under an optical microscope with phase contrast at 24 hpi (panel ac), 48 hpi (panel df), and 72 hpi (panel gi). The obtained images represent two independent experiments.
Figures 8A and 8B show virus adaptability ratings of EV71: BS , EV71: TLLm , and EV71: TLLmv in NIH / 3T3 and Vero cells at 37 ° C. EV71: NIH / 3T3 seeded overnight (Fig. 8A) infected with BS (panels a, d, g), EV71: TLLm (panel b, e, h), or EV71: TLLmv 8B). Vero cells were incubated at 37 占 폚 and observed under an optical microscope with a retardation at 24 hpi (panel ac), 48 hpi (panel df), and 72 hpi (panel gi). The obtained images represent two independent experiments.
Figures 9A and 9B show virus adaptability ratings of EV71: BS , EV71: TLLm , and EV71: TLLmv in NIH / 3T3 and Vero cells at 39 占 폚. EV71: NIH / 3T3 seeded (Fig. 9A) infected with BS (panels a, d, g), EV71: TLLm (panel b, e, h) or EV71: TLLmv 9B). Vero cells were incubated at 39 DEG C and observed under an optical microscope with a retardation at 24 hpi (panel ac), 48 hpi (panel df), and 72 hpi (panel gi). The obtained images represent two independent experiments.
Figures 10A-10L show the transfection of murine cell lines NIH / 3T3, Neuro-2A, and TCMK by EV71: BS viral RNA for the demonstration of viral replication. Overnight seeded NIH / 3T3, Neuro-2A, and TCMK cells are infected with 1000 CCID ₅₀ of EV71: BS virus (FIGS. 10A, 10C, and 10E), or with equivalent amounts of viral RNA 10B, 10D, and 10F) and harvested at 48 hpi for viral antigen detection. Viruses in the supernatant were harvested at 7 dpi and plated on new Vero (Figures 10G, 10I, and 10K) and NIH / 3T3 cells (Figures 10H, 10J, and 10L). Cells were harvested and stained at 48 hpi for virus antigens.
Figures 11A-11D show localization in VP1 and VP2 of adaptive mutations in the genomes of EV71: TLLm and EV71: TLLmv . 11A and 11B) and VP2 (Figs. 11C and 11D) of EV71: TLLm (Figs. 11A and 11C) and EV71: TLLmv (Figs. 11B and 11D) were observed in DeepView / SwissPDBviewer v3.7 and EV71 The 3D structure of the capsid P1 region (PDB ID 4AED) was modeled. It has been observed that mutations are mostly localized in surface-exposed loops of proteins as disclosed.
Figure 12 shows the potency ratio in NIH / 3T3 cells for titer in Vero cells of virus supernatants harvested from cells infected with EV71: BS viral RNA or infected with live virus. The supernatants were harvested from NIH / 3T3, Neuro-2A, Vero, and TCMK transfected with viral RNA or infected with live virus, and enumeration was performed by the Reed-and-Muench method. The ratio of the determined log (potency) in NIH / 3T3 cells to the determined titer in Vero cells was initiated: 3T3-TRANS: RNA transfected NIH / 3T3 cells; 3T3- INF: virus-infected NIH / 3T3 cells. Asterisks represent Student's t-test with a p-value < 0.05.
Figures 13A and 13B show survival analysis of infected animals. Infected animals were observed and body weight was measured daily. 13A: Kaplan-Meier plot of infected animals showing the number of deaths at various days after infection. Figure 13B: Weight change was plotted to determine general health of the animal.
Figures 14A-14D show the symptoms and pathology of infected animals. Most infected animals show signs of disease. 14A: Paralysis of the hind limbs (arrow). Fig. 14B: Gross anatomy of the lungs expanded after autopsy (arrow). Tissue sections were also stained with Hematoxylin and Eosin staining (Figure 14C 10x and Figure 14D 20x). The black arrows represent the mucous material that penetrates the alveolar space.
15A-15E show that live virus is obtained by transfection of viral genomic RNA into both primate and rodent cells. 15A: Genomic RNA extracted from EV71: BS , EV71: TLLm , or EV71: TLLmv was individually transfected with Vero, NIH / 3T3, and Neuro-2a cells (P0). Transfection supernatants were harvested and inoculated on Vero or NIH / 3T3 cells (P1) to assess the viability of the virus progeny. Infection of P0 cells was evaluated by observation of cytopathic effect (CPE) (Fig. 15B) and immunofluorescence detection of virus antigen (Fig. 15C). Similarly, infection of P1 cells from EV71: BS RNA-transfected cells was assessed by CPE induction (Figure 15D) and immunofluorescence detection of the expressed viral antigen (Figure 15E).
16A-16F show that the capsid-encoding region of mouse cell-adapted EV71: TLLm induces a proliferative infection of mouse cells by EV71: BS . 16A: EV71: an infectious cDNA clone of the full-length genome of BS was generated, and the P1 region was replaced with the sequence from the EV71: TLLm capsid to generate a chimeric virus, EV71: BS [M-P1] . 16B: The cells were infected with a clone-derived virus (CDV) from EV71: BS or EV71: BS [M-P1] and the infection was induced by induction of lytic cytopathic effect (CPE) 16D). &Lt; / RTI &gt; The supernatants were re-inoculated onto fresh cells and virus titers were measured from passage P1 of NIH / 3T3 (3T3) and Neuro-2A (N2a) cells as well as passages P1 and P2 obtained from infected Vero ). Error bars indicate SD. * p < 0.05.
Figures 17A-17G show that VP1-L169F amino acid substitution in the capsid is sufficient to enter EV71: BS into murine cells. 17A: Variant variant cDNA clones were identified as VP1: K98E, E145A, and L169F; And VP2: amino acid substitutions at S144T and K149I; Was generated by incorporation into the full-length EV71: BS genome. Mutations corresponding to amino acid substitutions are listed in parentheses. Infection of various cell lines with clone-derived virus (CDV) was monitored by evaluating the induction of lytic cell degenerative effects (CPE) (Figures 17B and 17C) and the expression of viral antigens (Figures 17D and 17E). Viral titer from infected Vero cells (Figure 17F) and NIH / 3T3 and Neuro-2a cells (Figure 17G) was determined to evaluate the generation of viable offspring. The error bar represents SD.
Figures 18A-18E showed that the EV71: BS virus with the combined VP1 amino acid substitutions in the capsid exhibited enhanced infection in mouse cells. 18A: Various variant cDNA clones were generated by incorporating a combination of amino acid substitutions in VP1 and VP2 into the full-length EV71: BS genome. Mutations corresponding to amino acid substitutions are listed in parentheses. (Fig. 18B), viral antigen expression (Fig. 18C), and infected Vero (Fig. 18D), and NIH / 3T3 (3T3) and Neuro-2a (N2A) cells (Figure 18E). No other clones without virus yield were started. The error bar represents SD.
19A-19C show that the EV71: BS virus with the combined VP1-K98E, E145A, L169F amino acid substitutions in the capsids can be stably transduced in the mouse neural cell line Neuro-2a. The clone-derived virus was transfected twice in Neuro-2a and NIH / 3T3 cells. In each passage, infection was monitored by evaluation of viral antigen expression (Fig. 19A) and viral titers measured in Vero cells (Fig. 19B). The error bar represents SD. * p &lt;0.05; ** p &lt;0.005; *** p < 0.0005. Figure 19C: Genomic sequence of representative CDV: BS _VP1 [ K98E / E145A / L169F ] was determined to evaluate the evidence of amino acid substitutions K98E (A2734G), E145A (A2876C), and L169F (C2947T). The mutation sites are marked with an asterisk.
20A-20F disclose that EV71: TLLmv uses SCARB2 to infect both primate and murine cells. Preincubation of NIH / 3T3 cells (Figure 20A) and Vero cells (Figure 20B) immobilized on a Teflon slide with murine SCARB2 (mSCARB2) antiserum was inhibited by EV71: TLLmv It inhibits binding. Fluorescence intensity on the membrane was measured using Imaris imaging software (n = 100). NSP (Non-specific rabbit serum). Preincubation of recombinant soluble proteins of mSCARB2 (Figure 20C) or human SCARB2 (hSCARB2) (Figure 20D) and EV71: TLLmv prior to inoculation on NIH / 3T3 cells, as assessed by immunofluorescence analysis, . EV71: Pre-incubation of live NIH / 3T3 cells with hSCARB2 (Figure 20E) or mSCARB2 (Figure 20F) antisera before infection with TLLmv reduced viral titer in culture supernatants. * p &lt;0.05; ** p &lt;0.005; *** p < 0.0005.
Figures 21A-21D show that incubation of murine SCARB2 rabbit antiserum and Neuro-2A cells reduces the severity of infection by CDV variants. Infectious severity in cells pre-incubated with rabbit mSCARB2 antiserum before infection with CDV: BS _VP1 [K98E / E145A / L169F] (Figures 21A and 21B or CDV: BS [M-P1] (Figures 21C and 21D) (P < 0.05) ** p < 0.005 (Figure 21A and 21C) and by evaluating the virus yield (Figures 21B and 21D) The degree of CPE : 1 (0-25% cell death), 2 (25-50%), 3 (50-75%), 4 (75-100%).
Figures 22a-22c show that EV71: TLLmv is the most fatal of the three strains of the transformed virus, as evidenced by induction of severe disease in 1 week old BALB / c mice. 22a: collected from infected (intraperitoneal; IP) mice with EV71: BS (n = 6), EV71: TLLm (n = 5) or EV71: TLLmv (n = 7) as assessed at the end of the observation period Neutralizing antibody titers in serum. Figures 22b and 22c: Inoculation with 10 ⁶ CCID ₅₀ (medium cell culture infectious dose) of EV71: BS , EV71: TLLm , or EV71: TLLmv via the IP path (Figure 22b) or the intramuscular (IM) Kaplan-Meier Survival Curve of Mouse. Statistical significance was determined using Welch's modified t-test (Figure 22a) or Mantel-Cox log-rank test (Figures 22b and 22c) for unequal variance. * p < 0.05, ** p < 0.005, *** p < 0.0005.
Figures 23A- 23H show that EV71: TLLmv infection in mice is characterized by acute severe disease similar to the human disease spectrum. Figures 23a and 23b: EV71: TLLmv Dose-dependent lethality of the infection. Figure 23a: EV71: Kaplan-Meier survival curves of IP injected 6-day-old pups at various doses of TLLmv . Figure 23b: Median humane endpoint (HD50) corresponds to a viral load of 3.98 x 10 ³ CCID ₅₀ . Figure 23c: Kaplan-Meier survival curves of 1 week old mice inoculated with EV71: TLLmv by IP or IM route. 23d: EV71: TLLmv in mice inoculated with 10 ⁶ CCID ₅₀ viruses Age- and path-dependent mortality caused by infection. Figures 23e and 23f: Clinical manifestations observed in terminally-ill mice, some of which represent paralysis of the hind legs (gray arrows) and / or forelaws, and others also represent minor paralysis lesions in the torso lesions (black arrow). Figures 23g and 23h: Disease classification of 1 week old mice inoculated with EV71: TLLmv by the IP path (Figure 23g) or the IM path (Figure 23h).
Figures 24A-24E show that the severity of EV71: TLLmv infection in BALB / c mice depends on host age, viral load and administration route. 24a and 24b: Groups of 8-10 mice were inoculated with 10 ⁶ CCID ₅₀ viruses by IP pathway (Fig. 24a) or IM pathway (Fig. 24b), and Kaplan- Meier survival curves were obtained from animals of other age groups . Figures 24c and 24d: At the end of the observation period from mice of various ages inoculated by the IP path (Figure 24c) or the IM path (Figure 24d); (N = 4, n = 6), and four weeks (n = 4; n = 6) Neutralization of antibody titers in serum collected from. 24e: various capacities of EV71: TLLmv ; Antibody titer collected from (IP) mice inoculated with CCID50 102 (n = 5), 103 (n = 4), 104 (n = 4), 105 (n = 5), or 106 Neutralization of. Statistical significance was determined by a t-test with Mantel-Cox log-rank tests (Figures 24a and 24b) or Welch's correction for heterospermicity (Figures 24c, 24d and 24e). * p < 0.05, ** p < 0.005, *** p &lt; 0.0005.
25a-25k show symptoms of EV71-induced neurogenic pulmonary edema (NPE) in Class IA mice. (Fig. 25A), or disease class IA (Fig. 25B), class IB (Fig. 25C), or EV71 representing the symptoms of class II (Fig. 25D) : TLLmv Representative visual pathology of lungs obtained from infected mice. The image shows a top view and a side view. Notice clearly the incomplete collapse of the lung in FIG. 25B (white arrow). 25e: mice infected with an infected mouse (n = 4), or disease class IA (n = 8), class IB (n = 9), or EV71: TLLmv representing symptoms of class II (n = 4) - wet weight comparisons of lungs harvested from infected mice. (Fig. 25f) or a disease class IA (Fig. 25g), a class IB (Fig. 25b) (Fig. 25h), or EV71: TLLmv - representing the symptoms of class II (Fig. 25i) - low magnification and high magnification images of lungs obtained from infected mice. Note the presence of pink proteinaceous fluid in the alveolar space (star in Figure 25g, high magnification), and some were also filled with erythrocytes (gray arrow in Figure 25g, high magnification). 25j and 25k: infected mice (n = 9), or disease class IA (n = 8), class IB Serum levels of adrenaline / epinephrine (Fig. 25j) and noradrenaline / norepinephrine (Fig. 25k), as determined in the EV71: TLLmv -infected mice showing the symptoms of nervosa (n = 9) or class II (n = 3). Error bars represent SEM . Statistical significance was determined by a t-test (Fig. 25j and 25k) and a Mann-Whitney test (Fig. 25e) with Welch's correction for heteroscedasticity. * p &lt; 0.05, ** p &lt; 0.005.
Figures 26a and 26b show the absence of viral replication or inflammation in lung and heart tissue of class IA mice. 26a: EV71: derived from various groups of mice infected with TLLmv , stained with hematoxylin and eosin (H & E) for histopathological examination, or rabbit serum against EV71 antigen (EV71 IHC) A representative image of the lung tissue section (5 탆) labeled with use. 26b: Representative image of cardiac tissue section (5 占 퐉) treated with H & E and EV71 IHC.
Figures 27a-27d show representative maps showing the location and distribution of EV71 antigen and virus-induced lesions in different regions of class IA and class IB mouse brain. The cerebellar cortex (CTX) (Figs. 27A, 27B and 27C); Hypothalamus: HY (Figs. 27A and 27B); Hippocampus: HP (Figures 27b and 27c); Thalamus: TH (Fig. 27B); Midbrain (MB) and pons (P) (Figure 27c); And cerebellum (CBX) and medulla oblongata (MY) (Figure 27d). Viral antigens and regions in which pathological lesions were detected were thus indicated. The larger the point, the greater the signal / lesion size. Template images were downloaded from brainstars.org1 and licensed in Japan Creative Commons. The coronal section maps were obtained from an interactive mouse brain map (http colon slash slash mouse dot brain-map dot org slash static slash atlas) [113].
Figures 28a-28n show that EV71: TLLmv infection in mice is associated with nerve tissue destruction and extensive viral replication. 28a-28l: Representative images of brain tissue sections (5 占 퐉) stained with hematoxylin and eosin (H & E) or immunostained with rabbit serum against the EV71 antigen (EV71 IHC). Disease Class IA (left panel), or Class IB (Right panel). &Lt; / RTI &gt; In the brain pathological lesions edema (broken line box (dashed boxes)), infiltration cell (infiltrating cells) (left upper quadrant of the left side panel (upper left quadrant) diagonal portions (diagonal area) and a right lower quadrant (lower right of Fig. 28k in neuronophagia (in the left panel of Figs. 28a-28c), neurodegeneration ( black asterisks ), and denaturation of Purkinje cells ( gray asterisks ). (Figures 28m and 28n: Disease Class IA (Figure 28m) or Class IB (Fig. 28n), representative maps of spinal cord coronal sections from the mouse. Viral antigens and areas where pathological lesions were detected were highlighted. The larger the point size, the wider the signal / lesion appeared. V , ventral side; D , dorsal side.
29a-29c showed EV71 antigen and virus-induced lesions in different parts of the hindbrain of class IA mice. 29a: Representative image of a dentate nucleus stained with rabbit serum against EV71 antigen (EV71 IHC) against hematoxylin and eosin (H & E) and viral antigen location for histopathological examination. The box part was enlarged and displayed on the inserted part. Figure 29b: Representative image of a caudal brainstem from a Class I mouse. The images represent the cerebellum cortex (CBX) and soft tissue (MY). The area prostrema (AP) and the nucleus of the solitary tract (NTS) were also labeled for reference. Viral antigens and areas where pathological lesions were detected were noted. The larger the point, the larger the signal / lesion size. The template image was downloaded from brainstars.org1 and licensed to Japan Creative Commons. The brain tissue coronal cross-sectional map was obtained from a mouse brain map (http colon slash slash mouse dot. Brain-map dot org slash static slash atlas) [113]. Figure 29c: Representative image of a medulla from a class IA mouse showing H & E and EV71 IHC staining patterns in AP and NTS.
Figures 30a-30f depict a histological section of neural tissue from an infected mouse (healthy control group). Representative image of normal mouse tissue fragment (5 쨉 m) stained with rabbit serum for hematoxylin and eosin (H & E) for histopathological examination or EV71 antigen (EV71 IHC) for viral antigen location. The brain section is composed of CA3 pyramidal neurons (Figure 30a) in the hippocampus; Reticular neurons in the hypothalamus (Figure 30b) and thalamus (Figure 30c); Neurons in periaqueductal gray matter (Figure 30d); Purkinje cell layer in the cerebellum cortex (Fig. 30e). Cell form in normal Purkinje (black star in left panel of FIG. 30e); And rectangular neurons in training (Figure 30f).
Figures 31a-31e show EV71: TLLmv -induced pathology and viral antigen distribution in different neural tissues. Representative images of mouse tissue sections (5 탆) stained with rabbit sera against EV71 antigen for hematoxylin and eosin (H & E) or immunohistochemical analysis (EV71 IHC) for histopathological examination. EV71: TLLmv - brain tissue was obtained from infected or infected mice. The cranial coronary cross section includes motor cortex pyramidal neurons (Fig. 31a); Pontine gray neurons (Figure 31b); And a cervical tubular section from the cervical (Fig. 31c), thoracic (Fig. 31d), and lumbar columns (Fig. 31e). Note that cellular infiltrate (lower right quadrant of the left panel of Fig. 31a) and neuronal necrosis (black asterisk in the second panel of Fig. 31a) appear in the motor cortex. 31C-31E, the box portion is enlarged and displayed at each inserted portion.

The present invention relates to Enterovirus 71 (EV71), development of animal models, and screening for candidate anti-EV71 compounds. More specifically, the present invention is based on the discovery that enterovirus 71 (EV71) strains adapted to infect rodent cell lines or clone-derived viruses containing mutations in VP1 can cause disease in immune-competent rodents and immuno- . The EV71 strain is sometimes referred to herein as the Enterovirus 71 modified herein.

The present invention also provides a method of treating a neurological disorder characterized by the use of a clinically validated model of an EV71-induced neurological disease by infecting a BALB / c mouse with a modified strain (e.g., EV71: TLLmv ) adapted to infect NIH / 3T3 mouse fibroblasts &Lt; / RTI &gt; Using this approach, the modified EV71 is used in mice to induce acute encephalomyelitis associated with neurogenic pulmonary edema, which is characterized by pulmonary swelling and increased tracheal weight compared to an infected lung. Despite the absence of pulmonary or cardiac tissue inflammation, focal hemorrhage and proteinuria in the alveoli, catecholamines at high serum levels, and extensive tissue damage in the brainstem, especially in the soft tissue, have been observed. The data demonstrate that the model accurately reproduces the symptoms and symptoms of human EV71-induced neurogenic pulmonary edema.

Therefore, in one aspect, the present invention relates to an animal model comprising a rodent infected with enterovirus 71 that is capable of infecting rodents, sometimes referred to herein as the modified Enterovirus 71. In one embodiment, the modified enterovirus 71 is a rodent cell line adapted enterovirus 71. In another embodiment, the modified enterovirus 71 is a clone-derived virus (CDV) comprising a mutation in VP1. In some embodiments, mutations in the VP1 can cause CDV to use the rodent SCARB2 protein to infect rodent cells. In one embodiment, the rodent is an immunologically-qualifying rodent. In another embodiment, the rodent is an immuno-compromised rodent. Suitable animals for use as models are preferably mammalian animals, most preferably convenient laboratory animals such as rabbits, rats, mice, and the like. In one embodiment, the animal is a mouse. In another embodiment, the rodent cell line is a mouse cell line. In a further embodiment, the mouse cell line is a mouse NIH / 3T3 cell line. In another embodiment, the mouse cell line is a mouse Neuro-2a cell line. In one embodiment, the rodent cell line adapted adenovirus 71 is EV71: TLLm . In another embodiment, the rodent cell line adapted enterovirus 71 is EV71: TLLmv . In one embodiment, the clone-derived virus comprising a mutation in said VP1 CDV: BS _VP1 [K98E / E145A / L169F] . The animal model is useful for studying systemic spread of virus and human disease spectrum in animal models. The animal models are also useful for screening antiviral drugs and vaccines.

The animal model was prepared according to the required standards. Massive standardized stock of rodent cell line-adapted EV71 strain was prepared, titrated, and maintained in a deep freezer (-80 ° C). Standardized "(based on statistical calculation) numbers of rodents, such as BALB / c mice or NSG mice, were transfected into standardized recipients of the virus strains to produce animal models. The animal model of the present invention has developed neurological symptoms (similar to what can occur in humans) upon infection. As disclosed herein, the modified Enterovirus 71, such as the rodent cell line-adapted EV71 virus strain, affects a variety of neurological diseases that occur in the brain and mouse.

In some embodiments, the rodent cell line adapted enterovirus 71 is EV71: TLLm . EV71: TLLm was derived after a series of passages of human EV71 BS strain in NIH / 3T3 mouse cell line for at least 60 cycles. In one embodiment, EV71: TLLm was deposited on Jan. 12, 2015 in accordance with the Budapest Treaty in the China Center for Type Culture Collection, Wuhan, China, Wuhan 430072, China, and assigned accession number CCTCC V201437. In another embodiment, the viral RNA is amplified using advanced reverse genetics synthesized using a viral RNA sequence (GenBank Accession No. KF514879; SEQ ID NO: 1) EV71: TLLm can be recovered. Techniques for advanced reverse genetics are well known in the art [84-87].

In another embodiment, the rodent cell line adapted enterovirus 71 is EV71: TLLmv . EV71: TLLmv was derived from an additional subsequence of EV71: TLLm in the NIH / 3T3 mouse cell line for another 40 cycles. In one embodiment, EV71: TLLmv was deposited in the China Center for Type Culture Collection in Wuhan, China, Wuhan 430072, on January 12, 2015, under the Budapest Treaty, and assigned accession number CCTCC V201438. In another embodiment, the viral RNA is amplified using advanced reverse genetics, which is synthesized using the viral RNA sequence (GenBank Accession No. KF514880; SEQ ID NO: 2) EV71: TLLmv can be recovered. Techniques for advanced reverse genetics are well known in the art.

In a further embodiment, the modified Enterovirus 71 is a clone-derived virus (CDV) with a mutation in the capsid protein VP1 that allows the modified Enterovirus 71 to use the rodent SCARB2 protein to infect rodent cells . Modified enterovirus 71 having a mutation in VP1 is known to those of ordinary skill in the art or is made by preparing a full-length genomic cDNA clone using the techniques described herein. Mutations in VP1 or other proteins of enterovirus 71 are produced using site-directed mutagenesis or CRISPR technology (see, for example, PCT Publication No. WO2014 / 127287). Live viruses (clone-derived viruses (CDV)) are known to those of ordinary skill in the art or are prepared from cDNA clones using the techniques described herein. CDVs with a collection of different mutations or mutations are tested for their ability to infect rodent cells. Alternatively, CDVs with different mutations or mutant vowels are then tested for their ability to bind rodent SCARB2 protein as an initial screening. Any suitable strain of Enterovirus 71 may be used to develop CDVs with mutations in VP1. The number of mutations and specific mutations can vary for each strain to produce sufficient CDVs to produce complete infection in target rodent cells. Therefore, a large number of rodent pathogenic EV71 strains capable of infecting several, many, or all of rodents, such as mice, cell lines, can be produced. In an embodiment, the EV71 strain used to generate the CDV with mutations in VP1 is an enterovirus 71 BS strain. In one embodiment, the modified enterovirus 71 is CDV: BS _VP1 [ K98E / E145A / L169F ] .

In another aspect, the invention provides a method of producing an animal model having a full-spectrum EV 71 -induced neural system infection, disease and pathology observed in humans. In some embodiments, the method comprises infecting the rodent disclosed herein with the modified Enterovirus 71 disclosed herein and breeding the infected rodent for up to about 4 weeks. In one embodiment, the modified Enterovirus 71 is EV71: TLLmv to be. In another embodiment, the modified enterovirus 71 is EV71: TLLm . In a further embodiment, the modified enterovirus 71 is CDV: BS _VP1 [K98E / E145A / L169F] . In some embodiments, the age of the infected rodent is from about 1 week to about 4 weeks. In another embodiment, the age of the infected rodent is from about one week to about three weeks. In another embodiment, the age of the infected rodent is from about one week to about two weeks. In one embodiment, the age of the infected rodent is about one week. In another embodiment, the age of the infected rodent is about two weeks. In an additional embodiment, the age of the infected rodent is about three weeks. In some embodiments, the infected rodent is bred for about 1 to about 4 weeks. In another embodiment, the infected rodent is bred for about 1 week to about 3 weeks. In another embodiment, the infected rodent is bred for about 1 to about 2 weeks. In one embodiment, the infected rodent is bred for about one week. In another embodiment, the infected rodent is bred for about 2 weeks. In an additional embodiment, the infected rodents are bred for about 3 weeks. In an additional embodiment, the infected rodent is bred for about 4 weeks. In some embodiments, the rodent is an immunologically-injured rodent. In some embodiments, the rodent is the mouse disclosed herein. In one embodiment, the immunostimulated mouse is a BALB / c mouse. In another embodiment, the rodent is infected by inoculating the rodent with the modified Enterovirus 71. In one embodiment, the inoculation is intraperitoneal (IP) inoculation. In another embodiment, the inoculation is intramuscular (IM) inoculation. In some embodiments, the virus capacity of vaccination to the rodent is an intermediate cell culture infective dose (CCID ₅₀₎ of between about 10 ³ to about 10 ^7. In another embodiment, the virus capacity of vaccination to the rodent is from about 10 ³ to about 10 ⁶ CCID ₅₀ of. In one embodiment, the virus capacity of vaccination to the rodent is about 4 x 10 ³ CCID ₅₀ to about 10 ^6. In another embodiment, the virus capacity of vaccination to the rodent is about ⁴ to 10 CCID ₅₀ of about 10 ^6. In a further embodiment, the virus dose inoculated with said rodent is from about 10 ⁵ to about 10 ⁶ CCID ₅₀ . In one embodiment, the virus dose inoculated with the rodent is about 10 ⁶ CCID ₅₀ .

An animal model produced in this manner is an authentic mouse model of EV71 neuron-infection exhibiting face validity, i. E., The animal is a neurological disease induced by EV71 infection, including NPE, in a human patient Lt; RTI ID = 0.0 &gt; of the &lt; / RTI &gt; clinical spectrum. The animal model also exhibits construct validity for the visual and histopathological characteristics of the disease, which is very similar to that reported in the fatal human case. The novel in vivo (in vivo) models, neural EV71 - pathogenesis (neuro-pathogenesis) for important events in and EV71- analyze the mechanisms of induced NPE and novel treatment modalities (treatment modalities), and possibly It represents a powerful tool for developing antiviral therapies and for performing pre-clinical evaluation of new vaccines.

In a further aspect, the invention provides a method of screening for an antiviral drug. According to this aspect, the method comprises the following steps: providing a control group of animals and a control group of animals, wherein each group of animals is an animal of the animal models disclosed herein; Administering the antiviral drug candidate to the test group; Monitoring disease progression in the test group and the control group; Comparing the disease progression in the test group with the disease progression in the control group; And selecting an antiviral drug candidate that reduces disease progression in the test group compared to the control group. In one embodiment, the antiviral drug is first screened in a test rodent cell line infected with rodent cell line adapted adenovirus 71, before screening in the animal. In another embodiment, the antiviral drug is first screened in a test rodent cell line infected with a clone-derived virus (CDV) containing a mutation at VP1, prior to screening in the animal.

In a further aspect, the invention provides a method of screening for an effective antiviral vaccine. According to this aspect, the method comprises the steps of: providing a test group of animals and a control group of animals, wherein each group of animals is an animal of the animal models disclosed herein; Administering the antiviral vaccine candidate to the test group; Monitoring disease progression in the test group and the control group; Comparing the disease progression in the test group with the disease progression in the control group; And selecting an antiviral vaccine candidate that reduces disease progression in the test group compared to the control group. In one embodiment, the antiviral vaccine candidate is first screened in a test rodent cell line infected with rodent cell line adapted adenovirus 71, before being screened in the animal. In another embodiment, the anti-viral vaccine candidate is first screened in a test rodent cell line infected with a clone-derived virus (CDV) containing a mutation at VP1, prior to screening in the animal.

In accordance with the method of the present invention, mass standardized stocks of rodent cell line-adapted EV71 strains were prepared, titrated, and maintained at a deep-freezer (-80 캜). Alternatively, mass standardized stocks of clone-derived virus (CDV) containing mutations in the VP1 strain were prepared, titrated, and maintained at a deep-freezer (-80 캜). The "normalization" (based on statistical calculations) of an animal, such as a Balb / c mouse or an NSG mouse, is normalized against the virus strain. The candidate antiviral drug or antiviral vaccine may be administered to the infected rodent at various standardized doses prior to the onset of the disease (for the analysis of prophylactic effect) or at the onset of the disease (for the analysis of the therapeutic effect of the drug) do. In one embodiment, wherein -EV71 in vitro mass high-speed (high through-put) of the compound (in vitro) the screening, the cell according to, rodent cell lines adapted EV71 virus strains, including those disclosed in as disclosed herein, an embodiment Lt; RTI ID = 0.0 &gt; lytic &lt; / RTI &gt; infection. In another embodiment, rapid, high-volume bit screening of anti-EV71 compounds is disclosed herein for susceptibility to cell lysate infections by a clonogenic virus (CDV) comprising a mutation in the VP1 strain, including those disclosed in the Examples. Lt; RTI ID = 0.0 &gt; cell line. &Lt; / RTI &gt; The in vitro screening is performed using techniques well known in the art. The promising compounds selected from the in vitro screening are subsequently screened in vivo in the animal models described herein.

As described in Examples 2-8, a sequential passage of the human EV71 isolate ( EV71: BS ) produced a virus strain with the ability to infect rodents cultured in vitro . A mouse adherent fibroblast cell line NIH / 3T3 [46] derived from the NIH / Swiss mouse embryo was used to adapt the human EV71 strain to infect rodent cells. Two of the NIH / 3T3- adapted strain, EV71: TLLm and EV71: TLLmv that was disclosed, in which EV71: TLLm represents an early stage of the adjustment process (passage number 60), EV71: TLLmv the late stage of the adaptive procedure ( The number of passages is 100). Based on the appearance of virus-induced CPE, measurement of high titer values, and positive detection of viral antigens through immunochromatography, virus-induced infections in the cells were classified as proliferating or non-proliferating. Proliferative infections, notwithstanding the observation of CPE, display viral titer as well as positive viral antigen detection. Non-proliferative infections, on the other hand, are characterized by an unmeasurable viral titer at the cut-off assay limit, despite viral antigen detection and / or CPE observations.

On the contrary, the clinical isolate EV71: BS infects only primate cell lines and EV71: TLLm proliferates both primate and rodent cell lines. Although the EV71: TLLm virus has successfully achieved the ability to infect rodent cells, it is noteworthy that adaptation to NIH / 3T3 cells is less prominent. The virus titers determined using Vero cells are much higher than those determined in NIH / 3T3 cells (Figures 5C and 5D), as indicated by negative values in relative replication rates (RRR) assays. In addition, EV71: TLLm can successfully infect Vero cells, leading to total CPE at various incubation temperatures, while achieving total CPE in infected NIH / 3T3 at 37 ° C (Table 1). EV71: With additional adaptation in mouse cells that obtain TLLmv virus, it shows high adaptability to mouse cells (Fig. 5B), but obtains a virus strain that narrows the spectrum of acceptable host cells. EV71: TLLmv was not able to infect primate cell lines as effectively as mouse cells, although this represented a successful infection, leading to a total CPE of incubated NIH / 3T3 cells at a wider temperature range (Table 1). However, Figure 2B-2C; TLLmv is shown to have lost the ability to not only monkey kidney COS-7 cells, entry and replication in human HeLa and Hep-2 cells (Fig. 3B-3C: EV71: compared with TLLm, EV71 , 2E-2F, and 2H-2I). (Fig. 3B-3D; Figs. 2K-2L and 2N-2O) in hamster CHO-K1 and rat NRK cells. These observations indicate that the additional passage of virus in NIH / 3T3 cells increases adaptability in mouse cells at the expense of loss of infectivity in cell lines of other origin.

Although whole amino acid substitutions can not accurately describe adaptation to mouse NIH / 3T3 host cells, whole genome sequencing of viruses can reveal potential adaptive mechanisms. Most of the identified amino acid substitutions were in P1 (capsid) and RNA polymerase (3D region) proteins (Tables 2 and 3), suggesting possible altered viral protein activity in host cell entry and replication. The accumulation of mutations in the P1 region is expected from the acquired ability of the EV71: TLLm and EV71: TLLmv strains to infect new host cells. The capsid protein forms a structural background in which the virus initiates interaction with the host cell via a viral receptor, which has recently been identified as Scavenger Receptor Class B Member 2 (SCARB2) [47] [48] and is used by some members of the human Enterovirus A (HEV-A) species. The human SCARB2 protein shares about 99% sequence identity with other primates. On the other hand, the mouse SCARB2 protein exhibits 15% sequence similarity compared to the primate protein [49], exhibiting significant structural deviations from the primate SCARB2 and possibly contributing to the recalcitrance of rodent cells to native EV71 infection . There is a possibility that an adaptive mutation in the virus capsid binds to the mouse cell receptor to make the virus suitable for inducing successful infestation and infection of a new host.

Mapping of the capsid protein mutation is based on the fact that most identified amino acid substitutions in the virus P1 region are found in the exposed regions of the protein (Figures 11A-11D), particularly in the BC, DE, EF, and GH loops Lt; / RTI &gt; The VP1 residues 150-180 are in a viral capsid canyon containing the SCARB2 protein. The central region at Gln-172 contains most of the VP1 neutralization epitope at amino acids 163-177 [32]. EV71: TLLm and EV71: TLLmv represent the substitutions E167D and L169F in the EF loop of the VP1 canyon (Figs. 11A-11B) and no loci has been previously reported. Other important amino acid substitutions near the SCARB2 docking site include N104D in the BC loop and S241L in the GH loop, which are located within a 20 ANGSTROM radius from Gln-172. The VP1 S241L mutation associated with the K244E, which emerges from the mouse strain of CHO cell line-adapted EV71, has previously been reported [50]. It was found that the mutation in combination with VP2 K149I is associated with a non-virulent phenotype in the 5-day-old mouse. However, reverse mutation of Leu to Ser [47] from VP1 241 resulting from adaptation in NOD / SCID mouse brain tissue has been reported [51] and has been found to be associated with the virulence phenotype of the mouse. The VP1 E145A mutation, which is far from the SCARB2 docking site and is located in the DE loop, is another candidate that provides the ability to infect mouse cells. The VP1 145 mutation was previously reported [34, 37], and a single E145A mutation led to virulence in NOD / SCID mice [51]. Other mutations in the VP1 of the C4 genotype EV71, Q145E, were associated with fetal outcome in 5-day-old mice [52]. In a neutralization epitope of VP2, particularly residues 136-150, mouse cell-adapted mutations may also contribute to viral ability to infect rodent cells [53]. Two substitutions in the VP2 EF loop were observed in EV71: TLLm (FIG. 11C) and three substitutions were in EV71: TLLmv (FIG. 11D). Neither of these mutations have been previously described, and a neighboring gene locus at VP2 149 in the EF loop has been mentioned in the literature [34, 50, 54] and has been described as an adaptive mutation for the passage in PSGL-1 transiently expressing cells [55].

EV71: BS virus RNA was transfected into murine cells to explore the possible role of P1 domain mutations in binding viral receptors for host cell entry. Mouse cell Causes a proliferative infection in NIH / 3T3 cells, as evidenced by measurable viral titers and the observation of virus-induced CPE in the culture supernatant analyzed in Vero cells by direct introduction of EV71: BS RNA into the cytoplasm (Fig. 12). However, re-inoculation of the virus supernatant on the new NIH / 3T3 cells failed to induce a proliferative infection (Fig. 6A) and no viral antigen was detected (Fig. S4H). Similarly, transfection of EV71: BS RNA with Neuro-2A cells induced positive antigen staining in Neuro-2A cells (Figs. 10C and 10D), although not directly viral infection, showing measurable viral titers (Fig. 12 ). Transfected viral supernatants on the new Vero and NIH / 3T3 cells induce positive antigen staining in Vero (Figure 10I), but not in NIH / 3T3 cells (Figure 10J). The data indicate that it avoids the requirement for receptor binding for host cell entry and successfully infects and induces the generation of viral descendants in NIH3T3 and Neuro-2A cells. The data also support that human EV71: BS can not successfully enter mouse NIH / 3T3 and Neuro-2A cells via murine cellular receptors. Moreover, the data suggest that mutations within the P1 region of the EV71: TLLm and EV71: TLLmv genomes provide the ability to efficiently bind to the virus, resulting in entry into the host cell.

Several amino acid mutations have also been observed in the P2 and P3 regions, which are important in viral replication and encode viral proteins using host cell protein translation machinery [56]. The adaptive mutation can serve to optimize EV71 genome replication and translation in mouse cells. Wherein said virus 3D protein has 8 amino acid substitutions in EV71: TLLmv and EV71: TLLm , And the two strains represent one mutation at 3B and two mutations at 3C, respectively. Direct inoculation of viral RNA into TCMK cells provides a possible role for adaptive mutations in unstructured proteins of the virus. Although TCMK cells were shown to be acceptable for EV71: TLLm and EV71: TLLmv infection (Figures 3B and 3D; Figures 4Q and 4R), transfection of EV71: BS viral RNA with TCMK cells did not successfully induce infection. Virus antigen signals were not detected in infected and transfected cells (FIGS. 10E-10F), and passage of viral supernatants on new NIH / 3T3 and Vero cells did not result in positive viral antigen detection (FIGS. 10K and 10L). Moreover, there was no analytical virus potency in both infected and transfected cells (Figure 12). Unlike the mutation in the capsid region, the data show that EV71: TLLm and EV71: TLLmv Mutations in the P2 and P3 regions found in Suggesting that it is required to successfully infect TCMK cells.

It is believed that this is the first reported EV71 strain derived from a human clinical sample that successfully obtained the ability to proliferate infectiously several rodent cell lines after a serial passage in a mouse cell line. Derived mutant genomes as a general reservoir of phenotypic traits for future adaptability with relatively high mutation rates during RNA replication, and by inducing dynamic plasticity of the RNA viral genome with replication involving pseudo-species distributions [57, 58] And adaptability to the environment [59, 60]. Although EV71 infected suckling mice [34, 37, 38, 51] and other rodents (e. G., Gerbils (gerbils)) is not that although previously reported, and the infection of in vitro cultured rodent cells to proliferate ever nowhere Not reported. This may be due to high genetic barriers and host range associated with major changes in phenotype [58]. Interestingly, this is the first report of a number of adaptive mutations within the consensus whole-genome sequence of EV71. On the other hand, previously reported mouse-adapted EV71 has reported less than 10 amino acid substitutions in the genome [34, 38, 51] and we have found 21 in EV71: TLLm and 31 in EV71: TLLmv To 36, more than the largest number of previously identified adaptive mutations [37]. This may not be enough to break the genetic barriers and to successfully adapt the virus to infect cultured mouse cells in several passages of virus [34, 36, 37] in mouse tissues. Instead, hundreds of consecutive passages may be needed, as observed in this study.

EV71 has been shown to have a host cell restriction in recent years by demonstrating that EV71 uses a Scavenger Receptor Class B Member-2 (SCARB2) as its functional receptor for host cell entry [47] and virus uncoating [72] in the endosome Lt; / RTI &gt; The human and murine SCARB2 proteins exhibited only 84% amino acid sequence identity [67] and presented structural differences between the two proteins. This scenario describes the general resistance of mice and other rodents to the EV71 experimental infection as well as the general loss of EV71 clinical isolates for infecting mouse-derived cells, and attempts to develop small animal models of EV71 infection . However, despite the virus-receptor incompatibility, it has been shown that some rat cells support EV71 infection when early stages of infection, i.e., receptor-mediated cell entry, bypass through viral RNA transfection into cells. EV71: Although BS does not infect Neuro-2a and NIH / 3T3 cells [71], the transfection of viral genomic RNA results in the expression of EV71 protein, the induction of microbial cytopathic effect (CPE) Lt; / RTI &gt; Similarly, live viruses have already been generated by transfecting poliovirus RNA into mammalian cells [73-75] and the cells used (HeLa) are known to be tolerable for poliovirus infection. In this experiment, non-permissive mouse neuronal Neuro-2a and fibroblast NIH / 3T3 cells were used to maintain viral replication and produce live virus offspring upon transfection of EV71: BS RNA into the cytoplasm And that the internal environment of the rat cells contained host factors required for EV71 infection, maintained the completion of the viral infection cycle, and the EV71 protein functioned in the murine cytosol. This finding also implies that the absence of NIH / 3T3 and Neuro-2a cellular infections at the time of virus inoculation can be due to defects in receptor-mediated host cell entry and uncoating, which is primarily a function of the capsid proteins. These results are similar to our previous observations (above or [71]), allowing certain amino acid substitutions in the EV71: BS capsid protein to bind to its receptor, leading to viral entry and uncoating, Of the population. Two unique tools - the mouse cell line (NIH / 3T3) - the adapted EV71 strain ( EV71: TLLm and EV71: TLLmv ) and two mouse cell lines (Neuro-2a and NIH / 3T3) provide the opportunity to examine the hypothesis .

The infection phenotype of a chimeric clone-derived virus expressing EV71: TLLm capsid protein but expressing EV71: BS non-structural protein ( CDV: BS [M-P1] ) was determined using the mouse cell- phenotype "can be provided by a capsid protein derived from a mouse cell line-adapted EV71 strain. These chimeric CDVs behave similarly to mouse cell-adapted EV71 strains and induce proliferative infections in Vero as well as NIH / 3T3 and Neuro-2a cells and provide direct evidence for the completion of the viral infection cycle, Induces the generation of descendants. In addition, mutagenesis of EV71: BS VP1 to introduce amino acid substitutions K98E, E145A, and L169F in VP2 S144T and K149I induced a limited infection of murine cells. EV71: TLLm P1 region substitution (CDV: BS [M-P1 ]) having the CDV and the combined amino acid substitutions VP1-K98E / E145A / L169F ( CDV: BS VP1 [K98E / E145A / L169F]) a CDV having Neuro- 2a and NIH / 3T3 cells and can produce viable viral descendants in the resulting culture supernatant. The remaining CDVs, which contain different amino acid substitutions, individually or in various combinations, exhibit limited entry into murine cells, inducing replication in one cycle, as evidenced by the observation of CPE and the detection of viral antigens in the inoculated cells . Live virus offspring was absent in the infected cell culture supernatant, failing to induce infection by re-inoculation on healthy mouse cells. The reason for the failure to generate live virus offspring in the culture supernatant of cells infected with CDV is unclear, but one possibility may be due to the structural instability of the capsids obtained after mutation. The present inventors contemplated that the introduced amino acid may be incompatible with other amino acid containing proteins, affect the entire capsid protein folding, and alter the capsid structure. These estimates highlight the complexity of the capsid protein assembly, where the four viral proteins (VP1-4) cooperatively interact to produce functional capsids. Therefore, amino acid substitutions that allow the virus to bind to new receptors can result in tragic consequences, and can inadvertently destabilize the capsid complexes, especially because of incompatibility with other amino acid residues in the protein.

The results disclosed in Examples 10-17 show that three VP1 substitutions: K98E, E145A, and L169F are required, sufficient to bind to its receptor in mouse cells, and sufficient for EV71 to enter. VP1-98 and VP1-145 residues as markers that bind human PSGL-1 receptor proteins on leukocytes have been previously mentioned [76], although the VP1-169 residues were not previously mentioned in the literature. Analysis of 1,702 VP1 sequences of the EV71 clinical isolate disclosed to Genbank confirmed the viability of the mutant combination VP1 98E / 145A, although only rarely, only in 5 isolates (0.3% of the database). On the other hand, since the VP1-169F mutant was not observed in the irradiated database of the EV71 VP1 sequence, its extreme scarcity was proved. The CDV: BS _VP1 [K98E / E145A / L169F] could be stably transduced on Neuro-2a cells and consistently generated live viral descendants while maintaining the mutations introduced into the viral genome during the three passages, The virus was at least alive and stable in Neuro-2a cells. Therefore, introducing these three residues: VP1 98E, 145A, and 169F into other EV71 clinical isolates, although not yet proven, is likely to infect mouse cells.

Similar to the previous findings [47, 72, 77] in which EV71 uses a Scavenger Receptor Class B Member-2 (SCARB2) protein as its receptor for host cell entry and uncoats with the cytosol [47, 72, 77] It has been demonstrated that the mouse cell-adapted EV71: TLLmv uses mouse SCARB2 (mSCARB2) to infect mouse cells. The virus binds directly to recombinant soluble mSCARB2 in vitro and reduces the severity of cellular infections by preincubation of the proteins with live viruses before inoculation onto healthy cells. In addition, by binding to polyclonal antibodies to mSCARB2, the glass surface of mSCARB2 was blocked on the host cell to reduce viral binding on immobilized cells and suppress infection of living cells. The result shows EV71: TLLmv binding to the human SCARB2 (hSCARB2) protein, which is used to infect primate cells. EV71: Binding and infection of primate cells by TLLmv is also blocked by antibodies to hSCARB2. The data presented herein represent only EV71: TLLmv, and the results also extend to EV71: TLLm . EV71: TLLmv is derived from an additional subsequence of EV71: TLLm in NIH / 3T3c cells, and several amino acid substitutions were observed between two mouse cell line-adapted EV71 strains. Thus, this indicates that both EV71: TLLm and EV71: TLLmv use cellular mSCARB2 for infection of rodent cells.

Similarly, CDV: BS [M-P1] and CDV: BS _VP1 [ K98E / E145A / L169F ] use mSCARB2 to infect mouse cells. Pre-incubation of the mSCARB2 antiserum and Neuro-2a cells blocks cellular infection by the virus, which is supported by reduced CPE induction and lower viral titer compared to the control group. Recent data indicate that SCARB2 binding to EV71 canons stabilizes mature virions and induces the release of a "pocket factor", a lipid in the capsid canyon that is presumed to be sphingosine in EV71 [78], a series of events in virus non-coating: capsid expansion (to form 135-S or A-particles), VP1 N-terminal and 5-fold axis capsid junctions VP4 into the endosomal membrane, and release of the viral genomic RNA into the host cell cytoplasm [78-81]. The latest human SCARB2 crystal structure data also indicates a lipid tunnel across the entire protein and is relevant in the context of SCARB2 function, which carries β-glucocerebrosidase as a lysosome However, Dang et al. [72] suggested that it is provided as a conduit for the removal and transport of spinocynes from capsid canons during SCARB2 binding. The SCARB2 amino acid residues 140-151, the sequence very deviates between human and rat proteins, is the major binding site for EV71 [49]. The same area acts as a gate to regulate the opening and closing of the SCARB2 lipid tunnel and the event is triggered by acidic pH during virus uncoating. The VP1-169 residue is in the capsid canyon and probably has direct function in SCARB2 binding. The abrupt change from leucine to phenylalanine at this position can alter the canonical structure so that it can be better fitted with mouse SCARB2 protein. While the VP1 98 and 145 residues may be placed in the fringe surrounding the capsid canyon and have other functions besides SCARB2 binding. This is merely a hypothesis, and the three VP1 amino acid substitutions resolve the structure of the murine SCARB2 protein to reveal the exact mechanism by which it can confer "mouse cell-entry phenotype" You will need to map.

This is believed to be the first scientific exploration of EV71 capsid site-specific mutations that naturally lead to proliferative infections of non-permissive murine cells. Previous studies have shown that selective virus adaptation [34,37,38,82], or that of human SCARB2 protein, as in the case of live animal passages to generate variants with improved infection profiles in mice Attempts have been made to overcome the virus host restriction through cytoplasmic changes by ectopic expression [47, 69, 70, 83]. The incompatibility of EV71 with murine SCARB2 generally accounts for the resistance of mice to EV71 infection, thus hindering the development of mouse models of EV71 infection. This also explains why most mouse models of EV71 infection using wild-type or mouse-adapted virus strains failed to reproduce the spectrum of disease observed in severe human infections [34,37,38]. On the other hand, transgenic mice expressing human SCARB2 do not require the mouse adaptation of the virus and characterize the more extensive EV71 infection, but the entire spectrum of human disease could still not be clearly reproduced [69,70]. Evidence that certain amino acid substitutions in EV71 can infect murine cells provides a first step in understanding the molecular mechanisms that allow mouse cell line-adapted EV71: TLLm and EV71: TLLmv to effectively infect cultured rodent cells. In addition, one can provide another approach to study the detailed pathogenesis mechanism and generate a mouse model of EV71 infection to reproduce the full spectrum of neurological diseases seen in human infection.

In Examples 22-25, young BALB / c mice inoculated with mouse cell-adapted Enterovirus 71 (EV71) for the first time developed acute encephalomyelitis associated with neurogenic pulmonary edema (NPE) very similar to the pathology observed in infected human patients . Adapted virus strain EV71: An animal challenged with TLLmv represents various levels of virus-induced tissue damage in the pyramidal and non-pyramidal regions of the brain and is associated with paralysis, ataxia and tremors ), Consistent with the CNS-topology pathology identified in the fatal case of EV71 infection [91-95]. In addition, some mice exhibited respiratory distress compatible with autonomic nervous dysfunction. Euthanasia (euthanasia) and when the display based on the disease, the animals can easily be classified into four groups: Class IA, Class IB, Class II and Survivors (Survivors). Survivors do not exhibit symptoms of the disease, but in class II mice exhibit persistent flaccid paralysis and severe weight loss, while Class IA and Class IB The mice also suffered from acute neurological disease that commonly leads to death within 3-7 DPI. Class IA mice also showed severe respiratory distress, not due to congestive heart failure or pneumonia. Instead, the animals in class IA showed high serum levels of catecholamines with extensive tissue damage to the tail brainstem, particularly in the soft tissues, indicating that respiratory symptoms observed in these mice are the result of neurogenic pulmonary edema (NPE). Comparing macroscopic pathology of the lungs of class IA mice and other groups, there was a significant increase in lung wet weight due to incomplete lung collapse at autopsy, as well as pulmonary hemorrhage and fluid leakage into the alveolar space. These features are very similar to those observed in experimental animal models of non-viral-induced NPE and in the case of fatal humans with extreme NPE [96, 97]. Indeed, histopathological analysis of class IA animals further elicited a focus region of alveolar space filled with proteinaceous and erythrocyte-filled permeable material consistent with observations in a fatal human case [21, 98-100].

Pulmonary edema (PE) is usually defined as an extravascular increase in the water content of the lung [48] and may be subclassified based on cardiogenic or neurogenic origin. The class IA mouse heart tissue exhibited normal histology and the absence of obvious signs of disease allowed the present inventor to exclude cardiac PE and the absence of viral replication or inflammation in the lung parenchyma was a direct virus- Thereby excluding tissue damage. Instead, we detected elevated serum levels of catecholamines in Class IA mice, suggesting that the group had previously been demonstrated as a result of catecholamine storm induced by severe sympathetic discharge, Neuropathic PE (NPE) [96, 101]. In this scenario, autonomic dysfunction causes catecholamine seizures, resulting in systemic and pulmonary vasoconstriction. This changes blood flow from whole body to pulmonary circulation, causing plasma leakage and bleeding into the alveolar space via a hydrostatic mechanism or direct endothelial injury [101-104]. Although several experimental animal models of non-viral-induced NPE have been recently developed (see Sedy [103] and Davison [104] for review), the present inventors used the EV71 infection only for the first time to demonstrate the typical signs of pulmonary edema Respectively. Therefore, the inventors' new models have made significant progress in seeking antiviral therapies and therapies that can limit EV71 infection in humans and prevent the onset of extreme NPE. Although pulmonary edema may be induced by host cytokine storms in response to EV71 infection [105-107], the data show that the main mechanism of EV71-induced NPE is not accompanied by a large-scale inflammatory response, It is strongly suggested that there is a relationship between tissue damage in certain areas of the brain.

The brain regions associated with NPE induction are designated trigger zones including the hypothalamic atria and the nucleus [101, 103] and the abdominal and dorsal and ventral [96, 104, 108-110] . EV71-induced NPE has previously been known to be due to extensive damage of brainstem tissue [21, 22, 93, 111]. In the novel murine model of the present invention, the inventors have found that extensive damage to viral antigens, Respectively. Class IA and Class IB mice showed up-regulation comparable to serum catecholamines as well as a similar distribution of lesions and viral antigens in brainstem and spinal cord, whereas the absence of NPE in Class IB animals resulted in reduced numbers and severity of brain lesions and / Or NTS, soft nodule nucleus (MdRN), AP area of soft tissue, dendritic nucleus in the cerebellum, and lower backbone nucleus of the anterior hypothalamus. Therefore, the present inventor has suggested that acute and severe destruction of brain stem tissue, particularly vascular motility-associated tissue, may lead to catecholamine seizures in EV71-infected hosts and to NPE if the known trigger region is sufficiently damaged.

In summary, the present invention is an authentic mouse model of EV71 neuro-infection showing facade validity [112], that is, the animals are in the full spectrum of neurological diseases induced by EV71 infection in human patients, including NPE Indicating the full range of clinical symptoms that can be observed over time. Characteristic observations of EV71: TLLmv -infected mice indicating class IA symptoms of the disease were made with video containing two video clips of two different class IA mice. Both animals lost consciousness and fell into a coma. Severe dyspnea, represented by tachypnea with subcostal recession, was noted in the first mouse. In the second mouse, a frothy fluid emerged from gasping, ribbing and nostrils. Characteristic observations of EV71: TLLmv -infected mice indicating class IB signs of disease were performed by video in one class IB mouse. The animal lost self-consciousness, and was in a hollow state. Ipsilateral paralysis of the right limb and continuous shaking of the left hind limb were also observed. The model also showed structural validity [112] with respect to the visual and histopathological features of the disease very similar to those reported in a fatal human case. The new in vivo model is based on the analysis of the mechanism of EV71-induced NPE, the development of new therapeutic methods and potential antiviral therapies, and the identification of the major EV71 neuro- It is a powerful tool for checking events.

The practice of the present invention employs conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA, genetics, immunology, cell biology, cell culture and gene transplantation biology, unless otherwise indicated, have. For example, Maniatis et al. , 1982, Molecular Cloning (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); Sambrook et al. , 1989, Molecular Cloning , 2nd Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); Sambrook and Russell, 2001, Molecular Cloning , 3rd Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); Green and Sambrook, 2012, Molecular Cloning , 4th Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); Ausubel et al. , 1992), Current Protocols in Molecular Biology (John Wiley & Sons, including periodic updates); Glover, 1985, DNA Cloning (IRL Press, Oxford); Russell, 1984, Molecular biology of plants: a laboratory course manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY); Anand, Techniques for the Analysis of Complex Genomes , (Academic Press, New York, 1992); Guthrie and Fink, Guide to Yeast Genetics and Molecular Biology (Academic Press, New York, 1991); Harlow and Lane, 1988, Antibodies , (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); Nucleic Acid Hybridization (BD Hames & SJ Higgins eds. 1984); Transcription And Translation (BD Hames & SJ Higgins eds., 1984); Culture of Animal Cells (RI Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); the treatise, Methods In Enzymology (Academic Press, Inc., NY); Methods In Enzymology , Vols. 154 and 155 (Wu et al. Eds.), Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology , Volumes I-IV (DM Weir and CC Blackwell, eds., 1986); Riott, Essential Immunology , 6th Edition, Blackwell Scientific Publications, Oxford, 1988; Fire et al., RNA Interference Technology: From Basic Science to Drug Development , Cambridge University Press, Cambridge, 2005; Schepers, RNA Interference in Practice , Wiley-VCH, 2005; Engelke, RNA Interference (RNAi): The Nuts & Bolts of siRNA Technology , DNA Press, 2003; Gott, RNA Interference, Editing, and Modification: Methods and Protocols (Methods in Molecular Biology) , Human Press, Totowa, NJ, 2004; See Sohail, Gene Silencing by RNA Interference: Technology and Application , CRC, 2004.

Example

The invention is described with reference to the following examples, which are provided for the purpose of illustration and are not intended to limit the invention in any way. Standard techniques well known in the art or techniques specifically disclosed below have been used.

Example 1

Materials and Methods for Examples 2-8

Cell lines and virus strains : All cell lines used in this study were purchased from the American Tissue Type Culture Collection (ATCC, USA). Studies have shown that various mammalian cell lines; Adenocarcinoma cell lines HeLa (CCL-2) and HEp-2 (CCL-23), and rhabdomyosarcoma RD (CCL-136); Renal fibroblast COS-7 (CRL-1651) of kidney Vero (CCL-81) and Berber monkey of African green monkey; Neuroblastoma Neuro2A (CCL-131), embryonic fibroblast NIH / 3T3 (CRL-1658), and kidney epithelial TCMK (CCL-139); Hamster ovarian epithelial-like CHO-K1 (CCL-61), and normal rat kidney epithelium NRK (CRL-6509).

The human EV71 BS strain ( EV71: BS ) was previously isolated from the brainstem of a deceased patient infected with EV71. The virus was spread over four cycles in Vero cells and stored at -80 ° C for later use. The mouse cell (NIH / 3T3) -tested strain EV71: TLLm was derived from the strain EV71: BS through a series of consecutive passages (> 60 cycles) in mouse NIH / 3T3 cells. A further passage (40 cycles) was performed in NIH / 3T3 cells to generate the EV71: TLLm strain mouse cell-adapted virulent strain ( EV71: TLLmv ).

Cell line management and infection with viruses : All cell lines were infected with 10% ( ^v / _v ) fetal bovine serum (FBS, i-DNA Singapore) and 0.22% ( ^w / _v ) Were grown in Dulbecco's modified Eagle's Medium (DMEM, Gibco, USA) supplemented with sodium bicarbonate (NaHCO ₃ , Sigma Aldrich, USA) and incubated at 37 ° C and 5% CO ₂ . All the infected cells were incubated in a maintenance medium (1% FBS and 0.22% NaHCO ₃ supplemented DMEM).

Cells (2.5-5.0 × 10 ⁵ cells per well) were seeded overnight in tissue culture-treated 6-well plates (Nunc, Fisher Scientific) and incubated with 500 μl of virus suspension (MOI 1) Infected, and incubated at 30 [deg.] C, 37 [deg.] C, or 39 [deg.] C for 2 hours. The cells were washed twice with sterile phosphate-buffered saline (PBS, pH 7.4) solution, and then fresh preserved medium (DMEM, 1% FBS) was added. Infected cells were observed daily for the emergence of a distinctive lytic cytopathic effect (CPE).

For virus growth kinetics studies, plates containing the infected cells were incubated at -80 ° C at various time points: hours post-infection (hpi) 0, 6, 12, 24, 36, 48, and It was frozen at 54 hours. Plates were treated with three cycles of freezing and thawing, and harvesting of the fungus was performed by vigorous vortexing and centrifugation at 1,500 x g for 10 minutes. The purified supernatant was stored at -80 占 폚 in cryovials (Nunc, Fisher Scientific) until further use.

For temperature adaptation analysis, inoculated Vero and NIH / 3T3 cells were incubated at 30 ° C, 37 ° C, and 39 ° C and monitored daily for the appearance of CPE. Each culture supernatant was harvested at 48 hpi and stored at -80 ° C until further use in a low temperature vial.

Neuro-2A and TCMK (mouse), CHO-K1 (hamster), and NRK cells (human), Vero and COS-7 (monkey), NIH / 3T3, Neuro- (Rats) were infected with a multiplicity of infection (MOI) of 1 in parental EV71: BS or the derived NIH / 3T3-adapted EV71 strain and incubated at 37 DEG C for 10 days. Cultures were observed daily for the appearance of CPE.

Determination of Viral Titer and Relative Replication Rate ( RRR ) : The virus supernatant was subjected to endpoint titration and analyzed in NIH / 3T3 and Vero cells. The virus titers were enumerated using the Reed and Muench method [61] and the Reed and Muench calculator [62]. Briefly, NIH / 3T3 (1 x 10 ⁴ cells per well) and Vero cells (4 x 10 ³ cells per well) were seeded overnight in 96-well plates. Frozen virus thawed at room temperature was diluted (10 ^-1 ) in sterile 1% aqueous sodium deoxycholate (Sigma Aldrich, USA) and mixed vigorously for 15 minutes to disintegrate the virus. The disassociated virus was diluted 10-fold in a stock medium, and 100 [mu] l of diluted virus from ^10-3 dilution was added to each well of the cells. Plates were incubated at &lt; RTI ID = 0.0 &gt; 37 C &lt; / RTI &gt; and observed daily for the appearance of distinct CPE under reversed phase optical microscopy. Virus titers were reported as 50% cell culture-infectious dose (CCID ₅₀ / ml) per volume.

To assess the adaptability of EV71: TLLm and EV71: TLLmv in NIH / 3T3 cells, virus titers were analyzed using both NIH / 3T3 and Vero cells in viral supernatants harvested from already infected primate and rodent cell lines. The ratio of potencies used to measure relative replication (RRR) in NIH / 3T3 and Vero cells was calculated using the following equation:

RRR  = log (A / B)

Where A is the viral titre analyzed in NIH / 3T3 cells and B is the viral titre analyzed in Vero cells.

Viral antigen detection by immunofluorescence analysis : In infected cells that do not exhibit significant CPE, immunofluorescence (IF) staining was performed to identify the infection. Cells were trypsinized at 72 hpi, washed twice in sterile PBS, and coated onto a Teflon slide (Erie, USA). The slides were air-dried in a biosafety cabinet and UV-treated for 15 minutes to inactivate the live virus and fixation in cold acetone at 4 ° C for 10 minutes . Slides were probed with a plate-enterovirus antibody (Merck Millipore, USA) and then incubated with FITC-conjugated mouse IgG (DAKO Cytomation, Denmark) with 0.01% ( ^w / _v ) Evan blue counter stain Lt; / RTI &gt;

Transfection of cells with EV71 viral RNA : Vero and NIH / 3T3 cells (3 x 10 ⁴ cells per well) seeded overnight in 24-well plates were incubated with Lipofectamine 2000 (Life technologies, USA) was used to transfect viral RNA extracted from 4 x ¹⁰⁶ CCID ₅₀ virus. RNA from EV71: BS , EV71: TLLm , and EV71: TLLmv was extracted using viral RNA kit (Qiagen, Germany) and incubated with lipofectamine 2000 on the cells for 6 hours at 37 ° C. Transfected cells were observed daily for the appearance of CPE. At 7 dpi, the supernatant was harvested from the infected cells and passed on freshly seeded Vero and NIH / 3T3 cells. Cells were observed daily for the appearance of CPE, and at 7 dpi, cells were trypsinized and processed for immunofluorescent viral antigen detection.

Battlefield genome sequencing and gene of EV71 strain mapping: EV71: BS, EV71: TLLm , and EV71: The viral RNA of TLLmv strain was extracted using a viral RNA kit (Qiagen, Germany), Superscript II (SII-RT, Life Technologies , USA). &Lt; / RTI &gt; The resulting cDNA was amplified with GoTaq Green (Promega, USA) and the EV71 primer (sequence of the primer is available upon request) is degenerate. The amplicon was purified using a PCR clean up kit (Geneaid Biotech, Taiwan) and cloned into a pZero2 vector (Lifetech, USA). Clones were selected from Kanamycin plates and inoculated with LB broth (50 占 퐂 / ml kanamycin) and grown for plasmid extraction by QiaSpin Miniprep kit (Qiagen, Germany) overnight at 37 占 폚. Plasmids were subsequently sequenced by the BigDye terminator method (Applied Biosystems, USA) using the same primers. The resulting 500-bp fragment sequences were used with BioEdit v7.0.9.0 [63] for the entire genomic sequence of EV71 Singapore isolate 3799-SIN-98 (GenBank accession number DQ341354.1) To rearrange the entire genome sequence of EV71: BS , EV71: TLLm , and EV71: TLLmv . Molecular modeling of the promoters of EV71: TLLm , and EV71: TLLmv was performed using Deepview / Swiss pdbviewer version 3.7 (http colon slash slash exposition dot org slash spdbv slash) and SWISS-MODEL server [64, 65].

Example 2

EV71: primate cell line, not a rodent cell line, acceptable for infection by BS

All primate cell lines used in this study were acceptable for infection with the EV71: BS virus. Human RD cells as well as monkey Vero and COS-7 cells exhibited a complete lytic cytopathic effect (CPE) within 48 hours after infection (hpi) (Figures 1A, 1J, and 1M) (Figures 2A-2L; data for RD, COS-7 and Vero cells are not disclosed). Growth kinetics of virus harvested from supernatants from various infected cell lines Proliferative infections were identified in RD, Vero, and COS-7 cells (Fig. 3A). The virus harvested from RD and Vero cells reached the end-titer of 3 x 10 ⁹ CCID ₅₀ / ml and the virus transcript from COS-7 was 10 ⁶ CCID ₅₀ / ml (Fig. 3A). EV71: BS did not induce total CPE in HeLa and Hep-2 cells (Figures 1D and 1G), and the viral titers obtained were not measurable within the assay cut-off limit. However, virus antigens were detected by indirect immunofluorescent staining in both HeLa cells (Figure 2a) and Hep-2 cells (Figure 2D), indicating successful entry of the virus into the cell, but not inefficient or defective replication Which can lead to virus titer.

All rodent cell lines tested were determined to be non-permissive for EV71: BS infection. 4A, 4D, 4G, 4J and 4M), the virus titer from the supernatant was not measurable and the virus antigen could not be detected in the inoculated cells (Fig. 2G, 2J and 4M) 2M; Figs. 10A, 10C and 10E).

Example 3

Mouse cells (NIH / 3T3) - adapted EV71: TLLm virus proliferates both primate and rodent cell lines

EV71: TLLm was derived after a series of passages of EV71: BS in NIH / 3T3 mouse cell line for at least 60 cycles. All primate and rodent cell lines tested except for NRK cells were acceptable for proliferative infections by EV71: TLLm . Total CPE was observed at 48 hpi in RD, Vero, and COS-7 (Figures 1B, 1K, and 1N) as well as NIH / 3T3 and Neuro-2A cells (Figure 4B, E). High virus titers were measurable in supernatants harvested from all infected cell lines except NRK (Figures 3C and 3D) and the infected cells were positively tested against virus antigens by indirect immunofluorescence analysis (Figure 2B, 2E, 2H, 2K and 2N). (Figure 4N; Figure 3D), but virus antigens could be detected (Figure 2K), indicating a successful entry of the virus into the NRK cells by EV71: TLLm However, ineffective viral replication can result in non-measurable viral titers.

Example 4

Mouse cells (NIH / 3T3) - adapted EV71: TLLmv virus multiplies rodent cell lines rather than all primate cells

EV71: TLLmv virus strain was derived from an additional pass of EV71: TLLm in NIH / 3T3 cells for another 40 cycles. EV71: TLLmv induced lytic CPE in fewer cell lines - RD, Vero, NIH / 3T3, Neuro-2A, and TCMK cells (Figure 3B), and total CPE induced RD, NIH / 3T3, and Neuro-2A cells (Fig. 1C; 4C, F). TCMK, CHO-K1 and NRK cells were also shown to be allowed to infect without progressing to the full CPE as shown by positive virus antigen detection (Figures 2L, 2O and 2R) in infected cells (Figure 4I, O).

The primer cell lines HeLa, Hep-2 and COS-7 inhibited the absence of CPE (Fig. 1F, 1I and 1O), unmeasurable viral titer (Fig. 3B) and negative viral antigen detection Lt; RTI ID = 0.0 &gt; EV71: TLLmv &lt; / RTI &gt;

Example 5

EV71: TLLmv virus shows higher fitness for NIH / 3T3 cells, and EV71: TLLm is more adaptive for replication in Vero cells

The amount of live virus in the supernatant harvested from infected cells at various time points was determined by enumerating the viral titers in both Vero and NIH / 3T3 cells. Relative replication ratio ( RRR ), calculated by taking the ratio of virus titers analyzed in NIH / 3T3 to the potency values analyzed in Vero, was used as a surrogate measure of virus adaptability to NIH / 3T3 cells . Parent EV71: BS viruses exhibit high negative RRR values for RD, Vero, and COS-7 (Fig. 5A), indicating that the viral titer analyzed in Vero cells far exceeds the potency assayed in NIH / 3T3 cells . Relative cloning rate values for other cell lines can not be determined because the virus titer can not be measured. On the other hand, except for the virus propagating in Vero cells (Fig. 5B), the EV71: TLLmv virus showed a positive RRR value. The positive RRR value represents a more efficient replication and represents a higher potency value in NIH / 3T3 cells as compared to Vero cells. Negative RRR values determined for EV71: TLLmv harvested from Vero cells are consistent with the observed slow growth kinetics (Figure 3B) and less virus titers. EV71: TLLm represents the negative RRR value (FIGS. 5C and 5D), which is less than the EVR: RRR value for BS . This indicates that EV71: TLLm is still better adapted to replicating in Vero cells than NIH / 3T3 cells, although it may infect prolifically several rodent cell lines.

Example 6

EV71: TLLm is EV71: TLLmv Better adaptation to temperature changes

Parent EV71: Vero and NIH / 3T3 cells infected with BS and the derived NIH / 3T3-adapted EV71: TLLm and EV71: TLLmv strains were incubated at various temperatures of 30 ° C, 37 ° C, and 39 ° C, The degree of adaptation to the virus was determined. EV71: BS exhibited the most limited adaptability, and total CPE was observed only in Vero cells incubated at 37 占 (FIG. 8B; Table 1). EV71: TLLmv was calculated based on the total CPE induction observed in NIH / 3T3 cells (Figure 8A, Figure 9A; Table 1) at 37 ° C in both Vero cells (Figure S2B) and at 37 ° C and 39 ° C Respectively. On the other hand, EV71: TLLm showed the highest degree of adaptation, and total CPE was induced for all incubation temperatures in Vero cells (Fig. 7B, Fig. 8B, Fig. 9B) but only at 37 ° C in NIH / 3T3 cells ; Table 1).

Assessment of virus adaptability of EV71: BS , EV71: TLLm and EV71: TLLmv grown in NIH / 3T3 and Vero cells for various incubation temperatures Induction of total cytopathic effect (CPE) within 48 hours after infection ¹ Incubation temperature (캜) EV71: BS EV71: TLLm EV71: TLLmv Vero NIH / 3T3 Vero NIH / 3T3 Vero NIH / 3T3 30 - ² - + (30%) ³ - - 37 + ³ - + + + + 39 (20%) ⁴ - + (<10%) ³ - +

¹ infected cells were observed daily for signs of sporadic cell death and the appearance of complete CPE.

² showed the absence of total CPE in infected cells.

³ showed observations of the total CPE.

⁴ showed the absence of total CPE, and the number in parentheses showed the maximum CPE observed in the cells.

Example 7

Multiple missense mutations accumulate as a result of adaptation of the viral genome of EV71: TLLm and EV71: TLLmv to NIH / 3T3 cells

The virus RNA of EV71: BS , EV71: TLLm , EV71: TLLmv was treated with Sanger sequencing to determine the consensus genome sequence and identify possible adaptive mutations resulting from the adaptation process in NIH / 3T3 cells. The consensus sequence of the genome representing a predominant species was deposited with GenBank, National Center for Biotechnology Information (NCBI). EV71: 60 nucleotide mutations in the alignment of the entire genomic sequence of EV71: TLLm (GenBank accession number KF514879; SEQ ID NO: 1) to BS (GenBank accession number KF514878; SEQ ID NO: 3) Resulting in amino acid substitutions (Table 2). On the other hand, 83 mutants with 36 amino acid substitutions appeared between the genomes of EV71: TLLmv (Genbank accession number KF514880; SEQ ID NO: 2) and EV71: BS . Most of the mutations were located in the P1 (capsid protein gene) region (Table 2), particularly within the VP1 protein gene (Table 3).

Amino acid changes were also observed in the P2 and P3 regions, particularly RNA-dependent RNA polymerase (3D region). EV71: TLLm usually obtained four amino acid changes in the palm and thumb regions of the enzyme (Table 4). On the other hand, EV71: TLLmv usually accumulated eight amino acid changes in the palm and islet regions of the polymerase. Nucleotide mutations were also observed in the 5 'untranslated region (UTR) of the genome. Besides base changes, 1-base insertion was found in EV71: TLLm , and 4-bp insertion and 20-bp deletion were observed in EV71: TLLmv 5'UTR (Tables 2 and 3). On the other hand, EV71: VP3 and 3A TLLm area, as well as two EV71: TLLm and EV71: this amino acid substitution was observed in the 3'UTR of TLLmv.

EV71: Compared with BS , Nucleotide and amino acid changes in the genome of EV71: TLLm and EV71: TLLmv EV71: BS vs. EV71: TLLm EV71: BS vs. EV71: TLLmv Genome region Number of nucleotide changes Number of amino acid changes Number of nucleotide changes Number of amino acid changes 5 'UTR 11 NA 11 NA Insert 1 bp Insert 4 bp 20 bp deletion P1 22 12 39 22 P2 11 2 11 2 P3 16 7 22 12 3 'UTR 0 NA 0 NA Total 60 21 83 36

EV71: TTLm and EV71: Adaptive mutations observed in the 5'UTR and P1 regions of the TLLmv viral genome EV71: BS vs. EV71: TLLm EV71: BS vs. EV71: TLLmv Amino acid change Amino acid change Genome region Nucleotide change Polyprotein ¹ Mature protein ² Nucleotide change Poly-protein Mature protein Cloverleaf C140G IRES ³ A141G A141C G195C T209C T209C G258A G258A C370T C370T G448A G448A A502C T502C G675T C709T T677C A671T C687T G675T C709T Insert T678I 678-681
insertion 726-745
fruition VP4 A809G E21G E21G A809C E21G E21G VP2 G1359A V204I V135I G1359A V204I V135I G1385C S213T S144T G1385C S213T S144T A1400T K218I K149I A1400T K218I K149I T1428C E228P E159P G1429C E228P E159P VP3 G1900C A385P A62P A2287G 7514A T191A A2421G I558M I235M VP1 T2462C V572A V7A T2462C V572A V7A C2725T L660F L95F C2530A Q595K Q30K A2734G K663E K98E A2719G I658V I93V A2752G N669D N104D T2724A D659E D64E A2876G E710A E145A C2725T L660F L95F A2943T E732D E167D A2734G K663E K98E C2947T L734F L169F A2752G C3165 S806L S241L A2753G N669G N104G A2876C E710A E145A A2943T E732D E167D C2947T L734F L169F C3165T S806L S241L T3175C Y810H Y245H G3148A V813I V248I G3319T A858S A293S

¹ Numbering of amino acids in polyproteins that have not degraded prior to mutagenesis.

Numbering of amino acids from ² mature proteins.

³ Internal ribosome entry site.

The mutation is based on alignment with reference to the EV71: BS genome.

EV71: TTLm and EV71: Adaptive mutations observed in the P2 and P3 regions of the TLLmv viral genome EV71: BS vs. EV71: TLLm EV71: BS vs EV71: TLLmv Amino acid change Amino acid change Genome region Nucleotide change Polyprotein ¹ Mature protein ² Nucleotide change Poly-protein Mature protein 2A G3772A G992E G130E G3772A G992E G130E 2C A4366G T1207A T96A A4366G T1207A T96A 3A C5117T A1457V A17V 3B T5357C L1537P L119 T5357C L1537P L119 3C A557G I1604V I56V A557G I1604V I56V A5569G I1608V I60V A5569G I1608V I60V 3D A6211G N1822D N91D A6070T T1775S T44S ³ T6835A S2030T S299T ³ T6137C V1797A V66A A7128G R2127S R396S A6211G N1822D N91D T7247C V2167A V436A C6404G S1886C S155C T6592G W1949G W218G ⁵ T6835A S2030T S299T A7128G R2127S R396S ⁶ T7247C V2167A V436A

¹ Numbering of amino acids in non-degraded polyproteins before mutagenesis.

² Numbering of amino acids from the mature protein.

³ Mutation located in the ring finger domain of an RNA-dependent RNA polymerase.

⁴ Mutation located in the palm domain of an RNA-dependent RNA polymerase.

^{5 &lt; /} RTI &gt; RNA-dependent RNA polymerase.

Mutations are based on alignment with reference to the EV71: BS genome.

Example 8

Transfection of EV71: BS viral RNA into murine cells induces a proliferative infection, but the viral descendants can not re-infect the same mouse cells

Vero and NIH / 3T3 cells transfected with viral RNA showed total CPE at 7 days post-transfection (dpt) (data not shown). Virus antigens were detected in NIH / 3T3 cells transfected with the viral RNA of EV71: BS (Fig. 10B) but not in the virus-infected NIH / 3T3 cells (Fig. 10A). The virus supernatant was re-inoculated onto the new Vero and NIH / 3T3 cells, resulting in proliferative infection (100% CPE) only in Vero cells that were not NIH / 3T3 cells (Fig. 6A) Infection was confirmed in Vero cells that are not cells (Fig. 6B).

Example 9

Materials and Methods for Examples 10-17

Plasmid, Virus, Bacteria and Cell Line: Plasmid (pMD18-mSCARB2) (Genbank accession number NP_031670.1) encoding mouse SCARB2 cDNA was purchased from Sino Biological, Inc. (Beijing, China). This . Coli (E. coli) pQE30 vector for the recombinant expression of the soluble protein in mSCARB2 cells (Qiagen, Germany), a Dr. Kian Hong Ng (Temasek Lifesciences Laboratory, Singapore). A plasmid encoding the full-length cDNA of EV71 was generated using the low-copy no. Plasmid pACYC177 (New England Biolabs, Singapore). A plasmid construct (pCMV-T7pol) expressing T7 polymerase was deposited at the University of Sydney, New South Wales. It was obtained from Peter McMinn. The plasmid pZero-2 used for fragment sequencing of clone-derived virus was purchased from Invitrogen (Life Technologies, USA).

The clinical isolates EV71: BS (Genbank accession number KF514878), EV71: TLLm (Genbank accession number KF514879.1), and EV71: TLLmv (Genbank accession number KF514880.1) [71].

All cell lines used in this study - African Green Monkey Kidney Vero (CCL-81); Mouse neuroblastoma Neuro-2a (CCL-131), and fibroblast NIH / 3T3 (CRL-1658) cells were purchased from the American Tissue Culture Collection (ATCC®, USA). Cells were grown and preserved as described above and previously [71].

this. Coli cell BL21 strain (New England Biolabs, Singapore) was used for high-level protein expression, TOP10 strain (Life Technologies, USA) was used for fragment sequencing of individual clones, XL-10 Gold ultracompetent strain It was used for the generation of full-length genomic cDNA clones.

EV71: Preparation of BS full-length genomic cDNA clones, capsid - chimeric clones, and VP1 / VP2 variant clones : EV71: BS cDNA clones were generated by two-step cloning. [71] The virus RNA extraction (Qiagen Viral RNA kit, Germany) and the conversion to cDNA (Life Technologies Superscript-II RT, USA) were described above or earlier. remind 5'UTR and proximal genomic fragment (genome proximal fragment) encoding the P1 region a primer pair (primer pair): EV71_ BamHI - PfF and EV71_ Pf - was amplified using AatIIR (Table 5), which is cloned into the plasmid pACYC177 Lt; RTI ID = 0.0 &gt; BamHI &lt; / RTI &gt; and AatII restriction sites. The terminal fragment encoding the P2, P3, and 3'UTR was amplified with primer pair HindIII EV71_ -DF and EV71_D- BamHIR, which also contains a HindIII and BamHI restriction sites for cloning. The proximal fragment includes a 5 ' UTR T7 polymerase promoter region upstream to facilitate transcription. The proximal fragment was ligated to the end fragment after degradation into EagI and AatII , and a full-length EV71: BS clone was generated.

primer primer  name SEQ ID NO: briefs EV71_ BamHI - PfF CTAGGGATCCTAATACGACTCACTATAGGTTCAAACAGCCTGTGGGTTGCACCCACTCACAGG (4) To clone EV71: BS proximal fragment ( 5'UTR-P1 region) with pACYC177 plasmid EV71_ Pf - AatIIR CTAGGACGTCCGGCCGAACTTTCCAAGGGTAGTAATGGCAGTACGACTAGTGCC (5) EV71_ HindIII -DF TAATAAGCTTCGGCCGGCAGTCTGGGGCCATCTACGTG (6) To clone EV71: BS end fragment ( P2-3'UTR ) with pACYC177 plasmid EV71_D- BamHIR GCGCGGATCCTTTTTTTTTTTTTTTTTTTTGCTATTCTGGTTATAACAAATTTACCCCCAC (7) SDM _ MluIF GGTGTCCACTCAACGCGTCGGCTCCCACGAGAACTCCAATTCAGCTACAGAAGGCTCC (8) To introduce MluI restriction sites with proximal fragment clones SDM _ MluIR CAAGCATGGGCTCACAGGTGTCCACTCAACGCGTCGGCTCCCACG (9) MluI - TLLm - P1F ACTCAACGCGTCGGCTCCCACGAGAACTCCAATTCAGCTACAGAAGGC (10) To amplify the P1 gene sequence of EV71: TLLm flanked by MluI and EagI restriction sites Eagi - TLLm - P1R ACTGCCGGCCGAACTTTCCAAGGGTAGTAATGGCAGTACGACTAGTGCC (11) VP2_ G1385C -F CAGAGGACA C CCACCCTCCTTACAAACAAACACAACCTGGCGCC (12) To introduce the G1385C mutation (VP2 S144T substitution) VP2_ G1385C -R GGAGGGT G GGTGTCCTCTGTTCCTGTACCGCCTG (13) VP2_ A1400T -F CTCCTTACA T ACAAACACAACCTGGCGCCGACG (14) To introduce the A1400T mutation (VP2 K149I substitution) VP2_ A1400T -R TGTGTTTGT A TGTAAGGAGGGTGGCTGTCCTCTGTTCC (15) VP1_ A2734G -F CTCCCTCTT G AGGGTACCACCAATCCAAATGGTTATGCCAACTGGG (16) To introduce the A2734G mutation (VP1 K98E substitution) VP1_ A2734G -F TGGTACCCT C AAGAGGGAGATCTATCTCTCCTACCAAACCTGCCC (17) VP1_ A2876C -F CTACTGGTG C GGTTGTTCCACAATTACTCCAGTATATGTTTGTTCCCCCTGG (18) To introduce the A2876C mutation (VP1 E145A substitution) VP1_ A2876C -R GGAACAACC G CACCAGTAGGAGTGCACGCAACAAAAGTGAATT (19) VP1_ C2947T -F AGAGAATCA T TTGCTTGGCAGACAGCCACAAACCCC (20) To introduce the C2947T mutation (VP1 L169F substitution) VP1_ C2947T -R GCCAAGCAA A TGATTCTCTAGACTCTGGTTTGGGAGCACC (21) pQE - mSCARB2F ATTAGGATCCGTCTTTCAGAAGGCGGTAGACCAG (22) To clone mouse SCARB2 gene with pQE30 protein expression plasmid pQE - mSCARB2R TATAAAGCTTCGACACGCCAGCCACGTGAAAACCAAGCCAAAG (23)

EV71: the P1 region of the BS EV71: to replace with the TLLm P1, a MluI restriction site was engineered in the boundary between the 5'UTR and P1 (primer pair SDM _ _ MluIF and SDM MluI -R). The P1 cDNA sequence of the EV71: TLLm was amplified (primer pair MluI- TLLm-P1F and EagI - TLLm - P1R ), MluI and EagI , and cloned into the construct with the proximal fragment. The modified proximal fragment was ligated to the end fragment as described hereinafter.

To generate clones with amino acid substitutions in the VP2 and VP1 proteins, site-directed mutagenesis was performed on the proximal fragment before ligating to the end fragment. VP2 is the S144T (nt G1385C) amino acid substitution was introduced into the proximal fragment has a specific primer pair VP2_G1385C-F and -R VP2_ G1385C. The VP2 S144T (nt G1385C), VP1 K98E (nt A2734G), E145A (nt A2876C), and E167D (nt C2947T) were also generated in a similar manner using different primer pairs (Table 5) .

Evaluation of "mouse cell-entry phenotype" : To generate live viruses, the cDNA clones were transfected with Vero cells to T7 RNA polymerase expression using lipofectamine 2000 (Life Technologies, USA) according to the protocol recommended by the manufacturer Transfected with another construct (pCMV-T7pol). Transfection supernatants were harvested 7-10 days after transfection and inoculated onto cell lines seeded overnight or overnight with 1 MOI as described above or earlier. Cells were incubated with virus supernatant at 37 ° C for 1 hour, washed twice with PBS, and then replaced with fresh DMEM, 1% FBS.

To evaluate the infection phenotype, the progression of lytic cytopathic effect (CPE) induction was recorded and the images were taken at various time points. Infected cells were also harvested and processed for immunofluorescence detection of viral proteins as described above and previously [71]. Briefly, adherent cells were trypsinized, combined with pelleted cells from the culture supernatant, washed twice with sterile phosphate buffered saline (PBS), and fixed on a Teflon slide. Immobilized cells were incubated with plate-enterovirus monoclonal antibody (Merck Millipore, USA) and detected with standard FITC-conjugated anti-mouse IgG antibody. Infected cell culture supernatants were also harvested and removed, and a series of dilutions were performed using the Reed and Muench method to determine viral titers [61]. Once the titre was known, the supernatant was transferred to 1 MOI on freshly seeded NIH / 3T3 and Neuro-2a cells, and the infectious phenotype was again assessed using the methods disclosed herein.

Recombinant protein expression of soluble SCARB2 protein and production of SCARB2 rabbit anti-serum : Plasmid pMD18-mSCARB2 encoding the extracellular domain of mouse SCARB2 (aa Arg27-Thr 432) was amplified by primer pairs pQE - mSCARB2F and pQE - mSCARB2R BamHI and HindIII restriction sites were introduced to promote cloning with the pQE30 protein expression vector. This clone the BL21. Was transformed with the E. coli cells, the protein expression was induced overnight with 1mM IPTG. The harvested cells were degraded lysosomes (1 mg / ml) and crude extracts were purified using a Ni-NTA column (Qiagen®, Germany). The purified fungus was incubated in 1 ml of 50% Ni-NTA slurry overnight at 4 ° C with gentle shaking. The protein was washed five times with Wash Buffer (50 mM NaH ₂ PO ₄ , 300 mM NaCl, 20 mM imidazole, pH 8.0) and elution buffer (50 mM NaH ₂ PO ₄ , 300 mM NaCl, 250 mM imidazole, pH 8.0).

Two healthy male rabbits were immunized at day 0 with 1.4 [mu] g of purified mouse SCARB2 protein mixed with Freund ' s complete adjuvant (Sigma-Aldrich). A booster containing 0.8 μg of antigen mixed with Freund's incomplete adjuvant (Sigma-Aldrich®) was injected at days 21, 42, 63, 84, and 105. Terminal bleed by cardiac puncture was performed on day 117, and the collected blood was incubated overnight at 4 ° C and centrifuged at 3,000 rpm for 30 minutes. Purified serum was collected and stored at -20 캜 until further use. Generation of SCARB2 rabbit antiserum was approved by the Temasek Lifesciences Laboratory Institutional Animal Care and Use Committee (TLL-IACUC) [Approval No. 047/12].

Rats Competition assay by SCARB2 protein : In vitro binding assay was performed to confirm the interaction of EV71: TLLmv with mouse and human SCARB2 protein. NIH / 3T3 cells (6000 per well) were seeded overnight on sterile Teflon coated slides (Erie, USA). Prior to viral inoculation, 100 MOI EV71: TLLmv was incubated with various concentrations of recombinant mouse SCARB2 (mSCARB2) or human SCARB2 (hSCARB2) protein (4.0, 2.0, 1.0, 0.5, 0.25, 0.125, Lt; RTI ID = 0.0 &gt; 37 C &lt; / RTI &gt; for 2 hours. Infected cells were observed daily for signs of CPE and fixed in absolute acetone at 48 hours post infection (4 ° C, 10 min). Immobilized cells were subjected to immunofluorescence analysis with plate-enterovirus antibody (Merck Millipore®, USA). The slides were imaged with an upright fluorescence microscope (Nikon, Japan).

Virus- SCARB2 Binding Assay : Antibody-mediated SCARB2 blocking assay was performed on fixed cells to assess whether blocking of cell surface SCARB2 protein affects binding viral binding. NIH / 3T3 and Vero cells cultured on a Teflon slide were fixed (4% PFA, 25 min, room temperature) and blocked with 5% BSA in PBS for 1 hour at 37 ° C. Slides were incubated at 37 [deg.] C for 1 hour in polyclonal rabbit serum raised for mSCARB2 (1: 100). For the negative control group, cells were incubated with polyclonal rabbit serum raised against Saffold virus L protein. The slides were washed with PBS and incubated with live EV71: TLLmv (1000 MOI) for 1 hour at 37 ° C, probed with plate-enterovirus antibody and detected with FITC-conjugated Abs. Slides were imaged with a Zeiss LSM 510 Meta inverted confocal laser microscope (Zeiss, Germany) and fluorescence intensities were measured using Imaris (BitPlane Scientific Software, Germany) imaging software. Statistical analysis of fluorescence intensity difference was performed using Prism GraphPad ver. 6.01 (GraphPad Software, Inc., USA).

Rabbit Port - SCARB2 Analysis of cell protection from viral infection using polyclonal serum : Antibody-mediated SCARB2 blocking assay was also performed to assess its effect on cell infections in living cells. Overnight seeded NIH / 3T3 cells (1x10 ⁴ cells per well in 96-well plate) were diluted 2X serial dilutions (1:20 to 1: 640) of rabbit polyclonal serum raised against mouse or human SCARB2 protein, Lt; RTI ID = 0.0 &gt; 37 C &lt; / RTI &gt; for 1 hour. Cells were subsequently inoculated with 100 MOI EV71: TLLmv or clone-derived viral variants CDV: BS [M-P1] and CDV: BS _VP1 [ K98E / E145A / L169F ] for 1 hour at 37 ° C. Cells were washed twice with PBS and replaced with fresh DMEM (1% FBS). Cells were observed daily for symptoms of CPE, and the infected cell culture supernatant was harvested 3 days after infection (dpi). The supernatant was viral titrated, as previously described, with 1% sodium deoxycholate in a vigorous vortex for 15 min at room temperature along with a pre-viral decay process [6, 71]. Virus titers were enumerated by the Reed and Muench method [61] and reported by CCID ₅₀ / ml by an infection calculator [62].

Example 10

Transfection of EV71: BS genomic RNA with mouse neuronal cell neuro-2a and fibroblast NIH / 3T3 cells produces live virus offspring

Rat fibroblast NIH / 3T3 and neuroblastoma Neuro-2a cells have previously been shown to be non-permissive for EV71: BS infection, and Vero cells have also been demonstrated (tact or [71]). EV71: Two strains derived from BS , EV71: TLLm and EV71: TLLmv , successfully entered and replicated in the rat cells. To determine whether the EV71: BS genome could be replicated in the non-permissive cells, genomic RNA was extracted from EV71: BS and transfected with Vero, NIH / 3T3, and Neuro-2a cells. Similarly, genomic RNA from EV71: TLLm and EV71: TLLmv was transfected into these three cell lines for comparison. To assess the viability of the resulting viral descendants, the transfection supernatant was subsequently re-inoculated onto new cells (Figure 15A).

Genomic RNA transfection of all three viral strains into Vero cells induced a lytic cell degenerative effect (CPE) in the monolayer of the transfected cells (Fig. 15B). Viral antigen expression was also observed in dead cells (Fig. 15C), indicating successful viral replication. Similar results were observed from the transfection of EV71: TLLm or EV71: TLLmv viral RNA into NIH / 3T3 and Neuro-2a cell monolayers (Fig. 15B and 15C). On the other hand, transfection of EV71: BS RNA with NIH / 3T3 and Neuro-2a cells showed viral antigen expression, but induced the death of some cells that did not express the whole CPE of the cell monolayer. Induction of complete lysis of the cell monolayer (Fig. 15D) and detection of viral antigen in dead cells (Fig. 15E) with an additional passage of EV71: BS transfection supernatants from NIH / 3T3 and Neuro- Lt; / RTI &gt; However, the passage of transfection supernatant on new NIH / 3T3 cells failed to obtain CPE (Figure 15D) or viral antigen expression (Figure 15E).

Example 11

Mouse cell lines - Encapsulated -encodings P1 region of adapted EV71: TLLm responsible for successful virus entry into murine and NIH / 3T3 and Neuro-2a cells

Previous analyzes suggested that capsid proteins of EV71: TLLm and EV71: TLLmv may be responsible for successful entry into NIH / 3T3 and Neuro-2a cells (tact or [71]). To confirm this, a full-length cDNA clone of the EV71: BS genome was generated by standard reverse genetics. EV71: The P1 (capsid) region of the full-length cDNA clone of BS was subsequently replaced by the genetic sequence of EV71: TLLm P1 , resulting in a chimeric plasmid clone (Fig. 16A). The EV71: BS cDNA clone was transfected with Vero cells to generate clone-derived virus (CDV: BS). Similarly, the chimeric clone was transfected to produce CDV: BS [M-Pl] , which expresses the capsid protein of EV71: TLLm and expresses the non-structural protein of EV71: BS . The CDV was re-inoculated on various cell lines to evaluate the infection phenotype (Figure 16B).

EV71: BS clone-derived virus ( CDV: BS ) induced CPE in Vero cells but failed to induce CPE in NIH / 3T3 and Neuro-2a cells and CDV: BS [M-P1] CPE was induced (hpi) 48 hours after inoculation (Fig. 16C). CDV: Rat cells infected by BS [M-P1 ], but not infected with CDV: BS, showed detection of viral antigen in dead cells (Fig. 16D). To analyze the generation and release of live virus offspring in the first passage ( P1 ), the purified culture supernatant from the infected cells was re-inoculated onto a new single layer of the same cell line and the virus yield was measured at 72 hpi. The passage of CDV: BS and CDV: BS [M-P1] on Vero cells showed high viral titers and a significant increase in the titer was observed after an additional pass P2 (Fig. 16E). On the other hand, CDV: BS [M-P1 ] , but, CDV: BS is not subcultured (P1), two NIH / 3T3, and gave the highest virus yield in Neuro-2a cells (Figure 16F).

Example 12

EV71: VP1-L169F amino acid substitution in BS capsid allows the virus to enter the murine cell and induce a limited infection.

The capsid protein of mouse cell-adapted EV71: TLLm could enter EV71: BS into murine cells and we were interested in the identity of the specific residues that provided the novel phenotype. EV71: Previous data for comparison of the polyprotein sequence alignment of the BS and mouse cell-adapted EV71 strains showed multiple amino acid substitutions in the VP1 and VP2 proteins that could be involved in viral receptor binding on the host cell [71]). The residues include VP1 K98E, E145A, and L169F, as well as VP2 S144T and K149I. To determine if the amino acid substitution is necessary for mouse cell entry, individual mutations leading to the amino acid substitutions were introduced into the EV71: BS full-length cDNA clone by standard site-directed mutagenesis (Fig. 17A). The modified cDNA clones were independently transfected into Vero cells to produce clone-derived virus (CDV), and the harvested supernatant was inoculated onto newly-seeded Vero, NIH / 3T3, and Neuro-2a cells The phenotype was evaluated.

Vero cells infected with all variant clone-derived viruses (CDV) showed 100% CPE but only CDV- CDV: BS _VP1 [K98E] , CDV: BS _VP1 [E145A] , and CDV: BS _VP1 [L169F] - induced 100% CPE in Neuro-2a cells (FIGS. 17B and 17C). Viral antigen expression was detected in Vero and Neuro-2a cells infected with CDV containing amino acid substitutions in VP1 ( CDV: BS _VP1 ) and VP2 ( CDV: BS _VP2 ), but only NIH / 3T3 cells infected with CDV: BS _VP2 (Figure 17D and 17E). In addition, Vero cells infected with all variant CDVs yielded measurable viral titers (Fig. 17F), indicating viral viability and only CDV: BS _VP1 [L169F] infected NIH / 3T3 and Neuro- 2a &lt; / RTI &gt; cells (Figure 17G). However, additional passages failed to induce infection on healthy murine cells with culture supernatants from NIH / 3T3 and Neuro-2a cells infected with CDV: BS _VP1 [L169F] .

Example 13

Effective proliferative infections in rat cells require combined amino acid substitutions in VP1

It EV71 to combine amino acid substitutions in the VP1 and VP2: In order to evaluate whether the system can be entered a BS in mouse cells, a variety of combinations of amino acid substitutions (BS _VP2 [S144T / K149I], BS _VP1 [K98E / E145A], BS _VP1 [ K98E / E145A / L169F ] , and BS [VP1 / VP2] ) and a full-length genomic cDNA clone of EV71: BS were generated (Fig. 18A). The plasmid clones were independently transfected onto Vero cells and the obtained supernatant was used to inoculate Vero, NIH / 3T3, and Neuro-2a cells to evaluate the infection phenotype.

CDV: All analyzed CDVs, except for BS _VP2 [S144T / K149I] , induced CPE in Vero and Neuro-2a cells (Fig. 18B). Viral antigens were also detected in all cells infected with various CDVs, but immunostaining was more prominent in Neuro-2a cells than in NIH / 3T3 cells when compared to murine cell lines (Fig. 18C). High viral titer was measurable in the culture supernatant of Vero cells infected with CDV (Fig. 18D) and only CDV: BS _VP1 [K98E / E145A] and CDV: BS _VP1 [ K98E / E145A / L169F ] As can be seen, viable titer of infected NIH / 3T3 and Neuro-2a cells yielded measurable viral titers (Fig. 18E).

Example 14

EV71: BS virus with amino acid substitutions combined in VP1 K98E, E145A, and L169F can be successfully delivered in mouse Neuro-2a cells.

Four clones derived from a virus isolate is EV71: BS is cultured mouse cells: CDV: BS [M-P1 ], CDV: BS VP1 [L169F], CDV: BS VP1 [K98E / E145A], and CDV: BS _VP1 [K98E / E145A / L169F] to enter and infect. To confirm that the CDV stably infects mouse cells for a number of cycles, the virus supernatant was passed from the second passage, i.e., Neuro-2a, to the new Neuro-2a cells in the same cell line. Infection was monitored by evaluation of CPE induction and viral antigen expression, and generation of viable viral descendants.

Only CDV: BS _VP1 [ K98E / E145A / L169F ] and CDV: BS [M-P1] were detected in Neuro-2a (Fig. 19B) as evidenced by detection of viral antigen Cells could be successively passed through in the cells. Positive staining was observed in both passages 2 and 3, and an increase in viral titers was recorded in the second passage compared to passage 1. On the other hand, only CDV: BS [M-P1] could induce the expression of viral antigens in NIH / 3T3 cells (Fig. 19A), but no viable viral descendants were detected. Genomic sequencing of CDV: BS _VP1 [ K98E / E145A / L169F ] derived from the third passage in Neuro-2a cells showed no change in the introduced amino acid mutations (Fig. 19C).

Example 15

Mouse cell line-adapted strain EV71: TLLmv is associated with SCARB2 protein in in vivo and in vitro

EV71 has been demonstrated to use the Scavenger Receptor Class B Member-2 (SCARB2) protein as its receptor for host cell entry [47]. Competitive virus binding assays were performed to confirm whether the mouse cell line-adapted EV71 strain used SCARB2 during infection of mouse cells. First, a Teflon-and grown overnight in the coated slide, 4% paraformaldehyde mildly immobilized NIH / 3T3, and Vero cells, as were incubated with rabbit serum to mouse SCARB2 protein (mSCARB2), then live EV71: TLLmv and the Bit . Bound cells were fluorescence detected using plate-enterovirus monoclonal antibody and fluorescence intensity was quantified. Preincubation of anti-mSCARB2 serum and NIH / 3T3 cells resulted in a significant reduction of EV71: TLLmv binding (Fig. 20A), which was not observed when cells were pre-incubated with nonspecific serum (NSP). Similar results were observed using Vero cells (Figure 20B).

In a second experiment, live EV71: TLLmv was incubated with recombinant soluble SCARB2 protein and then inoculated onto seeded NIH / 3T3 cells and infected by fluorescence tagging of bound plate-enterovirus monoclonal antibody Was evaluated. Availability Pre-incubation of mSCARB2 and virus reduced the severity of cell infection in a dose-dependent manner (Figure 20C). Similar results were obtained when human SCARB2 (hSCARB2) protein was used in the pre-incubation.

Example 16

EV71: Cell infections by TLLmv blocked by preincubation of mouse cells with increased serum for SCARB2 protein

To evaluate whether cellular infections are reduced by blocking the interaction of SCARB2 with EV71: TLLmv , seeded NIH / 3T3 cells are incubated with various dilutions of SCARB2 protein antiserum, then inoculated with live EV71: TLLmv , Infection was assessed by measuring the titer of living virus offspring. Preincubation of cells with low dilutions of hSCARB2 antiserum (1: 20-1: 80) resulted in a significant dose-dependent reduction of viral titer compared to the control group (Fig. 20E). Similar results were obtained when the cells were preincubated with the mSCARB2 antiserum (Fig. 20F).

Example 17

CDV: BS [M-P1] and CDV: BS _VP1 [ K98E / E145A / L169F ] used murine and SCARB2 proteins as their functional receptors for entry into murine cells

Two CDVs: BS [M-P1] and CDV: BS _VP1 [ K98E / E145A / L169F ] stably infected mouse Neuro-2a cells. Similar to mouse cell-adapted EV71: TLLmv strains, Neuro-2a cells were incubated with mSCARB2 antiserum and then infected with the CDV variants to determine whether the CDV also used mSCARB2 for virus entry and uncoating . The dose-dependency reduction of the lytic CPE is shown in CDV: BS _VP1 [ K98E / E145A / L169F ] (Figure 21A) or CDV: BS [M-P1] (Figure 21B). There was no significant difference in the titers of CDV: BS _VP1 [ K98E / E145A / L169F ] viruses in cells pre-incubated with SCARB2 antiserum compared to the control group by titration of culture supernatant 7 days after infection (dpi) (Fig. 21C). Meanwhile, significant viral titer reduction was detected in CDV: BS [M-Pl] - infected cells pre-incubated with serum in conjunction with the control group (Figure 21D).

Example 18

Materials and Methods for Example 19

Animal Models : To determine the animal infection phenotype of mouse cell-adapted strains ( EV71: TLLm and EV71: TLLmv ), 5-6- day-old Balb / c mice were infected with 10 ⁶ CCID ₅₀ of the virus, Symptoms and nervous system complications were observed. The animal was observed for up to 28 days, after which the animal was sacrificed and serum was collected for detection of the EV71-specific antibody.

Example 19

Neuroprotective study of mouse cell line-adapted EV71 ( EV71: TLLm and EV71: TLLmv ) in Balb / c mice

EV71: Two of the immune-competent animals infected with TLLm (n = 7) died from severe and sustained (> 24 hours) paralysis on day 8 after inoculation (29%) (FIG. 3A). Of the other surviving mice, 5 (5/7, 71.4%) showed tremor and malfunction, and 5 showed incomplete paresis in one or both hind limbs and 4 / 7, 57.1%) showed transient paralysis in one or both of the hindlimbs. On the other hand, animals infected with EV71: TLLmv exhibited clinical symptoms of a more serious disease. Nine of the 10 infected animals (90%) died of the disease within 8 days of infection (Fig. 13A), where 6 out of 9 (66.7%) died on the fourth day after infection. Other manifestations include numbness (5/10, 50%) in tremor (5/10, 50%), incomplete paralysis in one or both of the hind legs (6/10, 60%), and in one or both of the hind legs. There was no difference in body weight of mice infected with EV71: TLLm as compared to infected animals, and mice infected with EV71: TLLmv showed a significant decrease in body weight within the first 10 days after infection (Fig. 13B). More interestingly, the inventors observed new symptoms in EV71-infected mice, and as a result, the paralyzed animals (Fig. 14A, arrow) exhibited remarkable ribbing and rapid breathing. In addition, six out of 9 (66.7%) lethal ratios showed the above symptoms and were euthanized. At the time of autopsy, lung collapse was observed at the time of opening the thoracic cavity, which is a normal procedure in autopsy when collecting lung and heart tissue (FIG. 14B, arrow), indicating the presence of pulmonary edema. Histological examination of the tissue showed pulmonary edema and hemorrhage in the lung alveolar space (FIG. 14C), and high magnification images showed the presence of homogeneous proteinaceous material (FIG. 14D, arrow).

This example was also performed using an immunostimulated mouse, such as an NSG mouse. Similar results were obtained except that the severity of the illness was greater and the mortality rate was higher.

Example 20

Screening for candidate anti-EV71 compounds

Fast high - throughput bit screening of the candidate anti-EV71 compound was performed using a mouse NIH / 3T3 cell line that was shown to be responsive to cell lytic infection by the EV71: TLLm or EV71: TLLmv viral strain. This promising compound selected from in vitro screening were then tested in in vivo animal models. In order to achieve the above in vivo screening, BALB / c number (based on a statistical calculation) standardized mouse, have been manufactured, and the appropriate, deep freezer (-80 ℃) a mouse cell lines stored at-adapted strain EV71 (EV71 : TLLm and EV71: TLLmv ). Wherein said candidate anti-EV71 compound is administered at various standardized doses, prior to the appearance of the disease for the analysis of the potential prophylactic effect of said candidate compound, or after the onset of the disease for the analysis of the potential therapeutic effect of said candidate compound, Lt; / RTI &gt;

Example 21

Materials and Methods for Examples 22-25

Mouse and Viral Strain : Adult BALB / c mice were purchased from InVivos (Singapore) and mated to obtain pups. The EV71 strains used for inoculation include EV71: BS , EV71: TLLm , and EV71: TLLmv , the details and characteristics of which have been described herein.

Ethical regulation : The animal study was approved by the Institutional Care and Use of Animal Committee (IACUC) of the Temasek Lifesciences Laboratory (approval number TLL-14-023). The infected animals were euthanized by injecting pentobarbitone at 90 mg / kg via IP route. Neurological examinations were performed according to guidelines and standard tests established by the Institutional Care and Use of Animals Committee of the University of California, San Francisco (IACUC). Euthanasia standards include previously established guidelines [34]: (1) a maximum recorded weight loss of> 20%, (2)> 48 h persistent paralysis, (3) no ingestion or loss of ability to ingest (4) the loss of self-right ability, and (5) the altered state of consciousness that appears as stupor and coma. The pups were observed for a total of 28 days, and surviving animals over the period were euthanized by IP injection of Pentobarbitone.

Animal Handling and Infections : Groups of 8 mice of various ages (6, 14, 21, or 28 days of age) were immunized by IP or IM injection with EV71: TLLmv (Dose 10 ⁶ CCID ₅₀ ) were inoculated. EV71: To determine the optimal dose of TLLmv , a group of 6-day-old pups (n = 8 per group) received various doses of virus (10 ⁶ , 10 ⁵ , 10 ⁴ , 10 ³ , or 10 ² CCID ₅₀ ) It was challenged via the IP path. Infected animals were observed twice a day for disease symptoms during the first week after infection. Blood-dead animals and animals that survived the observation period were euthanized as described above. End blood collection was performed by cardiac puncture using a 26G needle.

Autopsy, gross pathological observation and tissue collection : Euthanasized animals were autopsied using standard protocols and organs were collected. A gross pathological examination was also performed and a photograph was taken by IACUC approval. The lungs were rinsed twice with sterile PBS twice, then blotted dry on filter paper, and the wet weight was measured. For histological studies, harvested organs were stored in 10% neutral buffered formalin (NBF) for 1 week at 4 ° C.

Determination of tissue virus load: Frozen tissue was softened using a Teflon pestle and reconstituted in 1 ml DMEM (1% FBS). The samples were then mixed for 1 hour and centrifuged twice (20 g, 30 minutes, 4 캜) to remove tissue debris and a purified virus was obtained. The virus samples were disassembled in 1% sodium deoxycholate, then diluted 10-fold serial, and transferred onto NIH / 3T3 cells. Infected cells were observed daily for cytopathic effect (CPE) and cells were stained with plate-enterovirus monoclonal antibody (Merck Millipore, USA) [88]. Virus titers are listed and reported as CCID ₅₀ per gram of tissue.

Tissue treatment for histological analysis : Fixed tissue was dehydrated at a series of increasing concentrations of 70%, 95% and 100% ethanol. The tissue was incubated with Alcohol 2 changes and Histoclear II (Electron Microscopy Sciences, USA) 3 changes, and finally with 4 changes of the molten Paraffin wax. All incubations were performed with gentle shaking at 100 rpm for 1 hour at room temperature. Paraffin infiltration was carried out in an oven set at 65 ° C. The paraffin-embedded tissue block was cut using a microtome (5 占 퐉), loaded onto poly-lysine-coated glass slides, dried overnight at 42 占 폚, then stored at room temperature for the next use .

Dyeing of tissue section: The tissue section was rehydrated by removing the wax by incubation with 2 changes of Histoclear II, and then slowly reducing the alcohol concentration to 100%, 95%, 70%, and 50%. The slides were incubated in PBS for 10 minutes, and then stained. Hematoxylin and eosin (H & E) staining was performed by first flowing Harris hematoxylin (Sigma Aldrich, USA) onto the slides and incubating for 15 minutes at room temperature (RT). The slides were then rinsed with water and decolored with 1% acid alcohol (95% ethanol, 1% HCl), soaked in 0.2% NH4OH, rinsed with water for 10 minutes and counter-stained in eosin solution. The slide was then decolorized with 95% ethanol and dehydrated with 3 changes of pure alcohol and 2 changes of Histoclear II. The tissue was finally fixed in DPX mounting fluid (Sigma Aldrich, USA).

Immunohistochemistry : After de-waxing and rehydration, heat-induced antigen recovery was performed by incubating the slides in a histology-grade microwave oven and citrate buffer (pH 6.0) for 30 minutes at 96 ° C . Slides were cooled to RT over 3 hours and subsequently blocked with 5% normal pig serum for 1 hour at RT. Without additional washing, the slides were then incubated overnight at 4 ° C in rabbit serum (obtained from Dr. Hiroyuki Shimizu of NIID Japan) containing polyclonal antibody against EV71. After the slide that tris- was washed five times with buffered saline (pH 7.4), 0.05% Tween -20 (TBS-T), were rinsed two times in TBS, 3% and then at RT for 1 hour, H ₂ O ₂ was quenched into endogenous peroxidase. The slides were then washed twice with TBS and incubated with swine-anti-rabbit Ig-HRP (Dako Cytomation, Denmark) for 1 hour at RT. After washing, the slides were incubated in a diaminobenzidine (DAB) substrate and counter-stained with hematoxylin.

Mapping of viral antigen and virus-induced lesions in tissue sections : Template images of representative coronal sections of the mouse brain were downloaded from the www dot brainstars dot org [89]. The image may be freely used and modified under the license of Creative Commons Japan. The observed lesions and viral antigens were displayed on the template images. The affected areas of the brain were identified using a mouse brain map of the coronal section (www dot dot dot brain slice static slash atlas) [90]. Similarly, a representative coronal section of the thoracic spinal cord was used as the template for the spinal cord map. Areas representing the presence of virus antigens and virus-induced lesions were displayed on the template images.

Measurement of Serum Catecholamine Levels : Blood samples were collected by cardiac puncture in an empty animal during autopsy. Serum-clotted blood samples were obtained by centrifuging 3000 g at 4 캜 for 30 minutes and then catecholamine level determination using a 2-CAT (AN) ELISA kit (Labor Diagnostika Nord, Germany) according to the manufacturer's protocol Lt; RTI ID = 0.0 &gt; -20 C. &lt; / RTI &

Statistical Analysis : All graphs were formed and statistical analysis was performed using GraphPad Prism for Windows (version 6.01) (GraphPad Software, USA, www dot graphpad dot com).

Comparison of infection phenotype induced by virus strain EV71: TLLm and EV71: TLLmv : EV71: BS , EV71: TLLm , VEGF , VEGF , Or 106 CCID50 doses of EV71: TLLmv (n = 10 mice per group). Animals were observed twice a day for signs of disease during the first week after inoculation and euthanized if severe symptoms were detected as previously described,

Measurement of antibody levels neutralizing in serum from infected mice : Blood samples were collected by cardiac puncture at autopsy, coagulated at room temperature, and sera were obtained by centrifugation at 3000 g, 4 ° C for 20 minutes. Samples were stored at -20 ° C until further analysis. To neutralize antibody titers, random samples of frozen raw material were analyzed. A twofold serial dilution (1: 20-1: 1280) of serum was prepared in 96-well plates and mixed with 100 CCID ₅₀ viruses. The mixture was incubated at 37 [deg.] C for 1 hour and NIH / 3T3 cells (6,000 cells / well) were added. Plates were incubated at 37 [deg.] C for several days and CPE was observed between 4-10 days. Neutralization of antibody titers was determined using the Reed and Muench method (reported in units per ml of serum).

Example 22

Infection Dynamics of the EV71 strain transformed from the rat host

Current animal models of Enterovirus 71 (EV71) -induced neurological disease and pathology replicate some human disease. Therefore, the present inventors aim to develop a clinically approved model of disease pathology using mouse cell (NIH / 3T3) -treated virus strains EV71: TLLm and EV71: TLLmv , Can be proliferatively infected [88]. First, the relative pathogenesis of EV71: TLLm and EV71: TLLmv was assessed by evaluating disease pathology in 1 week old BALB / c mice infected with the virus via the intraperitoneal (IP) route, compared to parental strain EV71: BS . Seroconversion was observed in all inoculated animals, and EV71: TLLm Or only mice infected with EV71: TLLmv progressed to a fatal disease (Figures 22a and 22b). Similarly, when the adapted strain was administered with an alternative intramuscular (IM) route, it was associated with reduced host survival (57% viability; Figure 22c) for the parental strain EV71: BS . When the IP and IM infection pathways are considered together, the median survival time after inoculation is EV71: TLLmv (DPI) for 4 days, EV71: TLLm It was 7 DPI for infection ( x ² = 6.840; p = 0.0089). The data also indicated that the mouse cell-adapted virus strain EV71: TLLmv was associated with the highest level of lethality and therefore was used in all subsequent experiments.

The optimal virus dose, inoculation route, and mouse age for use in future model development were evaluated next. First, disease severity in EV71: TLLmv -infected mice depends on viral load; The minimum survival rate was observed in animals inoculated with an intermediate cell culture infectious dose of 10 ⁶ (CCID ₅₀ ) (Fig. 23a) and the median humane endpoint (HD ₅₀ ) was equivalent to 3.98 x 10 ³ CCID ₅₀ 23b). The effects of animal age and route of infection on host survival were then assessed; EV71: The survival curves of 1 week old mice injected with TLLmv were not significantly affected by the inoculation route (Fig. 23c), but regardless of the site of viral injection, young animals had a somewhat poorer survival (Fig. 23D). Only the older animals were able to identify the effect of the infection route on the severity of the disease; Three-week-old mice showed complete resistance to IP infection, and some animals did not survive viral injection via the IM path (Figs. 24A and 24B). Seroconversion was detected in all mice surviving the infection, including those that did not exhibit symptoms of the disease (Figures 24c, 24d and 24e). The data demonstrate that EV71: TLLmv causes acute and severe infections that can kill mice 1-3 weeks old. Of the conditions tested here, disease severity was highest in 1-week-old mice injected with a virus dose of 10 ⁶ CCID ₅₀ into the peritoneal cavity or muscle tissue.

Example 23

EV71: TLLmv - disease progression in infected mice

EV71: Most of 1 week old mice inoculated with TLLmv died of disease and showed a number of clinical symptoms of neurological diseases. Infected animals exhibited failure, local or systemic tremor, unsteady gait, and limb incomplete paralysis and temporary or permanent paralysis until they were euthanized. Based on clinical symptoms, sick animals were grouped into four groups (Table 6). Survivors included mice that did not exhibit a blunted state at any point during the 28 day observation period. Class I animals exhibit severe symptoms including loss of ability to self-consciousness and confusion or coma after 3-7 DPI. All mice in this group exhibited spastic limb incomplete paralysis and / or paralysis (forelimb, hind leg, or both), but some animals did not have respiratory symptoms ( class IB ), others were fast breathing, hiccupping ), Gasping, and rib-back bite ( class IA ). Characterization of EV71: TLLmv -infected mice indicating class IA symptoms of the disease was performed by video containing two video clips of two different class IA mice. Both animals were unconscious and were in a coma. Severe dyspnea manifested by ribbing and rapid breathing was demonstrated in the first mouse. Foam fluid from the panting, ribbing, and nostrils was observed in the second mouse. Characterization of EV71: TLLmv -infected mice, indicating class IB symptoms of the disease, was performed by video of one class IB mouse. The animal was unconscious and was in a mixed state. Ipsilateral paralysis of the right limb and continuous tremor of the left hind limb were also observed. Finally, class II mice exhibited symptoms of infection, including severe limb weight loss (> 20% maximal body weight), including flaccid paralysis of the limbs (> 48h duration) after 7 DPI (Figure 23e) . In all disease classes, some of the infected animals exhibited hair loss lesions or bald spots that persisted for several days (Figure 23f). EV71: Most of the IPs inoculated with TLLmv were classified as Class I (Figure 23g); Class IA animals consisted of 19.3% (n = 11; apparent respiratory symptoms), class IB The animals consisted of 43.9% (n = 25; no apparent respiratory symptoms). Class II 4 animals exhibited only 12.3% (n = 7) of the infected pups, and survivors consisted of 24.5% (n = 14) of all infected mice. A similar pattern of distribution between disease categories was observed in infants immunized with the IM route (Figure 23h). The data also showed that mice infected with EV71: TLLmv exhibited various incidence and severity of neurological and respiratory symptoms reflecting the full spectrum of disease observed in human patients.

Clinical characteristics of EV71: TLLmv -infected BALB / c mice at euthanasia Class IA class IB Class II Survivor ^a The time of onset of symptoms [days after infection (DPI)] Within 3-5 days Within 3-7 days > 7 N / A Level of consciousness Confusion ^b / coma ^c Confused ^b activation activation Weight loss <20% body weight <20% body weight > 20% body weight No or <20% body weight Limb function (> 48 h) Stiffness Limb incomplete paralysis / paralysis Stiffness Limb incomplete paralysis / paralysis Relaxing limb paralysis normal Breathing function Fast breathing / panting / hiccups regular regular regular Cardiac function Tachy Tachycardia ^d / regular regular regular Limb tremor May appear May appear none none

^a Animals were evaluated at the end of the observation period (28 DPI).

^{b The} animal did not have any self-conscious, but responded to physical stimulation of the toes.

^{c The} animal was unconscious and did not respond to the physical stimulation of the toes.

^d Tachycardia is 35% of class IB Lt; / RTI &gt;

Example 24

Neurogenic pulmonary edema in mice exhibiting Class IA symptoms

It was further investigated whether dyspnea observed in Class IA mice was a symptom of virus-induced pulmonary edema (PE). Comparisons of visual lung pathology between Class IA, Class IB , and Class II mice resulted in swelling of Class IA lungs, incomplete collapse at autopsy (Figs. 25a-25d), and increased wet weight (Fig. 22E). Comparison of lung tissue sections from sham-inoculated (Fig. 25f) lungs and Class IA lungs showed the foci of the accumulation and appearance of proteinaceous and erythrocyte-filled fluids in the alveolar space of the infected animal 25g). The pathological features were absent in the lungs of Class IB and Class II mice (Figures 25h and 25i). In addition, the inventors were unable to find evidence of inflammatory infiltration or viral antigen in the lungs collected from any mouse group (Fig. 26A). Similarly, histochemical analysis of myocardium in each class of infected mice does not include any evidence of inflammatory infiltration, myocardial necrosis or viral antigen (Fig. 26B). The data also demonstrate that respiratory distress evidence in Class IA mice is not due to pneumonitis or congestive heart failure. Therefore, the present inventor was trying to determine whether the PE observed in the above group was a neurogenic origin, and the present inventors then determined whether neurotransmitter concentrations in the EV71: TLLmv -infected mice ( class IA ) with respiratory signs were controlled The serum levels of catecholamines were measured. Using this approach, it was observed that the blood concentrations of both adrenaline (epinephrine) and noradrenaline (norepinephrine) were significantly higher in the class IA mice than those detected in class II mice or infected animals And 25k). The data strongly indicated that Class IA mice exhibited EV71-induced neurogenic pulmonary edema (NPE) before their death.

Example 25

In Class IA, Class IB and Class II mice, EV71: TLLmv Neurotropism

The distribution of EV71: TLLmv and virus-induced lesions in the brain and spinal cord of animals from each disease group was evaluated in order to identify factors that could contribute to the selective development of NPE in Class IA mice only. Most of the animals in Class IA and Class IB exhibited ubiquitous staining of viral antigens (> 10 detected positive neurons) and mild pathological lesions (> 5 observed lesions) in all evaluated CNS regions (Table 7). In contrast, only one out of five mice with Class II disease showed viral antigen and / or lesions in the sensory cortex, hippocampus, brainstem, midbrain, soft tissue or lumbar spine. We could not detect viral antigen in any tissues tested outside the CNS (except skeletal muscle after inoculation via the IM path, data not shown).

[Table 7]

CNS distribution of EV71 antigen and virus-induced lesions in end-infected BALB / c mice

^a density of virus antigens detected per slide: +, <10 positive neurons; ++, 10-20 positive neurons; +++,> 20 positive neurons.

^b The percentage of animals expressing viral antigens in the specified brain region (n = 5)

^c Distribution of pathologic lesions in neuron: +, <5 lesions; ++, 5-10 lesions; +++,> 10 lesions.

^d Ratio of animals showing lesions in the specified brain area (n = 5)

When CNS pathology between Class IA and Class IB mice was compared, it was observed that tissue lesions and viral antigens were confined to the same sites within the hippocampus, jaundice, midbrain, cerebellum, and soft tissues, but pathology was observed in animals with Class IA disease (Table 7 and Figures 27a-27d). Indeed, compared to Class IB mice, Class IA animals exhibited broader neuronal cell degeneration, phagocytosis and necrosis than in hippocampal CA3 neurons (Figures 28a and 28b). Class IA mice also exhibited concentrated viral antigen staining in the hypothalamus, accompanied by marked tissue inflammation and neuronal cell necrosis, whereas these pathological features were limited in Class IB animals (Figures 28c and 28d and Figure 27b). Similarly, class IA mice also have a ventral-posterior complex (Figs. 28e and 28f and 27b) of the sagittal, midbrain-related tissues including gray matter (PAG) material, midbrain reticular sites, Induced pathology and virus antigenic strength in the cerebellar furkiney cells and tooth nuclei (Figures 28i and 28j, Figures 27d and 29a) as well as in the cerebellum Respectively.

In both disease groups ( Class IA and Class IB ), the most extensive distribution of pathological lesions, including viral antigen and nerve damage and tissue inflammation, was found in soft tissues (Figs 28k and 28l), in particular in intermediate reticular nuclei (IRN) , The parvicellular reticular nuclei (PARN) and the spinal nucleus of the trigeminal nerve (sptV) (Fig. 27d and Fig. 29b). However, only Class IA mice showed viral antigen and histological lesions in the dorsal and dorsal regions of the soft tissue nucleus (MdRN), isolated nucleus (NTS), and bottom zone (AP) (FIGS. 29b and 29c). For comparison, representative images of the hippocampus, hypothalamus, thalamic, midbrain, cerebellum, and soft tissue were also disclosed from the infected mice (Figs. 30A-30F). In contrast, Class IA and Class IB mice did not differ in regard to the distribution, location, or extent of tissue lesions or viral antigen staining in the motor cortex, somatosensory cortex, lumbar or ventral horn of spinal gray matter (Figures 28m and 28n, Figures 27a-27c and Figures 31a-31e), consistent with the notion that NPE is caused by virus damage to certain brain regions rather than a uniform increase in EV71-induced pathology in all tissues .

The use of the terms "a" and "an" and "the" and similar articles in the context of disclosing the invention (especially in the context of the following claims) Shall be construed to cover one, the singular and the plural. The terms "comprising," " having, "" including ", and" containing ", unless the context requires otherwise, Quot; including, but not limited to, " It should be understood that the enumeration of ranges of values herein is merely for the purpose of providing, in an abbreviated manner, each individual value falling within its scope, unless otherwise indicated herein, and each individual value, Lt; / RTI &gt; All methods disclosed herein may be performed in any suitable order, unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples or exemplary language (e.g., "such as") provided herein is intended to better describe the invention, unless otherwise claimed, Not limited. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the invention.

Embodiments of the present invention, including the best mode known to the inventors for carrying out the present invention, are disclosed herein. Modifications of the above embodiments will become more apparent to those of ordinary skill in the art by reading the foregoing detailed description. The inventors expect the skilled artisan to make appropriate use of such variations, and the inventors contemplate that the invention will be practiced otherwise than as specifically described herein. Accordingly, the present invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by law. Furthermore, unless otherwise indicated herein or otherwise clearly contradicted by context, any combination of the foregoing elements in all possible variations thereof is included in the present invention.

references

                         SEQUENCE LISTING <110> Temasek Life Sciences Laboratory Limited   <120> Enterovirus 71 Animal Model <130> 2577-243PCT &Lt; 150 > US 62 / 114,880 <151> 2015-02-11 <150> US 62 / 108,828 <151> 2015-01-28 <160> 23 <170> PatentIn version 3.5 <210> 1 <211> 7438 <212> DNA <213> Enterovirus 71: TLLm <400> 1 ttcaaacagc ctgtgggttg cacccactca cagggcccac gtggcgctag cactctggtt 60 ctacggaacc tttgtgcgcc tgttttacgc cccttcccca atttgcaact tagaagcaat 120 acacaacact gatcaacagc gggcatggcg caccagctat gtcttgatca agcacttctg 180 tttccccgga ccgactatca atagactgct cacgcggttg aaggagaaag cgtccgttat 240 ccggctaact acttcgaaaa acctagtaac accattgaag ctgcagagtg tttcgctcgg 300 cacttccccc gtgtagatca ggtcgatgag tcactgcaat ccccacgggt gaccgtggca 360 gtggctgcgt tggcggcctg cctatggggc aacccatagg acgctctaat gcggacatgg 420 tgcgaagagt ctattgagct agttagtagt cctccggccc ctgaatgcgg ctaatcctaa 480 ctgcggagca catgccttca acccagaggg tagtgtgtcg taatgggcaa ctctgcagcg 540 gaaccgacta ctttgggtgt ccgtgtttcc ttttattctt atattggctg cttatggtga 600 caattacaga attgttacca tatagctatt ggattggcca tccggtgtgc aatagagcta 660 ttatatacct ttttttttgg ctttgtacca ctaaccttaa aatctataat caccctcgac 720 tttatattaa ccctcaacac agtcaagcat gggctcacag gtgtccactc agcgatccgg 780 ctcccacgag aactccaatt cagctacagg aggctccacc attaattaca ctaccatcaa 840 ctattacaaa gactcctatg ctgcgacagc gggcaaacag agcctcaaac aagaccctga 900 taagtttgct aaccctgtca aggacatttt cactgaaatg gctgcgccac tgaagtctcc 960 atccgctgaa gcttgtggtt acagtgatcg cgtggcacaa ctcaccattg gaaactccac 1020 cattactaca caggaggcgg caaacatcat agttggttac ggtgagtggc cctcatactg 1080 ctctgatgac gacgctacag cggtggacaa accaacgcgc ccagatgttt cagtgaatag 1140 gttttataca ctggacacta aactgtggga aaagtcatcc aaggggtggt attggaagtt 1200 tcctgatgtg ttgactgaga ccggagtctt tggccagaac gcacagtttc actatttgta 1260 taggtcaggg ttttgcattc atgtgcaatg taacgctagc aagttccatc aaggagcgct 1320 gttagtcgcc atacttccag agtatgttat agggacaata gcaggcggta caggaacaga 1380 ggacacccac cctccttaca tacaaacaca acctggcgcc gacggtttcg agctgcagca 1440 cccgtacgtg ctcgatgctg ggattcctat atcacaattg acagtgtgtc cccatcaatg 1500 gattaacctg cggaccaata actgtgccac aataatagtg ccatatatga acacactgcc 1560 tttcgactct gccctgaacc attgcaattt tgggctgttg gtagtaccca ttagcccatt 1620 agattttgac caaggggcaa ctccggttat ccctattaca atcactctag ctccaatgtg 1680 ctctgagttt gcaggtctca gacaggcagt cactcaaggc tttcccactg agccaaaacc 1740 aggaacgaat caattcttga ccaccgatga cggcgtctca gcacccattc taccaaattt 1800 ccatcccact ccatgtattc acatacccgg tgaagtcaga aacctgcttg agttgtgtca 1860 agtggagact attcttgagg ttaacaacgt acccaccaat gctaccagtc tgatggaaag 1920 gctacgattc ccggtgtccg cgcaagcggg gaaaggtgaa ttgtgtgccg tgtttagggc 1980 cgaccctgga agagacggtc catggcaatc aacaatgctg ggccagttgt gtggatatta 2040 cacccagtgg tcagggtcac tggaggtcac ttttatgttt accgggtctt tcatggccac 2100 aggtaaaatg ctcatagctt atacacctcc tggcggcccc ttacccaaag atcgggccac 2160 agcaatgctg ggcacacatg ttatctggga ttttgggcta caatcatctg tcacccttgt 2220 aataccatgg attagtaata cccactacag ggcgcatgcc cgggatggag tgtttgacta 2280 ctataccaca ggactggtca gtatctggta tcaaacaaac tacgtagttc caattggggc 2340 acccaacaca gcttatataa tagcactagc ggcagcccag aagaatttca ccatgaaact 2400 gtgcaaagac accagtcaca tattacagac agcctccatt cagggagata gggtggcaga 2460 tgcgatcgag agctctatag gagatagtgt gagtagggca cttacccagg ccctgccagc 2520 acccacaggt caaaacacac aggtgagcag tcatcgacta gacactggcg aagttccagc 2580 gctccaagct gctgaaattg gggcatcgtc aaatactagt gatgagagta tgattgagac 2640 acgatgcgtt cttaactcac atagtacagc agagaccacc ttggacagtt tcttcagtag 2700 ggcaggtttg gtaggagaga tagatttccc tcttgagggt accaccaatc cagatggtta 2760 tgccaactgg gacatagaca taactggtta cgcacaaatg cgcaggaaag tggagctgtt 2820 cacctacatg cgctttgatg cggaattcac ttttgttgcg tgcactccta ctggtgcggt 2880 tgttccacaa ttactccagt atatgtttgt tccccctggt gctcccaaac cagagtctag 2940 agattcattt gcttggcaga cagccacaaa cccctcagtc tttgtcaagt tgactgatcc 3000 cccggcacag gtctcagttc cgttcatgtc acccgcgagc gcttaccagt ggttttacga 3060 cgggtacccc acgtttggag aacacaaaca ggagaaagac ctcgagtatg gagcgtgtcc 3120 taataatatg atgggcactt tctcggtgcg aaccgtgggg tcattaaagt ccaagtaccc 3180 cttggttgtc agaatatata tgagaatgaa gcatgtcagg gcgtggatac ctcgcccgat 3240 gcgcaaccaa aactatttgt tcaaagccaa cccaaactat gccggtaact ccattaagcc 3300 gaccggcact agtcgtactg ccattactac ccttggaaag ttcggccagc agtctggggc 3360 catctacgtg ggcaacttca gagtggttaa tcgtcacctc gctactcata atgactgggc 3420 gaacctcgtc tgggaagaca gctcccgcga cctattagtg tcgtctacca ccgctcaggg 3480 ctgtgataca attgcacgtt gtgactgtca aacaggagtg tactattgta attccaagag 3540 aaagcactat ccagtcagct tttctaaacc cagcctcata tatgtggaag ctagcgagta 3600 ttaccctgct agataccaat cgcacctgat gcttgcagtg ggccactctg agcccggcga 3660 ctgcggaggc atcttgaggt gtcaacatgg tgtagttggt atagtgtcca cgggtggcaa 3720 cgagctcgtt ggatttgctg atgtgaggga tctcttgtgg ttagatgaag aggccatgga 3780 gcaaggtgtg tccgactaca ttaaggggct cggtgatgcg tttggaacag gcttcactga 3840 cgctgtatcc agggaagttg aagcccttag gaaccacctt ataggatctg atggagcagt 3900 tgagaaaatc ctaaagaacc ttattaagct gatttcagcg ttagtaattg tgatcaggag 3960 cgattatgat atggtcaccc tcacagcaac tttagccctg attggttgtc atggaagtcc 4020 ttgggcttgg attaaagcca agacagcatc cattttaggt atccccatcg cccagaagca 4080 gagtgcttct tggctaaaga aatttaatga tatggcgagt gctgccaagg gtttagaatg 4140 gatatctaat aaaattagca agttcattga ctggctcagg gagaaaattg ttccagcagc 4200 taaggagaaa gcagaatttt taaccaattt gaagcaattg ccactattag agaaccagat 4260 cacaaattta gagcagtccg ctgcctcaca agaggacctt gaagctatgt ttgggaatgt 4320 gtcatacctc gcccatttct gtcgcaagtt ccaaccatta tacgccgcgg aagctaagcg 4380 agtctatgtt ctagagaaga gaatgaataa ctacatgcag ttcaagagca aacaccgtat 4440 tgaacctgta tgtctcatca ttagaggctc accaggcact ggaaagtccc ttgcgaccgg 4500 tatcattgct cgggccatag cagacaagta tcactctagt gtgtactcac ttccaccaga 4560 ccctgaccat tttgacgggt acaaacagca agtggttaca gttatggatg atctgtgtca 4620 raatcctgac ggcaaagaca tgtcattatt ttgccagatg gtgtctaccg tggattttat 4680 cccaccaatg gcttctctcg aagaaaaggg agtttctttc acatctaaat ttgttatcgc 4740 atccaccaac gctagcaaca ttatagtgcc tacagtgtca gactctgacg ccattcgtcg 4800 caggttttac atggattgcg acattgaggt gacagactca tacaaaacag atttgggtag 4860 actagacgct ggacgggctg ctaagctatg ctctgagaac aacaccgcaa acttcaaacg 4920 atgcagccca ctagtgtgtg ggaaagctat tcaacttaga gacaggaagt ctaaggtcag 4980 gtacagcgtg gacacagtgg tctctgaact tattagagaa tataatagca gatccgctat 5040 tggtaataca attgaagcac tattccaagg tccacccaag ttcaggccaa ttagaatcag 5100 tcttgaggag aagccagccc cagacgctat tggcgatctc ctcgctagtg tagatagcga 5160 ggaagtgcgc caatactgta gggagcaagg ctggatcatc cctgaaactc ccaccaatgt 5220 tgaacgacac cttaatagag cagtgctagt catgcaatcc atcgctactg tggtggcagt 5280 cgtctcactg gtgtacgtta tttacaagct ctttgcgggg tttcaaggtg cgtactctgg 5340 agctcccaag caaatgccca agaaacctgt cctccgtacg gcaacagtgc agggtccgag 5400 tcttgacttt gctctatcct tactgagaag gaacatcagg caagtccaaa cagatcaagg 5460 gcattttacc atgttaggtg tcagagatcg cttagccgtt cttccacggc actcacagcc 5520 cgggaagact atttgggtgg agcacaaact tgtgaacgtc cttgacgcag ttgagctggt 5580 ggatgagcag ggcgttaatt tggaactcac attggtgaca ctagatacta atgaaaaatt 5640 tagagatatc accaagttca ttccagagac cattagcggc gctagtgatg caactttagt 5700 gatcaacaca gaacatatgc catcaatgtt tgtcccagtg ggggacgtcg tgcagtacgg 5760 gttcttgaac cttagtggaa agccaactca taggaccatg atgtacaatt tccctacaaa 5820 agcaggacag tgtggaggtg tggtcacatc agtcggtaag attgttggca ttcacattgg 5880 cggcaacggg cgccaagggt tctgtgctgg tttgaagagg agttacttcg caagtgtgca 5940 gggtgagatc caatgggtga agcctaacaa ggaaactggt agactgaaca tcaatggtcc 6000 aactcgcact aagctggagc ctagtgtgtt tcatgatgtg tttgaaggta ataaggaacc 6060 agcagtttta acaagtaaag accctagatt ggaggtcgac tttgaacaag ccctgttttc 6120 caagtatgtg ggcaatgttt tacacgagcc cgatgaatac gtgattcaag ctgccctcca 6180 ctacgcgaat caacttaaac aattggacat agacactagc aagatgagca tggaggaagc 6240 gtgctatggc actgaaaacc tggaagcaat agacctctgc actagtgccg ggtacccata 6300 cagcgccctt ggtatcaaga aaagagacat tcttgacccc acaaccaggg atgtgtccaa 6360 gatgaaattc tatatggata aatacgggct agacctgcca tactctacct atgtgaagga 6420 tgagcttagg tccctggata aaatcaagaa aggaaaatca cgcttgatag aggctagtag 6480 cttgaatgac tctgtctacc ttagaatgac ttttgggcac ctttacgagg tgtttcatgc 6540 caaccctggc actgtgactg gctcagcagt gggttgcaac ccggacgtgt tttggagcaa 6600 actaccgatt ctgctgcctg ggtcactctt tgcctttgac tactcaggat acgatgctag 6660 tctcagcccg gtatggttca gggctctaga agttgtgtta cgggagattg ggtattcaga 6720 ggaggccgtg tccctaatag aagggatcaa ccacacccac catgtgtacc ggaacaaaac 6780 atactgtgta cttggtggaa tgccctcggg atgttctggt acttccatct ttaatacaat 6840 gatcaacaac atcatcatta gaaccctttt gatcaaaacc tttaagggaa tagacctgga 6900 tgagttgaac atggtggcct atggggacga tgtgctggct agttacccct ttcccattga 6960 ttgccttgag ttggctaaga ctggcaaaga gtatggtttg accatgacac ctgcagacaa 7020 atcaccctgt ttcaatgaag taacatggga aaatgctacc ttcctgaaga gaggattctt 7080 gccagaccac caatttccat tcttaattca ccctacgatg cccatgagtg agatccgtga 7140 gtccattcga tggactaaag acgcgcgcaa cacccaagat cacgtgcgct ccctgtgtct 7200 gttggcatgg cacaatggta aggatgaata tgagaagttt gtgagtgcaa ttagatcagt 7260 tccagttgga aaagcgttgg ccattcctaa tttcgagaac ctgagaagaa attggctcga 7320 attgttttaa tattacagct taaagctgaa ccccactaga aatctggtcg cgttaatgac 7380 tagtgggggt aaatttgtta taaccagaat agcaaaaaaa aaaaaaaaaaaaaaaaaa 7438 <210> 2 <211> 7421 <212> DNA <213> Enterovirus 71: TLLmv <400> 2 ttcaaacagc ctgtgggttg cacccactca cagggcccac gtggcgctag cactctggtt 60 ctacggaacc tttgtgcgcc tgttttacgc cccttcccca atttgcaact tagaagcaat 120 acacaacact gatcaacagg cggcatggcg caccagctat gtcttgatca agcacttctg 180 tttccccgga ccgagtatca atagactgct cacgcggttg aaggagaaag cgtccgttat 240 ccggctaact acttcgaaaa acctagtaac accattgaag ctgcagagtg tttcgctcgg 300 cacttccccc gtgtagatca ggtcgatgag tcactgcaat ccccacgggt gaccgtggca 360 gtggctgcgt tggcggcctg cctatggggc aacccatagg acgctctaat gcggacatgg 420 tgcgaagagt ctattgagct agttagtagt cctccggccc ctgaatgcgg ctaatcctaa 480 ctgcggagca catgccttca acccagaggg tagtgtgtcg taatgggcaa ctctgcagcg 540 gaaccgacta ctttgggtgt ccgtgtttcc ttttattctt atattggctg cttatggtga 600 caattacaga attgttacca tatagctatt ggattggcca tccggtgtgc aatagagcta 660 ttatatacct atttttcttt tggctttgta tcactaacct taaaatctat aatcaccctc 720 gactttatag catgggctca caggtgtcca ctcagcgatc cggctcccac gagaactcca 780 attcagctac aggaggctcc accattaatt acactaccat caactattac aaagactcct 840 atgctgcgac agcgggcaaa cagagtctca aacaagaccc tgataagttt gctaaccctg 900 tcaaggacat tttcactgaa atggctgcgc cactgaagtc tccatccgct gaagcttgtg 960 gttacagtga tcgcgtggca caactcacca ttggaaactc caccattact acacakgagg 1020 cggcaaacat catagttggt tacggtgagt ggccctcata ctgctctgat gacgacgcta 1080 cagcggtgga caaaccaacg cgcccagatg tttcagtgaa taggttttat acactggaca 1140 ctaaactgtg ggaaaagtca tccaaggggt ggtattggaa gtttcctgat gtgttgactg 1200 agaccggagt ctttggccag aatgcacagt ttcactattt gtataggtca gggttttgca 1260 ttcatgtgca atgtaacgct agcaagttcc atcaaggagc gctgttagtc gccatacttc 1320 cagagtatgt tatagggaca atagcaggcg gtacaggaac agaggacacc caccctcctt 1380 acatacaaac acaacctggc gccgacggtt tcccgctgca gcacccgtac gtgctcgatg 1440 ctgggattcc tatatcacaa ttgacagtgt gtccccatca atggattaac ctgcggacca 1500 ataactgtgc cacaataata gtgccatata tgaacacact gcctttcgac tctgccctga 1560 accattgcaa ttttgggctg ttggtagtac ccattagccc attagatttt gaccaagggg 1620 caactccggt tatccctatt acaatcactc tagctccaat gtgctctgag tttgcaggtc 1680 tcagacaggc agtcactcaa ggctttccca ctgagccaaa accaggaacg aatcaattct 1740 tgaccaccga tgacggcgtc tcagcaccca ttctaccaaa tttccatccc actccatgta 1800 ttcacatacc cggtgaagtc agaaacctgc ttgagttgtg tcaagtggag actattcttg 1860 aggttaacaa tgtacccacc aatcctacca gtctgatgga aaggctacga ttcccggtgt 1920 ccgcgcaagc ggggaaaggt gaattgtgtg ccgtgtttag ggccgaccct ggaagagacg 1980 gtccatggca atcaacaatg ctgggccagt tgtgtggata ttacacccag tggtcagggt 2040 cactggaggt cacttttatg tttaccgggt ctttcatggc cacaggtaaa atgctcatag 2100 cttatacacc tcctggcggc cccttaccca aagatcgggc cacagcaatg ctgggcacac 2160 atgttatctg ggattttggg ctacaatcat ctgtcaccct tgtaatacca tggattagta 2220 atacccacta cagggcgcat gcccgggatg gagtgtttga ctactatacc gcaggactgg 2280 tcagtatctg gtatcaaaca aactacgtag ttccaattgg ggcacccaac acagcttata 2340 taatagcact agcggcagcc cagaagaatt tcaccatgaa actgtgcaaa gacaccagtc 2400 acatgttaca gacagcctcc attcagggag atagggtggc agatgcgatc gagagctcta 2460 taggagatag tgtgagtagg gcacttaccc aggccctgcc agcacccaca ggtaaaaaca 2520 cacaggtgag cagtcatcga ctagacactg gcgaagttcc agcgctccaa gctgctgaaa 2580 ttggggcatc gtcaaatact agtgatgaga gtatgattga gacacgatgc gttcttaact 2640 cacatagtac agcagagacc accttggaca gtttcttcag tagggcaggt ttggtaggag 2700 aggtagaatt ccctcttgag ggtaccacca atccaggtgg ttatgccaac tgggacatag 2760 acataactgg ttacgcacaa atgcgcagga aagtggagct gttcacctac atgcgctttg 2820 atgcggaatt cacttttgtt gcgtgcactc ctactggtgc ggttgttcca caattactcc 2880 agtatatgtt tgttcccccc ggtgctccca aaccagagtc tagagattca tttgcttggc 2940 agacagccac aaacccctca gtctttgtca agttgactga tcccccggca caggtctcag 3000 ttccgttcat gtcacccgcg agcgcttacc agtggtttta cgacgggtac cccacgtttg 3060 gagaacacaa acaggagaaa gacctcgagt atggagcgtg tcctaataat atgatgggca 3120 ctttctcggt gcgaaccgtg gggtcattaa agtccaagca ccccttgatt gtcagaatat 3180 atatgagaat gaagcatgtc agggcgtgga tacctcgccc gatgcgcaac caaaactatt 3240 tgttcaaagc caacccaaac tatgccggta actccattaa gccgaccggc actagtcgta 3300 cttccattac cacccttgga aagttcggcc agcagtctgg ggccatctac gtgggcaact 3360 tcagagtggt taatcgtcac ctcgctactc ataacgactg ggcgaacctc gtctgggaag 3420 acagctcccg cgacctatta gtgtcgtcta ccaccgctca gggctgtgat acaattgcac 3480 gttgtgactg tcaaacagga gtgtactatt gtaattccaa gagaaagcac tatccagtca 3540 gcttttctaa acccagcctc atatatgtgg aagctagcga gtattaccct gctagatacc 3600 aatcgcacct gatgcttgca gtgggccact ctgagcccgg cgactgcgga ggcatcttga 3660 ggtgtcaaca tggtgtagtt ggtatagtgt ccacgggtgg caacgagctc gttggatttg 3720 ctgatgtgag ggatctcttg tggttagatg aagaggccat ggagcaaggt gtgtccgact 3780 acattaaggg gctcggtgat gcgtttggaa caggcttcac tgacgctgta tccagggaag 3840 ttgaagccct taggaaccac cttataggat ctgatggagc agttgagaaa atcctaaaga 3900 accttattaa gctgatttca gcgttagtaa ttgtgatcag gagcgattat gatatggtca 3960 ccctcacagc aactttagcc ctgattggtt gtcatggaag tccttgggct tggattaaag 4020 ccaagacagc atccatttta ggtatcccca tcgcccagaa gcagagtgct tcttggctaa 4080 agaaatttaa tgatatggcg agtgctgcca agggtttaga atggatatct aataaaatta 4140 gcaagttcat tgactggctc agggagaaaa ttgttccagc agctaaggag aaagcagaat 4200 ttttaaccaa tttgaagcaa ttgccactat tagagaacca gatcacaaat ttagagcagt 4260 ccgctgcctc acaagaggac cttgaagcta tgtttgggaa tgtgtcatac ctcgcccatt 4320 tctgtcgcaa gttccaacca ttatacgccg cggaagctaa gcgagtctat gttctagaga 4380 agagaatgaa taactacatg cagttcaaga gcaaacaccg tattgaacct gtatgtctca 4440 tcattagagg ctcaccaggc actggaaagt cccttgcgac cggtatcatt gctcgggcca 4500 tagcagacaa gtatcactct agtgtgtact cacttccacc agaccctgac cattttgacg 4560 ggtacaaaca gcaagtggtt acagttatgg atgatctgtg tcagaatcct gacggcaaag 4620 acatgtcatt attttgccag atggtgtcta ccgtggattt tatcccacca atggcttctc 4680 tcgaagaaaa gggagtttct ttcacatcta aatttgttat cgcatccacc aacgctagca 4740 acattatagt gcctacagtg tcagactctg acgccattcg tcgcaggttt tacatggatt 4800 gcgacattga ggtgacagac tcatacaaaa cagatttggg tagactagac gctggacggg 4860 ctgctaagct atgctctgag aacaacaccg caaacttcaa acgatgcagc ccactagtgt 4920 gtgggaaagc tattcaactt agagacagga agtctaaggt caggtacagc gtggacacag 4980 tggtctctga acttattaga gaatataata gcagatccgc tattggtaat acaattgaag 5040 cactattcca aggtccaccc aagttcaggc caattagaat cagtcttgag gagaagccag 5100 tcccagacgc tattggcgat ctcctcgcta gtgtagatag cgaggaagtg cgccaatact 5160 gtagggagga aggctggatc atccctgaaa ctcccaccaa tgttgaacga caccttaata 5220 gagcagtgct agtcatgcaa tccatcgcta ctgtggtggc agtcgtctca ctggtgtacg 5280 ttatttacaa gctctttgcg gggtttcaag gtgcgtactc tggagctccc aagcaaatgc 5340 ccaagaaacc tgtcctccgt acggcaacag tgcagggtcc gagtcttgac tttgctctat 5400 ccttactgag aaggaacatc aggcaagtcc aaacagatca agggcatttt accatgttag 5460 gtgtcagaga tcgcttagcc gttcttccac ggcactcaca gcccgggaag actatttggg 5520 tggagcacaa acttgtgaac gtccttgacg cagttgagct ggtggatgag cagggcgtta 5580 atttggaact cacattggtg acactagata ctaatgaaaa atttagagat atcaccaagt 5640 tcattccaga gaccattagc ggcgctagtg atgcaacttt agtgatcaac acagaacata 5700 tgccatcaat gtttgtccca gtgggggacg tcgtgcagta cgggttcttg aaccttagtg 5760 gaaagccaac tcataggacc atgatgtaca atttccctac aaaagcagga cagtgtggag 5820 gtgtggtcac atcagtcggt aagattgttg gcattcacat tggcggcaac gggcgccaag 5880 ggttctgtgc tggtttgaag aggagttact tcgcaagtgt gcagggtgag atccaatggg 5940 tgaagcctaa caaggaaact ggtagactga acatcaatgg tccaactcgc actaagctgg 6000 agcctagtgt gtttcatgat gtgtttgaag gtaataagga accagcagtt ttatcaagca 6060 aagaccctag attggaggtc gactttgaac aagccctgtt ttccaagtat gtgggcaatg 6120 ctttacacga gcccgatgaa tacgtgattc aagctgccct ccactacgcg aatcaactta 6180 aacaattgga catagacact agcaagatga gcatggagga agcgtgctat ggcactgaaa 6240 acctggaagc aatagacctc tgcactagtg ccgggtaccc atacagcgcc cttggtatca 6300 agaaaagaga cattcttgac cccacaacca gggatgtgtc caagatgaaa ttctatatgg 6360 ataaatacgg gctagacctg ccatactgta cctatgtgaa ggatgagctt aggtccctgg 6420 ataaaatcaa gaaaggaaaa tcacgcttga tagaggctag tagcttgaat gactctgtct 6480 accttagaat gacttttggg cacctttacg aggtgtttca tgccaaccct ggcactgtga 6540 ctggctcagc agtgggttgc aacccggacg tgtttgggag caaactaccg attctgctgc 6600 ctgggtcact ctttgccttt gactactcag gatacgatgc tagtctcagc ccggtatggt 6660 tcagggctct agaagttgtg ttacgggaga ttgggtattc agaggaggcc gtgtccctaa 6720 tagaagggat caaccacacc caccatgtgt accggaacaa aacatactgt gtacttggtg 6780 gaatgccctc gggatgttct ggtacttcca tctttaatac aatgatcaac aacatcatca 6840 ttagaaccct tttgatcaaa acctttaagg gaatagacct ggatgagttg aacatggtgg 6900 cctatgggga cgatgtgctg gctagttacc cctttcccat tgattgcctt gagttggcta 6960 agactggcaa agagtatggt ttgaccatga cacctgcaga caaatcaccc tgtttcaatg 7020 aagtaacatg ggaaaatgct accttcctga agagaggatt cttgccagac caccaatttc 7080 cattcttaat tcaccctacg atgcccatga gtgagatccg tgagtccatt cgatggacta 7140 aagacgcgcg caacacccaa gatcacgtgc gctccctgtg tctgttggca tggcacaatg 7200 gtaaggatga atatgagaag tttgtgagtg caattagatc agttccagtt ggaaaagcgt 7260 tggccattcc taatttcgag aacctgagaa gaaattggct cgaattgttt taatattaca 7320 gcttaaagct gaaccccact agaaatctgg tcgcgttaat gactagtggg ggtaaatttg 7380 ttataaccag aatagcaaaa aaaaaaaaaa aaaaaaaaaa a 7421 <210> 3 <211> 7437 <212> DNA <213> Enterovirus 71: BS <400> 3 ttcaaacagc ctgtgggttg cacccactca cagggcccac gtggcgctag cactctggtt 60 ctacggaacc tttgtgcgcc tgttttacgc cccttcccca atttgcaact tagaagcaat 120 acacaacact gatcaacagc aggcatggcg caccagctat gtcttgatca agcacttctg 180 tttccccgga ccgagtatca atagactgtt cacgcggttg aaggagaaag cgtccgttat 240 ccggctaact acttcgagaa acctagtaac accattgaag ctgcagagtg tttcgctcgg 300 cacttccccc gtgtagatca ggtcgatgag tcactgcaat ccccacgggt gaccgtggca 360 gtggctgcgc tggcggcctg cctatggggc aacccatagg acgctctaat gcggacatgg 420 tgcgaagagt ctattgagct agttagtggt cctccggccc ctgaatgcgg ctaatcctaa 480 ctgcggagca catgccttca atccagaggg tagtgtgtcg taatgggcaa ctctgcagcg 540 gaaccgacta ctttgggtgt ccgtgtttcc ttttattctt atattggctg cttatggtga 600 caattacaga attgttacca tatagctatt ggattggcca tccggtgtgc aatagagcta 660 ttatatacct atttgttggc tttgtaccac taaccttaaa atctataacc accctcgact 720 ttatattaac cctcaacaca gtcaagcatg ggctcacagg tgtccactca gcgatccggc 780 tcccacgaga actccaattc agctacagaa ggctccacca ttaattacac taccatcaac 840 tattacaaag actcctatgc tgcgacagcg ggcaaacaga gcctcaaaca agaccctgat 900 aagtttgcta accctgtcaa ggacattttc actgaaatgg ctgcgccact gaagtctcca 960 tccgctgaag cttgtggtta cagtgatcgc gtggcacaac tcaccattgg aaactccacc 1020 attactacac aggaggcggc aaacatcata gttggttacg gtgagtggcc ctcatactgc 1080 tctgatgacg acgctacagc ggtggacaaa ccaacgcgcc cagatgtttc agtgaatagg 1140 ttttatacac tggacactaa actgtgggaa aagtcatcca aggggtggta ttggaagttt 1200 cctgatgtgt tgactgagac cggagtcttt ggccagaacg cacagtttca ctatttgtat 1260 agatcagggt tttgcattca tgtgcaatgt aacgctagca agttccatca aggagcgctg 1320 ttagtcgcca tacttccaga gtatgttata gggacagtgg caggcggtac aggaacagag 1380 gacagccacc ctccttacaa acaaacacaa cctggcgccg acggttttga gctgcagcac 1440 ccgtacgtgc tcgatgctgg gattcctata tcacaattga cagtgtgccc ccatcaatgg 1500 attaacctgc ggaccaataa ctgtgccaca ataatagtgc catatatgaa cacactgcct 1560 ttcgactctg ccctgaacca ttgcaatttt gggctgttgg tagtgcccat tagcccatta 1620 gattttgacc aaggggcaac tccggttatc cctattacaa tcactctagc tccaatgtgc 1680 tctgagtttg caggtctcag acaggcagtc actcaaggct ttcccactga gccaaaacca 1740 ggaacgaatc aattcttgac caccgatgac ggcgtctcag cacccattct accaaatttc 1800 caccccactc catgtattca catacccggt gaagtcagaa acctgcttga gttgtgtcaa 1860 gtggagacta ttcttgaggt taacaacgta cccaccaatg ctaccagtct gatggaaagg 1920 ctacgattcc cggtgtccgc gcaagcgggg aaaggtgaat tgtgtgccgt gtttagggcc 1980 gaccctggaa gagacggtcc atggcaatca acaatgctgg gccagttgtg tggatattac 2040 acccagtggt cagggtcact ggaggtcact tttatgttta ccgggtcttt catggccaca 2100 ggtaaaatgc tcatagctta tacacctcct ggcggcccct tacccaaaga tcgggccaca 2160 gcaatgctgg gcacacatgt tatctgggat tttgggctac aatcatctgt cacccttgta 2220 ataccatgga ttagtaatac ccactacagg gcgcatgccc gggatggagt gttcgactac 2280 tataccacag gactggtcag tatctggtat caaacaaact acgtagttcc aattggggca 2340 cccaacacag cttacataat agcactagcg gcagcccaga agaattttac catgaaactg 2400 tgcaaagaca ccagtcacat attacagaca gcctccattc agggagatag ggtggcagat 2460 gtgatcgaga gctctatagg agatagtgtg agtagggcac ttacccaggc cctgccagca 2520 cccacaggtc aaaacacaca ggtgagcagt catcgactag acactggcga agttccagcg 2580 ctccaagctg ctgaaattgg ggcatcgtca aatactagtg atgagagtat gattgagaca 2640 cgatgcgttc ttaactcaca tagtacagca gagaccacct tggacagttt cttcagtagg 2700 gcaggtttgg taggagagat agatctccct cttaagggta ccaccaatcc aaatggttat 2760 gccaactggg acatagacat aactggttac gcacaaatgc gcaggaaagt ggagctgttc 2820 acctacatgc gctttgatgc ggaattcact tttgttgcgt gcactcctac tggtgaggtt 2880 gttccacaat tactccagta tatgtttgtt ccccctggtg ctcccaaacc agagtctaga 2940 gaatcacttg cttggcagac agccacaaac ccctcagtct ttgtcaagtt gactgatccc 3000 ccggcacagg tctcagttcc gttcatgtca cccgcgagcg cttaccagtg gttttacgac 3060 gggtacccca cgtttggaga acacaaacag gagaaagacc tcgagtatgg agcgtgtcct 3120 aataatatga tgggcacttt ctcggtgcga accgtggggt catcaaagtc caagtacccc 3180 ttggttgtca gaatatatat gagaatgaag catgtcaggg cgtggatacc tcgcccgatg 3240 cgcaaccaaa actatttgtt caaagccaac ccaaactatg ccggtaactc cattaaaccg 3300 accggcacta gtcgtactgc cattactacc cttggaaagt tcggccagca gtctggggcc 3360 atctacgtgg gcaacttcag agtggttaat cgtcacctcg ctactcataa tgactgggcg 3420 aacctcgtct gggaagacag ctcccgcgac ctattagtgt cgtctaccac cgctcagggc 3480 tgtgatacaa ttgcacgttg tgactgtcaa acaggagtgt actattgtaa ttccaagaga 3540 aagcactatc cagtcagctt ttctaaaccc agcctcatat atgtggaagc tagcgagtat 3600 taccctgcta gataccaatc gcacctaatg cttgcagtgg gccactctga gcccggcgac 3660 tgcggaggca tcttaaggtg tcaacatggt gtagttggta tagtgtccac gggtggcaac 3720 gggctcgttg gatttgctga tgtgagggat ctcttgtggt tagatgaaga ggccatggag 3780 caaggtgtgt ccgactacat taaggggctc ggtgatgcgt ttggaacagg cttcactgac 3840 gctgtatcca gggaagttga agcccttagg aaccacctca taggatctga tggagcagtt 3900 gagaaaatcc taaagaacct tattaagctg atttcagcgt tagtaattgt gatcaggagc 3960 gattatgata tggtcaccct cacagcaact ttagccctga ttggttgtca tggaagtcct 4020 tgggcttgga ttaaagccaa gacagcatcc attttaggta tccccatcgc ccagaagcag 4080 agtgcttctt ggctaaagaa atttaatgat atggcgagtg ctgccaaggg tttagaatgg 4140 atatccaata aaattagcaa gttcattgac tggctcaggg agaagattgt tccagcagct 4200 aaggagaaag cagaattttt aaccaatttg aagcaattgc cactattaga gaaccagatc 4260 acaaatttag agcagtccgc tgcctcacaa gaggaccttg aagctatgtt tgggaatgtg 4320 tcatacctcg cccatttctg tcgcaagttc caaccattat acgccacgga agctaagcga 4380 gtctatgttc tagagaagag aatgaacaac tacatgcagt tcaagagcaa acaccgtatt 4440 gaacctgtat gtctcatcat tagaggctca ccaggcactg gaaagtccct tgcgaccggt 4500 atcattgctc gggccatagc agacaagtat cactctagtg tgtactcact tccaccagac 4560 cctgaccatt ttgacgggta caaacagcaa gtggttacag ttatggatga tctgtgtcag 4620 aatcctgacg gcaaagacat gtcattattt tgccagatgg tgtccaccgt ggattttatc 4680 ccaccaatgg cttctctcga agaaaaggga gtttctttca catctaaatt tgttatcgca 4740 tccaccaacg ctagcaacat tatagtgcct acagtgtcag actctgacgc cattcgtcgc 4800 aggttttaca tggattgcga cattgaggtg acagactcat acaaaacaga tttgggtaga 4860 ctagacgctg gacgggctgc taagctatgc tctgagaaca acaccgcaaa cttcaaacga 4920 tgcagcccac tagtgtgtgg gaaagctatt caacttagag acaggaagtc taaggtcagg 4980 tacagcgtgg acacagtggt ctctgaactt attagagaat ataatagcag atccgctatt 5040 ggtaacacaa ttgaagcact attccaaggc ccacccaagt tcaggccaat tagaatcagt 5100 cttgaggaga agccagcccc agacgctatt ggcgatctcc tcgctagtgt agatagcgag 5160 gaagtgcgcc aatactgtag ggagcaaggc tggatcatcc ctgaaactcc caccaatgtt 5220 gaacgacacc ttaatagagc agtgctagtc atgcaatcca tcgctactgt ggtggcagtc 5280 gtctcactgg tgtacgttat ttacaagctc tttgcggggt ttcaaggtgc gtactctgga 5340 gctcccaagc aaatgctcaa gaaacctgtc ctccgtacgg caacagtgca gggtccgagt 5400 cttgactttg ctctatcctt actgagaagg aacatcaggc aagtccaaac agatcaaggg 5460 cattttacca tgttaggtgt cagagatcgc ttagccgttc tcccacggca ctcacagccc 5520 gggaagacta tttgggtgga gcacaaactt gtgaacatcc ttgacgcaat tgagctggtg 5580 gatgagcagg gcgttaattt ggaactcaca ttggtgacac tagatactaa tgaaaaattt 5640 agagatatca ccaagttcat tccagagacc attagcggcg ctagtgatgc aactttagtg 5700 atcaacatgcc aacatatgcc atcaatgttt gtcccagtgg gggacgtcgt gcagtacggg 5760 ttcttgaacc ttagtggaaa gccaactcat aggaccatga tgtacaattt ccctacaaaa 5820 gcaggacagt gtggaggtgt ggtcacatca gtcggtaaga ttgttggcat tcacattggc 5880 ggcaacgggc gccaagggtt ctgtgctggt ttgaagagga gttacttcgc aagtgtgcag 5940 ggtgagatcc aatgggtgaa gcctaacaag gaaactggta gactgaacat caatggtcca 6000 actcgcacta agctggagcc tagtgtattt catgatgtgt ttgaaggtaa taaggaacca 6060 gcagttttaa caagtaaaga ccctagattg gaggtcgact ttgaacaagc cctgttttcc 6120 aagtatgtgg gcaatgtttt acacgagccc gatgaatacg tgattcaagc tgccctccac 6180 tacgcgaatc aacttaaaca attggacata aacactagca agatgagcat ggaggaagcg 6240 tgctatggca ctgaaaacct ggaagcaata gacctctgca ctagtgccgg gtacccatac 6300 agcgcccttg gcatcaagaa aagagacatt cttgacccca caaccaggga tgtgtctaag 6360 atgaaattct atatggataa atacgggcta gacctgccat actctaccta tgtgaaggat 6420 gagcttaggt ccctggataa aatcaagaaa ggaaaatcac gcttgataga ggctagtagc 6480 ttgaatgact ctgtctacct cagaatgact tttgggcacc tttacgaggt gtttcatgcc 6540 aaccctggca ctgtgactgg ctcagcagtg ggttgcaacc cggacgtgtt ttggagcaaa 6600 ctaccgattc tgctgcctgg gtcactcttt gcctttgact actcaggata tgatgctagt 6660 ctcagcccgg tatggttcag ggctctagaa gttgtgttac gggagattgg gtattcagag 6720 gaggccgtgt ccctaataga agggatcaac cacacccacc atgtgtaccg gaacaaaaca 6780 tactgtgtac ttggtggaat gccctcggga tgttctggta cttccatctt taattcaatg 6840 atcaacaca tcatcattag aacccttttg atcaaaacct ttaagggaat agacctggat 6900 gagttgaaca tggtggccta tggggacgat gtgctggcta gttacccctt tcccattgat 6960 tgccttgagt tggctaaaac tggcaaagag tatggtttga ccatgacacc tgcagacaaa 7020 tcaccctgtt tcaatgaagt aacatgggaa aatgctacct tcctgaagag aggattcttg 7080 ccagaccacc aatttccatt cttaattcac cctacgatgc ccatgagaga gatccgtgag 7140 tccattcgat ggactaaaga cgcgcgcaac acccaagatc acgtgcgctc cctgtgtctg 7200 ttggcatggc acaatggtaa ggatgaatat gagaagtttg tgagtgtaat tagatcagtt 7260 ccagttggaa aagcgttggc cattcctaat ttcgagaatc tgagaagaaa ttggctcgaa 7320 ttgttttaat attacagctt aaagctgaac cccactagaa atctggtcgc gttaatgact 7380 agtgggggta aatttgttat aaccagaata gcaaaaaaaa aaaaaaaaaaaaaaaaa 7437 <210> 4 <211> 63 <212> DNA <213> Enterovirus 71 <400> 4 ctagggatcc taatacgact cactataggt tcaaacagcc tgtgggttgc acccactcac 60 agg 63 <210> 5 <211> 54 <212> DNA <213> Enterovirus 71 <400> 5 ctaggacgtc cggccgaact ttccaagggt agtaatggca gtacgactag tgcc 54 <210> 6 <211> 38 <212> DNA <213> Enterovirus 71 <400> 6 taataagctt cggccggcag tctggggcca tctacgtg 38 <210> 7 <211> 61 <212> DNA <213> Enterovirus 71 <400> 7 gcgcggatcc tttttttttt tttttttttt gctattctgg ttataacaaa tttaccccca 60 c 61 <210> 8 <211> 58 <212> DNA <213> Enterovirus 71 <400> 8 ggtgtccact caacgcgtcg gctcccacga gaactccaat tcagctacag aaggctcc 58 <210> 9 <211> 45 <212> DNA <213> Enterovirus 71 <400> 9 caagcatggg ctcacaggtg tccactcaac gcgtcggctc ccacg 45 <210> 10 <211> 48 <212> DNA <213> Enterovirus 71 <400> 10 actcaacgcg tcggctccca cgagaactcc aattcagcta cagaaggc 48 <210> 11 <211> 49 <212> DNA <213> Enterovirus 71 <400> 11 actgccggcc gaactttcca agggtagtaa tggcagtacg actagtgcc 49 <210> 12 <211> 44 <212> DNA <213> Enterovirus 71 <400> 12 cagaggacac ccaccctcct tacaaacaaa cacaacctgg cgcc 44 <210> 13 <211> 34 <212> DNA <213> Enterovirus 71 <400> 13 ggagggtggg tgtcctctgt tcctgtaccg cctg 34 <210> 14 <211> 33 <212> DNA <213> Enterovirus 71 <400> 14 ctccttacat acaaacacaa cctggcgccg acg 33 <210> 15 <211> 38 <212> DNA <213> Enterovirus 71 <400> 15 tgtgtttgta tgtaaggagg gtggctgtcc tctgttcc 38 <210> 16 <211> 46 <212> DNA <213> Enterovirus 71 <400> 16 ctccctcttg agggtaccac caatccaaat ggttatgcca actggg 46 <210> 17 <211> 45 <212> DNA <213> Enterovirus 71 <400> 17 tggtaccctc aagagggaga tctatctctc ctaccaaacc tgccc 45 <210> 18 <211> 52 <212> DNA <213> Enterovirus 71 <400> 18 ctactggtgc ggttgttcca caattactcc agtatatgtt tgttccccct gg 52 <210> 19 <211> 43 <212> DNA <213> Enterovirus 71 <400> 19 ggaacaaccg caccagtagg agtgcacgca acaaaagtga att 43 <210> 20 <211> 36 <212> DNA <213> Enterovirus 71 <400> 20 agagaatcat ttgcttggca gacagccaca aacccc 36 <210> 21 <211> 40 <212> DNA <213> Enterovirus 71 <400> 21 gccaagcaaa tgattctcta gactctggtt tgggagcacc 40 <210> 22 <211> 34 <212> DNA <213> Mus musculus <400> 22 attaggatcc gtctttcaga aggcggtaga ccag 34 <210> 23 <211> 43 <212> DNA <213> Mus musculus <400> 23 tataaagctt cgacacgcca gccacgtgaa aaccaagcca aag 43

Claims (33)

An enterovirus 71 (Enterovirus 71: EV71) neuro-infection animal model containing rodents infected with modified EV71 to infect rodents. The animal model of claim 1, wherein said modified EV71 is rodent cell line adapted EV71. The animal model according to claim 1 or 2, wherein the modified EV71 is a rodent cell line adapted EV71 having an EV71: TLLmv . An animal model according to claim 3, wherein EV71: TLLmv has been deposited in the China Center for Type Culture Collection, and the deposit number is assigned as CCTCC V201438. The animal model according to claim 1 or 2, wherein said modified EV71 is a rodent cell line adapted EV71 with an EV71: TLLm . An animal model according to claim 5, wherein EV71: TLLm has been deposited in the China Center for Type Culture Collection, and the deposit number is assigned as CCTCC V201437. The animal model of claim 1, wherein said modified EV71 is an EV71 clone derived virus (CDV) comprising a mutation at VP1. The animal model according to claim 1 or 7, wherein the modified EV71 is EV71 CDV CDV: BS _VP1 [K98E / E145A / L169F] . 7. An animal model according to any one of claims 1 to 6, wherein said rodent is immuno-competent. The animal model according to claim 9, wherein the rodent is a mouse. [Claim 11] The animal model according to claim 10, wherein the rodent cell line is a mouse cell line NIH / 3T3. The animal model according to claim 7 or 8, wherein the rodent is immune-competent. 13. The animal model of claim 12, wherein the rodent is a mouse. 14. The animal model according to claim 13, wherein the rodent cell line is a mouse cell line NIH / 3T3 or a mouse cell line Neuro-2a. The animal model according to claim 1 or 2, wherein said rodent is immuno-compromised. 16. The animal model of claim 15, wherein the rodent is a mouse. 17. The animal model of claim 16, wherein the mouse is a BALB / c mouse. Providing a test group of animals and a control group of animals, wherein each group of animals comprises the animal model of any one of claims 1 to 17; Administering the antiviral drug candidate to the test group; Monitoring a disease progression in the test group and the control group; Comparing the disease progression in the test group with the disease progression in the control group; And selecting an antiviral drug candidate that reduces disease progression in said test group compared to said control group. &Lt; Desc / Clms Page number 17 &gt; 19. The method of claim 18, wherein the antiviral drug is first screened in a test rodent cell line infected with the modified enterovirus 71, before screening in the animal. Providing a test group of animals and a control group of animals, wherein each group of animals comprises the animal model of any one of claims 1 to 17; Administering the antiviral vaccine candidate to the test group; Monitoring disease progression in the test group and the control group; Comparing the disease progression with the disease progression in the control group in the test group; And selecting an antiviral vaccine candidate that reduces disease progression in the test group compared to the control group. &Lt; Desc / Clms Page number 19 &gt; 21. The method of claim 20, wherein the antiviral vaccine is first screened in a test rodent cell line infected with the modified enterovirus 71, before being screened in the animal. Infected rodents with modified EV 71 to infect rodents,
Comprising infesting said infected rodent to produce an EV71 neuro-infected animal model. &Lt; RTI ID = 0.0 &gt; 18. &lt; / RTI &gt; 24. The method of claim 22, wherein the rodent infects at least about one week to about four weeks of age. 23. The method of claim 22 or 23 wherein the infected rodent is bred for up to about 4 weeks. The method of any one of claims 22 to 24, that is about 10 ³ to about 10 ⁷ cell culture medium infectious dose (median cell culture infectious dose) of which is used to infect the rodent. The method according to any one of claims 22 to 25, wherein the modified EV71 is a rodent cell line adapted EV71 with an EV71: TLLmv . 29. The method of claim 26, wherein EV71: TLLmv has been deposited in the China Center for Type Culture Collection, and the deposit number is assigned as CCTCC V201438. The method of any one of claims 22 to 25, wherein the modified EV71 is a rodent cell line adapted EV71 that is EV71: TLLm . 29. The method of claim 28, wherein EV71: TLLm has been deposited in the China Center for Type Culture Collection and the deposit number is assigned as CCTCC V201437. The method according to any one of claims 22 to 25, wherein the modified EV71 is an EV71 clone-derived virus (CDV) comprising a mutation at VP1. 32. The method of claim 30, wherein the modified EV71 is EV71 CDV CDV: BS _VP1 [K98E / E145A / L169F] . The method according to any one of claims 22 to 31, wherein the rodent is a mouse. 33. The method of claim 32, wherein the mouse is a BALB / c mouse.

Images