WO2016122403A1 - Enterovirus 71 animal model - Google Patents

Enterovirus 71 animal model Download PDF

Info

Publication number
WO2016122403A1
WO2016122403A1 PCT/SG2016/050031 SG2016050031W WO2016122403A1 WO 2016122403 A1 WO2016122403 A1 WO 2016122403A1 SG 2016050031 W SG2016050031 W SG 2016050031W WO 2016122403 A1 WO2016122403 A1 WO 2016122403A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
rodent
virus
mouse
animal model
Prior art date
Application number
PCT/SG2016/050031
Other languages
French (fr)
Inventor
Kaw Bing Chua
Original Assignee
Temasek Life Sciences Laboratory Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Temasek Life Sciences Laboratory Limited filed Critical Temasek Life Sciences Laboratory Limited
Priority to CN201680019293.5A priority Critical patent/CN107849540B/en
Priority to JP2017540259A priority patent/JP6772155B2/en
Priority to AU2016212766A priority patent/AU2016212766B2/en
Priority to MYPI2017001107A priority patent/MY202113A/en
Priority to KR1020177023889A priority patent/KR20170106473A/en
Priority to SG11201706054QA priority patent/SG11201706054QA/en
Publication of WO2016122403A1 publication Critical patent/WO2016122403A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K49/00—Preparations for testing in vivo
    • A61K49/0004—Screening or testing of compounds for diagnosis of disorders, assessment of conditions, e.g. renal clearance, gastric emptying, testing for diabetes, allergy, rheuma, pancreas functions
    • A61K49/0008—Screening agents using (non-human) animal models or transgenic animal models or chimeric hosts, e.g. Alzheimer disease animal model, transgenic model for heart failure
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5082—Supracellular entities, e.g. tissue, organisms
    • G01N33/5088—Supracellular entities, e.g. tissue, organisms of vertebrates
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/0337—Animal models for infectious diseases
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/32011—Picornaviridae
    • C12N2770/32311—Enterovirus
    • C12N2770/32321—Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/32011—Picornaviridae
    • C12N2770/32311—Enterovirus
    • C12N2770/32322—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/32011—Picornaviridae
    • C12N2770/32311—Enterovirus
    • C12N2770/32371—Demonstrated in vivo effect

Definitions

  • the present invention relates to Enterovirus 71 (EV7I), the development of an animal model and screening of candidate anti-EV71 compounds.
  • Enterovirus 71 is a small non-enveloped virus approximately 30 nm in diameter.
  • the viral capsid exhibits icosahedral symmetry and is comprised of 60 identical units (protomers), with each consisting of four viral structural proteins VP1-VP4.
  • the capsid surrounds a core of a single- stranded positive-sense RNA genome of 7,450 nucleotides (nt) Jong.
  • the genome contains a single open reading frame which encodes a polyprotein of 2193 amino acids (aa) and is flanked by a long 5' ' untranslated region (UTR) of 745 nt and a shorter 3 f UTR of 85 nt with a poly-A tract of variable length at its 3' terminus.
  • the polyprotein is divided into three regions, i.e., PI, P2 and. P3.
  • PI encodes four viral structural proteins 1 A-1D (VP4, VP2, VP3 and VP1 );
  • P2 and P3 encode seven non- structural proteins 2A-2C and 3A-3D [1-3].
  • EV71 causes an array of clinical diseases including hand, foot and mout disease (HFMD), aseptic meningitis, encephalitis and poliomyelitis-like paralysis mainly in infants and young children [4, 5], The virus was first isolated from a child with acute encephalitis in California, USA in 1969, and subsequently characterized as a new serotype of the genus Enterovirus in 1974 [6].
  • HFMD hand, foot and mout disease
  • aseptic meningitis encephalitis
  • encephalitis encephalitis
  • poliomyelitis-like paralysis mainly in infants and young children
  • the virus was first isolated from a child with acute encephalitis in California, USA in 1969, and subsequently characterized as a new serotype of the genus Enterovirus in 1974 [6].
  • SCARB2 Scavenger Receptor Class B Member-2
  • the viral RNA is translated, resulting in the expression of various viral non- structural proteins.
  • the viral RNA is subsequently replicated, packaged into the capsid, and released into the environment free to re-infect healthy cells.
  • RNA viruses by virtue of their error-prone replication and high mutation rates [40- 42], replicate as a swarm of related variant sequences known as quasispecies [43, 44]. It is comprised of a master species exhibiting the highest fitness in a certain environment, and of a mutant spectrum composed of a collection of closely related mutant sequences with a certain probability distribution [44, 45]. These endow RNA viruses with genome plasticity, which is reflected in their ability to quickly adapt to changing environments.
  • the present invention relates to Enterovirus 71 (EV71), the development of an animal model and screening of candidate anti-EV71 compounds. More specifically, the present invention relates to the discovery that Enterovirus 71 (EV71) strains that have been adapted to infect rodent cell lines or cloned derived virus containing mutations in VP1 can cause disease in immuno-competent rodents and immuno-compromised rodents.
  • the present invention relates to the development of a clinically authentic model of EV71 -induced neurological, disease by infecting BALB/c mice with a modified strain (e.g., EV71 :TLLmv) adapted to infect NIH/3T3 mouse fibroblasts.
  • a modified strain e.g., EV71 :TLLmv
  • the modified EV71 is used to induce acute encephalomyelitis associated with neurogenic pulmonary edema in mice, characterized by lung swelling and increased organ weight compared with mock- infected lungs.
  • the present invention relates to an animal model that comprises a rodent infected with an Enterovirus 71 capable of infecting the rodent, sometimes referred to herein as a modified Enterovirus 71.
  • an Enterovirus 71 is a rodent cell line adapted Enterovirus 71.
  • an Enterovirus 71 is a clone derived virus (CDV) containing mutations in VP1.
  • the mutations in VP1 enable the CDV to use rodent SCA B2 proteins to infect rodent cells.
  • the rodent is an immuno-competent rodent.
  • the rodent is an immuno-compromised rodent.
  • Suitable animals for use as models are preferably mammalian animals, most preferably convenient laboratory animals such as rabbits, rats, mice, and the like, h one embodiment, the animal is a mouse. In some embodiments, the mouse is a BALB/c mouse. In another embodiment, the rodent cell line is a mouse cell line. In a further embodiment, the mouse cell line is a mouse ⁇ /3 ⁇ 3 cell line. In another embodiment, the mouse cell line is a mouse Neuro-2a cell line. In one embodiment, the rodent cell line adapted Enterovirus 7 lis EV71:TLLm. hi another embodiment, the rodent cell line adapted Enterovirus 71 is EV71:TLLmv.
  • the clone derived virus containing mutations in VP1 is CDV:BSypi[K98E/E14SA/L169F] .
  • the animal model is useful for studying systemic spread of the vims and human disease spectrum in animal models.
  • the animal model is also useful for screening antiviral drugs and vaccines.
  • the present invention provides a method for preparing an animal model with the full-spectrum of EV71 -induced neurological infection, disease and pathology observed in humans.
  • the method comprises infecting a rodent described herein with a modified Enterovirus 71 described herein and raising the infected rodent for up to about 4 weeks.
  • the age of the rodent to be infected is between about 1 week and about 4 weeks.
  • the infected rodent is raised for about 1 week to about 4 weeks.
  • the rodent is a mouse as described herein.
  • the rodent is infected by inoculating the rodent with the modified Enterovirus 71.
  • the inoculation is intraperitoneal (LP.). In another embodiment, the inoculation is intramuscular (I.M.). hi some embodiments, the virus dose inoculated into the rodent is a median cell culture infectious dose (CCID50) between about between about 10 3 and about 10 7 .
  • CCID50 median cell culture infectious dose
  • the present invention provides a method to screen antiviral drugs.
  • the method comprises the following steps: providing a test group of animals and a control group of animals in which the animals of each group are animals of the animal model described herein; administering to the test group an antiviral drag candidate; monitoring disease progression in the test group and the control group; comparing the disease progression in the test group to the disease progression in the control group; and selecting the antiviral drug candidate that reduces disease progression in the test group relative to the control group.
  • the antiviral drug is first screened in a test rodent cell line infected with a rodent cell line adapted Enterovirus 71 before screening in the animals.
  • the antiviral drug is first screened in a test rodent cell line infected with a clone derived virus (CDV) containing mutations in VP1 before screening in the animals.
  • CDV clone derived virus
  • the present invention provides a method to screen effective antiviral vaccines.
  • the method comprises the following steps: providing a test group of animals and a control group of animals in which the animals of each group are animals of the animal model described herein; administering to the test group an antiviral vaccine candidate; monitoring disease progression in the test group and the control group; comparing the disease progression in the test group to disease progression in the control group; and selecting the antiviral vaccine candidate that reduces disease progression in the test group relative to the control group.
  • the antiviral vaccine candidate is first screened in a test rodent cell line infected with a rodent cell line adapted Enterovirus 71 before screening in the animals.
  • the antiviral vaccine candidate is first screened in a test rodent cell line infected with clone derived vims (CDV) containing mutations in VP1 before screening in the animals.
  • CDV clone derived vims
  • Figures lA-lO show cytopathic effects (CPE) observed following virus infection of various primate cell lines.
  • Primate cells RD cells ( Figures A1-1 C), HeLa cells ( Figures 1D-1F), HEp-2 cells ( Figures 1G-II), Vero cells ( Figures 1J-1L), and COS-7 cells ( Figures lM-lO) infected with 1 MOI of either EV71 :BS ( Figures 1A, I D, 1G, 1J and 1M), EV71 :TLLm ( Figures IB, IE, 1H, IK and IN), or EV71 :TLLmv ( Figures 1C, IF, II, 1L and 10) virus were observed at 48 hpi for cytopathic effects or death of the cell monolayer. Images are representative of results in three independent experiments.
  • Figures 2A-20 show virus antigen detection in cell lines infected with EV71 :BS, EV71 :TLLm and EV71 :TLLmv. Overnight seeded mammalian cell lines: HeLa ( Figures 2A- 2C), HEp-2 ( Figures 2D-2F), CHO-K1 ( Figures 2G-2LI, NRK ( Figures 2J-2L), and TCMK ( Figures 2M-20), were infected with 1 MOI of respective virus. Cells were harvested at 48 hpi, coated onto Teflon slides and fixed in cold acetone. Cells were probed with pan-enterovirus antibody and stained with FITC-conjugated anti-mouse IgG. Images are representative of two independent experiments.
  • Figures 3A-3D show growth kinetics of EV71.-BS, EV71:TLUr and EV71:TLLmv determined in ⁇ /3 ⁇ 3 and Vero cells. Supernatants from various mammalian cells infected with 1 MOI of respective virus were harvested at various time points and subjected to titration and enumerated using the Reed and Muench method.
  • Figure 3 A EV71 :BS virus titer determined in Vero cells.
  • Figure 3B EV71 :TLLmv virus titer determined in NIH/3T3 cells.
  • Figures 3C and 3D EV71:TLLm virus titer determined in NIH/3T3 cells. Growth curves from cell lines that did not exhibit productive infection are not shown.
  • Figures 4A-40 show cytopathic effects (CPE) observed following virus infection of various rodent cell lines.
  • Rodent cells NIH/3T3 cells ( Figures 4A-4C), Neuro-2A cells ( Figures 4D ⁇ 4F), TCMK cells ( Figures 4G-4I), CHO-K1 cells Figures (4J-4L), and NRK cells ( Figures 4M ⁇ O) infected with 1 MOI of either EV7LBS ( Figures 4A, 4D, 4G, 4J and 4M), EV71 :TLLm ( Figures 4B, 4E, 4H, 4K and 4N), or EV71:TLLmv ( Figures 4C, 4F, 41, 4L and 40) viruses were observed at 48 hpi for cytopathic effects or death of the cell monolayer. Images are representative of results from three independent experiments.
  • Figures 5A-5D show virus fitness assessment of EV71:BS, EV71:TLLm, and EV71:TLLmv in ⁇ /3 ⁇ 3 determined by the titer ratio. Virus titer determined separately in ⁇ /3 ⁇ 3 and Vero cells were used to calculate the virus fitness as log[(titer in NIH/3T3 cells)/(titer in Vero cells)]. Virus fitness of ( Figure 5 A) EV7J:BS, ( Figure 5B) EV71:TLLmv, and ( Figures 5C and 5D) EV71:TLLm were calculated from the virus titer values shown in Figures 3A-3D. Virus fitness assays obtained from cell lines that did not exhibit productive infection are not shown.
  • Figures 6A and 6B show transfection of NIH/3T3 with EV7LBS viral RNA induces productive infection. Overnight seeded N1H/3T3 and Vero cells were inoculated with virus supernatant harvested from NIH/3T3 cells previously transfected viral RNA extracted from EV71:BS, EV71:TLLm, and EV71:TLLmv.
  • Figure 6A Cells were imaged using inverted light microscope at 24 hpi to observe induced CPE.
  • Figure 6B Cells were harvested at 7 dpi, coated onto Teflon slides, probed with pan-enterovirus antibody, and stained with anti-mouse FITC- conjugated antibody.
  • Figures 7A and 7B show virus fitness assessment of EV7LBS, EV71:TLLm, and EV71:TLLmv in N1H/3T3 and Vero cells at 30°C. Overnight seeded ( Figure 7A) NIH/3T3 and ( Figure 7B) Vero cells infected with EV71:BS (panels a, d, g), EV71:TLLm (panels b, e, h), or EV71 :TLLmv (panels c, f, i) were incubated at 30°C and observed under the light microscope with phase-contrast at 24 hpi (panels a-c), 48 hpi (panels d- ⁇ f), and 72 hpi (panels g-i). Images taken are representative of two independent experiments.
  • Figures 8A and 8B show virus fitness assessment of EV71:BS, EV71 :TLLm, and EV71:TLLmv in NIH/3T3 and Vero cells at 37°C. Overnight seeded ( Figure 8A) NIH/3T3 and ( Figure 8B) Vero cells infected with EV7LBS (panels a, d, g), EV71:TLLm (panels b, e, h), or EV71 :TLLmv (panels c, f, i) were incubated at 37°C and observed under the light microscope with phase-contrast at 24 hpi (panels a-c), 48 hpi (panels d-f), and 72 hpi (panels g-i). Images taken are representative of two independent experiments.
  • Figures 9A and 9B show virus fitness assessment of EV7LBS, EV71:TLLm, and EV71:TLLmv in NIH/3T3 and Vero cells at 39°C. Overnight seeded ( Figure 9A) ⁇ /3 ⁇ 3 and ( Figure 9B) Vero cells infected with EV7EBS (panels a, d, g), EV71:TLLm (panels b, e, h), or EV71 :TLLmv (panels c, f, i) were incubated at 39°C and observed under the light microscope with phase-contrast at 24 hpi (panels a-c), 48 hpi (panels d-f), and 72 hpi (panels g-i). Images taken are representative of two independent experiments.
  • Figures 10A-10L show transfection of murine cell lines NIH/3T3, Neuro-2A, and TCMK with EV7LBS viral RNA for evidence of virus replication. Overnight seeded ⁇ /3 ⁇ 3, Neuro-2A, and TCMK cells were either infected with 1000 CCFD 50 of EV71.-BS virus ( Figures 10A, IOC, and 10E) or transfected with equivalent amounts of viral RNA ( Figures 10B, 10D, and 10F). and harvested at 48 hpi for viral antigen detection. Vims in the supernatants were harvested at 7 dpi and passaged onto fresh Vero ( Figures 1 OG, 101, and 10K) and. NIH/3T3 cells ( Figures 10H, 10J, and 10L). Cells were harvested and stained for viral antigens at 48 hpi.
  • Figures 1 1 A- 1 ID show localization in VP1 and VP2 of adaptive mutations in the genomes of EV71 :TL ' Lm and EV71 :TLLmv.
  • Adaptive mutations observed in the VP1 ( Figures 1 1A and 1 1B) and VP2 ( Figures 1 1C and 1 1 D) regions of EV71 :TLLm ( Figures 1 1A and 1 1 C) and EV71:TLLmv ( Figures 1 1B and 1D) were modelled using DeepView/SwissPDBviewer v3.7 and the 3D structure of EV71 capsid PI region (PDB ID 4AED). The mutations were observed to be mostly localized to the surface-exposed loops of the protein as shown.
  • Figure 12 shows titer ratio in NIH/3T3 cells relative to titer in Vero cells of virus supernatant harvested from cells either transfected with EV71 :BS viral RNA or infected with live virus.
  • Supernatants from ⁇ /3 ⁇ 3, Neuro-2A, Vero, and TCMK either transfected with viral RNA or infected with live virus were harvested and subjected to virus enumeration by Reed-and Muench method.
  • the ratio of the log(titer) determined in NIH/3T3 cells relative to the titer determined in Vero cells is shown.
  • 3T3-TRANS RNA transfected NIH/3T3 cells
  • 3T3-INF virus infected N1H/3T3 cells.
  • Asterisks indicate Student's t-test with p-value ⁇ 0.05.
  • Figures 13A and 13B show survival analysis of infected animals. Infected animals were observed and weighed daily.
  • Figure 13 A Kaplan-Meier plot of infected animals showing number of deaths at various days post-infection.
  • Figure 13B Changes in body weight were plotted to determine the general health of the animals.
  • Figures 14A-14D show symptoms and pathology of infected animals. Majority of the infected animals displayed symptoms of disease.
  • Figure 14A Paralysis of the hind limbs (arrow).
  • Figure 14B Gross anatomy of the inflated lungs following necropsy (arrows). Tissue sections were also stained with Hematoxylin and Eosin staining ( Figure 14C at l Ox and Figure 14D at 2 Ox). Black arrows point to the mucous substance infiltrating the alveolar spaces.
  • Figures 15A- 15E show that transfection of viral genomic RNA into both primate and rodent cells yields viable virus.
  • Figure 15A Genomic RNA extracted from either EV7LBS, EV71 :TLLm, or EV71:TLLmv were individually transfected into Vero, NIH/3T3, and Neuro-2a cells (P0). Transfection supernatants were harvested and inoculated onto either Vero or NIH/3T3 cells (P I ) to assess for viability of virus progeny. Infection of PO cells was assessed by observation of cytopathic effects (CPE) ( Figure 15B) and immunofluoresence detection of viral antigens (Figure 15C). Similarly, infection of PI cells from EV71:BS RNA-transfected cells was assessed by CPE induction ( Figure 15D) and immunofluorescence detection of expressed viral antigens ( Figure 15E).
  • CPE cytopathic effects
  • Figure 15C immunofluoresence detection of viral antigens
  • Figures 16A-16F show that the capsid-encoding region of mouse cell-adapted EV71 :TLLm drives productive infection of mouse cells with EV7LBS.
  • Figure 16A Infectious cDNA clones of the full genome of EV71 :BS were generated, and the PI region replaced with sequences from EV71;TLLm capsid to generate chimeric virus, EV71:BS[M-P1] .
  • Figure 16B Cells were infected with clone-derived virus (CDV) from either EV7LBS or EV71:BS[M-P1], and infection was assessed by induction of lytic cytopathic effects (CPE) ( Figure 16C) and viral antigen expression (Figure 16D).
  • CPE lytic cytopathic effects
  • Figure 16D viral antigen expression
  • Figures 17A-17G show that the VP1-L169F amino acid substitution in the capsid is sufficient to enable EV71:BS entry into murine cells.
  • Figure 17A Various mutant cDNA clones were generated by incoiporating amino acid substitutions in VP1 : K98E, E145A, and L169F; and VP2: S144T and K149I; into the full-length EV71.-BS genome.
  • Figures 18 A- 18E show that EV71:BS virus with combined VP1 amino acid substitutions in the capsid exhibit improved infection of mouse cells.
  • Figure 18A Various mutant cDNA clones were generated by incoiporating combinations of amino acid substitutions in VP1 and VP2 into the full-length EV71:BS genome. Mutations corresponding to amino acid substitutions are written in parentheses. Infection of various cell lines with clone-derived virus (CDV) was monitored by assessing cytopathic effects (Figure 18B), viral antigen expression (Figure 18C), and virus yield from infected Vero (Figure 18D), and NIH/3T3 (3T3) and Neuro- 2a (N2A) cells ( Figure ⁇ 8E). Other clones with no virus yield are not shown. Error bars indicate SD.
  • FIG. 19C Genome sequences of representative CDV:BSvpi[K98E/El45A/L169F] were determined to assess evidence of amino acid substitutions K98E (A2734G), El 45 A (A2876C), and L1 69F (C2947T). The mutation site is marked with an asterisk
  • Figures 20A-20 F show that EV71:TLLmv utilize SCARB2 to infect both primate and murine cells.
  • Preincubation of EV71 :TLLmv with recombinant soluble protein of either mSCARB2 (Figure 20C) or human SCARB2 (hSCARB2) ( Figure 20D) prior to inoculation onto NIH/3T3 cells reduces virus infection severity, as assessed by immunofluorescence assay.
  • Pre-incubation of live NIH/3T3 cells with either hSCARB2 ( Figure 20E) or mSCARB2 ( Figure 20F) antiserum prior to infection with EV71:TLLmv reduces the virus titer in culture supernatant. * p ⁇ 0.05; ** p ⁇ 0.005; *** p ⁇ 0.0005.
  • Figures 21A-21D show that incubation of Neuro-2A cells with murine SCARB2 rabbit antiserum reduced severity of infection with CDV mutants.
  • Infection severity in cells pre- incubated with rabbit mSCARB2 antiserum prior to infection with CDV:BSvpi[K98E/E145A/L169F] Figures 21 A and 21B or CDV:BS[M-P1]
  • Figures 21 C and 2 ID was monitored by assessing induction of cytopathic effects (CPE) ( Figures 21 A and 21C) and virus yield at 7 days post-infection ( Figures 21B and 21D).
  • CPE cytopathic effects
  • Figures 21B and 21D Error bars indicate SD; * p ⁇ 0.05; ** p ⁇ 0.005.
  • Degree of CPE 1 (0-25% cell death), 2 (25-50%), 3 (50-75%), 4 (75-100%).
  • Figures 22a-22c show that EV71 :TLLmv is the most virulent of the three modified viral strains as evidenced by induction of severe disease in 1-week old BALB/c mice.
  • Figures 22b and 22c Kaplan-Meier survival curves of mice inoculated with 10 6 CCIDso (median cell culture infective dose) of EV71:BS, EV71:TLLm, or EV71:TLLmv either via LP. route ( Figure 22b) or intramuscular (I.M.) route ( Figure 22c). Statistical significance was determined using t-test with Welch's correction for unequal variance (Figure 22a) or the Mantel-Cox log-rank test ( Figures 22b and 22c). *p ⁇ 0.05, **p ⁇ 0.005, ***p ⁇ 0.0005.
  • Figures 23a-23h show that EV71:TLLmv infection in mice is characterized by acute severe disease resembling the human disease spectrum.
  • Figure 23a and 23b Dose-dependent lethality of EV7 ] :TL.Lmv infection in 1 week-old mice.
  • Figure 23a Kaplan-Meier survival curve of 6 day-old pups LP. injected with various doses of EV71 :TLLmv
  • Figure 23b The median humane endpoint (HD50) was equivalent to a virus dose of 3.98 x 10 3 CCn1 ⁇ 2.
  • Figure 23c Kaplan-Meier survival curves of 1 week-old mice inoculated with EV71:TLLmv via LP. or I.M.
  • Figure 23d Age- and route-dependent lethality induced by EV71:TLLmv infection in mice inoculated with a virus dose of 10 6 CCIDso-
  • Figures 23e and 23 f Clinical signs observed in terminally-ill mice, some of which presented with paralysis of the hind limbs ⁇ gray arrow) and/or forelimbs. Others also exhibited small hairless lesions on the torso ⁇ black arrow).
  • Figures 23g and 23h Disease classification of 1 week-old mice inoculated with EV7I:TLLmv via the LP. route ( Figure 23g), or I.M. route ( Figure 23h).
  • Figures 24a-24e show that Severity of EV71:TLLmv infection in BALB/c mice depends on host age, virus dose, and route of administration.
  • Figures 24a and 24b Groups of 8- 10 mice were inoculated with 10 6 CCID 5 0 of virus by LP. route ( Figure 24a) or I.M. route ( Figure 24b) and the Kaplan-Meier survival curves determined for animals of different age groups.
  • Statistical significance was determined by Mantel-Cox log-rank test ( Figures 24a and 24b) or t-test with Welch's correction for unequal variance ( Figures 24c, 24d and 24e). *p ⁇ 0.05, **p ⁇ 0.005, ***p ⁇ 0.0005.
  • Figures 25a-25k show Signs of EV71 -induced neurogenic pulmonary edema (NPE) in Class IA mice.
  • Figures 25a-25d Representative gross pathology of the lungs obtained from mock-infected mice ( Figure 25a), or EV7 :TLLmv infected mice presenting with signs of disease Class IA (Figure 25b), Class IB ( Figure 25c), or Class 11 ( Figure 25d). Images show top- and side-views. Note the incomplete collapse of the lungs apparent in Figure 25b ⁇ white arrows).
  • Figures 25f-25i Representative images of lung tissue sections (5 ⁇ ) stained with hematoxylin & eosin (H&E). Shown are low- and high magnification images of lungs obtained from mock-infected mice ( Figure 25f) or EV71:TLLmv- fected mice presenting with signs of disease Class IA ( Figure 25g), Class IB ( Figure 25h), or Class II ( Figure 25i).
  • Figures 26a and 26b show the absence of viral replication or inflammation in the lung and heart tissues of Class IA mice.
  • Figure 26a Representati e images of lung tissue sections (5 ⁇ ) derived from various groups of mice infected with EV7I:TLLmv and stained with either Hematoxylin & Eosin (H&E) for histopathological examination, or labelled using rabbit serum against EV71 antigens (EV71 IHC) for virus antigen localization.
  • Figure 26b Representative images of heart tissue sections (5 ⁇ ) processed for H&E and EV71 IHC.
  • Figures 27a-27d show representative maps depicting the localization and. distribution of EV71 antigens and virus-induced lesions in different regions of Class IA and Class IB mouse brains.
  • the cerebellar cortex (CTX) ( Figures 27a, 27b and 27c); hypothalamus (HY) ( Figures 27a and 27b); hippocampus (HP) ( Figures 27b and 27c); thalamus (TH) ( Figure 27b); midbrain (MB) and pons (P) ( Figure 27c); and cerebellum (CBX) and medulla oblongata (MY) ( Figure 27d) are indicated. Areas where viral antigens and pathologic lesions were detected are marked accordingly.
  • Figures 28a-28n show that EV71 ;TLLmv infection in mice is associated with nervous tissue destruction and extensive viral replication.
  • Figures 28a-281 Representative images of brain tissue sections (5 ⁇ ) stained with hematoxylin and eosin (H&E) or immunostained with rabbit serum against EV71 antigens (EV71 IHC). Sections were derived from mice presenting with, signs of disease Class IA (left panels), or Class IB (right panels).
  • Pathologic lesions in the brain included edema (dashed boxes), infiltrating cells (diagonal area in upper left quadrant of left panel and diagonal area in lower right quadrant of Figure 28k), neuronophagia (in left panels of Figures 28a-28c), neurodegeneration (black asterisk's), and degeneration of Purkinje cells (gray asterisks).
  • Figures 28m and 28n Representative maps of spinal cord coronal sections from mice in disease Class IA ( Figure 28m) or Class IB ( Figure 28n). Highlighted are areas where viral antigens and pathologic lesions were detected. Larger dot sizes indicate more extensive signals/lesions. V, ventral side; Z , dorsal side.
  • Figures 29a-29c show EV71 antigens and virus-induced lesions in other areas of the hindbrain of Class IA mice.
  • Figure 29a Representative images of the dentate nucleus stained with either Hematoxylin and Eosin (H&E) for histopathological examination or rabbit serum against EV71 antigens (EV71 IHC) for virus antigen localization. Boxed areas are shown magnified in the inset.
  • Figure 29b Representative images of the caudal brainstem from Class I mice, images depict the cerebellar cortex (CBX) and medulla oblongata (MY).
  • CBX cerebellar cortex
  • MY medulla oblongata
  • the area prostrema (AP; asterisk) and nucleus of the solitary tract (NTS; dashed circle) are also labelled for reference. Areas where viral antigens and pathologic lesions were detected are indicated. Larger dots represent stronger signals/lesion size.
  • Template images were downloaded from brainstars.org 1 and licensed under the Creative Commons of Japan.
  • the brain tissue coronal section maps were obtained from the Mouse Brain Atlas (http colon slash slash mouse dot .brain-map dot org slash static slash atlas) [113].
  • Figure 29c Representative images of the medulla from Class IA mice depicting the H&E and EV71 IHC staining patterns in the AP and NTS.
  • Figures 30a-30f show histological sections of nervous tissues from mock-infected mice (healthy controls). Representative images of normal mouse tissue sections (5 ⁇ ) stained with either Hematoxylin & Eosin (H&E) for histopathological examination or rabbit serum against EV71 antigens (EV71 IHC) for virus antigen localization.
  • Brain sections show CA3 pyramidal neurons in the hippocampus ( Figure 30a); reticular neurons in the hypothalamus ( Figure 30b) and thalamus (Figure 30c); neurons in the periaqueductal gray matter (Figure 30d); Purkinje cell layer in the cerebellar cortex ( Figure 30e). Note the nonnal Purkinje cell morphology (black asterisks in left panel of Figure 30e); and reticular neurons in the medulla oblongata ( Figure 3 Of).
  • Figures 31a-31e show EV7I: TLLmv-induced pathology and viral antigen distribution in other nervous tissues. Representative images of mouse tissue sections (5 ⁇ ) stained with either Hematoxylin & Eosin (H&E) for histopathological examination or rabbit serum against EV71 antigens for immunohistochemical analysis (EV71 IHC). Brain tissues were obtained from EV71 :TLLmv- infected or mock-infected mice. Brain coronal sections depict motor cortex pyramidal neurons ( Figure 33 a); pontine gray neurons ( Figure 31b); and spinal cord coronal sections from the cervical ( Figure 31c), thoracic ( Figure 3 I d), and lumbar columns (Figure 31e).
  • H&E Hematoxylin & Eosin
  • EV71 IHC immunohistochemical analysis
  • the present invention relates to Enterovirus 71 (EV73), the development of an animal model and screening of candidate anti-EV71 compounds. More specifically, the present invention relates to the discovery that Enterovirus 71 (EV71) strains that have been adapted to infect rodent cell lines or cloned derived virus containing mutations in VP1 can cause disease in immuno-competent rodents and immuno-compromised rodents. These EV71 strains are sometimes referred to as modified Enterovirus 71 herein.
  • the present invention relates to the development of a clinically authentic model of EV7 ] -induced neurological disease by infecting BALB/c mice with a modified strain (e.g., EV71:TLLmv) adapted to infect NIH/3T3 mouse fibroblasts.
  • a modified strain e.g., EV71:TLLmv
  • the modified EV71 is used to induce acute encephalomyelitis associated with neurogenic pulmonary edema in mice, characterized by lung swelling and increased organ weight compared with mock- infected lungs.
  • the present invention relates to an animal model that comprises a rodent infected with an Enterovirus 71 capable of infecting the rodent, sometimes referred to herein as a modified Enterovirus 71.
  • a modified Enterovirus 71 is a rodent cell line adapted Enterovirus 71.
  • such a modified Enterovirus 71 is a clone derived virus (CDV) containing mutations in VP1.
  • the mutations in VP1 enable the CDV to use rodent SCARB2 proteins to infect rodent cells.
  • the rodent is an immuno-competent rodent.
  • the rodent is an inimuno-compromised rodent.
  • Suitable animals for use as models are preferably mammalian animals, most preferably convenient laboratory animals such as rabbits, rats, mice, and the like.
  • the animal is a mouse.
  • the rodent cell line is a mouse cell line.
  • the mouse cell line is a mouse NIH/3T3 cell line.
  • the mouse cell line is a mouse Neuro-2a cell line.
  • the rodent cell line adapted Enterovirus 71 is EV7I:TLLmv.
  • the clone derived virus containing mutations in VP1 is CDV:BS VP1 [K98E/E145A/L169F] .
  • the animal model is useful for studying systemic spread of the virus and human disease spectrum in animal models.
  • the animal model is also useful for screening antiviral drugs and vaccines.
  • the animal model is prepared on an as needed basis.
  • a large standardized stock of rodent cell line-adapted EV7I strains is prepared, titrated and kept in a deep freezer (minus 80°C).
  • a "standardized" (based on statistical calculation) number of rodents such as BALB/c mice or NSG mice, are infected with a standardized titer of the vims strains to produce the animal model.
  • the animal model of the present invention develops neurological symptoms (similar to those that can develop in humans) upon infection.
  • the modified Enterovirus 71 such as rodent cell line-adapted EV71 virus strains, affect brain and a variety of neurological diseases that are manifested in mice.
  • the rodent cell line adapted Enterovirus 71 is EV71 :TLLm.
  • EV71 ;TLLm was derived, following serial passage of the huma EV71 BS strain in NIH/3T3 mouse cell line for a minimum of 60 cycles, hi one embodiment, EV71:TLLm was deposited on 12 January 201.5 under tenns of the Budapest Treaty with China Center for Type Culture Collection located at Wuhan University, Wuhan 430072 Peoples Republic of China, and assigned Accession Number CCTCC V201437.
  • EV71:TLLm can be recovered using advanced reverse genetics if the viral RNA is synthesized using the viral RNA sequence (GenBank Accession No. F514879; SEQ ID NO: l). Techniques for advanced reverse genetics are well known in the art [84-87].
  • the rodent cell, line adapted Enterovirus 71 is EV71:TLLmv.
  • EV71 :TLLmv was derived from further passage of EV71:TLLm in NIH 3T3 mouse cell line for another 40 cycles.
  • EV71:TLLmv was deposited on 12 January 2015 under tenns of the Budapest Treaty with China Center for Type Culture Collection located at Wuhan University, Wuhan 430072 Peoples Republic of China, and assigned Accession Number CCTCC V201438.
  • EV71:TLLmv can be recovered using advanced reverse genetics if the viral RNA is synthesized using the viral RNA sequence (GenBank Accession No. KF514880; SEQ ID NO:2).
  • the modified Enterovirus 71 is a clone derived virus (CDV) having mutations in the capsid protein VP1 which enables the modified Enterovirus 71 to use rodent SCARB2 proteins to infect rodent cells.
  • a modified Enterovirus 71 having mutations in VP1 is made by preparing a full length genomic cDNA clone using techniques known to the skilled artisan or as described herein. Mutations in VP1 or other proteins of Enterovirus 71 are made using site-directed mutagenesis or CRISPR technology (see, e.g., PCX Publication No. WO2014/127287).
  • Live vims (clone derived virus (CDV)) is prepared from the cDNA clones clone using techniques known to the skilled artisan or as described herein. CDVs having different mutations or collections of mutations are then tested for their ability to infect rodent cells. Alternatively, CDVs having different mutations or collections of mutations are then tested for their ability to bind to rodent SCARB2 proteins as an initial screening. Any suitable Enterovirus 71 strains can be used to develop CDVs having mutations in VP1. The number of mutations may and specific mutations vary for each strain in order to produce CDVs that are sufficient to produce a full blown infection in the target rodent cell.
  • the EV71. strain used to produce a CDV having mutations in VP1 is Enterovirus 71 BS strain.
  • the modified Enterovirus 71 is CD V:BS V pi[K98E/E145A/L169F] .
  • the present invention provides a method for preparing an animal model with the full-spectrum of EV71 -induced neurological infection, disease and pathology observed in humans.
  • the method comprises infecting a rodent described herein with a modified Enterovirus 71 described herein and raising the infected rodent for up to about 4 weeks.
  • the modified Enterovirus 71 is EV71:TLLmv.
  • the modified Enterovirus 71 is EV71:TLLm.
  • the modified Enterovirus 71 is CDV:BSvpi[K98E/E145A/L169F] .
  • the age of the rodent to be infected is between about 1 week and about 4 weeks. In other embodiments, the age of the rodent to be infected is between about 1 week and about 3 weeks. In other embodiments, the age of the rodent to be infected is between about 1 week and about 2 weeks. In one embodiment, the age of the rodent to be infected is about 1 week. In another embodiment, the age of the rodent to be infected is about 2 weeks. In a further embodiment, the age of the rodent to be infected is about 3 weeks, hi some embodiments, the infected rodent is raised for about 1 week to about 4 weeks. In other embodiments, the infected rodent is raised for about 1 week to about 3 weeks.
  • the infected rodent is raised for about 1 week to about 2 weeks. In one embodiment, the infected rodent is raised for about 1 week. In another embodiment, the infected rodent is raised for about 2 weeks. In an additional embodiment, the infected rodent is raised for about 3 weeks. In a further embodiment, the infected rodent is raised for about 4 weeks. In some embodiments, the rodent is an immune- compromised rodent. In some embodiments, the rodent is a mouse as described herein. In one embodiment, the immune-compromised mouse is a BALB/c mouse. In other embodiments, the rodent is infected by inoculating the rodent with the modified Enterovirus 71.
  • the inoculation is intraperitoneal (LP.). In another embodiment, the inoculation is intramuscular (I.M.).
  • the virus dose inoculated into the rodent is a median cell culture infectious dose (CCID50) between about between about 10 ' and about 10 . In other embodiments, the virus dose inoculated into the rodent is a CCID50 between about between about 10 3 and about 10 6 . In one embodiment, the virus dose inoculated into the rodent is a CCID 5 0 between about 4 x 10 3 and about 10 6 . In another embodiment, the virus dose inoculated into the rodent is a CCID50 between about 10 4 and about 10 6 .
  • the virus dose inoculated into the rodent is a CCID50 between about 10 5 and about 10 6 .
  • the virus dose inoculated into the rodent is a CCID 5 0 of about 10 .
  • the animal model prepared in this manner is an authentic mouse model of EV71 neuro -infection that exhibits face validity, i.e., these animals display the entire range of clinical signs that can be observed across the full spectrum of neurological disease induced by EV71 infection in human patients, including NPE. This animal model also displays construct validity with respect to the gross and histopathological features of disease, which closely resemble those reported in fatal human cases.
  • This new in vivo model represents a powerful tool for identifying the key events in EV71 neuro-pathogenesis, for dissecting the mechanism of EV71 -induced NPE, developing novel treatment modalities and potential antiviral therapies, and for conducting pre-clinical evaluation of novel, vaccines.
  • the present invention provides a method to screen antiviral drugs.
  • the method comprises the following steps: providing a test group of animals and a control group of animals in which the animals of each group are animals of the animal model described herein; administering to the test group an antiviral drug candidate; monitoring disease progression in the test group and the control group; comparing the disease progression in the test group to the disease progression in the control group; and selecting the antiviral drug candidate that reduces disease progression in the test group relative to the control group.
  • the antiviral drug is first screened in a test rodent cell line infected with the rodent cell line adapted Enterovirus 71 before screening in the animals, hi another embodiment, the antiviral drug is first screened in a test rodent cell line infected with a clone derived virus (CDV) containing mutations in VPl before screening in the animals.
  • CDV clone derived virus
  • the present invention provides a method to screen effective antiviral vaccines.
  • the method comprises the following steps: providing a test group of animals and a control group of animals in which the animals of each group are animals of the animal model described herein; administering to the test group an antiviral vaccine candidate; monitoring disease progression in the test group and the control group; comparing the disease progression in the test group to disease progression in the control group; and selecting the antiviral vaccine candidate that reduces disease progression in the test group relative to the control group.
  • the antiviral vaccine candidate is first screened in a test rodent cell line infected with the rodent cell line adapted Enterovirus 71 before screening in the animals.
  • the antiviral vaccine candidate is first screened in a test rodent cell line infected with clone derived virus (CDV) containing mutations in VPl before screening in the animals.
  • CDV clone derived virus
  • a large standardized stock of rodent cell line-adapted EV71 strains is prepared, titrated and kept in a deep freezer (minus 80°C).
  • a large standardized stock of clone derived virus (CDV) containing mutations in VP l strains is prepared, titrated, and kept in a deep freezer (minus 80°C).
  • CDV clone derived virus
  • the candidate antiviral drug or antiviral vaccine is administered to the infected rodents at various standardized dosages at before appearance of illness (for assay of preventive effect) or at onset of illness (for assay of therapeutic effect of the drug).
  • high through-put in vitro screening of anti- EV71 compounds is performed using tissue culture cell lines susceptible to cytolytic infection by the rodent cell lined adapted EV71 virus strains, such as those described herein, including those described in the Examples.
  • high through-put in vitro screening of anti-EV71 compounds is performed using tissue culture cell lines susceptible to cytolytic infection by clone derived virus (CDV) containing mutations in VPl strains, such as those described herein, including the Examples.
  • CDV clone derived virus
  • the in vitro screening is performed using techniques well known in the art.
  • the selected promising compounds from the in vitro screening are then screened in vivo in the animal model described herein.
  • sequential passage of the human EV71 isolate (EV7LBS) generated virus strains that gained the ability to infect in vitro cultured rodent cell lines.
  • NJH/3T3-adapted strains are described - EV71:TLLm and EV7J:TLLmv, where EV71:TLLm represents the early stage (passage number 60) and EV71:TLLmv represents the late stage (passage number 100) of the adaptation process.
  • EV71:TLLm represents the early stage (passage number 60)
  • EV71:TLLmv represents the late stage (passage number 100) of the adaptation process.
  • virus-induced infection in cells as either productive or nonproductive.
  • Productive infection exhibits positive viral antigen detection as well as high virus titers, regardless of observation of CPE.
  • non-productive infection is characterized by immeasurable virus titer at cut-off assay limit despite viral antigen detection and/or observation of CPE.
  • EV71:TLLm successfully infects Vero cells leading to full CPE at various incubation temperatures whereas it can only achieve full CPE in infected NIH/3T3 at 37°C (Table 1). Further adaptation in mouse cells, which yielded the EV7 ] :TLLmv vims, resulted in a virus strain that displays a higher degree of adaptation to mouse cells ( Figure 5B) but at the cost of narrowing down the spectrum of permissible host cells. EV71 :TLLmv does not infect primate cell lines as effectively as mouse cells although it exhibits successful infection leading to full CPE of NIH/3T3 cells incubated at a broader range of temperatures (Table 1).
  • Capsid proteins form the structural context with which the vims initiates interaction with the permissive host cell through the vims receptor, which had been identified recently as Scavenger Receptor Class B Member 2 (SCARB2) [47] and later characterized as the main virus uncoating receptor of EV71 [48] and which is also utilized by some members of Human Enterovirus A (HEV-A) species.
  • SCARB2 protein shares approximately 99% sequence identity with that of other primates.
  • mouse SCARB2 protein exhibits 15% sequence dissimilarity compared to the primate protein [49], implying significant structural deviations from primate SCARB2 and perhaps contributing to the recalcitrance of rodent cells to native EV71 infection. It is plausible that adaptive mutations in the virus capsid may render the vims competent to bind the mouse cell receptor and result in successful entry and infection of novel hosts.
  • Mapping of the capsid protein mutations indicate that majority of the identified amino acid substitutions in the viral PI region reside in exposed regions of the protein ( Figures 1 1A- 1 1D), specifically in the B-C, D-E, E-F, and G-H loops on the surface of VP 1.
  • the VP 1 residues 150-180 harbour the viral capsid canyon that engages SCARB2 protein.
  • This region centred at Gin- 172 contains a major VP1 neutralization epitope at amino acids 163-177 [32].
  • This mutation in combination with a VP2 K1491, was found to be associated with a non-virulent phenotype in 5-day mouse pups.
  • a reverse mutation at VP 1 241 from Leu to Ser [51 ] was reported arising from adaptation in NOD/SCID mouse brain tissues and found to be associated with a mouse virulent phenotype.
  • the VP1 E145A mutation which is far from the SCARB2 docking site and located in the D-E loop, is another candidate for conferring the ability to infect murine cells.
  • the VP1 145 mutation had been previously reported [34, 37] and a single El 45 A mutation leads to virulence in NOD/SCID mice [51].
  • VP1 of a C4 genotype EV71 , Q145E was associated with virulence in 5-day old mice [52].
  • Two substitutions in VP2 E-F loop were observed in EV71:TLLm ( Figure 1 1C), while three substitutions were present in EV71:TLLmv ( Figure 1 ID). None of these mutations have been previously described, although a nearby locus at VP2 149 in the E-F loop had been mentioned in the literature [34, 50, 54] and described as an adaptive mutation to passage in PSGL-1 overexpressing cells [55].
  • EV7LBS viral RNA was transfected into murine cells.
  • Direct introduction of EV7LBS RNA into the mouse cell cytoplasm results to productive infection in NIH/3T3 cells, as suggested by the observation of virus-induced CPE and measurable virus titers in the culture supernatant as assayed in Vero cells ( Figure 12).
  • Re-inoculation of the virus supernatant onto fresh ⁇ /3 ⁇ 3 cells fails to induce productive infection (Figure 6A) and no viral antigens were detected (Figure S4H).
  • TCMK cells have been shown to be permissible to EV71:TLLm and EV71:TLLmv infection ( Figures 3B and 3D; Figures 4Q and 4R), transfection of EV71 :BS viral RNA into TCMK cells did not result to successful infection.
  • Viral antigen signals were not detected in infected and trans fected cells ( Figures 10E-10F), and passage of virus supernatant onto fresh NEH/3T3 and Vero cells did not yield positive viral antigen detection ( Figures 10K and 10L).
  • there was no assayable virus titer in both infected and transfected cells (Figure 12).
  • EV71:BS does not infect Neuro-2a and NIH/3T3 cells [71], but transfection of viral genomic RNA results to expression of EV71 proteins, induction of lytic cytopathic effects (CPE), and production of viable virus progeny.
  • CPE lytic cytopathic effects
  • live virus had been previously generated following transfection of Poliovirus RNA into mammalian cells [73-75], though the cells used (HeLa) were known to be permissive to Poliovirus infection.
  • non-permissive mouse neuronal Neuro-2a and fibroblast NIH/3T3 cells were demonstrated to support viral replication and generate live virus progeny upon transfection of EV71:BS RNA into the cytoplasm, suggesting that the internal environment of murine cells contain host factors required for EV71 infection and support completion of the virus infection cycle, and that EV71 proteins are functional in murine cytosol.
  • These findings also imply that the absence of N1H/3T3 and Neuro-2a cellular infection upon virus inoculation may be due to a defect in receptor-mediated host cell entry and uncoating, which is mainly the function of the capsid protein.
  • ⁇ CD V:BSvpi[K98E/E145A/L169F]) could be successfully passaged in Neuro-2a and NJH/3T3 cells to produce viable virus progenies in the resultant culture supernatant.
  • the VP1 -169F variant was not observed in the surveyed database of EV71 VPl sequences, demonstrating its extreme rarity.
  • the CDV:BSvpi[K98E/E145A/L169F] could be stably passaged onto Neuro-2a cells and consistently produced live virus progeny while retaining the introduced mutations into the vims genome for three passages, suggesting that this vims is viable and stable at least in Neuro-2a cells.
  • introducing these three residues: VPl 98E, 145 A, and 169F, into other EV71 clinical isolates could enable it to infect murine cells, although this remains to be demonstrated.
  • mSCARB2 blocking the free surfaces of mSCARB2 on host cells by binding with polyclonal antibodies against mSCAEJB2 reduced both, virus binding on fixed cells and inhibited the infection of live cells.
  • the results also exhibit EV71:TLLmv binding to human SCARB2 (hSCARB2) protein, which the virus use to infect primate cells. Binding to and infection of primate cells with EV7J:TLLmv is also blocked by antibodies against hSCARB2. While the data presented here only showed EV71 :TLLmv, the results are also extended to EV71 :TLLm.
  • EV71:TLLmv was derived from further passage of EV71:TLLm in NIH/3T3c cells, and only a few amino acid substitutions were observed between the two mouse cell line-adapted EV71 strains. Therefore, these indicate that both EV71:TLLin and EV71:TLLmv utilize cellular mSCARB2 for infection of rodent cells.
  • both CDV:BS[M-P1] and CDV:BS V pi[K98E/E145A/L169F] utilize mSCARB2 to infect murine cells.
  • Pre-incubation of Neuro-2a cells with mSCARB2 antiserum blocked cellular infection with the virus, as supported by reduced CPE induction and lower virus titers compared to control.
  • the recent human SCARB2 crystal structure data also reveals a lipid tunnel traversing the entire protein [67], which in the context of SCARB2 function of delivering ⁇ -glucocerebrosidase to the lysosome has no relevance, but to which Dang et al. [72] proposed that it serves as a conduit for removal and transport of sphingosine from the capsid canyon during SCARB2 binding.
  • the SCARB2 amino acid residues 140-151 whose sequences are highly divergent between the human and murine proteins, are the main binding site for EV71 [49], This same region acts as a gate controlling the opening and closing of the SCARB2 lipid tunnel, an event triggered by acidic pH during virus uncoating.
  • the VP1-169 residue lies within the capsid canyon, and probably has a direct function in SCARB2 binding.
  • the drastic change from Leucine to Phenylalanine in this position may have altered the canyon structure resulting to a better fit with murine SCARB2 protein.
  • the VP1 98 and 145 residues lie on the fringe surrounding the capsid canyon and may have another function aside from SCARB2 binding.
  • mice inoculated with a mouse cell-adapted enterovirus 71 exhibit an acute encephalomyelitis associated with neurogenic pulmonary edema (NPE) that closely resembles the pathology observed in infected human patients.
  • Animals challenged with the adapted viral strain EV7J :TLLmv displayed varying levels of virus -induced tissue damage in both the pyramidal and extrapyramidal regions of the brain, presenting as paralysis, ataxia and tremors, and consistent with the CNS-localized pathology identified in fatal cases of EV71 infection [91 -95].
  • Furthenriore some mice displayed respiratory distress compatible with autonomic nervous dysfunction.
  • mice could be readily classified into four groups: Class IA, Class IB, Class II and Survivors. While Survivors did not present signs of disease, mice in Class II exhibited persistent flaccid paralysis and severe weight loss, whereas Class IA and Class IB mice additionally suffered from acute neurologic disease that was universally lethal within 3-7 DPI. Class IA mice also exhibited patent severe respiratory distress that was not due to either congestive heart failure or pneumonitis. Instead, animals in Class IA exhibited extensive tissue damage in the caudal brainstem, particularly the medulla, along with high serum levels of catecholamines, strongly suggesting that the respiratory signs observed in these mice were a consequence of neurogenic pulmonary edema (NPE).
  • NPE neurogenic pulmonary edema
  • Pulmonary edema is typically defined as an extravascular increase in the water content of the 3ungs,48 and can be subcategorized on the basis of cardiogenic or neurogenic origin. Since Class IA mouse heart tissues exhibited normal histology and lacked overt signs of disease we were able to exclude cardiogenic PE, and the absence of viral replication or inflammation in the lung parenchyma excluded direct virus-induced tissue injury.
  • Brain regions associated with NPE induction have been designated as trigger zones, which encompass the hypothalamic paraventricular and dorsomedial nuclei [101, 103], and the ventrolateral and dorsal medulla, including the NTS and AP regions [96, 104, 108-1 10].
  • EV71 - induced NPE has previously been attributed to extensive damage of brainstem tissue [21, 22, 93, 111], and in our novel murine model we detected both viral antigens and extensive damage in the brainstem and spinal cord.
  • the present invention is an authentic mouse model of EV71 neuroinfection that exhibits face validity [1 12], i.e., these animals display the entire range of clinical signs that can be observed, across the full spectrum of neurological disease induced by EV71 infection in human patients, including NPE. Hallmark observations in EV7I :TLLmv-mfected mice presenting Class 1A signs of disease were made by video comprising two video clips of two different Class IA mice. Both animals were unable to self-right and were in a state of coma. Severe respiratory distress presenting as tachypnea with subcostal recession was evident in the first mouse. Gasping, subcostal recession and a frothy fluid emanating from the nostrils were seen in the second mouse.
  • RNA Interference Technology From Basic Science to Drug Development, Cambridge University Press, Cambridge, 2005; Schepers, RNA Interference in Practice, Wiley-VCH, 2005; Engelke, RNA Interference (RNAi): The Nuts & Bolts of siRNA Technology, DNA Press, 2003; Gott, RNA Interference, Editing, and Modification: Methods and Protocols (Methods in Molecular Biology), Human Press, Totowa, NJ, 2004; Sohail, Gene Silencing by RNA Interference: Technology and Application, CRC, 2004.
  • Cell lines and virus strains All cell lines used in this study were purchased from the American Tissue Type Culture Collection (ATCC, USA). Studies were performed using various mammalian cell lines; human adenocarcinoma cell lines HeLa (CCL-2) and HEp-2 (CCL-23), and rhabdomyosarcoma RD (CCL-136); African green monkey kidney Vero (CCL-81 ), and Vervet monkey kidney fibroblast COS-7 (CRL-1651); mouse neuroblastoma Neuro2A (CCL- 131), embryonic fibroblast ⁇ /3 ⁇ 3 (CRL-1658), and kidney epithelial TCM (CCL-139); hamster ovarian epithelial-like CHO- 1 (CCL-61), and normal rat kidney epithelial NRK (CRL-6509).
  • ATCC American Tissue Type Culture Collection
  • the human EV71 BS strain (EV71:BS) was previously isolated from the brainstem of a deceased patient infected with EV71. The virus was passaged in Vero cells for four cycles prior to storage at -80°C until further use.
  • the mouse cell (NIH/3T3)-adapted EV71:TLLm strain was derived from the EV71 :BS strain via continuous serial passage (>60 cycles) in mouse NIH/3T3 cells.
  • the EV71:TLLm strain was further passaged (40 cycles) in N1H/3T3 cells to generate the mouse cell-adapted virulent strain (EV71:TLLmv).
  • Ail cell lines were grown in Dulbecco's Modified Eagle's Medium (DMEM, Gibco, USA) supplemented with 10% (7 V ) of fetal bovine serum (FBS, i-DNA Singapore) and 0.22% ( w / v ) sodium bicarbonate (NaHCC>3, Sigma Aldrich, USA) and incubated at 37°C and 5% C0 2 , unless otherwise stated. All infected cells were incubated in maintenance medium (DMEM supplemented with 1% FBS and 0.22% NaHC0 3 ).
  • DMEM Dulbecco's Modified Eagle's Medium
  • FBS fetal bovine serum
  • NaHCC sodium bicarbonate
  • All infected cells were incubated in maintenance medium (DMEM supplemented with 1% FBS and 0.22% NaHC0 3 ).
  • Cells (2.5-5.0x 10 5 cells per well) were seeded in tissue culture-treated six-well plates (Nunc, Fisher Scientific) overnight, infected with 500 ⁇ of virus suspension (MOI 1), and incubated at 30°C, 37°C, or 39°C for 2 hours. Cells were washed twice in sterile Phosphate- Buffered Saline (PBS, pH 7.4) solution before addition of fresh maintenance medium (DMEM, 1% FBS). Infected cells were observed daily for appearance of distinct lytic cytopathic effects (CPE).
  • PBS sterile Phosphate- Buffered Saline
  • DMEM fresh maintenance medium
  • inoculated Vero and ⁇ /3 ⁇ 3 cells were incubated at 30°C, 37°C, and 39°C and observed daily for appearance of CPE. Respective culture supernatants were harvested at 48 hpi and stored in cryovials at - ⁇ 80°C until further use.
  • Various mammalian cell lines i.e. RD, HeLa, and HEp-2 (human), Vero and COS-7 (monkey), NIH/3T3, Neuro-2A, and TCMK (mouse), CHO-K1 (hamster), and NRK cells (rat), were infected with either parental EV71:BS or derived NIH/3T3 -adapted EV71 strains at MOI (multiplicity of infection) of 1 and incubated at 37°C for 10 days. Cultures were observed daily for appearance of CPE.
  • MOI multiplicity of infection
  • Virus supernatants were subjected to endpoint titration and assayed in both NIH/3T3 and Vero cells.
  • the virus titer was enumerated using the Reed and Muench method [61] and the Reed and Muench calculator [62]. Briefly, ⁇ /3 ⁇ 3 (l x l 0 4 cells per well) and Vero cells (4x l 0 3 cells per well) were seeded overnight in a 96-well plate.
  • Frozen virus thawed to room temperature were diluted ( ⁇ 1 ) in sterile 1% aqueous sodium deoxycholate (Sigma Aldrich, USA), and vigorously mixed for 15 minutes to disaggregate virus. Disaggregated virus was subjected to ten-fold serial dilution in maintenance medium, and 100 ⁇ diluted virus from 10 dilution onwards was added onto each well of cells. Plates were incubated at 37°C and observed daily under inverted light microscopy for the appearance of distinct CPE. Virus titer was reported as 50% cell culture-infectious doses per volume (CCID 5 ⁇ )/ml).
  • A is the virus titer assayed in N1H/3T3 cells
  • B is the virus titer assayed in Vero cells.
  • Virus antigen detection by immunofluorescence assay For infected cells that did. not exhibit significant CPE, immunofluorescence (IF) staining was performed to verify infection. Cells were trypsinized at 72 hpi, washed twice in sterile PBS, and coated onto Teflon slides (Erie, USA). Slides were air-dried inside the biosafety cabinet and UV-treated for 15 minutes to inactivate live virus prior to fixation in cold acetone at 4°C for 10 minutes.
  • IF immunofluorescence
  • RNA from EV7LBS, EV71:TLLm, and EV71:TLLmv was extracted using Viral RNA kit (Qiagen, Germany) and incubated with Lipofectamine 2000 on cells for 6 hours at 37°C. Transfected cells were observed daily for appearance of CPE.
  • Viral RNA of EV7EBS, EV71 :TLLm, and EV71:TLLmv strains was extracted using Viral RNA kit (Qiagen, Germany) and reverse-transcribed using Superscript II (SII-RT, Life Technologies, USA).
  • the cDNA obtained was amplified with GoTaq Green (Promega, USA) and degenerate EV71 primers (primers' sequences are available upon request).
  • the amplicon was purified using PCR clean up kit (Geneaid Biotech, Taiwan) and cloned into pZero2 vector (Lifetech, USA).
  • Clones were selected from Kanamycin plates, inoculated into LB broth (50 ⁇ Kanamycin) and allowed to grow overnight at 37°C for plasmid extraction with QiaSpin Miniprep kit (Qiagen, Germany). Plasmids were subsequently sequenced by the BigDye tenninator method (Applied Biosystems, USA) using the same primers. The 500-bp fragment sequences obtained were aligned using BioEdit v7.0.9.0 [63] against the whole genome sequence of an EV71 Singapore isolate 3799-SIN-98 (GenBank accession no. DQ341354.1) to reconstruct the full genome sequences of EV71:BS, EV71:TLLm, and EV71:TLLmv.
  • Virus harvested from RD and Vero cells reached an endpoint titer of 3 ⁇ 10 9 CCEDso/ml, while virus titer from COS-7 was 10 6 CCID 50 /ml (Figure 3A).
  • EV7LBS did not induce full CPE in HeLa and Hep-2 cells ( Figures ID and 1G), and the resulting viral titer was not measurable within, the assay cutoff limit.
  • viral antigen was detected by indirect immunofluore scent staining in both HeLa cells ( Figure 2a) and Hep-2 cells ( Figure 2D) indicating successful virus entry into the cells but inefficient or defective replication may have resulted in immeasurable vims titer,
  • EV71 :TLLm was derived following serial passage of EV7LBS in NIH/3T3 mouse cell line for a minimum of 60 cycles. All primate and rodent cell lines tested, with the exception of
  • NRK cells were permissible to productive infection by EV71:TLLm. Full CPE was observed in
  • the EV71:TLLmv virus strain was derived from further passage of EV71 :TLLm in
  • NIH/3T3 cells for another 40 cycles.
  • EV71 ;TLLmv caused lytic CPE in fewer number of cell lines - D, Vero, ⁇ /3 ⁇ 3, Neuro-2A, and TCMK cells (Figure 3B), and full CPE was only observed in RD, NIH/3T3, and Neuro-2A cells ( Figure 1C; 4C, F).
  • TCMK, CHO-K1 and NRK cells were also noted to be permissible to infection without progressing to full CPE ( Figure 41,
  • the primate cell lines HeLa, Hep-2, and COS -7 were observed to be non-permissible to EV71:TLLmv infection, as shown by the absence of CPE ( Figures IF, II, and 10), immeasurable virus titers ( Figure 3B), and negative viral antigen detection ( Figures 2C, 2F, and data not shown).
  • NIH/3T3 to the titer values assayed in Vero was used as a surrogate measure of the degree of virus adaptation to NIH/3T3 cells.
  • the parental EV71.-BS virus displayed highly negative RRR values for RD, Vero, and COS-7 ( Figure 5A), indicating that the virus titer assayed in Vero cells far exceeds the titer assayed in NIH/3T3 cells. The relative reproductive ratio values for other cell lines could not be determined since the vims titers could not be measured.
  • EV71:TLLmv virus exhibited positive RRR values, with the exception of virus propagated in Vero cells ( Figure 5B).
  • EV71 :BS displayed the most limited adaptability, with Ml CPE observed only in Vero cells incubated at 37°C ( Figure 8B; Table 1).
  • EV71 :TLLmv displayed moderate adaptability, based on the observed Ml CPE induction in Vero cells at 37°C ( Figure S2B) and in NIH/3T3 cells in both
  • Viral RNA of EV7EBS, EV7 LTLLm, EV71;TLLmv were subjected to Sanger sequencing to determine the consensus genome sequence and identify possible adaptive mutations arising from the adaptation process in NIH/3T3 cells.
  • the consensus sequences of the genomes representing dominant population of the quasi-species have been deposited i the
  • GenBank NCBI (National Center for Biotechnology Information). Alignment of the full genome sequences of EV71:TLLm (GenBank Accession No. KF514879; SEQ ID NO:l) against
  • EV7 -BS (GenBank Accession No. KF514878; SEQ ID NO:3) revealed 60 nucleotide mutations, 21 of which resulted in amino acid substitutions (Table 2). On the other hand, 83 mutations with 36 amino acid substitutions, were noted between the genomes of EV7J :TLLmv
  • Vero and NIH 3T3 cells transfected with viral RNA exhibited full CPE at 7 days post- transfection (dpt) (data not shown).
  • Viral antigens were detected in NIH/3T3 cells transfected with viral RNA of EV71:BS ( Figure 10B), but not in NIH/3T3 cells subjected to infection with the virus ( Figure 10A).
  • Virus supematants re-inoculated onto fresh Vero and NIH/3T3 cells resulted in productive infection (100% CPE) only in Vero but not in NIH/3T3 cells ( Figure 6A), and viral antigen detection confirmed infection in Vero cells, but not NIH/3T3 ( Figure 6B).
  • Plasmids, viruses, bacteria, and cell lines' The plasmid encoding murine SCARB2 cDNA (pMD18 ⁇ mSCARB2) (Genbank accession no. NPJ 1670.1) was purchased from Sino Biological, Inc. (Beijing, China).
  • the pQE30 vector (Qiagen, Germany) for recombinant expression of soluble mSCARB2 protein in E. coli cells was a generous gift from Dr. Kian Hong Ng (Temasek Lifesciences Laboratory, Singapore). Plasmids encoding the full-length cDNA of EV71 were generated using the low-copy no. plasmid pACYC177 (New England Biolabs, Singapore).
  • a plasmid construct expressing T7 polymerase (pCMV-T7pol) was a generous gift from Dr. Peter McMinn of University of Sydney, New South Wales.
  • the plasmid pZero-2 used for fragment sequencing of clone-derived viruses was purchased from Invitrogen (Life Technologies, USA).
  • E. coli cells BL21 strain (New England Biolabs, Singapore) was used for high-level protein expression, TOP 10 strain (Life Technologies, USA) for fragment sequencing of individual clones, and XL-10 Gold ultracompetent strain (Stratagene, USA) for generation of full-length genomic cDNA clones.
  • Construction of EV7 LBS full-length genomic cDNA clones, capsid-chimeric clones, and VP1/VP2 mutant clones were generated by two-step cloning.
  • Viral RNA extraction (Qiagen Viral RNA kit, Germany) and conversion to cDNA (Life Technologies Superscript-II RT, USA) have been described above or previously [71 ].
  • the genome proximal fragment encoding the 5'UTR and PI regions was amplified using the primer pair: EV71_BamHI-PfF and EV71_Pf-AatIIR (Table 5), which contains BamHI and A atll restriction sites for cloning into the plasmid pACYC177.
  • the distal fragment encoding the P2, PS, and S VTR was amplified with the primer pair EV71_HindIII ⁇ DF and EV71 D-BamHIR, which also contains Hindlll and BamHI restriction sites for cloning.
  • the proximal fragment contains a T7 polymerase promoter region upstream of the 5'UTR to facilitate transcription.
  • the proximal fragment was ligated to the distal fragment following digestion with Eagl and Aatll, and the full-length EV71 :BS clone was produced.
  • GTACGACTAGTGCC (1 1) VP2_ G1385C-F CAGAGGACACCCACCCTCCTTACAAACAAACACAA For introducing the G3385C CCTGGCGCC (12) mutation.
  • VPJ_C2947T-F AGAGAATCATTTGCTTGGCAGACAGCCACAAACCC
  • an Mlul restriction site was engineered within the boundary between 5 'UTR and PI (primer pair SDM MlulF and SDM_Ml I-R).
  • the PI cDNA sequence of EV71 :TLLm was amplified (primer pair Mh - TLLm-PlF and Eagl-TLLm-PlR), digested with Mlul and EagI, and cloned into the construct harbouring the proximal fragment. This modified proximal fragment was subsequently ligated to the distal fragment as described.
  • CPE lytic cytopathic effects
  • Infected cell culture supematants were also harvested, cleared, and subjected to serial dilutions for vims titer determination using the Reed and Muench method [61]. Once the titer is known, the supematants were passaged onto freshly seeded ⁇ /3 ⁇ 3 and Neuro-2a cells at 1 MOI, and the infection phenotype was again assessed using the method described here.
  • Harvested cells were lysozyme (1 mg/ml) digested, and the crude extract was purified using a Ni-NTA column (Qiagen®, Germany). Cleared lysate was incubated overnight in 1 ml of 50% Ni-NTA slurry at 4° C with gentle shaking. The protein was washed 5 times in Wash Buffer (50 mM NaPi 2 P0 4 , 300 mM NaCl, 20mM. imidazole, pH 8.0) and eluted with Elution Buffer (50 mM Na3 ⁇ 4P0 4 , 300 mM NaCl, 250mM imidazole, pH 8.0.
  • Wash Buffer 50 mM NaPi 2 P0 4 , 300 mM NaCl, 20mM. imidazole, pH 8.0
  • Elution Buffer 50 mM Na3 ⁇ 4P0 4 , 300 mM NaCl, 250mM imidazole, pH 8.0.
  • Virus competition assay with murine SCARB2 protein In vitro binding assays were performed to confirm the interaction of EV71:TLLmv with mouse and human SCARB2 proteins. ⁇ /3 ⁇ 3 cells (6000 per well) were seeded overnight onto sterile Teflon coated slides (Erie, USA), Prior to viras inoculation, 100 MOI EV71 :TLLmv was incubated with various concentrations of recombinant mouse SCARB2 (mSCARB2) or human SCARB2 (hSCARB2) proteins (4.0 g, 2.0 ⁇ g, 1.0 ⁇ g, 0.5 g, 0.25 g, 0.125 ⁇ g, and 0 ⁇ g) for 2 hours at 37° C in a shaking platform.
  • mSCARB2 mouse SCARB2
  • hSCARB2 human SCARB2
  • Infected cells were observed daily for signs of CPE and fixed at 48 hours postinfection . in absolute acetone (4° C, 10 mins). Fixed cells were immunofluorescently assayed with pan-Enterovirus antibody (Merck Miilipore®, USA). Slides were imaged with an upright fluorescence microscope (Nikon, Japan).
  • Virus ⁇ SCARB2 binding assays Antibody-mediated SCARB2 blocking assays were performed on fixed cells to assess whether masking cell surface SCARB2 proteins affects binding virus binding. N1H/3T3 and Vero cells cultured on Teflon slides were fixed (4% PFA, 25 minutes, room temp.), and blocked with 5% BSA in PBS for 1 hour at 37° C. Slides were incubated in polyclonal rabbit sera raised against mSCARB2 (1 :100) for 1 hour at 37° C. For negative controls, cells were incubated with polyclonal rabbit sera raised against Saffoid Viras L protein.
  • Cells were subsequently inoculated with 100 MOI EV71 :TLLmv or clone-derived virus mutants CDV:BS[M-P1] and CDV:BS VPl [K98E/E145A/L169F] for 1 hour at 37° C. Cells were washed twice in PBS prior to replacement with fresh DMEM (1 % FBS). Cells were observed daily for signs of CPE, and infected cell culture supematants were harvested at 3 days post-infection (dpi). Supematants were subjected to virus titration with prior virus disaggregation process by vigorous vortexing for 15 minutes at room temperature in 1 % sodium deoxycholate, as previously [6, 71 ]. Virus titers were enumerated with the Reed and Muench method [61] and reported as CCID 50 / ml with the Infectivity Calculator [62] .
  • Murine fibroblast NIH/3T3 and neuroblastoma Neuro-2a cells were previously demonstrated as non-permissible to EV71:BS infection, while Vcro cells are (above or [71]).
  • Two strains, EV7 ⁇ iTLLm. and EV71;TLLmv, both derived from EV71.-BS successfully entered and replicated within these murine cells.
  • genomic RNA from EV7J:BS was extracted and transfected into Vero, NIH/3T3, and Neuro-2a cells.
  • genomic RNA from EV71:TLLm and EV71:TLLmv were transfected into these three cell lines for comparison.
  • transfection supematants were subsequently re- inoculated onto fresh cells (Figure 15A).
  • Capsid-Encoding PI Region of Mouse Cell Line- Adapted EV71;TLLm Is responsible for Successful Virus Entry into Murine NIH/3T3 and Neuro-2a Cells
  • the EV71:BS cDNA clone was transfected into Vero cells to generated clone-derived virus (CDV:BS). Similarly, the chimeric clone was transfected to generate CDV:BS[M-P1] that exhibits the capsid protein of EV71 :TLLm and expresses the nonstructural proteins of EV71.-BS. These CDV were re-inoculated onto various cell lines to assess the infection phenotype ( Figure 16B).
  • EV71:BS clone-derived virus (CDV:BS) induced CPE in Vero cells but not ⁇ /3 ⁇ 3 and Neuro-2a cells, while CDV:BS[M-P1] induced CPE in all three cell lines at 48 hours post- inoculation (hpi) ( Figure 16C).
  • clarified culture supernatants from infected cells were re-inoculated onto fresh monolayers of the same cell line, and viral yields were measured at 72 hpi.
  • the capsid protein of mouse cell-adapted EV71 :TLLm enables entry of EV71.-BS into murine cells, and we are interested in the identity of specific residues that confer this novel phenotype.
  • Previous data on the comparison of polyprotein sequence alignments of EV7EBS and mouse cell-adapted EV71 strains showed multiple amino acid substitutions in VPl and VP2 proteins that may be involved in virus receptor engagement on host cells (above or [71 ]).
  • Vero cells infected with all the mutant clone-derived viruses (CDV) exhibited 100% CPE, but only those CDV harbouring VP 1 amino acid substitutions - CDV:BSm[K98EJ, CDV;BSVPJ[EJ45AJ ⁇ and CDV:BS VP! [L169F] - resulted in 100% CPE in Neuro-2a cells ( Figures 17B and 17 C).
  • Viral antigen expression was detected in Vero and Neuro-2a cells infected with CDV containing amino acid substitutions in VP 1 (CDV:BS VP i) and VP2 (CDV: BSy P2 ), but only the ⁇ /3 ⁇ 3 cells infected with CDV:BSy P 2 exhibited viral antigen expression ( Figures 1 D and 17E). Furthermore, Vero cells infected with all the mutant CDV yielded measurable virus titers ( Figure 17F), suggesting virus viability, but only CDV:BSvpi[L169F] generated measurable virus titer in the culture supernatant of infected NIH/3T3 and Neuro-2a cells ( Figure 17G) as assayed in Vero cells. However, further passage onto healthy murine cells, of culture supernatants from NIH/3T3 and Neuro-2a cells infected with CDV:BS VP1 [LJ69FJ, failed to induce infection.
  • BSVPI[K98E/E145A/L169F] ' were generated ( Figure 18 A).
  • the plasmid clones were independently transfected onto Vero cells, and the resulting supernatant was used to inoculate Vero, NIFI/3T3, and Neuro-2a cells to assess the infection phenotype.
  • CD V BS V PI[K98E/E]45A]
  • CDV BS VP! [K98E/E145A/L169F] .
  • CDV could stably infect mouse cells for multiple cycles, virus supernatants were passaged twice in the same cell line, i.e. from Neuro-2a to fresh Neuro-2a cells. Infection was monitored by assessment of CPE induction and viral antigen expression, and production of viable virus progeny.
  • CDV:BS yP1 [K98E/E145A/L169F] and CDV:BS[M-P1] could be successfully passaged consecutively in Neuro-2a cells as demonstrated by detection of viral antigens (Figure 19A) and measurable virus titers ( Figure 19B). Positive staining was observed in both passage No. 2 and 3, and an increase in vims titer was recorded in passage No. 2 compared to the first passage.
  • CDV:BS[M-P1] was able to induce expression of viral antigens in NIH/3T3 cells, ( Figure 19 A), but no viable virus progeny was detected.
  • Genomic sequencing of CDV:BS VP1 [K98E/E145A/L169F] derived from the third passage in Neuro-2a cells exhibited no change in the introduced amino acid mutations ( Figure 19C).
  • SCARB2 protein as its receptor for host cell entry [47].
  • SCARB2 protein as its receptor for host cell entry [47].
  • competitive virus binding assays were performed. Firstly, NIH/3T3 and Vero cells grown overnight in
  • EV71 :TLLmv strain also utilize mSCARB2 for virus entry and uncoating, Neuro-2a cells were incubated with mSCARB2 antiserum prior to infection with the CDV mutants. Dose-dependent reduction of lytic CPE was observed in cells infected with either
  • Animal model To determine the animal infection phenotype of the mouse cell- adapted strains (EV71 ;TLLm and EV71:TLLmv), 5-6-day old Balb/c mice were infected with 10 6 CCID 50 of the virus and observed for symptoms of disease and neurological complications. The animals were followed up for a maximum of 28 days, after which the animals were sacrificed and sera were collected for detection of EV71 -specific antibodies.
  • mice infected with EV71:TLLmv exhibited a drastic reduction in body weight within the first 10 days of infection (Figure 13B). More interestingly, we observed a novel symptom in EV71 -infected mice, whereby the paralyzed animals (Figure 14A, arrow) presented with tachypnea with prominent subcostal recession.
  • This Example is also performed using immuno-compromised mice, such as NSG mice. Similar results are obtained except that severity of disease is greater and the mortality rate is higher.
  • High through-put in vitro screening of candidate anti-EV71 compounds is performed using the mouse ⁇ /3 ⁇ 3 cell line which has been shown to be susceptible to cytolytic infection by EV71 :TLLm or EV71:TLLmv virus strains.
  • the selected promising compounds from the in vitro screening are then in vivo tested in the animal model.
  • a standardized (based on statistical calculation) number of BALB/c mice are infected with a standardized titer of the virus strains taken from a standardized stock of mouse cell line-adapted EV71 strains (EV71 :TLLm and EV71 :TLLmv) that is prepared, titrated and kept in a deep freezer (-80°C).
  • the candidate anti-EV71 compound is administered to the infected mice at various standardized dosages either before appearance of illness for assaying a potential preventive effect of the candidate compound or after onset of illness for assaying a potential therapeutic effect of the candidate compound.
  • mice Male BALB/c mice were purchased from InVivos (Singapore), and mated to obtain pups.
  • EV71 strains used for inoculation included EV71.-BS, EV71 :TLLm, and EV71:TLLmv, whose details and characteristics have been described herein.
  • mice of varying age (6, 14, 21, or 28 days old) were inoculated, with EV71:TLLmv (dose 10 6 CCID 5 o) either by LP. or I.M. injection.
  • EV71:TLLmv dose 10 6 CCID 5 o
  • Infected animals were observed twice daily for disease presentation during the first week postinfection. Both moribund animals and those that survived the observation period were euthanized as described above. Terminal blood collection was performed via cardiac puncture using a 26G needle.
  • Necropsy, gross pathological observations, and tissue collection Euthanized animals were necropsied using standard protocols to harvest organs. Gross pathologic examination was also performed and photographs were taken with IACUC approval. Lungs were superficially flushed twice with sterile PBS, and then blotted dry on filter paper prior to measuring the wet weight. Harvested organs for histological studies were stored in 1.0% neutral buffered fomialin (NBF) for 1 week at 4° C.
  • NBF neutral buffered fomialin
  • Tissue processing for histological analyses Fixed tissues were dehydrated in a series of increasing concentrations of 70%, 95% and 100% ethanol. Tissues were incubated in two changes of alcohol and three changes of Histoclear II (Electron Microscopy Sciences, USA), and finally infiltrated with four changes of melted paraffin wax. All incubations were performed for 1 h at room temperature with gentle rocking at 100 rpm. Paraffin infiltrations were performed in an oven set at 65° C. Paraffin-embedded tissue blocks were sectioned (5 pm) using a microtome, loaded onto poly-lysine-coated glass slides, dried overnight at 42° C, and then stored at room temperature until further use.
  • tissue sections were de-waxed by incubation in two changes of Histoclear II and then slowly rehydrated in decreasing alcohol concentrations of 100%, 95%, 70%, and 50%. Slides were incubated in PBS for lOmin prior to staining. Hematoxylin and eosin (H &E) staining was performed by first flooding the slides with Harris' hematoxylin (Sigma Aldrich, USA.) and incubating at room temperature (RT) for 15 min.
  • H &E Hematoxylin and eosin
  • the slides were then rinsed in water, de-stained in 1% acid alcohol (95% ethanol, 1% HC1), dipped in 0.2% NH40H, and rinsed in water for 10 min prior to counterstaining in eosin solution.
  • the slides were next de-stained in 95%» ethanol, dehydrated by three changes of absolute alcohol and two changes of Histoclear ⁇ . Tissues were finally set in DPX mounting fluid (Sigma Aldrich, USA).
  • mice infected with either EV71 :TLLm or EV77 ;TLLmv progressed to lethal disease ( Figures 22a and 22b).
  • I.M intramuscular
  • mice inoculated with EV71 :TLLmv succumbed to disease and exhibited myriad clinical signs of neurological illness.
  • Infected animals exhibited ataxia, localized or whole-body tremors, unsteady gait, and limb paresis and paralysis either transiently or persisting until the time of euthanasia. Based on clinical presentation, the sick animals could be readily categorized into four groups (Table 6). Survivors included mice that did not appear moribund at any point during the observation period of 28 days. Class I animals presented after just 3-7 DPI with severe signs including an inability to self-right and either stupor or coma.
  • mice in this group exhibited spastic limb paresis and/or paralysis (fore-limbs, hind-limbs, or both), but while some animals were devoid of respiratory symptoms ⁇ Class IB), others were additionally characterized by signs of respiratory distress, including tachypnea, hiccupping, gasping, and subcostal recession ⁇ Class IA). Hallmark observations in EV71 :TLLinv-mfecied mice presenting Class IA signs of disease were made by video comprising two video clips of two different Class IA mice. Both animals were unable to self-right and were in a state of coma. Severe respiratory distress presenting as tachypnea with subcostal recession was evident in the first mouse.
  • Class IA mice also exhibited intense viral antigen staining in hypothalamus, accompanied by marked tissue inflammation and neuronal necrosis, whereas these pathological features were limited in Class IB animals ( Figures 28c and 28d and Figure 27b). Similarly, Class IA mice also presented features of more severe virus-induced pathology and viral antigen intensity in the ventro- posterior complex of the thalamus ( Figures 28e and 28f and Figure 27b), the mesencephalon- associated tissues including the periaqueductal gray (PAG) matter, midbrain reticular area, and motor-related superior colliculus (Figures 28g and 28h and Figure 27c), as well as in the Purkinje cells and dentate nucleus of the cerebellum ( Figures 28i and 28j, Figure 27d and Figure 29a.
  • PAG periaqueductal gray
  • Figure 27c motor-related superior colliculus
  • Class IA and Class IB mice did not differ with respect to the distribution, localization or extent of tissue lesions or viral antigen staining within the motor cortex, somatosensory cortex, pons or ventral horns of the spinal cord gray matter ( Figures 28m and 28n, Figures 27a-27c and Figures 31 a-31e), consistent with the concept that NPE is caused by virally triggered damage to specific brain regions rather than a uniform increase in EV71- induced pathology across all tissues.
  • Yamayoshi S, Koike S (201 1) Identification of a human SCARB2 region that is important for enterovirus 71 binding and infection. J Virol 85: 4937-4946.
  • enterovirus 71 A-particle forms a gateway to allow genome release: a cryoEM study of picornavirus uncoating.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Urology & Nephrology (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biochemistry (AREA)
  • Pathology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Medicinal Chemistry (AREA)
  • Toxicology (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Environmental Sciences (AREA)
  • Cell Biology (AREA)
  • Epidemiology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Virology (AREA)
  • General Engineering & Computer Science (AREA)
  • Diabetes (AREA)
  • Endocrinology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Rheumatology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Tropical Medicine & Parasitology (AREA)

Abstract

The present invention relates to Enterovirus 71 (EV71), the development of an animal model and screening of candidate anti-EV71 compounds. More specifically, the present invention relates to the discovery that Enterovirus 71 (EV71 ) strains that have been adapted to infect rodent cell lines or cloned derived virus containing mutations in VP1 can cause disease in immuno-competent rodents.

Description

ENTEROVIRUS 71 ANIMAL MODEL
CROSS-REFERENCE TO RELATED APPLICATIONS
[0Θ01] The present application is related to and claims priority to U.S. provisional patent application Serial No. 62/1 14,880 filed on 11 February 2015 and to U.S. provisional patent application Serial No. 62/108,828 filed on 28 January 2015. Each application is incorporated herein in its entirety.
SUBMISSION OF SEQUENCE LISTING
[0002] The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is entitled 2577243PCTSequenceListing.txt, created on 29 December 2015 and is 32 kb in size. The information in the electronic format of the Sequence Listing is incorporated herein by reference in their entirety.
BACKGROUND OF THE INVENTION
[0003] The present invention relates to Enterovirus 71 (EV7I), the development of an animal model and screening of candidate anti-EV71 compounds.
[0004] The publications and other materials used herein to illuminate the background of the invention, and in particular, cases to provide additional details respecting the practice, are incorporated by reference, and for convenience are referenced in the following text by author and date and are listed alphabetically by author in the appended bibliography.
[0005] Enterovirus 71 (EV71 ) is a small non-enveloped virus approximately 30 nm in diameter. The viral capsid exhibits icosahedral symmetry and is comprised of 60 identical units (protomers), with each consisting of four viral structural proteins VP1-VP4. The capsid surrounds a core of a single- stranded positive-sense RNA genome of 7,450 nucleotides (nt) Jong. The genome contains a single open reading frame which encodes a polyprotein of 2193 amino acids (aa) and is flanked by a long 5'' untranslated region (UTR) of 745 nt and a shorter 3f UTR of 85 nt with a poly-A tract of variable length at its 3' terminus. The polyprotein is divided into three regions, i.e., PI, P2 and. P3. PI encodes four viral structural proteins 1 A-1D (VP4, VP2, VP3 and VP1 ); P2 and P3 encode seven non- structural proteins 2A-2C and 3A-3D [1-3]. Phylogenetic analysis of the major capsid protein (VP1) gene divided EV71 into six genotypes (denoted A to F) [66], and genotypes B and C are further subdivided into subgenotypes Bl to B5 and CI to C5 [3]. [0006] EV71 causes an array of clinical diseases including hand, foot and mout disease (HFMD), aseptic meningitis, encephalitis and poliomyelitis-like paralysis mainly in infants and young children [4, 5], The virus was first isolated from a child with acute encephalitis in California, USA in 1969, and subsequently characterized as a new serotype of the genus Enterovirus in 1974 [6]. Outbreaks of HFMD with or without neurologic complications and deaths were reported in various parts of the world [7-20]. Since 1997, EV71 infections have been a major public health burden and of constant epidemiologic concern in the Asia-Pacific Region, An HFMD outbreak due to highly neurovirulent EV71 emerged in Malaysia resulting in 48 deaths in 1997 [21 , 22], followed by a larger outbreak that occurred in Taiwan in 1998 with more than 129,000 cases of HFMD, 405 severe infections and 78 deaths due to acute brainstem encephalomyelitis with neurogenic cardiac failure and pulmonary edema [23-26]. h People's Republic of China, 488,955 HFMD cases with 126 deaths were recorded in 2008 [27] and increased to 1 ,155,525 cases with 353 fatalities in 2009 [28]. In 2010, China experienced the largest ever HFMD outbreak with more than 1.7 million cases, 27,000 patients with severe neurologic complications, and 905 deaths [29],
[0007] Similar to other human enteroviruses, EV71 is unable to infect animals other than humans, although rhesus and cynomolgous monkeys can be experimentally infected [30-32]. This is primarily due to the inefficient binding of EV71 to its receptor for uncoating and entry into mouse cells, which had been recently identified as Scavenger Receptor Class B Member-2 (SCARB2) protein [47]. The human and murine SCARB2 proteins exhibit only 84% amino acid sequence identity and therefore display significant structural divergence [49, 67], hence precipitating the virus-receptor incompatibility underlying the natural resistance of non-human cells to EV71 infection. Once the virus successfully engages the SCARB2 receptor on the cellular surface and uncoats into the cytoplasm, the viral RNA is translated, resulting in the expression of various viral non- structural proteins. The viral RNA is subsequently replicated, packaged into the capsid, and released into the environment free to re-infect healthy cells.
[0008] Understanding its pathogenesis and development of specific therapeutics against the virus are hampered by the lack of suitable small animal models, because EV71 is unable to naturally infect small rodents. Attempts to establish mouse models of EV71 infection and disease have been made, mostly through virus adaptation by serial passages in young suckling mice [33-39]. Although some models were able to recapitulate symptoms of clinical illness, none has been reported to cause disease in immuno-competent mice aged 2 weeks old or older. Moreover, clinical features of disease and pathology of EV71 infections in humans and experimental monkeys could not be replicated in mice, with the exception of the immunocompromised interferon receptor-deficient AG129 mice [35]. More recently, transgenic mice expressing human PSGL-1 [68] and human SCARB2 [69, 70] proteins have been available, but these exhibit only marginal improvements in susceptibility to EV71 infection.
[0009] RNA viruses, by virtue of their error-prone replication and high mutation rates [40- 42], replicate as a swarm of related variant sequences known as quasispecies [43, 44]. It is comprised of a master species exhibiting the highest fitness in a certain environment, and of a mutant spectrum composed of a collection of closely related mutant sequences with a certain probability distribution [44, 45]. These endow RNA viruses with genome plasticity, which is reflected in their ability to quickly adapt to changing environments.
[0010] The mechanisms by which EV7I infection causes fatal neurological disease are not fully understood, hence several research groups have attempted to reproduce the pathology of human infection in experimental animals including rhesus and cynomolgous monkeys [114- 120], laboratory mice [1 12, 121-129], and other mammals [130-133], Unfortunately, none of these models exhibits the full spectrum of neurological features observed in human cases, especially those attributable to acute brainstem encephalitis with fulminant neurogenic pulmonary edema (NPE) [21 , 22, 134-137]. Indeed, even in experimental systems that more accurately replicate the signs and symptoms of EV71 infection in humans, the underlying mechanisms differ substantially from those that confer disease in human patients. To date, no single animal model has conclusively replicated EV71 -induced NPE. A key distinction is that EV71 is restricted to CNS tissues in human patients [92-94, 1 11], whereas in animal models the virus can also be detected in non-nervous tissues including the skeletal muscles [33-36, 38, 98] and liver [1 19]. While there have also been efforts to create transgenic mice that express the human EV71 receptor proteins PSGL-1 (P-selectin glycoprotein ligand-1) and SCARB2 (S 66 cavenger Receptor Class B, member 2) [68-70, 47, 138], none of these models exhibits NPE, hence their utility for identifying novel interventions for human patients is limited.
[0011] No suitable animal models exist to study infection and disease progression in EV71 infected animals or that could be used to screen anti-viral compounds or anti-viral vaccines. It is desired to develop an animal model for these purposes.
SUMMARY OF THE INVENTION
[0012] The present invention relates to Enterovirus 71 (EV71), the development of an animal model and screening of candidate anti-EV71 compounds. More specifically, the present invention relates to the discovery that Enterovirus 71 (EV71) strains that have been adapted to infect rodent cell lines or cloned derived virus containing mutations in VP1 can cause disease in immuno-competent rodents and immuno-compromised rodents.
[0013] In addition, the present invention relates to the development of a clinically authentic model of EV71 -induced neurological, disease by infecting BALB/c mice with a modified strain (e.g., EV71 :TLLmv) adapted to infect NIH/3T3 mouse fibroblasts. Using this approach, the modified EV71 is used to induce acute encephalomyelitis associated with neurogenic pulmonary edema in mice, characterized by lung swelling and increased organ weight compared with mock- infected lungs. Despite the absence of lung or cardiac tissue inflammation, focal hemorrhage and proteinaceous fluid in the alveoli, high serum levels of catecholamines, and extensive tissue damage in the brainstem, particularly the medulla oblongata were observed. These data demonstrate that the model accurately reproduces the signs and symptoms of human EV71 - induced neurogenic pulmonary edema.
[0014] Thus, in one aspect, the present invention relates to an animal model that comprises a rodent infected with an Enterovirus 71 capable of infecting the rodent, sometimes referred to herein as a modified Enterovirus 71. In one embodiment, such an Enterovirus 71 is a rodent cell line adapted Enterovirus 71. In another embodiment, such, an Enterovirus 71 is a clone derived virus (CDV) containing mutations in VP1. In some embodiments, the mutations in VP1 enable the CDV to use rodent SCA B2 proteins to infect rodent cells. In one embodiment, the rodent is an immuno-competent rodent. In another embodiment, the rodent is an immuno-compromised rodent. Suitable animals for use as models are preferably mammalian animals, most preferably convenient laboratory animals such as rabbits, rats, mice, and the like, h one embodiment, the animal is a mouse. In some embodiments, the mouse is a BALB/c mouse. In another embodiment, the rodent cell line is a mouse cell line. In a further embodiment, the mouse cell line is a mouse ΝΓΗ/3Τ3 cell line. In another embodiment, the mouse cell line is a mouse Neuro-2a cell line. In one embodiment, the rodent cell line adapted Enterovirus 7 lis EV71:TLLm. hi another embodiment, the rodent cell line adapted Enterovirus 71 is EV71:TLLmv. hi one embodiment, the clone derived virus containing mutations in VP1 is CDV:BSypi[K98E/E14SA/L169F] . The animal model is useful for studying systemic spread of the vims and human disease spectrum in animal models. The animal model is also useful for screening antiviral drugs and vaccines.
[0015] In another aspect, the present invention provides a method for preparing an animal model with the full-spectrum of EV71 -induced neurological infection, disease and pathology observed in humans. In some embodiments, the method comprises infecting a rodent described herein with a modified Enterovirus 71 described herein and raising the infected rodent for up to about 4 weeks. In some embodiments, the age of the rodent to be infected is between about 1 week and about 4 weeks. In other embodiments, the infected rodent is raised for about 1 week to about 4 weeks. In some embodiments, the rodent is a mouse as described herein. In. other embodiments, the rodent is infected by inoculating the rodent with the modified Enterovirus 71. In one embodiment, the inoculation is intraperitoneal (LP.). In another embodiment, the inoculation is intramuscular (I.M.). hi some embodiments, the virus dose inoculated into the rodent is a median cell culture infectious dose (CCID50) between about between about 103 and about 107.
[0016] In an additional aspect, the present invention provides a method to screen antiviral drugs. In accordance with this aspect, the method comprises the following steps: providing a test group of animals and a control group of animals in which the animals of each group are animals of the animal model described herein; administering to the test group an antiviral drag candidate; monitoring disease progression in the test group and the control group; comparing the disease progression in the test group to the disease progression in the control group; and selecting the antiviral drug candidate that reduces disease progression in the test group relative to the control group. In one embodiment, the antiviral drug is first screened in a test rodent cell line infected with a rodent cell line adapted Enterovirus 71 before screening in the animals. In another embodiment, the antiviral drug is first screened in a test rodent cell line infected with a clone derived virus (CDV) containing mutations in VP1 before screening in the animals.
[0017] In a further aspect, the present invention provides a method to screen effective antiviral vaccines. According to this aspect, the method comprises the following steps: providing a test group of animals and a control group of animals in which the animals of each group are animals of the animal model described herein; administering to the test group an antiviral vaccine candidate; monitoring disease progression in the test group and the control group; comparing the disease progression in the test group to disease progression in the control group; and selecting the antiviral vaccine candidate that reduces disease progression in the test group relative to the control group. In one embodiment, the antiviral vaccine candidate is first screened in a test rodent cell line infected with a rodent cell line adapted Enterovirus 71 before screening in the animals. In another embodiment, the antiviral vaccine candidate is first screened in a test rodent cell line infected with clone derived vims (CDV) containing mutations in VP1 before screening in the animals. BRIEF DESCRIPTION OF THE FIGURES
[0018] Figures lA-lO show cytopathic effects (CPE) observed following virus infection of various primate cell lines. Primate cells: RD cells (Figures A1-1 C), HeLa cells (Figures 1D-1F), HEp-2 cells (Figures 1G-II), Vero cells (Figures 1J-1L), and COS-7 cells (Figures lM-lO) infected with 1 MOI of either EV71 :BS (Figures 1A, I D, 1G, 1J and 1M), EV71 :TLLm (Figures IB, IE, 1H, IK and IN), or EV71 :TLLmv (Figures 1C, IF, II, 1L and 10) virus were observed at 48 hpi for cytopathic effects or death of the cell monolayer. Images are representative of results in three independent experiments.
[0019] Figures 2A-20 show virus antigen detection in cell lines infected with EV71 :BS, EV71 :TLLm and EV71 :TLLmv. Overnight seeded mammalian cell lines: HeLa (Figures 2A- 2C), HEp-2 (Figures 2D-2F), CHO-K1 (Figures 2G-2LI, NRK (Figures 2J-2L), and TCMK (Figures 2M-20), were infected with 1 MOI of respective virus. Cells were harvested at 48 hpi, coated onto Teflon slides and fixed in cold acetone. Cells were probed with pan-enterovirus antibody and stained with FITC-conjugated anti-mouse IgG. Images are representative of two independent experiments.
[0020] Figures 3A-3D show growth kinetics of EV71.-BS, EV71:TLUr and EV71:TLLmv determined in ΝΪΗ/3Τ3 and Vero cells. Supernatants from various mammalian cells infected with 1 MOI of respective virus were harvested at various time points and subjected to titration and enumerated using the Reed and Muench method. Figure 3 A: EV71 :BS virus titer determined in Vero cells. Figure 3B: EV71 :TLLmv virus titer determined in NIH/3T3 cells. Figures 3C and 3D: EV71:TLLm virus titer determined in NIH/3T3 cells. Growth curves from cell lines that did not exhibit productive infection are not shown.
[0021] Figures 4A-40 show cytopathic effects (CPE) observed following virus infection of various rodent cell lines. Rodent cells: NIH/3T3 cells (Figures 4A-4C), Neuro-2A cells (Figures 4D^4F), TCMK cells (Figures 4G-4I), CHO-K1 cells Figures (4J-4L), and NRK cells (Figures 4M^O) infected with 1 MOI of either EV7LBS (Figures 4A, 4D, 4G, 4J and 4M), EV71 :TLLm (Figures 4B, 4E, 4H, 4K and 4N), or EV71:TLLmv (Figures 4C, 4F, 41, 4L and 40) viruses were observed at 48 hpi for cytopathic effects or death of the cell monolayer. Images are representative of results from three independent experiments.
[0022] Figures 5A-5D show virus fitness assessment of EV71:BS, EV71:TLLm, and EV71:TLLmv in ΝΓΗ/3Τ3 determined by the titer ratio. Virus titer determined separately in ΝΓΗ/3Τ3 and Vero cells were used to calculate the virus fitness as log[(titer in NIH/3T3 cells)/(titer in Vero cells)]. Virus fitness of (Figure 5 A) EV7J:BS, (Figure 5B) EV71:TLLmv, and (Figures 5C and 5D) EV71:TLLm were calculated from the virus titer values shown in Figures 3A-3D. Virus fitness assays obtained from cell lines that did not exhibit productive infection are not shown.
[0023] Figures 6A and 6B show transfection of NIH/3T3 with EV7LBS viral RNA induces productive infection. Overnight seeded N1H/3T3 and Vero cells were inoculated with virus supernatant harvested from NIH/3T3 cells previously transfected viral RNA extracted from EV71:BS, EV71:TLLm, and EV71:TLLmv. Figure 6A: Cells were imaged using inverted light microscope at 24 hpi to observe induced CPE. Figure 6B: Cells were harvested at 7 dpi, coated onto Teflon slides, probed with pan-enterovirus antibody, and stained with anti-mouse FITC- conjugated antibody.
[0024] Figures 7A and 7B show virus fitness assessment of EV7LBS, EV71:TLLm, and EV71:TLLmv in N1H/3T3 and Vero cells at 30°C. Overnight seeded (Figure 7A) NIH/3T3 and (Figure 7B) Vero cells infected with EV71:BS (panels a, d, g), EV71:TLLm (panels b, e, h), or EV71 :TLLmv (panels c, f, i) were incubated at 30°C and observed under the light microscope with phase-contrast at 24 hpi (panels a-c), 48 hpi (panels d-~f), and 72 hpi (panels g-i). Images taken are representative of two independent experiments.
|0025] Figures 8A and 8B show virus fitness assessment of EV71:BS, EV71 :TLLm, and EV71:TLLmv in NIH/3T3 and Vero cells at 37°C. Overnight seeded (Figure 8A) NIH/3T3 and (Figure 8B) Vero cells infected with EV7LBS (panels a, d, g), EV71:TLLm (panels b, e, h), or EV71 :TLLmv (panels c, f, i) were incubated at 37°C and observed under the light microscope with phase-contrast at 24 hpi (panels a-c), 48 hpi (panels d-f), and 72 hpi (panels g-i). Images taken are representative of two independent experiments.
[0026] Figures 9A and 9B show virus fitness assessment of EV7LBS, EV71:TLLm, and EV71:TLLmv in NIH/3T3 and Vero cells at 39°C. Overnight seeded (Figure 9A) ΝΠΪ/3Τ3 and (Figure 9B) Vero cells infected with EV7EBS (panels a, d, g), EV71:TLLm (panels b, e, h), or EV71 :TLLmv (panels c, f, i) were incubated at 39°C and observed under the light microscope with phase-contrast at 24 hpi (panels a-c), 48 hpi (panels d-f), and 72 hpi (panels g-i). Images taken are representative of two independent experiments.
[0027] Figures 10A-10L show transfection of murine cell lines NIH/3T3, Neuro-2A, and TCMK with EV7LBS viral RNA for evidence of virus replication. Overnight seeded ΝΪΗ/3Τ3, Neuro-2A, and TCMK cells were either infected with 1000 CCFD50 of EV71.-BS virus (Figures 10A, IOC, and 10E) or transfected with equivalent amounts of viral RNA (Figures 10B, 10D, and 10F). and harvested at 48 hpi for viral antigen detection. Vims in the supernatants were harvested at 7 dpi and passaged onto fresh Vero (Figures 1 OG, 101, and 10K) and. NIH/3T3 cells (Figures 10H, 10J, and 10L). Cells were harvested and stained for viral antigens at 48 hpi.
[0028] Figures 1 1 A- 1 ID show localization in VP1 and VP2 of adaptive mutations in the genomes of EV71 :TL' Lm and EV71 :TLLmv. Adaptive mutations observed in the VP1 (Figures 1 1A and 1 1B) and VP2 (Figures 1 1C and 1 1 D) regions of EV71 :TLLm (Figures 1 1A and 1 1 C) and EV71:TLLmv (Figures 1 1B and 1 1D) were modelled using DeepView/SwissPDBviewer v3.7 and the 3D structure of EV71 capsid PI region (PDB ID 4AED). The mutations were observed to be mostly localized to the surface-exposed loops of the protein as shown.
10029] Figure 12 shows titer ratio in NIH/3T3 cells relative to titer in Vero cells of virus supernatant harvested from cells either transfected with EV71 :BS viral RNA or infected with live virus. Supernatants from ΝΓΗ/3Τ3, Neuro-2A, Vero, and TCMK either transfected with viral RNA or infected with live virus were harvested and subjected to virus enumeration by Reed-and Muench method. The ratio of the log(titer) determined in NIH/3T3 cells relative to the titer determined in Vero cells is shown. 3T3-TRANS: RNA transfected NIH/3T3 cells; 3T3-INF: virus infected N1H/3T3 cells. Asterisks indicate Student's t-test with p-value <0.05.
[0Θ3Ο] Figures 13A and 13B show survival analysis of infected animals. Infected animals were observed and weighed daily. Figure 13 A: Kaplan-Meier plot of infected animals showing number of deaths at various days post-infection. Figure 13B: Changes in body weight were plotted to determine the general health of the animals.
[0031] Figures 14A-14D show symptoms and pathology of infected animals. Majority of the infected animals displayed symptoms of disease. Figure 14A: Paralysis of the hind limbs (arrow). Figure 14B: Gross anatomy of the inflated lungs following necropsy (arrows). Tissue sections were also stained with Hematoxylin and Eosin staining (Figure 14C at l Ox and Figure 14D at 2 Ox). Black arrows point to the mucous substance infiltrating the alveolar spaces.
[0032] Figures 15A- 15E show that transfection of viral genomic RNA into both primate and rodent cells yields viable virus. Figure 15A: Genomic RNA extracted from either EV7LBS, EV71 :TLLm, or EV71:TLLmv were individually transfected into Vero, NIH/3T3, and Neuro-2a cells (P0). Transfection supernatants were harvested and inoculated onto either Vero or NIH/3T3 cells (P I ) to assess for viability of virus progeny. Infection of PO cells was assessed by observation of cytopathic effects (CPE) (Figure 15B) and immunofluoresence detection of viral antigens (Figure 15C). Similarly, infection of PI cells from EV71:BS RNA-transfected cells was assessed by CPE induction (Figure 15D) and immunofluorescence detection of expressed viral antigens (Figure 15E).
[0033] Figures 16A-16F show that the capsid-encoding region of mouse cell-adapted EV71 :TLLm drives productive infection of mouse cells with EV7LBS. Figure 16A: Infectious cDNA clones of the full genome of EV71 :BS were generated, and the PI region replaced with sequences from EV71;TLLm capsid to generate chimeric virus, EV71:BS[M-P1] . Figure 16B: Cells were infected with clone-derived virus (CDV) from either EV7LBS or EV71:BS[M-P1], and infection was assessed by induction of lytic cytopathic effects (CPE) (Figure 16C) and viral antigen expression (Figure 16D). Supernatants were re-inoculated onto fresh cells, and virus titers were measured from passages (PI and P2) obtained from infected Vero (Figure 16E), as well as passage PI of NIH 3T3 (3T3) and Neuro-2A (N2a) cells (Figure 16F). Error bars indicate SD. * p<0.05.
[0034] Figures 17A-17G show that the VP1-L169F amino acid substitution in the capsid is sufficient to enable EV71:BS entry into murine cells. Figure 17A: Various mutant cDNA clones were generated by incoiporating amino acid substitutions in VP1 : K98E, E145A, and L169F; and VP2: S144T and K149I; into the full-length EV71.-BS genome. Mutations corresponding to amino acid substitutions are written in parentheses, infection of various cell lines with clone- derived virus (CDV) was monitored by assessing induction of lytic cytopathic effects (CPE) (Figures 17B and 17C) and expression of viral antigens (Figures 17D and 17E). Virus titers from infected Vero cells (Figure 17F) and NIH/3T3 and Neuro-2a cells (Figure 17G) were determined to assess generation of viable virus progeny. Error bars indicate SD.
[0035] Figures 18 A- 18E show that EV71:BS virus with combined VP1 amino acid substitutions in the capsid exhibit improved infection of mouse cells. Figure 18A: Various mutant cDNA clones were generated by incoiporating combinations of amino acid substitutions in VP1 and VP2 into the full-length EV71:BS genome. Mutations corresponding to amino acid substitutions are written in parentheses. Infection of various cell lines with clone-derived virus (CDV) was monitored by assessing cytopathic effects (Figure 18B), viral antigen expression (Figure 18C), and virus yield from infected Vero (Figure 18D), and NIH/3T3 (3T3) and Neuro- 2a (N2A) cells (Figure ί 8E). Other clones with no virus yield are not shown. Error bars indicate SD.
[0036] Figurers 19A-19C show that EV71 :BS virus with combined VP1 -K98E, El 45 A, L169F amino acid substitutions in the capsid could be stably passaged in mouse neuronal cell line Neuro-2a. Clone-derived virases were passaged twice in Neuro-2a and NIH/3T3 cells. At each passage, infection was monitored by assessment of viral antigen expression (Figure 19A) and virus titer measured in Vero cells (Figure I9B). Error bars indicate SD. * p < 0.05; ** p < 0.005; *** p < 0.0005. Figure 19C: Genome sequences of representative CDV:BSvpi[K98E/El45A/L169F] were determined to assess evidence of amino acid substitutions K98E (A2734G), El 45 A (A2876C), and L1 69F (C2947T). The mutation site is marked with an asterisk
[0037] Figures 20A-20 F show that EV71:TLLmv utilize SCARB2 to infect both primate and murine cells. Pre-incubation of ΝΓΗ/3Τ3 cells (Figure 20A) and Vero cells (Figure 20B) fixed onto Teflon slides with murine SCARB2 (mSCA B2) antiserum inhibits EV71:TLLmv binding, as determined by reduced fluorescence signals. Fluorescence intensity on membranes was measured using Imaris imaging software (n = 100). NSP (non-specific rabbit serum). Preincubation of EV71 :TLLmv with recombinant soluble protein of either mSCARB2 (Figure 20C) or human SCARB2 (hSCARB2) (Figure 20D) prior to inoculation onto NIH/3T3 cells reduces virus infection severity, as assessed by immunofluorescence assay. Pre-incubation of live NIH/3T3 cells with either hSCARB2 (Figure 20E) or mSCARB2 (Figure 20F) antiserum prior to infection with EV71:TLLmv reduces the virus titer in culture supernatant. * p<0.05; ** p<0.005; *** p<0.0005.
[0038] Figures 21A-21D show that incubation of Neuro-2A cells with murine SCARB2 rabbit antiserum reduced severity of infection with CDV mutants. Infection severity in cells pre- incubated with rabbit mSCARB2 antiserum prior to infection with CDV:BSvpi[K98E/E145A/L169F] (Figures 21 A and 21B or CDV:BS[M-P1] (Figures 21 C and 2 ID) was monitored by assessing induction of cytopathic effects (CPE) (Figures 21 A and 21C) and virus yield at 7 days post-infection (Figures 21B and 21D). Error bars indicate SD; * p < 0.05; ** p < 0.005. Degree of CPE: 1 (0-25% cell death), 2 (25-50%), 3 (50-75%), 4 (75-100%).
[0039] Figures 22a-22c show that EV71 :TLLmv is the most virulent of the three modified viral strains as evidenced by induction of severe disease in 1-week old BALB/c mice. Figure 22a: Neutralizing antibody titers in sera collected from mice infected (intraperitoneal; LP.) with either EV71 :BS (n=6), EV71:TLLm (n=5) or EV71:TLLmv (n=7) as assessed at the end of the observation period. Figures 22b and 22c: Kaplan-Meier survival curves of mice inoculated with 106 CCIDso (median cell culture infective dose) of EV71:BS, EV71:TLLm, or EV71:TLLmv either via LP. route (Figure 22b) or intramuscular (I.M.) route (Figure 22c). Statistical significance was determined using t-test with Welch's correction for unequal variance (Figure 22a) or the Mantel-Cox log-rank test (Figures 22b and 22c). *p<0.05, **p<0.005, ***p<0.0005. [0040] Figures 23a-23h show that EV71:TLLmv infection in mice is characterized by acute severe disease resembling the human disease spectrum. Figure 23a and 23b: Dose-dependent lethality of EV7 ] :TL.Lmv infection in 1 week-old mice. Figure 23a: Kaplan-Meier survival curve of 6 day-old pups LP. injected with various doses of EV71 :TLLmv, Figure 23b: The median humane endpoint (HD50) was equivalent to a virus dose of 3.98 x 103 CCn½. Figure 23c: Kaplan-Meier survival curves of 1 week-old mice inoculated with EV71:TLLmv via LP. or I.M. route. Figure 23d: Age- and route-dependent lethality induced by EV71:TLLmv infection in mice inoculated with a virus dose of 106 CCIDso- Figures 23e and 23 f: Clinical signs observed in terminally-ill mice, some of which presented with paralysis of the hind limbs {gray arrow) and/or forelimbs. Others also exhibited small hairless lesions on the torso {black arrow). Figures 23g and 23h: Disease classification of 1 week-old mice inoculated with EV7I:TLLmv via the LP. route (Figure 23g), or I.M. route (Figure 23h).
f 00 1 J Figures 24a-24e show that Severity of EV71:TLLmv infection in BALB/c mice depends on host age, virus dose, and route of administration. Figures 24a and 24b: Groups of 8- 10 mice were inoculated with 106 CCID50 of virus by LP. route (Figure 24a) or I.M. route (Figure 24b) and the Kaplan-Meier survival curves determined for animals of different age groups. Figures 24c and 24d: Neutralizing antibody titers in sera collected at the end of the observation period from mice of various ages inoculated via either LP. route (Figure 24c) or I.M. route (Figure 24d); 1 week (LP. n=7; I.M. n=4), 2 weeks (n=5, n-7), 3 weeks (n=4; n=8), and 4 weeks (n=4; n=6). Figure 24e: Neutralizing antibody titers in sera collected from, mice inoculated (LP.) with various doses of EV7I:TLLmv; CCID50 102 (n=5), 103 (n=4), 104 (n=4), 105 (n=5), or 106 (n=7). Statistical significance was determined by Mantel-Cox log-rank test (Figures 24a and 24b) or t-test with Welch's correction for unequal variance (Figures 24c, 24d and 24e). *p<0.05, **p<0.005, ***p<0.0005.
[0042] Figures 25a-25k show Signs of EV71 -induced neurogenic pulmonary edema (NPE) in Class IA mice. Figures 25a-25d: Representative gross pathology of the lungs obtained from mock-infected mice (Figure 25a), or EV7 :TLLmv infected mice presenting with signs of disease Class IA (Figure 25b), Class IB (Figure 25c), or Class 11 (Figure 25d). Images show top- and side-views. Note the incomplete collapse of the lungs apparent in Figure 25b {white arrows). Figure 25e: Wet weight comparison of lungs harvested from mock-infected mice (n=4), or EV7J :TLLmv-infected mice presenting with signs of disease Class IA (n=8), Class IB (n=9), or Class II (n=4). (Figures 25f-25i: Representative images of lung tissue sections (5μηι) stained with hematoxylin & eosin (H&E). Shown are low- and high magnification images of lungs obtained from mock-infected mice (Figure 25f) or EV71:TLLmv- fected mice presenting with signs of disease Class IA (Figure 25g), Class IB (Figure 25h), or Class II (Figure 25i). Note the presence of pink proteinaceous fluid in the alveolar spaces {asterisks in Figure 25g, high mag.), some of which were also filled with erythrocytes (gray arrows in Figure 25g, high mag.). Figures 25j and 25k: Serum levels of adrenal ine/epinephrine (Figure 25j) and noradrenaline/norepinephrine (Figure 25k) as determined in mock-infected mice (n=9), or EV71 :TLLmv-iafecied mice presenting with signs of disease Class IA (n=8). Class IB (n=9), or Class II (n=3). Error bars indicate SEM. Statistical significance was determined by Mann- Whitney test (Figure 25e) or /-test with Welch's correction for unequal variance (Figures 25j and 25k). * ?<0.05, **j?<0.005.
(0043] Figures 26a and 26b show the absence of viral replication or inflammation in the lung and heart tissues of Class IA mice. Figure 26a: Representati e images of lung tissue sections (5 μτη) derived from various groups of mice infected with EV7I:TLLmv and stained with either Hematoxylin & Eosin (H&E) for histopathological examination, or labelled using rabbit serum against EV71 antigens (EV71 IHC) for virus antigen localization. Figure 26b: Representative images of heart tissue sections (5 μηι) processed for H&E and EV71 IHC.
[0044] Figures 27a-27d show representative maps depicting the localization and. distribution of EV71 antigens and virus-induced lesions in different regions of Class IA and Class IB mouse brains. The cerebellar cortex (CTX) (Figures 27a, 27b and 27c); hypothalamus (HY) (Figures 27a and 27b); hippocampus (HP) (Figures 27b and 27c); thalamus (TH) (Figure 27b); midbrain (MB) and pons (P) (Figure 27c); and cerebellum (CBX) and medulla oblongata (MY) (Figure 27d) are indicated. Areas where viral antigens and pathologic lesions were detected are marked accordingly. Larger dots indicate stronger signals/lesion size. Template images were downloaded from brainstars.org! and licensed under the Creative Commons of Japan. The brain tissue coronal section maps were obtained from the interactive Mouse Brain Atlas (http colon slash slash mouse dot brain-map dot org slash static slash atlas) [1 13].
[0045] Figures 28a-28n show that EV71 ;TLLmv infection in mice is associated with nervous tissue destruction and extensive viral replication. Figures 28a-281: Representative images of brain tissue sections (5μιη) stained with hematoxylin and eosin (H&E) or immunostained with rabbit serum against EV71 antigens (EV71 IHC). Sections were derived from mice presenting with, signs of disease Class IA (left panels), or Class IB (right panels). Pathologic lesions in the brain included edema (dashed boxes), infiltrating cells (diagonal area in upper left quadrant of left panel and diagonal area in lower right quadrant of Figure 28k), neuronophagia (in left panels of Figures 28a-28c), neurodegeneration (black asterisk's), and degeneration of Purkinje cells (gray asterisks). (Figures 28m and 28n: Representative maps of spinal cord coronal sections from mice in disease Class IA (Figure 28m) or Class IB (Figure 28n). Highlighted are areas where viral antigens and pathologic lesions were detected. Larger dot sizes indicate more extensive signals/lesions. V, ventral side; Z , dorsal side.
|0046] Figures 29a-29c show EV71 antigens and virus-induced lesions in other areas of the hindbrain of Class IA mice. Figure 29a: Representative images of the dentate nucleus stained with either Hematoxylin and Eosin (H&E) for histopathological examination or rabbit serum against EV71 antigens (EV71 IHC) for virus antigen localization. Boxed areas are shown magnified in the inset. Figure 29b: Representative images of the caudal brainstem from Class I mice, images depict the cerebellar cortex (CBX) and medulla oblongata (MY). The area prostrema (AP; asterisk) and nucleus of the solitary tract (NTS; dashed circle) are also labelled for reference. Areas where viral antigens and pathologic lesions were detected are indicated. Larger dots represent stronger signals/lesion size. Template images were downloaded from brainstars.org 1 and licensed under the Creative Commons of Japan. The brain tissue coronal section maps were obtained from the Mouse Brain Atlas (http colon slash slash mouse dot .brain-map dot org slash static slash atlas) [113]. Figure 29c: Representative images of the medulla from Class IA mice depicting the H&E and EV71 IHC staining patterns in the AP and NTS.
[0047] Figures 30a-30f show histological sections of nervous tissues from mock-infected mice (healthy controls). Representative images of normal mouse tissue sections (5 μιη) stained with either Hematoxylin & Eosin (H&E) for histopathological examination or rabbit serum against EV71 antigens (EV71 IHC) for virus antigen localization. Brain sections show CA3 pyramidal neurons in the hippocampus (Figure 30a); reticular neurons in the hypothalamus (Figure 30b) and thalamus (Figure 30c); neurons in the periaqueductal gray matter (Figure 30d); Purkinje cell layer in the cerebellar cortex (Figure 30e). Note the nonnal Purkinje cell morphology (black asterisks in left panel of Figure 30e); and reticular neurons in the medulla oblongata (Figure 3 Of).
[0048] Figures 31a-31e show EV7I: TLLmv-induced pathology and viral antigen distribution in other nervous tissues. Representative images of mouse tissue sections (5 μηι) stained with either Hematoxylin & Eosin (H&E) for histopathological examination or rabbit serum against EV71 antigens for immunohistochemical analysis (EV71 IHC). Brain tissues were obtained from EV71 :TLLmv- infected or mock-infected mice. Brain coronal sections depict motor cortex pyramidal neurons (Figure 33 a); pontine gray neurons (Figure 31b); and spinal cord coronal sections from the cervical (Figure 31c), thoracic (Figure 3 I d), and lumbar columns (Figure 31e). Note the cellular infiltrate (lower right quadrant of left panel in Figure 31a) and neuronal necrosis (black asterisks in second panel of Figure 31a) apparent in the motor cortex. Boxed areas in Figures 31 c-31 e are shown magnified, in the respective insets.
DETAILED DESCRIPTION OF THE INVENTION
[0049] The present invention relates to Enterovirus 71 (EV73), the development of an animal model and screening of candidate anti-EV71 compounds. More specifically, the present invention relates to the discovery that Enterovirus 71 (EV71) strains that have been adapted to infect rodent cell lines or cloned derived virus containing mutations in VP1 can cause disease in immuno-competent rodents and immuno-compromised rodents. These EV71 strains are sometimes referred to as modified Enterovirus 71 herein.
[0050] In addition, the present invention relates to the development of a clinically authentic model of EV7 ] -induced neurological disease by infecting BALB/c mice with a modified strain (e.g., EV71:TLLmv) adapted to infect NIH/3T3 mouse fibroblasts. Using this approach, the modified EV71 is used to induce acute encephalomyelitis associated with neurogenic pulmonary edema in mice, characterized by lung swelling and increased organ weight compared with mock- infected lungs. Despite the absence of lung or cardiac tissue inflammation, focal hemorrhage and proteinaceous fluid in the alveoli, high serum levels of catecholamines, and extensive tissue damage in the brainstem, particularly the medulla oblongata were observed. These data demonstrate that the model accurately reproduces the signs and symptoms of human EV71- induced neurogenic pulmonary edema.
[0051 ] Thus, in one aspect, the present invention relates to an animal model that comprises a rodent infected with an Enterovirus 71 capable of infecting the rodent, sometimes referred to herein as a modified Enterovirus 71.. In one embodiment, such a modified Enterovirus 71 is a rodent cell line adapted Enterovirus 71. In another embodiment, such a modified Enterovirus 71 is a clone derived virus (CDV) containing mutations in VP1. In some embodiments, the mutations in VP1 enable the CDV to use rodent SCARB2 proteins to infect rodent cells. In one embodiment, the rodent is an immuno-competent rodent. In another embodiment, the rodent is an inimuno-compromised rodent. Suitable animals for use as models are preferably mammalian animals, most preferably convenient laboratory animals such as rabbits, rats, mice, and the like. In one embodiment, the animal is a mouse. In another embodiment, the rodent cell line is a mouse cell line. In a further embodiment, the mouse cell line is a mouse NIH/3T3 cell line. In another embodiment, the mouse cell line is a mouse Neuro-2a cell line. In one embodiment, the rodent cell line adapted Enterovirus 7 lis EV71 :TLLm. In another embodiment, the rodent cell line adapted Enterovirus 71 is EV7I:TLLmv. In one embodiment, the clone derived virus containing mutations in VP1 is CDV:BSVP1[K98E/E145A/L169F] . The animal model is useful for studying systemic spread of the virus and human disease spectrum in animal models. The animal model is also useful for screening antiviral drugs and vaccines.
[0052] The animal model is prepared on an as needed basis. A large standardized stock of rodent cell line-adapted EV7I strains is prepared, titrated and kept in a deep freezer (minus 80°C). A "standardized" (based on statistical calculation) number of rodents, such as BALB/c mice or NSG mice, are infected with a standardized titer of the vims strains to produce the animal model. The animal model of the present invention develops neurological symptoms (similar to those that can develop in humans) upon infection. As shown herein, the modified Enterovirus 71, such as rodent cell line-adapted EV71 virus strains, affect brain and a variety of neurological diseases that are manifested in mice.
[0053] In some embodiments, the rodent cell line adapted Enterovirus 71 is EV71 :TLLm. EV71 ;TLLm was derived, following serial passage of the huma EV71 BS strain in NIH/3T3 mouse cell line for a minimum of 60 cycles, hi one embodiment, EV71:TLLm was deposited on 12 January 201.5 under tenns of the Budapest Treaty with China Center for Type Culture Collection located at Wuhan University, Wuhan 430072 Peoples Republic of China, and assigned Accession Number CCTCC V201437. In another embodiment, EV71:TLLm can be recovered using advanced reverse genetics if the viral RNA is synthesized using the viral RNA sequence (GenBank Accession No. F514879; SEQ ID NO: l). Techniques for advanced reverse genetics are well known in the art [84-87].
[0054] In another embodiment, the rodent cell, line adapted Enterovirus 71 is EV71:TLLmv. EV71 :TLLmv was derived from further passage of EV71:TLLm in NIH 3T3 mouse cell line for another 40 cycles. In one embodiment, EV71:TLLmv was deposited on 12 January 2015 under tenns of the Budapest Treaty with China Center for Type Culture Collection located at Wuhan University, Wuhan 430072 Peoples Republic of China, and assigned Accession Number CCTCC V201438. In another embodiment, EV71:TLLmv can be recovered using advanced reverse genetics if the viral RNA is synthesized using the viral RNA sequence (GenBank Accession No. KF514880; SEQ ID NO:2). Techniques for advanced reverse genetics are well known in the art. [0055] In a further embodiment, the modified Enterovirus 71 is a clone derived virus (CDV) having mutations in the capsid protein VP1 which enables the modified Enterovirus 71 to use rodent SCARB2 proteins to infect rodent cells. A modified Enterovirus 71 having mutations in VP1 is made by preparing a full length genomic cDNA clone using techniques known to the skilled artisan or as described herein. Mutations in VP1 or other proteins of Enterovirus 71 are made using site-directed mutagenesis or CRISPR technology (see, e.g., PCX Publication No. WO2014/127287). Live vims (clone derived virus (CDV)) is prepared from the cDNA clones clone using techniques known to the skilled artisan or as described herein. CDVs having different mutations or collections of mutations are then tested for their ability to infect rodent cells. Alternatively, CDVs having different mutations or collections of mutations are then tested for their ability to bind to rodent SCARB2 proteins as an initial screening. Any suitable Enterovirus 71 strains can be used to develop CDVs having mutations in VP1. The number of mutations may and specific mutations vary for each strain in order to produce CDVs that are sufficient to produce a full blown infection in the target rodent cell. Thus, multiple rodent virulent EV71 strains can be produced that can infect several, many or all types of rodent, e.g., mouse, cell lines. In embodiment, the EV71. strain used to produce a CDV having mutations in VP1 is Enterovirus 71 BS strain. In one embodiment, the modified Enterovirus 71 is CD V:BSVpi[K98E/E145A/L169F] .
[Θ056] In another aspect, the present invention provides a method for preparing an animal model with the full-spectrum of EV71 -induced neurological infection, disease and pathology observed in humans. In some embodiments, the method comprises infecting a rodent described herein with a modified Enterovirus 71 described herein and raising the infected rodent for up to about 4 weeks. In one embodiment, the modified Enterovirus 71 is EV71:TLLmv. In another embodiment, the modified Enterovirus 71 is EV71:TLLm. In a further embodiment, the modified Enterovirus 71 is CDV:BSvpi[K98E/E145A/L169F] . In some embodiments, the age of the rodent to be infected is between about 1 week and about 4 weeks. In other embodiments, the age of the rodent to be infected is between about 1 week and about 3 weeks. In other embodiments, the age of the rodent to be infected is between about 1 week and about 2 weeks. In one embodiment, the age of the rodent to be infected is about 1 week. In another embodiment, the age of the rodent to be infected is about 2 weeks. In a further embodiment, the age of the rodent to be infected is about 3 weeks, hi some embodiments, the infected rodent is raised for about 1 week to about 4 weeks. In other embodiments, the infected rodent is raised for about 1 week to about 3 weeks. In other embodiments, the infected rodent is raised for about 1 week to about 2 weeks. In one embodiment, the infected rodent is raised for about 1 week. In another embodiment, the infected rodent is raised for about 2 weeks. In an additional embodiment, the infected rodent is raised for about 3 weeks. In a further embodiment, the infected rodent is raised for about 4 weeks. In some embodiments, the rodent is an immune- compromised rodent. In some embodiments, the rodent is a mouse as described herein. In one embodiment, the immune-compromised mouse is a BALB/c mouse. In other embodiments, the rodent is infected by inoculating the rodent with the modified Enterovirus 71. In one embodiment, the inoculation is intraperitoneal (LP.). In another embodiment, the inoculation is intramuscular (I.M.). In some embodiments, the virus dose inoculated into the rodent is a median cell culture infectious dose (CCID50) between about between about 10' and about 10 . In other embodiments, the virus dose inoculated into the rodent is a CCID50 between about between about 103 and about 106. In one embodiment, the virus dose inoculated into the rodent is a CCID50 between about 4 x 103 and about 106. In another embodiment, the virus dose inoculated into the rodent is a CCID50 between about 104 and about 106. In an additional embodiment, the virus dose inoculated into the rodent is a CCID50 between about 105 and about 106. In one embodiment, the virus dose inoculated into the rodent is a CCID50 of about 10 . 10057] The animal model prepared in this manner is an authentic mouse model of EV71 neuro -infection that exhibits face validity, i.e., these animals display the entire range of clinical signs that can be observed across the full spectrum of neurological disease induced by EV71 infection in human patients, including NPE. This animal model also displays construct validity with respect to the gross and histopathological features of disease, which closely resemble those reported in fatal human cases. This new in vivo model represents a powerful tool for identifying the key events in EV71 neuro-pathogenesis, for dissecting the mechanism of EV71 -induced NPE, developing novel treatment modalities and potential antiviral therapies, and for conducting pre-clinical evaluation of novel, vaccines.
[0058] I an additional aspect, the present invention provides a method to screen antiviral drugs. In accordance with this aspect, the method comprises the following steps: providing a test group of animals and a control group of animals in which the animals of each group are animals of the animal model described herein; administering to the test group an antiviral drug candidate; monitoring disease progression in the test group and the control group; comparing the disease progression in the test group to the disease progression in the control group; and selecting the antiviral drug candidate that reduces disease progression in the test group relative to the control group. In one embodiment, the antiviral drug is first screened in a test rodent cell line infected with the rodent cell line adapted Enterovirus 71 before screening in the animals, hi another embodiment, the antiviral drug is first screened in a test rodent cell line infected with a clone derived virus (CDV) containing mutations in VPl before screening in the animals.
J0059J In a further aspect, the present invention provides a method to screen effective antiviral vaccines. According to this aspect, the method comprises the following steps: providing a test group of animals and a control group of animals in which the animals of each group are animals of the animal model described herein; administering to the test group an antiviral vaccine candidate; monitoring disease progression in the test group and the control group; comparing the disease progression in the test group to disease progression in the control group; and selecting the antiviral vaccine candidate that reduces disease progression in the test group relative to the control group. In one embodiment, the antiviral vaccine candidate is first screened in a test rodent cell line infected with the rodent cell line adapted Enterovirus 71 before screening in the animals. In another embodiment, the antiviral vaccine candidate is first screened in a test rodent cell line infected with clone derived virus (CDV) containing mutations in VPl before screening in the animals.
[0060] In accordance with the methods of the present invention, a large standardized stock of rodent cell line-adapted EV71 strains is prepared, titrated and kept in a deep freezer (minus 80°C). Alternatively, a large standardized stock of clone derived virus (CDV) containing mutations in VP l strains is prepared, titrated, and kept in a deep freezer (minus 80°C). A "standardized" (based on statistical calculation) number of animals, such as Balb/c mice or NSG mice, are infected with a standardized titer of the virus strains. The candidate antiviral drug or antiviral vaccine is administered to the infected rodents at various standardized dosages at before appearance of illness (for assay of preventive effect) or at onset of illness (for assay of therapeutic effect of the drug). In one embodiment, high through-put in vitro screening of anti- EV71 compounds is performed using tissue culture cell lines susceptible to cytolytic infection by the rodent cell lined adapted EV71 virus strains, such as those described herein, including those described in the Examples. In another embodiment, high through-put in vitro screening of anti-EV71 compounds is performed using tissue culture cell lines susceptible to cytolytic infection by clone derived virus (CDV) containing mutations in VPl strains, such as those described herein, including the Examples. The in vitro screening is performed using techniques well known in the art. The selected promising compounds from the in vitro screening are then screened in vivo in the animal model described herein. [0061] As shown in Examples 2-8, sequential passage of the human EV71 isolate (EV7LBS) generated virus strains that gained the ability to infect in vitro cultured rodent cell lines. The mouse adherent fibroblast cell line NIH/3T3, which was derived from the NIH/Swiss mouse embryo [46], was used to adapt the human EV71 strain to infect rodent cells. Two such. NJH/3T3-adapted strains are described - EV71:TLLm and EV7J:TLLmv, where EV71:TLLm represents the early stage (passage number 60) and EV71:TLLmv represents the late stage (passage number 100) of the adaptation process. Based on the appearance of virus-induced CPE, measurement of high titer values, and positive detection of viral antigen through immunostaining, we categorized the virus-induced infection in cells as either productive or nonproductive. Productive infection exhibits positive viral antigen detection as well as high virus titers, regardless of observation of CPE. On the other hand, non-productive infection is characterized by immeasurable virus titer at cut-off assay limit despite viral antigen detection and/or observation of CPE.
[0062J Whereas the clinical isolate EV7LBS infects only primate cell lines, EV71:TLLm productively infects both primate and rodent cell lines. It is worth noting that although EV71 TLLm virus has successfully achieved the ability to infect rodent cells, the degree of adaptation to N1H/3T3 cells is less pronounced. The virus titer detennined using Vero cells is much higher than that determined in NIH/3T3 cells, as indicated by negative values in relative replication rates (RRR) assay (Figures 5C and 5D). In addition, EV71:TLLm successfully infects Vero cells leading to full CPE at various incubation temperatures whereas it can only achieve full CPE in infected NIH/3T3 at 37°C (Table 1). Further adaptation in mouse cells, which yielded the EV7 ] :TLLmv vims, resulted in a virus strain that displays a higher degree of adaptation to mouse cells (Figure 5B) but at the cost of narrowing down the spectrum of permissible host cells. EV71 :TLLmv does not infect primate cell lines as effectively as mouse cells although it exhibits successful infection leading to full CPE of NIH/3T3 cells incubated at a broader range of temperatures (Table 1). However, compared to the predecessor EV71 :TLLm, EV71 :TLLmv seemed to have lost the ability to enter and replicate in monkey kidney COS-7 cells, as well as human HeLa and Hep-2 cells (Figures 3B-3C; Figures 2B-2C, 2E-2F, and 2H-2I). It also lost the ability to replicate efficiently within hamster CHO-K1 and rat NRK cells (Figures 3B-3D; Figures 2K-2L and 2N-20). These observations indicate that further passage of the virus in NIH/3T3 cells increases the degree of adaptation in mouse cells at the cost of losing infective ability in cell lines of other origin. [0063] Although it is not possible to pinpoint which amino acid substitutions are adaptive to the mouse N1H/3T3 host cell, viral whole genome sequencing may shed light to potential adaptive mechanisms. Most of the amino acid substitutions identified reside in the PI (capsid) and R A polymerase (3D region) proteins (Table 2, 3), suggesting possible altered vims protein activity in host cell entry and replication. The accumulation of mutations in the PI region is expected from the acquired ability of EV71:TLLm and EV71 :TLLmv strains to infect new host cells. Capsid proteins form the structural context with which the vims initiates interaction with the permissive host cell through the vims receptor, which had been identified recently as Scavenger Receptor Class B Member 2 (SCARB2) [47] and later characterized as the main virus uncoating receptor of EV71 [48] and which is also utilized by some members of Human Enterovirus A (HEV-A) species. The human SCARB2 protein shares approximately 99% sequence identity with that of other primates. On the other hand, mouse SCARB2 protein exhibits 15% sequence dissimilarity compared to the primate protein [49], implying significant structural deviations from primate SCARB2 and perhaps contributing to the recalcitrance of rodent cells to native EV71 infection. It is plausible that adaptive mutations in the virus capsid may render the vims competent to bind the mouse cell receptor and result in successful entry and infection of novel hosts.
[0064] Mapping of the capsid protein mutations indicate that majority of the identified amino acid substitutions in the viral PI region reside in exposed regions of the protein (Figures 1 1A- 1 1D), specifically in the B-C, D-E, E-F, and G-H loops on the surface of VP 1. The VP 1 residues 150-180 harbour the viral capsid canyon that engages SCARB2 protein. This region centred at Gin- 172 contains a major VP1 neutralization epitope at amino acids 163-177 [32]. Both EV71 :TLLm and EV71 :TLLmv exhibited substitutions E167D and L1 69F in the E-F loop of the VP 1 canyon (Figures 1 1A-1 1 B), loci which have not been previously reported. Other significant amino acid substitutions near the SCARB2 docking site include N104D within the B-C loop and S241 L in the G-H loop, which are located within a 20 A radius from Gin- 172. The VP1 S241 L mutation, in association with the K244E, had been previously reported arising from mouse passage of a CHO cell line-adapted EV71 [50]. This mutation, in combination with a VP2 K1491, was found to be associated with a non-virulent phenotype in 5-day mouse pups. However, a reverse mutation at VP 1 241 from Leu to Ser [51 ] was reported arising from adaptation in NOD/SCID mouse brain tissues and found to be associated with a mouse virulent phenotype. The VP1 E145A mutation, which is far from the SCARB2 docking site and located in the D-E loop, is another candidate for conferring the ability to infect murine cells. The VP1 145 mutation had been previously reported [34, 37] and a single El 45 A mutation leads to virulence in NOD/SCID mice [51]. Another mutation in VP1 of a C4 genotype EV71 , Q145E, was associated with virulence in 5-day old mice [52]. The mouse cell-adaptive mutations in VP2, particularly those within the neutralizing epitope of residues 136-150 [53], may also contribute to the virus ability to infect rodent cells. Two substitutions in VP2 E-F loop were observed in EV71:TLLm (Figure 1 1C), while three substitutions were present in EV71:TLLmv (Figure 1 ID). None of these mutations have been previously described, although a nearby locus at VP2 149 in the E-F loop had been mentioned in the literature [34, 50, 54] and described as an adaptive mutation to passage in PSGL-1 overexpressing cells [55].
[0065] To explore the possible role of the PI region mutations in binding the virus receptor for host cell entry, EV7LBS viral RNA was transfected into murine cells. Direct introduction of EV7LBS RNA into the mouse cell cytoplasm results to productive infection in NIH/3T3 cells, as suggested by the observation of virus-induced CPE and measurable virus titers in the culture supernatant as assayed in Vero cells (Figure 12). Re-inoculation of the virus supernatant onto fresh ΝΓΗ/3Τ3 cells, however, fails to induce productive infection (Figure 6A) and no viral antigens were detected (Figure S4H). Similarly, transfection of EV7LBS RNA into Neuro-2A cells, but not direct virus infection, resulted in positive antigen staining in Neuro-2A cells (Figures I OC and, 10D) and measurable virus titers (Figure 12). Vims supernatants passaged onto fresh Vero and ΝΓΗ/3Τ3 cells resulted to positive antigen staining in Vero (Figure 101) but not in ΝΓΗ/3Τ3 cells (Figure 10 J). These data indicate that circumventing the requirement of receptor engagement for host cell entry led to successful infection and production of virus progenies in NIH3T3 and Neuro-2A cells. These data also support that human EV71:BS cannot successfully enter mouse NIH/3T3 and Neuro-2A cells through murine cellular receptor. Moreover, these data suggest that mutations within the PI region of EV71:TLLm and EV77 :TLLmv genomes confer the virus with the ability for efficient receptor engagement, and consequently host cell entry.
[Θ066] Several amino acid mutations were also observed in the P2 and P3 regions, which encode virus proteins that are crucial for vims replication and hijacking the host cell protein translation machinery [56]. These adaptive mutations may function in optimizing EV71 genome replication and translation within mouse cells. The viral 3D protein alone accumulated 8 amino acid substitutions in EV71 :TLLmv and 4 in EV71 :TLLm, and both strains exhibited 1 mutation each in 3B and 2 mutations each in 3C. Direct inoculation of viral RNA into TCMK cells give insight into the possible role of the adaptive mutations in the nonstructural proteins of the viais. Although TCMK cells have been shown to be permissible to EV71:TLLm and EV71:TLLmv infection (Figures 3B and 3D; Figures 4Q and 4R), transfection of EV71 :BS viral RNA into TCMK cells did not result to successful infection. Viral antigen signals were not detected in infected and trans fected cells (Figures 10E-10F), and passage of virus supernatant onto fresh NEH/3T3 and Vero cells did not yield positive viral antigen detection (Figures 10K and 10L). Moreover, there was no assayable virus titer in both infected and transfected cells (Figure 12). These data suggest that apart from mutations in the capsid region, mutations within the P2 and P3 regions, which are found in EV71 :TLLm and EV71:TLLmv, are required to successfully infect TCMK cells.
[0067] It is believed that this is the first report of EV71 strains originally derived from human clinical sample that have successfully gained the ability to productively infect several rodent ceil lines following successive passages in a mouse cell line. The relatively high mutation rates during RNA replication results in variant genomes that serve as genetic reservoirs of phenotypic traits for future adaptive potential, and the consequential replication as a quasispecies distribution [57, 58] leads to the dynamic plasticity of RNA viral genomes conferring adaptability to changing environments [59, 60]. Although EV71 infecting suckling mice [34, 37, 38, 51] and other rodents (e.g., gerbils) [39] have been reported previously, none was reported to productively infect in vitro cultured rodent cells. This may be due to the high genetic barrier associated with major changes in phenotype and host range [58]. Interestingly, this is the first report of a large number of adaptive mutations within the consensus foil genome sequence of EV71. Whereas previously documented mouse-adapted EV71 reported less than 10 amino acid substitutions in the genome [34, 38, 51], we report 21 in EV71:TLLm and 36 in EV71:TLLmv, still more than the most number of adaptive mutations previously identified [37]. These suggest that few passages of the virus in mouse tissues [34, 36, 37] may not be sufficient to break the genetic barrier and successfully adapt the virus to infect cultured mouse cells. Instead, hundreds of successive passages might be necessary, as is observed in this study.
[0068] The host cell restriction of EV71 had recently been explained, with the demonstration that EV71 utilizes Scavenger Receptor Class B Member-2 (SCARB2) as its functional receptor for host cell entry [47] and virus uncoating in the endosome [72]. The human and murine SCARB2 proteins exhibit only 84% amino acid sequence identity [67] suggesting structural differences between the two proteins. This scenario explains the general inability of EV71 clinical isolates to infect mouse-derived cells, as well as the general resistance of mice and other rodents to EV71 experimental infections, which complicates efforts in developing small animal models of EV71 infection. Despite this virus-receptor incompatibility, however, we have shown that some murine cells support EV71 infection when the initial stage of infection, i.e. receptor- mediated cell entry, is bypassed through viral RNA trans fection into cells. EV71:BS does not infect Neuro-2a and NIH/3T3 cells [71], but transfection of viral genomic RNA results to expression of EV71 proteins, induction of lytic cytopathic effects (CPE), and production of viable virus progeny. Similarly, live virus had been previously generated following transfection of Poliovirus RNA into mammalian cells [73-75], though the cells used (HeLa) were known to be permissive to Poliovirus infection. In our experiments, non-permissive mouse neuronal Neuro-2a and fibroblast NIH/3T3 cells were demonstrated to support viral replication and generate live virus progeny upon transfection of EV71:BS RNA into the cytoplasm, suggesting that the internal environment of murine cells contain host factors required for EV71 infection and support completion of the virus infection cycle, and that EV71 proteins are functional in murine cytosol. These findings also imply that the absence of N1H/3T3 and Neuro-2a cellular infection upon virus inoculation may be due to a defect in receptor-mediated host cell entry and uncoating, which is mainly the function of the capsid protein. These results were similar to our previous observations (above or [71]) and led us to the hypothesis that certain amino acid substitutions in the EV71:BS capsid protein may enable it to bind its receptor, thus leading to virus entry and uncoating, and subsequently infect mouse cells. Two unique tools - the mouse cell line (NIH/3T3)- adapted EV71 strains (EV71:TLLm and EV71:TLLmv) and the two mouse cell lines (Neuro-2a and NIH/3T3), provided the opportunity to investigate this hypothesis.
[0Θ69] The infection phenotype of chimeric clone-derived virus exhibiting EV71:TLLm capsid proteins but expressing EV7LBS non-structural proteins (CDV:BS[M-P1J) confirmed that the "mouse cell-entry phenotype" could be conferred by the capsid protein derived from mouse cell line-adapted EV71 strains.. These chimeric CDV behaved similar to mouse cell- adapted EV71 strains and induced productive infection in Vero, as well as NIH/3T3 and Neuro- 2a cells, with direct evidence for completion of virus infection cycle, i.e. generation of viable virus progeny. Further, mutagenesis of EV71:BS VP1 to introduce amino acid substitutions K98E, E145A, and L169F and in VP2 S144T and K149I led to limited infection of murine cells. Only CDV with EV7J :TLLm PI region replacement (CDV:BS[M-PJJ) and CDV having the combined amino acid substitutions VP1- 98E/E145A L169F
{CD V:BSvpi[K98E/E145A/L169F]) could be successfully passaged in Neuro-2a and NJH/3T3 cells to produce viable virus progenies in the resultant culture supernatant. The rest of the CDVs containing other amino acid substitutions, either individually or in various combinations, exhibited limited entry into murine cells leading to one cycle of replication, as supported by the observation of CPE and detection of viral antigens in the inoculated cells. Live virus progeny were absent in the infected cell culture supematants, as its re-inoculation onto healthy mouse cells failed to induce infection. The reason precipitating the failure of viable virus progeny production in the culture supernatant of cells infected with these CDV is unclear, but one possibility may be due to structural instability of the resultant capsid following the mutations. We suspect that the introduced amino acids may be incompatible with other amino acids comprising the protein, thus affecting the entire capsid protein fold and altering the capsid structure. This assumption highlights the complexity of capsid protein assembly, where four viral proteins (VP 1 -4) cooperatively interact to generate a functional capsid. Thus, amino acid substitutions that may enable the virus to bind new receptors could also have catastrophic consequences, especially if it inadvertently destabilizes the capsid complex because of incompatibility with other amino acid residues in the protein.
[0070] The results shown in Examples 10- 17 reveal that three VP l substitutions: K98E, E145A, and L169F are necessary and sufficient to bind its receptor on mouse cells and enable EV71 entry. Although the VP 1.-169 residue had not been previously mentioned in the literature, the VPl -98 and VP 1 -145 residues had been previously implicated as markers for binding human PSGL-1 receptor proteins on leukocytes [76]. Analysis of 1 ,702 VPl sequences of EV71 clinical isolates published in Genbank confirmed the viability, albeit rarity, of the mutant combination VPl 98E/14 A, which appeared in only 5 isolates (0.3% of the database). On the other hand, the VP1 -169F variant was not observed in the surveyed database of EV71 VPl sequences, demonstrating its extreme rarity. The CDV:BSvpi[K98E/E145A/L169F] could be stably passaged onto Neuro-2a cells and consistently produced live virus progeny while retaining the introduced mutations into the vims genome for three passages, suggesting that this vims is viable and stable at least in Neuro-2a cells. Thus, it is possible that introducing these three residues: VPl 98E, 145 A, and 169F, into other EV71 clinical isolates could enable it to infect murine cells, although this remains to be demonstrated.
[0071J Similar to previous findings that EV71 utilizes Scavenger Receptor Class B Member- 2 (SCARB2) protein as its receptor for host cell entry and uncoating into the cytosol [47, 72, 77], our data also demonstrate that the mouse cell-adapted EV71 :TLLmv utilize mouse SCARB2 (mSCARB2) to infect murine cells. The virus directly bound recombinant soluble mSCARB2 in vitro, and pre-incubation of live virus with the protein prior to inoculation onto healthy cells reduced the severity of cellular infection. Further, blocking the free surfaces of mSCARB2 on host cells by binding with polyclonal antibodies against mSCAEJB2 reduced both, virus binding on fixed cells and inhibited the infection of live cells. The results also exhibit EV71:TLLmv binding to human SCARB2 (hSCARB2) protein, which the virus use to infect primate cells. Binding to and infection of primate cells with EV7J:TLLmv is also blocked by antibodies against hSCARB2. While the data presented here only showed EV71 :TLLmv, the results are also extended to EV71 :TLLm. EV71:TLLmv was derived from further passage of EV71:TLLm in NIH/3T3c cells, and only a few amino acid substitutions were observed between the two mouse cell line-adapted EV71 strains. Therefore, these indicate that both EV71:TLLin and EV71:TLLmv utilize cellular mSCARB2 for infection of rodent cells.
[0072] Similarly, both CDV:BS[M-P1] and CDV:BSVpi[K98E/E145A/L169F] utilize mSCARB2 to infect murine cells. Pre-incubation of Neuro-2a cells with mSCARB2 antiserum blocked cellular infection with the virus, as supported by reduced CPE induction and lower virus titers compared to control. Recent data showed SCARB2 binding to EV71 canyon triggers the release of the "pocket factor," a lipid within the capsid canyon that stabilizes the mature virion and is presumed to be sphingosine in EV71 , [78], precipitating a series of events in virus uncoating: capsid expansion (to form the 135-S or A-particle), extrusion of the VP1 N-tem inus and VP4 from the five-fold axis capsid junction into the endosome membrane, and release of the viral genomic RNA into the host cell cytoplasm [78-81]. The recent human SCARB2 crystal structure data also reveals a lipid tunnel traversing the entire protein [67], which in the context of SCARB2 function of delivering β-glucocerebrosidase to the lysosome has no relevance, but to which Dang et al. [72] proposed that it serves as a conduit for removal and transport of sphingosine from the capsid canyon during SCARB2 binding. The SCARB2 amino acid residues 140-151, whose sequences are highly divergent between the human and murine proteins, are the main binding site for EV71 [49], This same region acts as a gate controlling the opening and closing of the SCARB2 lipid tunnel, an event triggered by acidic pH during virus uncoating. The VP1-169 residue lies within the capsid canyon, and probably has a direct function in SCARB2 binding. The drastic change from Leucine to Phenylalanine in this position may have altered the canyon structure resulting to a better fit with murine SCARB2 protein. The VP1 98 and 145 residues, on the other hand, lie on the fringe surrounding the capsid canyon and may have another function aside from SCARB2 binding. These are simply hypotheses, and it. would be necessary to solve the structure of murine SCARB2 protein and map the interactions with the virus capsid in order to elucidate the exact mechanism by which the three VP1 amino acids substitutions could confer the "mouse cell-entry phenotype."
[0073] It is believed that this is the first scientific exploration of EV71 capsid site-specific mutations that induce productive infection of naturally non-permissible murine cells. Previous studies attempted to overcome virus host restriction through either selective virus adaptation, as in the case of passage in live animals to generate mutants with improved infection profile in mice [34, 37, 38, 82], or cellular alteration by ectopic expression of human SCARB2 protein [47, 69, 70, 83]. The incompatibility of EV71 to murine SCA B2 generally accounts for the resistance of mice to EV71 infection, thus impeding the development of mouse model of EV71 infections. This probably also explains why most mouse models of EV71 infection that use either wild type or mouse-adapted virus strains fail to recapitulate the spectrum of diseases observed in severe human infections [34, 37, 38]. On the other hand, transgenic mice expressing human SCARB2 exhibited features of more extensive EV71 infection without the need for mouse adaptation of the virus, but the full spectrum of human diseases still could not be clearly reproduced [69, 70]. The demonstration herein that certain amino acid substitutions in EV71 enable it to infect murine cells provides the first step in understanding the molecular mechanisms that enable the mouse cell line-adapted EV71:TLLm and EV71:TLLmv to efficiently infect cultured rodent cells. In addition, it may provide another approach to generating a mouse model of EV71 infection to study detailed pathogenesis and reproduce the full spectrum of neurological diseases seen in human infections.
[0074] In Examples 22-25, it is demonstrated for the first time that young BALB/c mice inoculated with a mouse cell-adapted enterovirus 71 (EV71) exhibit an acute encephalomyelitis associated with neurogenic pulmonary edema (NPE) that closely resembles the pathology observed in infected human patients. Animals challenged with the adapted viral strain EV7J :TLLmv displayed varying levels of virus -induced tissue damage in both the pyramidal and extrapyramidal regions of the brain, presenting as paralysis, ataxia and tremors, and consistent with the CNS-localized pathology identified in fatal cases of EV71 infection [91 -95]. Furthenriore, some mice displayed respiratory distress compatible with autonomic nervous dysfunction. Based on disease presentation at the time of euthanasia, animals could be readily classified into four groups: Class IA, Class IB, Class II and Survivors. While Survivors did not present signs of disease, mice in Class II exhibited persistent flaccid paralysis and severe weight loss, whereas Class IA and Class IB mice additionally suffered from acute neurologic disease that was universally lethal within 3-7 DPI. Class IA mice also exhibited patent severe respiratory distress that was not due to either congestive heart failure or pneumonitis. Instead, animals in Class IA exhibited extensive tissue damage in the caudal brainstem, particularly the medulla, along with high serum levels of catecholamines, strongly suggesting that the respiratory signs observed in these mice were a consequence of neurogenic pulmonary edema (NPE). Gross pathological comparison of lungs from Class IA mice with those from other groups revealed incomplete lung collapse at necropsy, as well as significantly increased lung wet weight, likely due to hemorrhage and fluid leakage into the alveolar spaces. These features closely resembled those observed in experimental animal models of non-virally-induced NPE and fatal human cases with fulminant NPE [96, 97], Indeed, histopathological analyses of Class IA animals further revealed focal areas of alveolar spaces filled with proteinaceous and erythrocyte-filled transudate consistent with observations in fatal human cases [21 , 98-100],
[0075] Pulmonary edema (PE) is typically defined as an extravascular increase in the water content of the 3ungs,48 and can be subcategorized on the basis of cardiogenic or neurogenic origin. Since Class IA mouse heart tissues exhibited normal histology and lacked overt signs of disease we were able to exclude cardiogenic PE, and the absence of viral replication or inflammation in the lung parenchyma excluded direct virus-induced tissue injury. Instead, we detected high serum levels of catecholamines in Class IA mice, strongly indicating that this group exhibited neurogenic PE (NPE), which has previously been demonstrated as a consequence of catecholamine storm induced by severe sympathetic discharge [96, 101], In this scenario, autonomic nervous system dysfunction triggers a catecholamine storm, resulting in systemic and pulmonary vasoconstriction. This leads to a shift in blood volume from systemic to pulmonary circulation, which culminates in plasma leakage and hemorrhage into the alveolar spaces either through a hydrostatic mechanism or due to direct pulmonary endothelial injury [101 -104]. While several experimental animal models of non-virally-induced NPE have been developed in recent years (see Sedy [103] and Davison [104] for review), ours is the first to successfully induce the classical signs of pulmonary edema using EV71 infection alone. Thus, our new model constitutes a significant advance in the pursuit of antiviral therapies and treatment regimens that can limit EV71 infection and prevent the onset of fulminant NPE in human patients. Although it is possible that pulmonary edema can also be induced by host cytokine storm in response to EV71 infection [105-107], the data strongly suggest that a major mechanism of EV71 -induced NPE does not involve a massive inflammatory response and is instead associated with tissue damage in specific regions of the brain. [0076] Brain regions associated with NPE induction have been designated as trigger zones, which encompass the hypothalamic paraventricular and dorsomedial nuclei [101, 103], and the ventrolateral and dorsal medulla, including the NTS and AP regions [96, 104, 108-1 10]. EV71 - induced NPE has previously been attributed to extensive damage of brainstem tissue [21, 22, 93, 111], and in our novel murine model we detected both viral antigens and extensive damage in the brainstem and spinal cord. While Class I A and Class IB mice exhibited similar distributions of lesions and viral antigens in the brainstems and spinal cords, as well as comparable up- regulation of serum catecholamines, the absence of NPE in Class IB animals might be explained by the reduced number and severity of brain lesions and/or the lower viral antigen intensity in the NTS, medullary reticular nuclei (MdRN), and AP regions of the medulla, the dentate nucleus in the cerebellum, and the dorsomedial nuclei of the anterior hypothalamus. We therefore propose that acute, severe destruction of brainstem tissue, particularly those associated with the vasomotor areas, leads to a catecholamine storm in EV71 -infected hosts, and that this can progress to NPE if known trigger zones are sufficiently damaged.
[0077] In summary, the present invention is an authentic mouse model of EV71 neuroinfection that exhibits face validity [1 12], i.e., these animals display the entire range of clinical signs that can be observed, across the full spectrum of neurological disease induced by EV71 infection in human patients, including NPE. Hallmark observations in EV7I :TLLmv-mfected mice presenting Class 1A signs of disease were made by video comprising two video clips of two different Class IA mice. Both animals were unable to self-right and were in a state of coma. Severe respiratory distress presenting as tachypnea with subcostal recession was evident in the first mouse. Gasping, subcostal recession and a frothy fluid emanating from the nostrils were seen in the second mouse. Hallmark observations in EV71:TLLmv-mfected mice presenting Class IB signs of disease were made by a video of one Class IB mouse. The animal was unable to self-right and was in a state of stupor. Ipsilateral paralysis of the right limbs and persistent tremor of the left hind-limb were also observed. This model also displays construct validit [ 1 32] with respect to the gross and histopathological features of disease, which closely resemble those reported in fatal human cases. This new in vivo model represents a powerful tool for identifying the key events in EV7 neuro-pathogenesis, for dissecting the mechanism of EV71 -induced NPE, developing novel treatment modalities and potential antiviral therapies, and for conducting pre- clinical evaluation of novel vaccines. [0078] The practice of the present invention employs, unless otherwise indicated, conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA, genetics, immunology, cell biology, cell culture and transgenic biology, which are within the skill of the art. See, e.g., Maniatis et al,, 1982, Molecular Cloning (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); Sambrook et al, 1989, Molecular Cloning, 2nd Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); Sambrook and Russell, 2001 , Molecular Cloning, 3rd Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); Green and Sambrook, 2012, Molecular Cloning, 4th. Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); Ausubel et ai, 1992), Current Protocols in Molecular Biology (John Wiley & Sons, including periodic updates); Glover, 1 85, DNA Cloning (IRL Press, Oxford); Russell, 1984, Molecular biology of plants: a laboratory course manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.); Anand, Techniques for the Analysis of Complex Genomes, (Academic Press, New York, 1992); Guthrie and Fink, Guide to Yeast Genetics and Molecular Biology (Academic Press, New York, 1991); Harlow and Lane, 1 88, Antibodies, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); Nucleic Acid Hybridization (B. D. Harries & S. J. Higgins eds. 1984); Transcription And Translation (B. D. Homes & S. J. Higgins eds. 1984); Culture Of Animal Cells (R. 1. Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); the treatise, Methods In Enzymology (Academic Press, Inc., N.Y.); Methods In Enzymology, Vols. 154 and 155 (Wu et al. eds.), Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes I- IV (D. M, Weir and C. C. Blackwell, eds., 1986); Riott, Essential Immunology, 6th Edition, Blackwell Scientific Publications, Oxford, 1988; Fire et al., RNA. Interference Technology: From Basic Science to Drug Development, Cambridge University Press, Cambridge, 2005; Schepers, RNA Interference in Practice, Wiley-VCH, 2005; Engelke, RNA Interference (RNAi): The Nuts & Bolts of siRNA Technology, DNA Press, 2003; Gott, RNA Interference, Editing, and Modification: Methods and Protocols (Methods in Molecular Biology), Human Press, Totowa, NJ, 2004; Sohail, Gene Silencing by RNA Interference: Technology and Application, CRC, 2004.
EXAMPLES
[0079] The present invention is described by reference to the following Examples, which are offered by way of illustration and are not intended to limit the invention in any manner. Standard techniques well known in the art or the techniques specifically described below were utilized
EXAMPLE 1
Materials and Methods for Examples 2-8
[0080] Cell lines and virus strains: All cell lines used in this study were purchased from the American Tissue Type Culture Collection (ATCC, USA). Studies were performed using various mammalian cell lines; human adenocarcinoma cell lines HeLa (CCL-2) and HEp-2 (CCL-23), and rhabdomyosarcoma RD (CCL-136); African green monkey kidney Vero (CCL-81 ), and Vervet monkey kidney fibroblast COS-7 (CRL-1651); mouse neuroblastoma Neuro2A (CCL- 131), embryonic fibroblast ΝΪΗ/3Τ3 (CRL-1658), and kidney epithelial TCM (CCL-139); hamster ovarian epithelial-like CHO- 1 (CCL-61), and normal rat kidney epithelial NRK (CRL-6509).
[0081] The human EV71 BS strain (EV71:BS) was previously isolated from the brainstem of a deceased patient infected with EV71. The virus was passaged in Vero cells for four cycles prior to storage at -80°C until further use. The mouse cell (NIH/3T3)-adapted EV71:TLLm strain was derived from the EV71 :BS strain via continuous serial passage (>60 cycles) in mouse NIH/3T3 cells. The EV71:TLLm strain was further passaged (40 cycles) in N1H/3T3 cells to generate the mouse cell-adapted virulent strain (EV71:TLLmv).
[0082] Maintenance of cell lines and infection with virus: Ail cell lines were grown in Dulbecco's Modified Eagle's Medium (DMEM, Gibco, USA) supplemented with 10% (7V) of fetal bovine serum (FBS, i-DNA Singapore) and 0.22% (w/v) sodium bicarbonate (NaHCC>3, Sigma Aldrich, USA) and incubated at 37°C and 5% C02, unless otherwise stated. All infected cells were incubated in maintenance medium (DMEM supplemented with 1% FBS and 0.22% NaHC03).
[0083] Cells (2.5-5.0x 105 cells per well) were seeded in tissue culture-treated six-well plates (Nunc, Fisher Scientific) overnight, infected with 500 μΐ of virus suspension (MOI 1), and incubated at 30°C, 37°C, or 39°C for 2 hours. Cells were washed twice in sterile Phosphate- Buffered Saline (PBS, pH 7.4) solution before addition of fresh maintenance medium (DMEM, 1% FBS). Infected cells were observed daily for appearance of distinct lytic cytopathic effects (CPE).
[0084 j For virus growth kinetic studies, plates containing the infected cells were frozen at "80°C at various time-points: 0, 6, 12, 24, 36, 48, and 54 hours post-infection (hpi). Plates were subjected to three cycles of freezing and thawing, and ly sates were harvested and cleared by vigorous vortexing followed by centrifugation at l,500x g for 10 minutes. Cleared supernatants were stored in cryovials (Nunc, Fisher Scientific) at -80°C until further use.
[0085] For temperature adaptation assays, inoculated Vero and ΝΓΗ/3Τ3 cells were incubated at 30°C, 37°C, and 39°C and observed daily for appearance of CPE. Respective culture supernatants were harvested at 48 hpi and stored in cryovials at -~80°C until further use.
[0086] Various mammalian cell lines, i.e. RD, HeLa, and HEp-2 (human), Vero and COS-7 (monkey), NIH/3T3, Neuro-2A, and TCMK (mouse), CHO-K1 (hamster), and NRK cells (rat), were infected with either parental EV71:BS or derived NIH/3T3 -adapted EV71 strains at MOI (multiplicity of infection) of 1 and incubated at 37°C for 10 days. Cultures were observed daily for appearance of CPE.
[0Θ87] Determination of virus titer and relative replication rates (RRR): Virus supernatants were subjected to endpoint titration and assayed in both NIH/3T3 and Vero cells. The virus titer was enumerated using the Reed and Muench method [61] and the Reed and Muench calculator [62]. Briefly, ΝΓΗ/3Τ3 (l x l 04cells per well) and Vero cells (4x l 03 cells per well) were seeded overnight in a 96-well plate. Frozen virus thawed to room temperature were diluted (Κ 1) in sterile 1% aqueous sodium deoxycholate (Sigma Aldrich, USA), and vigorously mixed for 15 minutes to disaggregate virus. Disaggregated virus was subjected to ten-fold serial dilution in maintenance medium, and 100 μΐ diluted virus from 10 dilution onwards was added onto each well of cells. Plates were incubated at 37°C and observed daily under inverted light microscopy for the appearance of distinct CPE. Virus titer was reported as 50% cell culture-infectious doses per volume (CCID5{)/ml).
[0088] To assess the degree of adaptation of EV71:TLLm and EV71:TLLmv in NIH/3T3 cells, virus supernatants harvested from previously infected primate and rodent cell lines were subjected to virus titer assay using both ΝΓΗ/3Τ3 and Vero cells. The titer ratio used to measure relative replication rates (RRR) in ΝΓΗ/3Τ3 and Vero cells was calculated using the following formula:
RRR = log (A/B)
where A is the virus titer assayed in N1H/3T3 cells, and B is the virus titer assayed in Vero cells.
[0089] Virus antigen detection by immunofluorescence assay: For infected cells that did. not exhibit significant CPE, immunofluorescence (IF) staining was performed to verify infection. Cells were trypsinized at 72 hpi, washed twice in sterile PBS, and coated onto Teflon slides (Erie, USA). Slides were air-dried inside the biosafety cabinet and UV-treated for 15 minutes to inactivate live virus prior to fixation in cold acetone at 4°C for 10 minutes. Slides were probed with pan-Enterovirus antibody (Merck Millipore, USA) and subsequently with FITC-conjugated mouse IgG (DAKO Cytomation, Denmark) mixed with 0.01% (w/v) Evan's blue counter stain.
[0090] Transfection of cells with EV71 viral RNA: Vera and NIH/3T3 cells (3><104 cells per well) seeded overnight in 24-well plates were transfected with viral RNA extracted from 4*106 CCID50 virus using Lipofectamine 2000 (Life technologies, USA) following the manufacturer's protocol. RNA from EV7LBS, EV71:TLLm, and EV71:TLLmv was extracted using Viral RNA kit (Qiagen, Germany) and incubated with Lipofectamine 2000 on cells for 6 hours at 37°C. Transfected cells were observed daily for appearance of CPE. At 7 dpi, supernatant was harvested from infected cells and passaged onto f eshly seeded Vero and NIH/3T3 cells. Cells were observed daily for appearance of CPE, and at 7 dpi, cells were trypsinized and processed for immunofluorescence viral antigen detection.
[0091J Full genome sequencing and genetic mapping of EV7.I strains: Viral RNA of EV7EBS, EV71 :TLLm, and EV71:TLLmv strains was extracted using Viral RNA kit (Qiagen, Germany) and reverse-transcribed using Superscript II (SII-RT, Life Technologies, USA). The cDNA obtained was amplified with GoTaq Green (Promega, USA) and degenerate EV71 primers (primers' sequences are available upon request). The amplicon was purified using PCR clean up kit (Geneaid Biotech, Taiwan) and cloned into pZero2 vector (Lifetech, USA). Clones were selected from Kanamycin plates, inoculated into LB broth (50 μ^ηιΐ Kanamycin) and allowed to grow overnight at 37°C for plasmid extraction with QiaSpin Miniprep kit (Qiagen, Germany). Plasmids were subsequently sequenced by the BigDye tenninator method (Applied Biosystems, USA) using the same primers. The 500-bp fragment sequences obtained were aligned using BioEdit v7.0.9.0 [63] against the whole genome sequence of an EV71 Singapore isolate 3799-SIN-98 (GenBank accession no. DQ341354.1) to reconstruct the full genome sequences of EV71:BS, EV71:TLLm, and EV71:TLLmv. Molecular modelling of the protomers of EV71 :TLLm, and EV71 :TLLmv was performed using Deepview/Swiss pdbviewer ver. 3.7 (http colon slash slash expasy dot org slash spdbv slash) and the SWISS-MODEL server [64, 65]. EXAMPLE 2
Primate Cell Lines but not Rodent
Cell Lines Permissible to Infection by EV71;BS
[0092] All primate cell lines used in this study were permissible to infection by EV7LBS virus. Human RD cells, as well as monkey Vero and COS-7 cells, exhibited full lytic cytopathic effects (CPE) within 48 hours post-infection (hpi) (Figures 1 A, 1 J, and 1M), and viral antigens were detected in fixed infected cells (Figures 2A-2L; data not shown for RD, COS-7 and Vero cells). Growth kinetic curves of the virus harvested from supernatant of various infected cell lines confirmed productive infection in RD, Vero, and COS-7 cells (Figure 3A). Virus harvested from RD and Vero cells reached an endpoint titer of 3 < 109 CCEDso/ml, while virus titer from COS-7 was 106 CCID50/ml (Figure 3A). EV7LBS did not induce full CPE in HeLa and Hep-2 cells (Figures ID and 1G), and the resulting viral titer was not measurable within, the assay cutoff limit. However, viral antigen was detected by indirect immunofluore scent staining in both HeLa cells (Figure 2a) and Hep-2 cells (Figure 2D) indicating successful virus entry into the cells but inefficient or defective replication may have resulted in immeasurable vims titer,
[0093] All the rodent cell lines tested were determined to be non-permissive to EV71:BS infection. Lytic CPE of cells was absent following infection (Figures 4A, 4D, 4G, 4J and 4M), virus titer from supernatants was not measurable, and viral antigens could not be detected in inoculated cells (Figures 2G, 2J and 2M; Figures 10A, IOC and 10E).
EXAMPLE 3
Mouse Cell (NIH/3T3)-adapted EV71 :TLLm Virus
Productively Infected both Primate and Rodent Cell Lines
[0094] EV71 :TLLm was derived following serial passage of EV7LBS in NIH/3T3 mouse cell line for a minimum of 60 cycles. All primate and rodent cell lines tested, with the exception of
NRK cells, were permissible to productive infection by EV71:TLLm. Full CPE was observed in
RD, Vero, and COS-7 (Figures IB, IK, and IN), as well as NIH/3T3 and Neuro-2A ceils
(Figures 4B, E) at 48 hpi. High virus titer was measurable in supernatants harvested from all infected cell lines except NRK (Figures 3C and 3D), and the infected cells were tested positive for viral antigen by indirect immunofluorescent assay (Figures 2B, 2E, 2H, 2K and 2N). Full
CPE and measurable viral titer were not observed in NRK cells (Figure 4N; Figure 3D), but viral antigens could be detected (Figure 2K), indicating successful virus entry into NRK cells by
EV71 ;TLLm but inefficient virus replication could have resulted in non-measurable virus titer. EXAMPLE 4
Mouse Cell (NIH/3T3)-adapted EV71;TLLmv Virus
Productively Infected Rodent Cell Lines but not All Primate Lines
[0095] The EV71:TLLmv virus strain was derived from further passage of EV71 :TLLm in
NIH/3T3 cells for another 40 cycles. EV71 ;TLLmv caused lytic CPE in fewer number of cell lines - D, Vero, ΝΓΉ/3Τ3, Neuro-2A, and TCMK cells (Figure 3B), and full CPE was only observed in RD, NIH/3T3, and Neuro-2A cells (Figure 1C; 4C, F). TCMK, CHO-K1 and NRK cells were also noted to be permissible to infection without progressing to full CPE (Figure 41,
L, O), as shown by positive viral antigen detection in the infected cells (Figures 2L, 20, and
2R).
[0096J On the other hand, the primate cell lines HeLa, Hep-2, and COS -7 were observed to be non-permissible to EV71:TLLmv infection, as shown by the absence of CPE (Figures IF, II, and 10), immeasurable virus titers (Figure 3B), and negative viral antigen detection (Figures 2C, 2F, and data not shown).
EXAMPLE 5
EV71:TL' Lmv Virus Exhibited a Higher Degree of Adaptation to ΝΪΗ73Τ3 Cells, While EV71:TLLm was More Adapted to Replicate in Vero Cells
|0097] The amount of viable virus in supernatants harvested from infected cells at various time points was determined by enumerating the virus titer in both Vero and NIH/3T3 cells. The relative reproductive ratio (RRR). calculated by taking the ratio of virus titer values assayed in
NIH/3T3 to the titer values assayed in Vero, was used as a surrogate measure of the degree of virus adaptation to NIH/3T3 cells. The parental EV71.-BS virus displayed highly negative RRR values for RD, Vero, and COS-7 (Figure 5A), indicating that the virus titer assayed in Vero cells far exceeds the titer assayed in NIH/3T3 cells. The relative reproductive ratio values for other cell lines could not be determined since the vims titers could not be measured. On the other hand, EV71:TLLmv virus exhibited positive RRR values, with the exception of virus propagated in Vero cells (Figure 5B). The positive RRR values were indicative of more efficient replication, and therefore higher titer values, in NIH/3T3 cells compared to Vero cells. The negative RRR value determined for EV71 :TLLmv harvested from Vero cells was consistent with the observed slow growth kinetics (Figure 3B) and lower virus titer. EV71 :TLLm exhibited negative RRR values (Figures 5C and 5D), although of lesser degree than the RRR values for EV71:BS. This suggested that although EV71:TLLm could productively infect a few rodent cell lines, it was still more adapted to replicate in Vero than NIH/3T3 cells. EXAMPLE 6
EV71:TLLm Exhibited Better Adaptability
to Changing Temperatures than EV71 : TLLmv
[00981 Vero and NIH 3T3 cells infected with the parental EV71 :BS and the derived
NIH/3T3- adapted EV71:TLLm and EV71: TLLmv strains were incubated at various temperatures
-30°C, 37°C, and 9°C, to determine virus adaptability to temperature variation or changes.
EV71 :BS displayed the most limited adaptability, with Ml CPE observed only in Vero cells incubated at 37°C (Figure 8B; Table 1). EV71 :TLLmv displayed moderate adaptability, based on the observed Ml CPE induction in Vero cells at 37°C (Figure S2B) and in NIH/3T3 cells in both
37°C and 39°C (Figure 8A, Figure 9A; Table \). EV71 :TLLm, on the other hand, displayed the greatest adaptability, where it induced full CPE in Vero cells for all incubation temperatures
(Figure 7B, Figure 8B, Figure 9B) though only at 37°C in NIH/3T3 cells (Figure 8 A; Table 1).
TABLE 1
Assessment of Virus Adaptability ofEV7J:BS, EV7I:TLLm and EV71 TLLmv Grown in NTH/3T3 and Vero Cells to Various Incubation Temperatures
Figure imgf000037_0001
CPE.
" Indicates absence of full CPE in infected cells.
3 Indicates observation of full CPE.
4 Indicates absence of full CPE, while number in parenthesis indicates the maximum degree of CPE observed in cells. EXAMPLE 7
Viral Genomes of EV71:TLLm and EV71 iTLLmv Accumulated Multiple Missense Mutations as a Result of Adaptation to NIH/3T3 Cells
[0099] Viral RNA of EV7EBS, EV7 LTLLm, EV71;TLLmv were subjected to Sanger sequencing to determine the consensus genome sequence and identify possible adaptive mutations arising from the adaptation process in NIH/3T3 cells. The consensus sequences of the genomes representing dominant population of the quasi-species have been deposited i the
GenBank, NCBI (National Center for Biotechnology Information). Alignment of the full genome sequences of EV71:TLLm (GenBank Accession No. KF514879; SEQ ID NO:l) against
EV7 -BS (GenBank Accession No. KF514878; SEQ ID NO:3) revealed 60 nucleotide mutations, 21 of which resulted in amino acid substitutions (Table 2). On the other hand, 83 mutations with 36 amino acid substitutions, were noted between the genomes of EV7J :TLLmv
(Genbank Accession No. KF514880; SEQ ID NO:2) and EV7EBS. Majority of the missense mutations were located in the PI (capsid protein genes) region (Table 2), particularly within the
VP1 protein gene (Table 3).
[00100] Amino acid changes were also observed within the P2 and P3 regions, most notably in the RNA-dependent RNA polymerase (3D region). EV7J :TLLm acquired four amino acid changes, mostly in the palm and thumb domains of the enzyme (Table 4). EV71:TLLmv, on the other hand, accumulated eight amino acid changes, mostly also in the palm and thumb domains of the polymerase. Nucleotide mutations were also observed in the 5' untranslated region (UTR) of the genome. Apart from base changes, a 1-base insertion was found in EV71:TLLm, while a 4-bp insertion and a 20-bp deletion were observed in EV71 :TLLmv 5'UTR (Tables 2 and 3). On the other hand, no amino acid substitutions were observed in the VP3 and 3A regions of EV71 :TLLm, as well as in the 3'UTR of both EV71:TLLm and EV71:TLLinv.
TABLE 2
Nucleotide and Amino Acid Changes in the Genomes of EV71 :TLLm and EV71:TLLmv Compared to EV71:BS
EV71:BS vs EV71:TLLm EV71:BS YS EV7LTLLmv
Genomic Region No. Nucleotide No. Amino Acid No, Nucleotide No. Amino Acid
Changes Changes Changes Changes
5' UTR 11 NA 11 NA
1 bp Insertion 4 bp Insertion 20 bp Deletion
PI 22 12 39 22
P2 1 1 2 1 1 2
P3 16 7 22 12
3' UTR 0 NA 0 NA
Total 60 21 83 36
TABLE 3
Adaptive Mutations Observed in the 5'UTR and gions of EV71:TTLm and EV7I: TLLmv Viral Genomes
EV71:BS v& EV71;TLLm EV71:BS v$ EV71:TLLmv
Amino Acid Changes Amino Acid Changes
Genome Nucleotide Polyprotein' Mature Nucleotide Polyprotein Mature Region Changes Protein2 Changes Protein
Cloverleaf C140G
IRES3 A141G A141C
G195C T209C
T209C G258A
G258A C370T
C370T G448A
G448A A502C
T502C G675T
C709T T677C
A671 T C687T
G675T C709T
T678Insertion 678-681
Insertion
726-745
Deletion VP4 A809G E21G E21G A809C E21G E21G
VP2 G1359A V204I V135I G1359A V204I V135I
G1385C S213T S144T G1385C S213T S1 4T
A1400T Κ218Ϊ K149I A1400T K218I K149I
T1428C E228P E159P
G1429C E228P E159P
VP3 G1900C A385P A62P
A2287G 7514A T191A
A2421G I558M I235M
VP1 T2462C V572A V7A T2462C V572A V7A
C2725T L660F L95F C2530A Q595K Q30K
A2734G K663E K98E A2719G 1658V I93V
A2752G N669D N104D T2724A D659E D64E
A2876G E710A E145A C2725T L660F L95F
A2943T E732D E167D A2734G K.663E K98E
C2947T L734F L169F A2752G
C3165 S806L S241L A2753G N669G N104G
A2876C E710A E145A
A2943T E732D E167D
C2947T L734F L169F
C3165T S806L S241L
T3175C Y810H Y245H
G3148A V8I3I V248I
G3319T A858S
1 Numbering of amino acids in the uncieaved polyprotein prior to maturation.
2 Numbering of amino acids in the mature protein.
3 Internal Ribosome Entry Site.
Mutations are based on alignment with reference EV7 BS genome. TABLE 4
Adaptive Mutations Observed in the P2 and
P3 Regions of EV71 :TTLm and EV71:TLLmv Viral Genomes
Figure imgf000041_0001
1 Numbering of amino acids in the uncleaved polyprotein prior to maturation.
Numbering of amino acids in the mature protein.
Mutation located in the Ring finger domain oi the RNA-dependent RNA polymerase.
4 Mutation located in the Palm domain of the RNA-dependent RNA polymerase.
5 Mutation located in the Thumb domain of the RNA-dependent RN A polymerase. Mutations are based on alignment with reference EV71:BS genome. EXAMPLE 8
Transfection of EV7LBS Viral RNA into Murine Cells Resulted in Productive Infection but the Virus Progeny could not Re-infect the Same Mouse Cells
[0100] Vero and NIH 3T3 cells transfected with viral RNA exhibited full CPE at 7 days post- transfection (dpt) (data not shown). Viral antigens were detected in NIH/3T3 cells transfected with viral RNA of EV71:BS (Figure 10B), but not in NIH/3T3 cells subjected to infection with the virus (Figure 10A). Virus supematants re-inoculated onto fresh Vero and NIH/3T3 cells resulted in productive infection (100% CPE) only in Vero but not in NIH/3T3 cells (Figure 6A), and viral antigen detection confirmed infection in Vero cells, but not NIH/3T3 (Figure 6B).
EXAMPLE 9
Materials and Methods for Examples 10-17
[0101] Plasmids, viruses, bacteria, and cell lines'. The plasmid encoding murine SCARB2 cDNA (pMD18~mSCARB2) (Genbank accession no. NPJ 1670.1) was purchased from Sino Biological, Inc. (Beijing, China). The pQE30 vector (Qiagen, Germany) for recombinant expression of soluble mSCARB2 protein in E. coli cells was a generous gift from Dr. Kian Hong Ng (Temasek Lifesciences Laboratory, Singapore). Plasmids encoding the full-length cDNA of EV71 were generated using the low-copy no. plasmid pACYC177 (New England Biolabs, Singapore). A plasmid construct expressing T7 polymerase (pCMV-T7pol) was a generous gift from Dr. Peter McMinn of University of Sydney, New South Wales. The plasmid pZero-2 used for fragment sequencing of clone-derived viruses was purchased from Invitrogen (Life Technologies, USA).
[0102] The clinical isolate EV7LBS (Genbank accession no. KF514878), EV71:TLLm (Genbank Accession No. KF514879.1), and EV71:TLLmv (Genbank Accession No. KF514880.1) used in this study were described above or previously [71].
[0103] All cell lines used in this study - African green monkey kidney Vero (CCL-81); mouse neuroblastoma Neuro-2a (CCL-131 ), and fibroblast NIH/3T3 (CRL-1658) cells were purchased from the American Tissue Culture Collection (ATCC®, USA). Cells were grown and maintained as described above or previously [71].
[0104] E. coli cells BL21 strain (New England Biolabs, Singapore) was used for high-level protein expression, TOP 10 strain (Life Technologies, USA) for fragment sequencing of individual clones, and XL-10 Gold ultracompetent strain (Stratagene, USA) for generation of full-length genomic cDNA clones. [0105] Construction of EV7 LBS full-length genomic cDNA clones, capsid-chimeric clones, and VP1/VP2 mutant clones: EV7LBS cDNA clones were generated by two-step cloning. Viral RNA extraction (Qiagen Viral RNA kit, Germany) and conversion to cDNA (Life Technologies Superscript-II RT, USA) have been described above or previously [71 ]. The genome proximal fragment encoding the 5'UTR and PI regions was amplified using the primer pair: EV71_BamHI-PfF and EV71_Pf-AatIIR (Table 5), which contains BamHI and A atll restriction sites for cloning into the plasmid pACYC177. The distal fragment encoding the P2, PS, and S VTR was amplified with the primer pair EV71_HindIII~DF and EV71 D-BamHIR, which also contains Hindlll and BamHI restriction sites for cloning. The proximal fragment contains a T7 polymerase promoter region upstream of the 5'UTR to facilitate transcription. The proximal fragment was ligated to the distal fragment following digestion with Eagl and Aatll, and the full-length EV71 :BS clone was produced.
TABLE 5
Primers
Primer name Sequence (SEQ IB NO:) Remarks
EV71_BamHI- CTAGGGATCCTAATACGACTCACTATAGGTTCAAA For cloning EV71 :BS PfF C AGCCTGTGGGTTGCACC C ACTC AC AGG (4) proximal fragment (5'UTR- Pl regions) into the
EV71_Pf-AatIIR CTAGGACGTCCGGCCGAACTTTCCAAGGGTAGTAA
pACYC177 plasmid
TGGCAGTACGACTAGTGCC (5)
EV71_HindIII- TAATAAGCTTCGGCCGGCAGTCTGGGGCCATCTAC For cloning EV7I :BS distal DF GTG (6) fragment (P2-3'UTR) into the pACYC 177 plasmid
EV71_D- GCGCGGATCCTTTTTTTTTTTTTTTTI TTGCTATTCT
B mHIR GGTTATAACAAATTTACCCCCAC (7)
SDM_MluIF GGTGTCCACTCAACGCGTCGGCTCCCACGAGAACT For introducing Mlul
CCAATTCAGCTACAGAAGGCTCC (8) restriction site into the proximal fragment clone
SDM MluIR CAAGCATGGGCTCACAGGTGTCCACTCAACGCGTC
GGCTCCCACG (9)
Ml l-TLLm-PlF ACTCAACGCGTCGGCTCCCACGAGAACTCCAATTC For amplifying the PI gene
AGCTACAGAAGGC (10) sequences of EV71 :TLLm flanked by Mlul and Eagl
Eagl- TLLm-PIR ACTGCCGGCCGAACTTTCCAAGGGTAGTAATGGCA
restriction sites
GTACGACTAGTGCC (1 1) VP2_ G1385C-F CAGAGGACACCCACCCTCCTTACAAACAAACACAA For introducing the G3385C CCTGGCGCC (12) mutation.
VP2_G13SSC-R GGAGGGTGGGTGTCCTCTGTTCCTGTACCGCCTG (VP2 S144T substitution)
(13)
VP2_A1400T-F CTCCTTACArACAAACACAACCTGGCGCCGACG For introducing the A1400T
(14) mutation
VP2_A1400T-R TGTGTTTGT/4TGTAAGGAGGGTGGCTGTCCTCTGTT (VP2 149I substitution)
CC (15)
VP1__A2734G-F CTCCCTCTTGAGGGTACCACCAATCCAAATGGTTAT For introducing the A2734G
GCCAACTGGG (16) mutation
VP1_A2734G-F TGGTACCCTCAAGAGGGAGATCTATCTCTCCTACCA (VP1 K98E substitution)
AACCTGCCC (17)
VP1_A2876C-F CTACTGGTGCGGTTGTTCCACAATTACTCCAGTATA For introducing the A2876C
TGTTTGTTCCCCCTGG (18) mutation
VP1_A2876C-R GGAACAACCGCACCAGTAGGAGTGCACGCAACAA (VP 1 E145A substitution)
AAGTGAATT (1 )
VPJ_C2947T-F AGAGAATCATTTGCTTGGCAGACAGCCACAAACCC For introducing the C2947T
C (20) mutation
VP1 C2947T-R GCCAAGCAA4TGATTCTCTAGACTCTGGTTTGGGA (VP1 L169F substitution)
GCACC (21 )
pQE-mSCARB2F ATTAGGATCCGTCTTTCAGAAGGCGGTAGACCAG For cloning mouse SCARB2
(22) gene into pQE30 protein expression plasmid
pQE-mSCARB2R TATAAAGCTTCGACACGCCAGCCACGTGAAAACCA.
AGCCAAAG (23)
[0106] To replace the PI region ofEV71:BS with the PI of EV71 :TIXm, an Mlul restriction site was engineered within the boundary between 5 'UTR and PI (primer pair SDM MlulF and SDM_Ml I-R). The PI cDNA sequence of EV71 :TLLm was amplified (primer pair Mh - TLLm-PlF and Eagl-TLLm-PlR), digested with Mlul and EagI, and cloned into the construct harbouring the proximal fragment. This modified proximal fragment was subsequently ligated to the distal fragment as described.
[ 107 J To generate clones with amino acid substitutions in the VP2 and VP 3 proteins, site- directed mutagenesis was performed in the proximal fragment prior to ligation to the distal fragment. The VP2 S144T (nt G1385C) amino substitution, was introduced into the proximal fragment with the specific primer pair VP2 G1385C-F and VP2_G138SC-R. The VP2 S144T (nt G1385C), VP1 K98E (nt A2734G), E145A (nt A2876C), and E167D (nt C2947T) were also generated in a similar manner using different primer pairs (Table 5).
[0108] Assessment of "mouse cell-entry phenotype": To generate live virus, the cDNA clones were co-transfected with another construct expressing the T7 RNA polymerase (pCMV-T7pol) into Vero cells using Lipofectamine 2000 (Life Technologies, USA) following the manufacturer's recommended protocol. Transfection supematants were harvested 7-10 days post-trans fection and inoculated onto overnight seeded cell lines at 1 MOI as described above or previously [71]. Cells were incubated with virus supernatant at 37 C for 1 hour and. washed twice with PBS prior to replacement of media with fresh DMEM, 1% FBS.
[0109] hi order to assess the infection phenotype, progression of lytic cytopathic effects (CPE) induction was recorded, and images were taken at various time points. Infected cells were also harvested and processed for immunofluorescence detection of viral proteins as described above or previously [71]. Briefly, adherent cells were trypsinized and combined with pelleted cells from culture supernatant, washed twice in sterile phosphate buffered saline (PBS), and fixed onto Teflon slides. Fixed cells were incubated with pan-Enteroviras monoclonal antibodies (Merck Millipore, USA) and detected with standard FITC-conjugated anti-mouse IgG antibodies. Infected cell culture supematants were also harvested, cleared, and subjected to serial dilutions for vims titer determination using the Reed and Muench method [61]. Once the titer is known, the supematants were passaged onto freshly seeded ΝΓΗ/3Τ3 and Neuro-2a cells at 1 MOI, and the infection phenotype was again assessed using the method described here.
[0110] Recombinant protein expression of soluble SCARB2 proteins and production of SCARB2 rabbit anti-sera: The plasmid pMD18-mSCARB2 encoding the extracellular domain of mouse SCARB2 (aa Argil - Thr 432) was amplified with the primer pair pQE-mSCARB2F and pQE-m$CARB2R to introduce BamHl and Hindlll restriction sites to facilitate cloning into the pQE30 protein expression vector. The clones were transformed into BL21 E. coli cells, and protein expression was induced with ImM IPTG overnight. Harvested cells were lysozyme (1 mg/ml) digested, and the crude extract was purified using a Ni-NTA column (Qiagen®, Germany). Cleared lysate was incubated overnight in 1 ml of 50% Ni-NTA slurry at 4° C with gentle shaking. The protein was washed 5 times in Wash Buffer (50 mM NaPi2P04, 300 mM NaCl, 20mM. imidazole, pH 8.0) and eluted with Elution Buffer (50 mM Na¾P04, 300 mM NaCl, 250mM imidazole, pH 8.0. [0111] Two healthy male rabbits were immunized with 1.4 μg purified mouse SCARB2 protein mixed with Freund's complete adjuvant (Sigma- Aldrich®) at day 0. Booster containing 0.8 ig antigen mixed with Freund's incomplete adjuvant (Sigma- Aldrich®) was injected at days 23, 42, 63, 84, and 105. Terminal bleed by cardiac puncture was performed at day 3 17, and collected blood was incubated overnight at 4° C prior to centrifugation at 3,000 rpm for 30 minutes. Cleared serum was collected and stored at -20° C until further use. Production of SCARB2 rabbit antiserum was approved by the Temasek Lifesciences Laboratory Institution Animal Care and Use Committee (TLL-IACUC) [Approval No. 047/32].
[0112] Virus competition assay with murine SCARB2 protein: In vitro binding assays were performed to confirm the interaction of EV71:TLLmv with mouse and human SCARB2 proteins. ΝΪΗ/3Τ3 cells (6000 per well) were seeded overnight onto sterile Teflon coated slides (Erie, USA), Prior to viras inoculation, 100 MOI EV71 :TLLmv was incubated with various concentrations of recombinant mouse SCARB2 (mSCARB2) or human SCARB2 (hSCARB2) proteins (4.0 g, 2.0 μg, 1.0 μg, 0.5 g, 0.25 g, 0.125 μg, and 0 μg) for 2 hours at 37° C in a shaking platform. Infected cells were observed daily for signs of CPE and fixed at 48 hours postinfection. in absolute acetone (4° C, 10 mins). Fixed cells were immunofluorescently assayed with pan-Enterovirus antibody (Merck Miilipore®, USA). Slides were imaged with an upright fluorescence microscope (Nikon, Japan).
[0113] Virus~SCARB2 binding assays: Antibody-mediated SCARB2 blocking assays were performed on fixed cells to assess whether masking cell surface SCARB2 proteins affects binding virus binding. N1H/3T3 and Vero cells cultured on Teflon slides were fixed (4% PFA, 25 minutes, room temp.), and blocked with 5% BSA in PBS for 1 hour at 37° C. Slides were incubated in polyclonal rabbit sera raised against mSCARB2 (1 :100) for 1 hour at 37° C. For negative controls, cells were incubated with polyclonal rabbit sera raised against Saffoid Viras L protein. Slides were washed in PBS prior to incubation with live EV71 :TLLmv (1000 MOI) for 1 hour at 37° C and probed with pan-Enterovirus antibody and detected with FITC-conjugated Ab. Slides were imaged with Zeiss LSM 510 Meta inverted confocal laser microscope (Zeiss, Germany), and fluorescence intensities were measured using the Imaris (BitPlane Scientific Software, Germany) imaging software. Statistical analyses of fluorescence intensity differences were performed using Prism GraphPad ver. 6.01 (GraphPad Software, Inc., USA).
[0114] Assay of cell protection from virus infection using rabbit anti- SCARB2 polyclonal sera: Antibody-mediated SCARB2 blocking assays were also performed on live cells to assess its effect on cellular infection. Overnight seeded NIH/3T3 cells (1x104 cells per well in 96-well plates) were incubated with two-fold serial dilutions (1 :20 to 1 :640) of rabbit polyclonal sera raised against either mouse or human SCARB2 proteins for 1 hour at 37° C. Cells were subsequently inoculated with 100 MOI EV71 :TLLmv or clone-derived virus mutants CDV:BS[M-P1] and CDV:BSVPl[K98E/E145A/L169F] for 1 hour at 37° C. Cells were washed twice in PBS prior to replacement with fresh DMEM (1 % FBS). Cells were observed daily for signs of CPE, and infected cell culture supematants were harvested at 3 days post-infection (dpi). Supematants were subjected to virus titration with prior virus disaggregation process by vigorous vortexing for 15 minutes at room temperature in 1 % sodium deoxycholate, as previously [6, 71 ]. Virus titers were enumerated with the Reed and Muench method [61] and reported as CCID50/ ml with the Infectivity Calculator [62] .
EXAMPLE 10
Transfection of EV7LBS Genomic RNA into Mouse Neuronal Neuro-2a and Fibroblast NIH/3T3 Cells Generate Viable Virus Progeny
[011O] Murine fibroblast NIH/3T3 and neuroblastoma Neuro-2a cells were previously demonstrated as non-permissible to EV71:BS infection, while Vcro cells are (above or [71]). Two strains, EV7 Ί iTLLm. and EV71;TLLmv, both derived from EV71.-BS successfully entered and replicated within these murine cells. To determine whether the EV71:BS genome can replicate in these non-permissible cells, genomic RNA from EV7J:BS was extracted and transfected into Vero, NIH/3T3, and Neuro-2a cells. Similarly, genomic RNA from EV71:TLLm and EV71:TLLmv were transfected into these three cell lines for comparison. To assess the viability of the virus progeny generated, transfection supematants were subsequently re- inoculated onto fresh cells (Figure 15A).
[Oi l I ] Genomic RNA transfection of all three virus strains into Vero cells resulted in lytic cytopathic effects (CPE) in the transfected cell monolayer (Figure 15B). Viral antigen expression was also observed in dead cells (Figure 15C), indicating successful virus replication. Similar results were observed from transfection of either EV71:TLLm or EV71:TLLmv viral RNA into ΝΓΗ/3Τ3 and Neuro-2a cell monolayers (Figures 1 B and 15C). On the other hand, transfection of EV71 :BS RNA into NIH/3T3 and Neuro-2a cells led to death of some cells that exhibited viral antigen expression, but did not result in full CPE of the cell monolayer. Further passage of EV7J:BS transfection supematants from both ΝΓΗ/3Τ3 and Neuro-2a cells onto fresh Vero cells led to induction of full lysis of the cell monolayer (Figure 15D) and detection of viral antigens in dead cells (Figure 15E). However, passage of the transfection supernatants onto fresh NIH/3T3 cells yielded neither CPE (Figure 15D) nor viral antigen expression (Figure 15E).
EXAMPLE 11
The Capsid-Encoding PI Region of Mouse Cell Line- Adapted EV71;TLLm Is Responsible for Successful Virus Entry into Murine NIH/3T3 and Neuro-2a Cells
[Oil 2] The previous analysis suggests that the ca sid protein of EV71:TLLm and EV7 ] :TLLmv may be responsible for successful entry into NIH/3T3 and Neuro-2a cells )above or [71]). To confirm this, full-length cDNA clones of EV71:BS genome were generated by standard reverse genetics. The PI (capsid) region of the full-length cDNA clone of EV71 :BS was subsequently replaced with the genetic sequence of EV71 :TLLm PI to generate a chimeric plasmid clone (Figure 16A). The EV71:BS cDNA clone was transfected into Vero cells to generated clone-derived virus (CDV:BS). Similarly, the chimeric clone was transfected to generate CDV:BS[M-P1] that exhibits the capsid protein of EV71 :TLLm and expresses the nonstructural proteins of EV71.-BS. These CDV were re-inoculated onto various cell lines to assess the infection phenotype (Figure 16B).
[0113] EV71:BS clone-derived virus (CDV:BS) induced CPE in Vero cells but not ΝΓΗ/3Τ3 and Neuro-2a cells, while CDV:BS[M-P1] induced CPE in all three cell lines at 48 hours post- inoculation (hpi) (Figure 16C). Murine cells infected with CDV:BS[M-P1], but not with CDV:BS, resulted in detection of viral antigens in dead cells (Figure 16D). To assess the production and release of viable virus progeny in the first passage (PI), clarified culture supernatants from infected cells were re-inoculated onto fresh monolayers of the same cell line, and viral yields were measured at 72 hpi. Passage of both CDV:BS and CDV:BS[M-P1] onto Vero cells exhibited high virus titers, and a significant titer increase was observed after further passage (P2) (Figure 16E). Meanwhile, passage (PI) of CDV:BS[M-P1], but not CDV.BS, produced high virus yield in both NIH/3T3 and Neuro-2a cells (Figure 16F).
EXAMPLE 12
The VP1-L169F Amino Acid Substitution in EV71:BS Capsid Enables the Virus to Enter and Induce Limited Infection in Murine Cells
[0114] The capsid protein of mouse cell-adapted EV71 :TLLm enables entry of EV71.-BS into murine cells, and we are interested in the identity of specific residues that confer this novel phenotype. Previous data on the comparison of polyprotein sequence alignments of EV7EBS and mouse cell-adapted EV71 strains showed multiple amino acid substitutions in VPl and VP2 proteins that may be involved in virus receptor engagement on host cells (above or [71 ]). These residues include VP1 K98E, E145A, and L169F, as well as VP2 S 144T and K149L To determine which of these amino acid substitutions is/are necessary for mouse cell entry, individual mutations resulting in these amino acid substitutions were introduced into the EV71.-BS full-length cDNA clone via standard site-directed mutagenesis (Figure 17A). These modified cDNA clones were independently transfected into Vero cells to generate clone-derived virus (CDV), and harvested supernatants were inoculated onto freshly-seeded Vero, NIH/3T3, and Neuro-2a cells to assess the infection phenotype.
[01 15] Vero cells infected with all the mutant clone-derived viruses (CDV) exhibited 100% CPE, but only those CDV harbouring VP 1 amino acid substitutions - CDV:BSm[K98EJ, CDV;BSVPJ[EJ45AJ} and CDV:BSVP![L169F] - resulted in 100% CPE in Neuro-2a cells (Figures 17B and 17 C). Viral antigen expression was detected in Vero and Neuro-2a cells infected with CDV containing amino acid substitutions in VP 1 (CDV:BSVPi) and VP2 (CDV: BSyP2), but only the ΝΓΗ/3Τ3 cells infected with CDV:BSyP2 exhibited viral antigen expression (Figures 1 D and 17E). Furthermore, Vero cells infected with all the mutant CDV yielded measurable virus titers (Figure 17F), suggesting virus viability, but only CDV:BSvpi[L169F] generated measurable virus titer in the culture supernatant of infected NIH/3T3 and Neuro-2a cells (Figure 17G) as assayed in Vero cells. However, further passage onto healthy murine cells, of culture supernatants from NIH/3T3 and Neuro-2a cells infected with CDV:BSVP1[LJ69FJ, failed to induce infection.
EXAMPLE 13
Efficient Productive Infection in Murine Cells
Requires the Combined Amino Acid Substitutions at VP1
[0116] To assess whether combining the amino acid substitutions in VP 1 and VP2 could also enable EV71:BS to enter mouse cells, full-length genomic cDNA clones of EV7LBS with various combinations of amino acid substitutions (BSVP2[S144T/K149IJ, BSVP1[K98E/E145A] ,
BSVPI[K98E/E145A/L169F] ', and BS[VP1/VP2]) were generated (Figure 18 A). The plasmid clones were independently transfected onto Vero cells, and the resulting supernatant was used to inoculate Vero, NIFI/3T3, and Neuro-2a cells to assess the infection phenotype.
[0117] All the assayed CDV, except CDV:BSVP2[S144T/K149I] , induced CPE in Vero and
Neuro-2a cells (Figure 18B). Viral antigens were also detected in all cells infected with the various CDV, although immunostaining was more prominent in Neuro-2a than NIH/3T3 cells when comparing the murine cell lines (Figure 18C). High virus titer was measurable in the culture supernatants of Vero cells infected with all the CDV (Figure 18D), but only CDV:BSypj[K98E/E145A] and CDV:BSVP,[K98E/E]45A/L169FJ yielded measurable viral titers in the culture supernatant of infected NIH/3T3 and Neuro-2a cells (Figure 18E), as assayed in Vero cells.
EXAMPLE 14
EV7I:BS Virus with the Combined Amino Acid Substitutions at VP1 K98E, E145A, and L169F Could Be Successfully Passaged in Mouse Neuro-2a Cells
[0118] Four of the clone-derived virus isolates have so far enabled EV71 :BS to enter and infect cultured mouse cell lines: CDV:BS[M-P1], CD V:BSVpi[L169F],
CD V:BSVPI[K98E/E]45A], and CDV:BSVP![K98E/E145A/L169F] . To identify which of these
CDV could stably infect mouse cells for multiple cycles, virus supernatants were passaged twice in the same cell line, i.e. from Neuro-2a to fresh Neuro-2a cells. Infection was monitored by assessment of CPE induction and viral antigen expression, and production of viable virus progeny.
[01191 Only CDV:BSyP1[K98E/E145A/L169F] and CDV:BS[M-P1] could be successfully passaged consecutively in Neuro-2a cells as demonstrated by detection of viral antigens (Figure 19A) and measurable virus titers (Figure 19B). Positive staining was observed in both passage No. 2 and 3, and an increase in vims titer was recorded in passage No. 2 compared to the first passage. On the other hand, only CDV:BS[M-P1] was able to induce expression of viral antigens in NIH/3T3 cells, (Figure 19 A), but no viable virus progeny was detected. Genomic sequencing of CDV:BSVP1[K98E/E145A/L169F] derived from the third passage in Neuro-2a cells exhibited no change in the introduced amino acid mutations (Figure 19C).
EXAMPLE 15
The Mouse Cell Line- Adapted Strain
EV71:TLLmv Binds SCARB2 Protein Both In Vivo and In Vitro
[0120] EV71 was recently demonstrated to utilize Scavenger Receptor Class B Member-2
(SCARB2) protein as its receptor for host cell entry [47]. To confirm whether the mouse cell line-adapted EV71 strains also utilize SCARB2 during infection of mouse cells, competitive virus binding assays were performed. Firstly, NIH/3T3 and Vero cells grown overnight in
Teflon-coated slides and fixed gently with 4% paraformaldehyde were incubated with rabbit sera against mouse SCARB2 protein (mSCARB2) prior to in vitro binding with live EV71:TLLmv. Bound cells were fluorescently detected using pan-Entero virus monoclonal antibodies, and the fluorescence intensity was quantified. Pre-incubation of ΊΗ/3Τ3 cells with the anti-mSCARB2 sera resulted in significant reduction of EV71:TLLmv binding (Figure 20A), which was not observed when cells were pre-incubated with nonspecific serum (NSP). Similar results were observed using Vero cells (Figure 20B).
|0121] In the second experiment, live EV71: TLLmv was incubated with recombinant soluble SCARB2 proteins prior to inoculation onto seeded NIH/3T3 cells, and infection was assessed by fluorescence tagging of bound pan-Enterovirus monoclonal antibodies. Pre-incubation of virus with soluble mSCARB2 reduced the severity of cellular infection in a dose-dependent manner (Figure 20C). Similar results were obtained when using human SCARB2 (hSCARB2) protein in the pre-incubation (Figure 20D).
EXAMPLE 16
Cellular Infection with EV71 :TLLmv Is Blocked by
Pre-incubation of Mouse Cells with Serum Raised Against SCARB2 Protein
10122] hi order to assess whether cellular infection is reduced by blocking the interaction of EV71 :TLLmv with SCARB2, seeded NIH/3T3 cells were incubated with various dilutions of SCARB2 protein antiserum prior to inoculation with live EV71 :TLLmv, and infection was assessed by measuring the titer of live virus progeny. Pre-incubation of cells with low dilutions of hSCARB2 antiserum (1 :20 to 1 :80) resulted in significant dose-dependent reduction of virus titer compared with control (Figure 20E). Similar results were obtained when cells were pre- incubated with mSCARB2 antiserum (Figure 20F).
EXAMPLE 3 7
The CDV:BS[M-P1 ] and CDV:BSVP1[K98E/E145A/L169FJ Vmze Murine SCARB2 Protein as Their Functional Receptor for Entry into Murine Cells
[01 231 Both CDV:BS[M-P1] and CDV:BSVP1[K98E/E145A/L169F] stably infect mouse
Neuro-2a cells. In order to determine whether these CDV, like the mouse cell-adapted
EV71 :TLLmv strain, also utilize mSCARB2 for virus entry and uncoating, Neuro-2a cells were incubated with mSCARB2 antiserum prior to infection with the CDV mutants. Dose-dependent reduction of lytic CPE was observed in cells infected with either
CDV:BSVpi[K98E/E145A/L169F] (Figure 21A) or CD V:BS[M-P1] (Figure 21B). Titration of culture supernatants at 7 days post-infection (dpi) reveal no significant difference in
CDV:BS¥P![K98E/E145A/L169F] virus titer in cells pre-incubated with. SCARB2 antiserum compared to controls (Figure 21 C). On other hand, significant virus titer reduction was detected in CDV:BS[M-P1] -infected cells pre-incubated with sera with respect to controls (Figure 2 ID).
EXAMPLE 18
Materials and Methods for Example 19
[0124] Animal model: To determine the animal infection phenotype of the mouse cell- adapted strains (EV71 ;TLLm and EV71:TLLmv), 5-6-day old Balb/c mice were infected with 106 CCID50 of the virus and observed for symptoms of disease and neurological complications. The animals were followed up for a maximum of 28 days, after which the animals were sacrificed and sera were collected for detection of EV71 -specific antibodies.
EXAMPLE 19
Neuro- Virulence Study of Mouse Cell Line- Adapted
EV71 (EV71:TLLm and EV71:TLLmv) In Baib/c Mice
[0125] Of the immuno-competent animals infected with E V71 :TLLm (n = 7), two died (29%) of severe and persistent (> 24 hours) paralysis at 8 days post-infection (Figure 13 A). Of the other surviving mice, 5 (5/7, 71.4%) exhibited tremors and ataxia, 5 exhibited paresis in either one or both hind limbs, and 4 (4/7, 57.1 %) exhibited temporary paralysis in either one or both hind limbs. On the other hand, animals infected with EV71 :TLLmv exhibited a more severe clinical manifestation of the disease. Nine out of ten (90%) infected animals succumbed to the disease within 8 days of infection (Figure 13 A), with 6 of the 9 (66.7%) deaths occurring within the fourth day post-infection. Other symptoms presented include tremors (5/10, 50%), paresis in either one or both hind limbs (6/10, 60%), and paralysis in either one or both hind limbs (5/10,
50). While there seems to be no difference in the body weights of mice infected with
EV7 Ί :TLLm compared to mock-infected animals, mice infected with EV71:TLLmv exhibited a drastic reduction in body weight within the first 10 days of infection (Figure 13B). More interestingly, we observed a novel symptom in EV71 -infected mice, whereby the paralyzed animals (Figure 14A, arrow) presented with tachypnea with prominent subcostal recession.
Further, 6 of the 9 (66.7%) fatalities presented this symptom prior to euthanasia. Upon necropsy, we also observed failure of the lungs to collapse upon opening of thoracic cavity (Figure 14B, arrows), a normal procedure in necropsy when collecting lung and heart tissues, suggesting the existence of pulmonary edema. Histological examination of the tissues revealed features of pulmonary edema and hemorrhage in the alveolar spaces of the lungs (Figure 14C), and higher magnification images show the present of homogenous proteinaceous material (Figure 14D, arrows).
[0126] This Example is also performed using immuno-compromised mice, such as NSG mice. Similar results are obtained except that severity of disease is greater and the mortality rate is higher.
EXAMPLE 20
Screening Candidate Anti-EV71 Compounds
[0127] High through-put in vitro screening of candidate anti-EV71 compounds is performed using the mouse ΝΓΗ/3Τ3 cell line which has been shown to be susceptible to cytolytic infection by EV71 :TLLm or EV71:TLLmv virus strains. The selected promising compounds from the in vitro screening are then in vivo tested in the animal model. To accomplish the in vivo screening, a standardized (based on statistical calculation) number of BALB/c mice are infected with a standardized titer of the virus strains taken from a standardized stock of mouse cell line-adapted EV71 strains (EV71 :TLLm and EV71 :TLLmv) that is prepared, titrated and kept in a deep freezer (-80°C). The candidate anti-EV71 compound is administered to the infected mice at various standardized dosages either before appearance of illness for assaying a potential preventive effect of the candidate compound or after onset of illness for assaying a potential therapeutic effect of the candidate compound.
EXAMPLE 21
Materials and Methods for Examples 22-25
[0128] Mouse and virus strains: Adult BALB/c mice were purchased from InVivos (Singapore), and mated to obtain pups. EV71 strains used for inoculation included EV71.-BS, EV71 :TLLm, and EV71:TLLmv, whose details and characteristics have been described herein.
[0129] Ethics statement: The animal procedures were approved by the Institutional Care and Use of Animal Committee (IACUC) of Temasek Lifesciences Laboratory (approval no. TLL-14- 023). Infected animals that became moribund were euthanized by injection with 90 mg/kg pentobarbitone via the LP. route. Neurologic examination was performed following the guidelines and standard procedures set by The Institutional Care and. Use of Animals Committee (IACUC) of University of California San Francisco. Criteria for euthanasia included previously set guidelines [34]: (1) loss of > 20% maximum recorded body weight. (2) paralysis lasting >48 h, (3) absence of feeding or inability to feed, (4) inability to self-right, and (5) altered state of consciousness presenting as either stupor or coma. Pups were observed for 28 days total, and animals that survived throughout this period were euthanized by LP. injection of pentobarbitone.
[01301 Animal handling and infection: Groups of eight mice of varying age (6, 14, 21, or 28 days old) were inoculated, with EV71:TLLmv (dose 106 CCID5o) either by LP. or I.M. injection. To determine the optimum dose of EV71:TLLmv, groups of 6-day old pups (n=8 per group) were challenged with varying doses of virus (106, 105, 104, 103, or 102 CCID5o) via the LP. route. Infected animals were observed twice daily for disease presentation during the first week postinfection. Both moribund animals and those that survived the observation period were euthanized as described above. Terminal blood collection was performed via cardiac puncture using a 26G needle.
[0131] Necropsy, gross pathological observations, and tissue collection: Euthanized animals were necropsied using standard protocols to harvest organs. Gross pathologic examination was also performed and photographs were taken with IACUC approval. Lungs were superficially flushed twice with sterile PBS, and then blotted dry on filter paper prior to measuring the wet weight. Harvested organs for histological studies were stored in 1.0% neutral buffered fomialin (NBF) for 1 week at 4° C.
[0132] Determination: of tissue viral load. Frozen tissues were macerated using a Teflon pestle and reconstituted in lml DM.EM (1% FBS). Samples were then mixed for lh and centrifuged twice (20 g, 30 min, 4° C) to remove tissue debris and obtain clarified virus. The virus sample was disaggregated in 1% sodium deoxycholate [88] prior to ten-fold serial dilution and transfer onto N1H/3T3 cells. Infected cells were observed daily for cytopathic effects (CPE), and cells were stained with pan-enterovirus monoclonal antibody (Merck Millipore, USA) [88]. Vims titers were enumerated, and reported as CCID50 per g tissue.
[0133] Tissue processing for histological analyses: Fixed tissues were dehydrated in a series of increasing concentrations of 70%, 95% and 100% ethanol. Tissues were incubated in two changes of alcohol and three changes of Histoclear II (Electron Microscopy Sciences, USA), and finally infiltrated with four changes of melted paraffin wax. All incubations were performed for 1 h at room temperature with gentle rocking at 100 rpm. Paraffin infiltrations were performed in an oven set at 65° C. Paraffin-embedded tissue blocks were sectioned (5 pm) using a microtome, loaded onto poly-lysine-coated glass slides, dried overnight at 42° C, and then stored at room temperature until further use.
[0134] Staining of tissue sections: Tissue sections were de-waxed by incubation in two changes of Histoclear II and then slowly rehydrated in decreasing alcohol concentrations of 100%, 95%, 70%, and 50%. Slides were incubated in PBS for lOmin prior to staining. Hematoxylin and eosin (H &E) staining was performed by first flooding the slides with Harris' hematoxylin (Sigma Aldrich, USA.) and incubating at room temperature (RT) for 15 min. The slides were then rinsed in water, de-stained in 1% acid alcohol (95% ethanol, 1% HC1), dipped in 0.2% NH40H, and rinsed in water for 10 min prior to counterstaining in eosin solution. The slides were next de-stained in 95%» ethanol, dehydrated by three changes of absolute alcohol and two changes of Histoclear Π. Tissues were finally set in DPX mounting fluid (Sigma Aldrich, USA).
[0135] Immunohistochemistry'. Following de-waxing and rehydration, slides were subjected to heat-induced antigen retrieval by incubation in a histology-grade microwave oven and citrate buffer (pH 6.0) for 30 min at 96° C. Slides were allowed to cool to RT over 3h and were subsequently blocked with 5%o normal pig serum for 1 h at RT. Without further washing, the slides were then incubated at 4° C overnight in rabbit serum containing polyclonal antibodies against EV71 (a generous gift from Dr. Hiroyuki Shimizu of NIID, Japan). The slides were then washed 5 times in Tris-buffered saline (pH 7.4), 0.05% Tween-20 (TBS-T), and rinsed twice in TBS prior to quenching endogenous peroxidases by addition of 3% H202 for 1 h at RT. Slides were subsequently washed twice in TBS prior to incubation with swine-anti rabbit ig-HRP (Dako Cytomation, Denmark) for Ih at RT. After washing, slides were incubated in diam inobenzidine (DAB) substrate, and counterstained with hematoxylin.
[0136] Mapping viral antigens and virus-induced lesions in tissue sections: Template images of representative coronal sections of the mouse brain were downloaded from www dot brainstars dot org [89]. These images are free to be used and modified under license from the Creative Commons of Japan. The observed lesions and viral, antigens were marked onto template images. Affected brain regions were identified using the mouse brain atlas of coronal sections (www dot mouse dot brain-map dot org slash static slash atlas) [90]. Similarly, a representative coronal section of the thoracic spinal cord was used as the template for spinal cord maps. Areas depicting the presence of viral antigens and virus-induced lesions were then marked onto the template images.
[0137] Measurement of serum catecholamine levels: Blood samples were collected by cardiac puncture of moribund animals during necropsy. Serum was obtained by centrifuging coagulated blood, samples at 3000 g, 4° C, for 30 min, then stored at -20° C until determination of catecholamine levels using the 2-CAT (A-N) ELISA kit (Labor Diagnostika Nord, Germany) according to the manufacturer's protocols. (0138] Statistical analyses: All graphs were created and statistical analyses performed using GraphPad Prism (version 6.01 ) for Windows (GraphPad Software, USA, www dot graphpad dot com).
[0139] Comparison of the infection phenotypes induced by viral strains EV71 :TLLm and EV71 :TLLmv: Groups of 6-day old BALB/c pups were inoculated with a 106 CCID50 dose of EV7L-BS, EV71:TLLm, or EV71:TLLmv via the intraperitoneal (I.P.) or intramuscular (I.M.) route (n=10 mice per group). Animals were observed twice daily for signs of disease during the first week post-inoculation and euthanized whe critical signs were detected as already described.
[0140] Measurement of neutralizing antibody levels in sera from infected mice: Blood samples were collected by cardiac puncture at necropsy before being clotted at room temperature and the serum obtained by centrifugation for 20min at 3000g, 4° C. Samples were stored at -20° C until further analysis. Random samples of the frozen stocks were assayed for neutralizing antibody titers. Two-fold serial dilutions of serum (1 :20 to 1 : 1280) were prepared in 96-well plates and mixed with 100 CCID5o virus. The mixture was incubated for 1 h at 37° C prior to addition of NIH/3T3 cells (6,000 cells/well). Plates were incubated at 37° C for several days and observed for CPE between days 4-10. Neutralizing antibody titers were determined using the Reed and Muench method (reported as units per ml sera).
EXAMPLE 22
Infection Dynamics of Modifi ed EV71 Strains in Murine Hosts
[0141] Current animal models of enterovirus 71 (EV71 )-induced neurological disease and pathology only partially replicate the human disease. We therefore aimed to develop a clinically authentic model of disease pathology using the mouse cell (NIH/3T3)-adapted virus strains EV71:TLLm and EV71 :TLLmv, which can productively infect both rodent and primate cell lines [88]. First, the relative virulence of EV71 :TLLm and EV71 :TLLmv compared with the parental strain EV71:BS was assessed by assessing disease pathology in 1-week old BALB/c mice infected with virus via the intraperitoneal (LP.) route. While seroconversion was observed in all the inoculated animals, only mice infected with either EV71 :TLLm or EV77 ;TLLmv progressed to lethal disease (Figures 22a and 22b). Similarly, when the adapted strains were administered via the alternative intramuscular (I.M,) route, these were again associated with reduced host survival relative to the parental strain EV71:BS (57% survival; Figure 22c). When the I.P. and I.M. infection routes were considered together, the median survival time after inoculation was 4 days post-infection (DPI) for EV71:TLLmv infection and 7 DPI for EV71:TLLm infection (x2 = 6.840; p - 0.0089). Together, these data indicated that mouse cell-adapted viral strain EV71 :TLLmv was associated with the greatest levels of lethality, and was therefore used in all subsequent experiments.
[01421 The optimal virus dose, inoculatio route, and mouse age to use for further model development were next assessed. First, it was confirmed that disease severity in EV71:TLLmv- infected mice was dependent on virus dose; minimum survival rate was observed in animals inoculated with a median ceil culture infectious dose (CCID50) of 106 (Figure 23a) and the median humane endpoint (HD50) was equivalent to 3.98 x W CCID50 (Figure 23b). The influence of animal age and infection route on host survival was then evaluated; the survival curves of 1 week-old mice injected with EV71 :TLLmv were not significantly affected by inoculation route (Figure 23 c), but young animals exhibited consistently poorer survival than did older animals, irrespective of vims injection site (Figure 23d). Only in older animals was it possible to discern any effect of infection route on disease severity; while 3 week-old mice were completely resistant to LP. infection, some animals did not survive virus injection via the I.M. route (Figures 24a and 24b). Seroconversio was detected in all mice that survived the infection, including those that did not exhibit any signs of disease (Figures 24c, 24d and 24e). These data demonstrated that EV71:TLLmv induces acute and severe i fection that is lethal in mice aged 1-3 weeks old. Of the conditions tested here, disease severity was greatest in 1 week-old mice injected with a virus dose of 106 CCID50 either into the peritoneal cavity or muscle tissue.
EXAMPLE 23
Disease Progression in EV71: Tl mv-Infected Mice
[0143] The majority of 1-week old mice inoculated with EV71 :TLLmv succumbed to disease and exhibited myriad clinical signs of neurological illness. Infected animals exhibited ataxia, localized or whole-body tremors, unsteady gait, and limb paresis and paralysis either transiently or persisting until the time of euthanasia. Based on clinical presentation, the sick animals could be readily categorized into four groups (Table 6). Survivors included mice that did not appear moribund at any point during the observation period of 28 days. Class I animals presented after just 3-7 DPI with severe signs including an inability to self-right and either stupor or coma. All mice in this group exhibited spastic limb paresis and/or paralysis (fore-limbs, hind-limbs, or both), but while some animals were devoid of respiratory symptoms {Class IB), others were additionally characterized by signs of respiratory distress, including tachypnea, hiccupping, gasping, and subcostal recession {Class IA). Hallmark observations in EV71 :TLLinv-mfecied mice presenting Class IA signs of disease were made by video comprising two video clips of two different Class IA mice. Both animals were unable to self-right and were in a state of coma. Severe respiratory distress presenting as tachypnea with subcostal recession was evident in the first mouse. Gasping, subcostal recession and a frothy fluid emanating from the nostrils were seen in the second mouse. Hallmark observations in EF7/. LLmv-infected mice presenting Class IB signs of disease were made by a video of one Class IB mouse. The animal was unable to self-right and was in a state of stupor. Ipsilateral paralysis of the right limbs and persistent tremor of the left hind-limb were also observed. Finally, Class II mice presented after 7 DPI with signs of infection including persistent flaccid paralysis of the limbs (>48h. duration) (Figure 23e) together with severe weight loss (>20% max. body weight). In all disease classes, some of the infected animals displayed hairless lesions or bald spots on their backs that persisted for a few days (Figure 23f). The majority of pups inoculated LP. with EV7I :TLLmv were categorized into Class I (Figure 23g); Class IA animals comprised 19.3% (n=l l ; patent respiratory signs), while Class IB animals comprised 43.9% (n=25; no overt respiratory signs). Class 114 animals represented just 12.3% (n=7) of the infected pups, and Survivors constituted 24.5% (n=14) of all infected mice. A similar pattern of distribution between disease categories was observed in pups inoculated via the I.M. route (Figure 23h). Together, these data indicated that mice infected with EV7I:TLLmv exhibit variable incidence and severity of both neurological and respiratory symptoms that reflect the full spectrum of disease observed in human patients.
TABLE 6
Clinical Features of iiF7A ZZwv-Infected
BALB/c Mice at the Time of Euthanasia
Class IA Class IB Class II Sunnvors3
Time to onset of signs Within 3-5 Within 3-7 > 7 N/A
[days post-infection
(DPI)]
Level of consciousness Stuporb / Comac Stuporb Active Active
Weight loss < 20% body < 20% body > 20% body None or < 20%
weight weight weight body weight
Limb function (>48 h) Spastic limb Spastic limb Flaccid limb Normal
paresis / paresis / paralysis
paralysis paralysis
Breathing function Tachpnea / Regular Regular Regular
gasping / hiccupping
Cardiac function Tachycadia Tachycardiad / Regular Regular
Regular
Limb tremors May be present May be present Absent Absent
a Animals were assessed at the end of the observation period (28 DPI)
b Animal was unable to self-right, but responded to physical stimulation of the toes.
c Animal was unable to self-right and did not respond to physical stimulation of the toes.
d Tachycardia was observed in 35% of Class IB mice
EXAMPLE 24
Neurogenic Pulmonary Edema in Mice Presenting Class IA Signs
[01.44] Whether the respiratory distress observed in Class IA mice was a sign of virus- induced pulmonary edema (PE) was further investigated. Comparison of gross lung pathology between Class IA, Class IB, and Class II mice revealed that Class IA lungs were swollen, incompletely collapsed at necropsy (Figures 25a-25d), and displayed increased wet weight relative to lungs from other groups (Figure 22E). Comparison of lung tissue sections from sham- inoculated (Figure 25f) and Class IA lungs revealed focal areas of hemorrhage and accumulation of proteinaceous and erythrocyte- filled fluid in the alveolar spaces of the infected animals only (Figure 25g). These pathological features were absent from the lungs of Class IB and Class II mice (Figures 25h and 25i). Furthennore, we found no evidence of inflammatory infiltrate or viral antigens in the lungs collected from any group of mice (Figure 26a). Similarly, sto chemical analyses of the cardiac muscles in each class of infected mice were also unable to uncover any evidence of an inflammatory infiltrate, cardiac muscle necrosis, or viral antigens (Figure 26b). Together, these data demonstrated that the respiratory distress evident in Class IA mice could not be attributed to either pneumonitis or congestive heart failure. We therefore sought to determine whether the PE observed in this group was of neurogenic origin, so we next measured serum levels of catecholamines to determine whether neurotransmitter concentrations were modulated in EV7I ;TLLmv-infected mice with respiratory signs (Class IA). Using this approach, we observed that blood concentrations of both adrenaline (epinephrine) and noradrenaline (norepinephrine) were significantly higher in Class IA mice than those detected in either Class II mice or mock-infected animals (Figures 25j and 25k). These data strongly indicated that Class IA mice exhibited EV71 -induced neurogenic pulmonary edema (NPE) prior to death. EXAMPLE 25
EV71 :TLLmv Viral Neurotropism in Class IA, Class IB, and Class //Mice
[0145] The distribution of EV71 :TLLmv and virus-induced lesions in the brains and spinal cords of animals from each disease group were next assessed in order to identify factors that might contribute to the selective development of NPE in Class IA mice only. The majority of animals in Class IA. and Class IB exhibited ubiquitous staining of viral antigens (>10 positive neurons detected) and mild pathological lesions (>5 lesions observed) in all of the CNS regions assessed (Table 7). in contrast, only 1 of 5 mice with Class II disease exhibited viral antigens and/or lesions in the sensory cortex, hippocampus, diencephalon, mesencephalon, medulla oblongata, or lumbar spinal cord. We were unable to detect viral antigens in any tissues tested outside of the CNS (except for the skeletal muscles after inoculation via the I.M. route; data not shown).
TABLE 7
CNS Distribution of EV71 Antigens and
Virus-Induced Lesions in Tenninally-Infected BALB/c Mice
Figure imgf000061_0001
Density of viral antigens detected per slide: +, < 10 positive neurons; ++, 10-20 positive neurons; +++, > 20 positive neurons b Percentage of animals exhibiting viral antigens in the specified brain region (n = 5)
c Distribution of pathologic lesions in nervous tissues: +, < 5 lesions; ++, 5-10 lesions; +++, >10 lesions
d Percentage of animals exhibiting lesions in the specified brain region (n = 5)
[0146] When CNS pathology between Class IA and Class IB mice was compared, it was observed that both tissue lesions and viral antigens were localized to the same areas within the hippocampus, diencephalon, mesencephalon, cerebellum, and medulla, but pathology was more severe in animals with Class IA disease (Table 7 and Figures 27a-27d). Indeed, when compared with Class IB mice, animals in Class IA displayed more extensive neuronal degeneration, phagocytosis, and necrosis in CA3 neurons of the hippocampus (Figures 28a and 28b). Class IA mice also exhibited intense viral antigen staining in hypothalamus, accompanied by marked tissue inflammation and neuronal necrosis, whereas these pathological features were limited in Class IB animals (Figures 28c and 28d and Figure 27b). Similarly, Class IA mice also presented features of more severe virus-induced pathology and viral antigen intensity in the ventro- posterior complex of the thalamus (Figures 28e and 28f and Figure 27b), the mesencephalon- associated tissues including the periaqueductal gray (PAG) matter, midbrain reticular area, and motor-related superior colliculus (Figures 28g and 28h and Figure 27c), as well as in the Purkinje cells and dentate nucleus of the cerebellum (Figures 28i and 28j, Figure 27d and Figure 29a.
[0147] In both disease groups (Class IA and Class IB), the most extensive distribution of viral antigens and pathological lesions involving neuronal damage and tissue inflammation were detected in the medulla oblongata (Figures 28k and 281), particularly in the motor-related areas of the intermediate reticular nuclei (IRN), parvicellular reticular nuclei (PARN), and spinal nucleus of the trigeminal nerve (sptV) (Figure 27d and Figure 29b). However, only Class IA mice exhibited viral antigens and tissue lesions in the ventral and dorsal regions of the medullary reticular nucleus (MdRN), the nucleus of the solitary tract (NTS) and area prostrema (AP) (Figures 29b and 29c). For coxiiparison, representative images of the hippocampus, hypothalamus, thalamus, midbrain, cerebellum, and medulla from mock-infected mice are also shown (Figures 30a-30f). In contrast, Class IA and Class IB mice did not differ with respect to the distribution, localization or extent of tissue lesions or viral antigen staining within the motor cortex, somatosensory cortex, pons or ventral horns of the spinal cord gray matter (Figures 28m and 28n, Figures 27a-27c and Figures 31 a-31e), consistent with the concept that NPE is caused by virally triggered damage to specific brain regions rather than a uniform increase in EV71- induced pathology across all tissues.
[0148] The use of the terms "a" and "an" and "the" and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms "comprising," "having," "including," and "containing" are to be construed as open-ended terms (i.e., meaning "including, but not limited to,") unless otherwise noted . Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as") provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.
[0149] Embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.
BIBLIOGRAPHY
[0150] 1. Alexander IP, Baden L, Pallansch MA, Anderson LJ (1994) Enterovirus 71 infections and neurologic disease-United States, 1977-1991. J Infect Dis 169: 905-908.
[0151] 2. Melnick JL (1996) Enteroviruses: Polioviruses, Coxsackieviruses, Echoviruses, and Newer Enteroviruses. In: Fields B N KDM, Howley P M, et al.., editor. Fields Virology. Philadelphia.: Lippincott- Raven. 655-712.
[0152] 3. Bible JM, Iturriza-Gomara M, Megson B, Brown D, Pantelidis P, et al. (2008) Molecular epidemiology of human enterovirus 71 in the United Kingdom from 1998 to 2006. J Clin Microbiol 46: 3192-3200.
[0153] 4. Ooi MH, Wong SC, Lewthwaite P, Cardosa MJ, Solomon T (2010) Clinical features, diagnosis, and management of enterovirus 71. Lancet Neurol 9: 1097-1 105.
[0154] 5. Solomon T, Lewthwaite P, Perera D, Cardosa MJ, McMinn P, et al. (2010) Virology, epidemiology, pathogenesis, and control of enterovirus 71. Lancet Infect Dis 10: 778— 790. [0155] 6. Schmidt NJ, Lennette EH; Ho HH (1974) An apparently new enterovirus isolated from patients with disease of the central nervous system. J infect Dis 129: 304-309.
[0156] 7. Blomberg J, Lycke E, Ahlfors K, Johnsson T, Wolontis S, et al. (1 74) Letter: New enterovirus type associated with epidemic of aseptic meningitis and-or hand, foot, and mouth disease. Lancet 2: 1 12.
[0157] 8. Kennett ML, Birch CJ, Lewis FA, Yung AP, Locarnini SA, et al. (1974) Enterovirus type 71 infection in Melbourne. Bull World Health Organ 51 : 609-615.
[0158] 9. Deibel R, Gross LL, Collins DN (1975) Isolation of a new enterovirus (38506). Proc Soc Exp Biol Med 148: 203-207.
[0159] 10. Hagiwara A, Tagaya I, Yoneyama T (1978) Epidemic of hand, foot and mouth disease associated with enterovirus 71 infection. Intervirology 9: 60-63.
[0160] 11. Chumakov M, Voroshilova M, Shindarov L, Lavrova 1, Gracheva L, et al. (1979) Enterovirus 71 isolated from cases of epidemic poliomyelitis-like disease in Bulgaria. Arch Virol 60: 329-340.
[0161] 12. Shindarov LM, Chumakov MP, Voroshilova MK, Bojinov S, Vasilenko SM, et al. (1979) Epidemiological, clinical, and pathomorphologies characteristics of epidemic poliomyelitis-like disease caused by enterovirus 71. J Hyg Epidemiol Microbiol Immunol 23: 284-295.
[0162] 13. Nagy G, Takatsy S, Kukan E, Mihaly I, Domok I (1982) Virological diagnosis of enterovirus type 71 infections: experiences gained during an epidemic of acute CNS diseases in Hungary in 1978. Arch Virol 71 : 217-227.
[0163] 14. Chonmaitree T, Menegus MA, Schervish-Swierkosz EM, Schwalenstocker E (1981) Enterovirus 71 infection: report of an outbreak with two cases of paralysis and a review of the literature. Pediatrics 67: 489-493.
[0164] 15. Samuda GM, Chang WK, Yeung CY, Tang PS (1987) Monoplegia caused by Enterovirus 71 : an outbreak in Hong Kong. Pediatr Infect Dis J 6: 206-208.
[0165] 16. Gilbert GL, Dickson KE, Waters MX Kennett ML, Land SA, et al. (1988) Outbreak of enterovirus 71 infection in Victoria, Australia, with a high incidence of neurologic involvement. Pediatr Infect Dis J 7: 484^88.
[0166] 17. Hayward JC, Gillespie SM, Kaplan KM, Packer R, Pallansch M, et al. (1989) Outbreak of poliomyelitis-like paralysis associated with enterovirus 71. Pediatr Infect Dis J 8: 611-616.
[0167] 18. Tagaya I, Takayama R, Hagiwara A (1981 ) A large-scale epidemic of hand, foot and mouth disease associated with enterovirus 71 infection in Japan in 1978. Jpn J Med Sci Biol 34: 191-196.
[0168] 19. Ishimaru Y, Nakano S, Yamaoka K, Takami S (1980) Outbreaks of hand, foot, and mouth disease by enterovirus 71. High incidence of complication disorders of central nervous system. Arch Dis Child 55: 583-588.
[0169] 20. Hagiwara A, Yoneyama T, Hashimoto I (1983) Isolation of a temperature- sensitive strain of enterovirus 71 with reduced neurovirulence for monkeys. J Gen Virol 64 (Pt 2): 499-502.
[0170] 21. Lum LC, Wong KT, Lam SK, Chua KB, Goh AY, et al. (1998) Fatal enterovirus 71 encephalomyelitis. J Pediatr 133: 795-798. [0171] 22. Lum LC, Wong KT, Lam SK, Chua KB, Goh AY (1998) Neurogenic pulmonary oedema and enterovirus 71 encephalomyelitis. Lancet 352: 1391.
[0172] 23. Chang LY, Huang YC, Lin TY (1998) Fulminant neurogenic pulmonary oedema with, hand, foot, and mouth disease. Lancet 352: 367—368.
[0173] 24. Yan JJ, Wang JR, Liu CC, Yang HB, Su IJ (2000) An outbreak of enterovirus 71 infection in Taiwan 1998: a comprehensive pathological, virological, and molecular study on a case of fulminant encephalitis. J Clin Virol 17: 13-22.
[0174] 25. Liu CC, Tseng HW, Wang SM, Wang JR, Su IJ (2000) An outbreak of enterovirus 71 infection in Taiwan, 1998: epidemiologic and clinical manifestations. J Clin Virol 17: 23-30.
[0175] 26. Wang JR, Tsai HP, Chen PF, Lai YJ, Yan JJ, et al. (2000) An outbreak of enterovirus 71 infection in Taiwan, 1998. II. Laboratory diagnosis and genetic analysis. J Clin Virol 17: 91-99.
[0176] 27. China C (2008) Report on the hand, foot and mouth disease outbreak in Fuyang City, Anhui Province and the prevention and control in China. Beijing, China: Office of the World Health Organization, China.
[0177] 28. Yang F, Zhang T, Hu Y, Wang X, Du J, et al. (201 1) Survey of enterovirus infections from hand, foot and mouth disease outbreak in China, 2009. Virol J 8: 508.
[0178] 29. Zeng M, El Khatib NF, Tu S, Ren P, Xu S, et al. (2012) Seroepidemiology of Enterovirus 71 infection prior to the 201 1 season in children in Shanghai. J Clin Virol 53: 285- 289.
[01 9] 30. Zhang Y, Cui W, Liu L, Wang J, Zhao H, et al. (201 1) Pathogenesis study of enterovirus 71 infection in rhesus monkeys. Lab Invest 91 : 1337-1350.
[0180] 31. Arita M, Shimizu H, Nagata N, Ami Y, Suzaki Y, et al (2005) Temperature- sensitive mutants of enterovirus 71 show attenuation in cynomolgus monkeys. J Gen Virol 86: 1391-1401.
[0181] 32. Chen P, Song Z, Qi Y, Feng X, Xu N, et al. (2012) Molecular determinants of enterovirus 71 viral entry: cleft around GLN-172 on VPl protein interacts with variable region on scavenge receptor B 2. J Biol Chem 287: 6406-6420.
[0182] 33. Chen YC, Yu CK, Wang YF, Liu CC, Su IJ, et al. (2004) A murine oral enterovirus 71 infection model with central nervous system involvement. J Gen Virol 85: 69-77.
[0183] 34. Chua BH, Phuektes P, Sanders SA, Nicholls PK, McMinn PC (2008) The molecular basis of mouse adaptation by human enterovirus 71. J Gen Virol 89: 1622-1632.
[0184] 35. Khong WX, Yan B, Yeo H, Tan EL, Lee JJ, et al. (2012) A non-mouse- adapted enterovirus 71 (EV71) strain exhibits neurotropism, causing neurological manifestations in a novel mouse model of EV71 infection. J Virol 86: 2121— 2131.
[0185] 36. Ong KC, Badmanathan M, Devi S, Leong KL, Cardosa MJ, et al. (2008) Pathologic characterization of a murine model of human enterovirus 71 encephalomyelitis. J Neuropathol Exp Neurol 67: 532-542,
[0186] 37. Wang W, Duo J, Liu J, Ma C, Zhang L, et al. (2011) A mouse muscle-adapted enterovirus 71 strain with increased virulence in mice. Microbes Infect 13: 862-870. [01871 38. Wang YF, Chou CT, Lei HY, Liu CC, Wang SM, et al. (2004) A mouse- adapted enterovirus 71 strain causes neurological disease in mice after oral infection. J Virol 78: 7916-7924.
[0188] 39. Yao PP, Qian L, Xia Y, Xu F, Yang ZN, et al. (2012) Enterovirus 71 -induced neurological disorders in young gerbils, Meiiones unguiculatus: development and application of a neurological disease model. PLoS One 7: e51996.
[0189] 40. Borrego B, Novella IS, Giralt E, Andreu D, Domingo E (1993) Distinct repertoire of antigenic variants of foot-and-mouth disease virus in the presence or absence of immune selection. J Virol 67: 6071-6079.
[0190] 41 , Burch CL, Chao L (1999) Evolution by small steps and rugged landscapes in the RNA virus phi6. Genetics 151 : 921-927.
[0191] 42. Stemhauer DA, Domingo E, Holland JJ (1992) Lack of evidence for proofreading mechanisms associated with an RNA virus polymerase. Gene 122: 281-288.
[0192] 43. Biebricher C, Eigen M (2006) What is a Quasispecies. In: Domingo E, editor. Quasispecies: Concept and Implications for Virology. Heidelberg: Springer- Verlag. 1-31.
[0193] 44. Eigen M, Schuster P (1977) The hypercycle. A principle of natural self- organization. Part A: Emergence of the hypercycle. Naturwissenschaften 64: 541-565.
[0194] 45. Eigen M, Biebricher C (1988) Sequence Space and Quasispecies Distribution. In: Domingo E, Holland J, Ahlquist P, editors. RNA Genetics. Boca Raton: CRC Press. 21 1-
[0195] 46. ATCC NIH/3T3 ATCC CRL-1 1658.
[0196] 47. Yamayoshi S, Yamashita Y, Li J, Hanagata N, Minowa T, et al. (2009) Scavenger receptor B2 is a cellular receptor for enterovirus 71. Nat Med 15: 798-801.
[0197] 48. Yamayoshi S, Ohka S, Fujii K, Koike S (2013) Functional comparison of SCARB2 and PSGL1 as receptors for enterovirus 1. J Virol 87: 3335-3347.
[0198] 49. Yamayoshi S, Koike S (201 1) Identification of a human SCARB2 region that is important for enterovirus 71 binding and infection. J Virol 85: 4937-4946.
[0199] 50. Zaini Z, Phuektes P, McMinn P (2012) Mouse adaptation of a sub-genogroup B5 strain of human enterovirus 71 is associated with a novel lysine to glutamic acid substitution at position 244 in protein VP1. Virus Res 167: 86-96.
[0200] 51. Arita M, Ami Y, Wakita T, Shimizu H (2008) Cooperative effect of the attenuation determinants derived from poliovirus sabin 1 strain is essential for attenuation of enterovirus 71 in the NOD/SC!D mouse infection model. J Virol 82: 1787-1797.
[0201] 52. Zaini Z, McMinn P (2012) A single mutation in capsid protein VP1 (Q145E) of a genogroup C4 strain of human enterovirus 71 generates a mouse- virulent phenotype. J Gen Virol 93: 1935-1940.
[0202] 53. Liu CC, Chou AH, Lien SP, Lin HY, Liu SJ, et al. (2011) Identification and characterization of a cross-neutralization epitope of Enterovirus 71. Vaccine 29: 4362-4372.
[0203] 54. Zaini Z, Phuektes P, McMinn P (2012) A reverse genetic study of the adaptation of human enterovirus 71 to growth in Chinese hamster ovary cell cultures. Virus Res 165: 151-156. [0204] 55. Miyamura K, Nishimura Y, Abo M, Wakita T, Shimizu H (2011) Adaptive mutations in the genomes of enterovirus 71 strains following infection of mouse cells expressing human P-selectin glycoprotein figand-1. J Gen Virol 92: 287— 291.
[0205] 56. Lin JY, Chen TC, Weng KF, Chang SC, Chen LL, et al. (2009) Viral and host proteins involved in picornavirus life cycle. J Biomed Sci 16: 103.
[0206] 57. Eigen M (1993) The origin of genetic information: viruses as models. Gene 135: 37^7.
[02073 58. Domingo E, Sheldon J, Perales C (2012) Viral quasispecies evolution. Microbiol Mol Biol Rev 76: 159-216.
[0208] 59. Domingo E, Menendez- Arias L; Holland JJ (3 997) RNA virus fitness. Rev Med Virol 7: 87-96.
[0209] 60. Domingo E (2002) Quasispecies theory in. virology. Journal of Virology 76: 463^65.
[0210] 61. Reed L, Muench H (1938) A simple method of estimating fifty per cent endpoints. The American Journal of Hygiene 27: 493-497.
[0211] 62. Lindenbach BD, Evans MS, Syder AJ, Wolk B} Tellinghuisen TL, et al. (2005) Complete replication of hepatitis C virus in cell culture. Science 309: 623-626.
[0212] 63. Hall T (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41 : 95-98.
[0213] 64. Arnold K, Bordoli L, opp J, Schwede T (2006) The SWISS-MODEL workspace: a web-based environment for protein structure homology modelling. Bioinformatics 22: 1 5-201.
[0214] 65. Guex N, Peitsch MC (1997) SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling. Electrophoresis 18: 2714-2723.
[0215] 66. Bessaud M, Razafmdratsimandresy R, Nougairede A, Joffret ML, Deshpande JM, Dubot-Peres A, Heraud JM, de Lamballerie X, Delpeyroux F, Bailly JL. (2014). Molecular comparison and evolutionary analyses of VP1 nucleotide sequences of new African human enterovirus 71 isolates reveal a wide genetic diversity. PloS one 9:e90624.
[0216] 67. Neculai D, Schwake M, Ravichandran M, Zunke F, Collins RF, Peters J, Neculai M, Plumb J, Loppnau P, Pizarro JC, Seitova A, Trimble WS, Saftig P, Grinstein S, Dhe- Paganon S. (2013). Structure of LIMP-2 provides functional insights with implications for SR- BI and CD36. Nature 504: 172476.
[0217] 68. Liu J, Dong W, Quan X, Ma C, Qin C, Zhang L. (2012). Transgenic expression of human P-selectin glycoprotein ligand-1 is not sufficient for enterovirus 71 infection in mice. Archives of virology 157:539-543.
[0218] 69. Fujii K, Nagata N, Sato Y, Ong KC, Wong KT, Yamayoshi S, Shimanuki M, Shitara H, Taya C, Koike S. (2013). Transgenic mouse model for the study of enterovirus 71 neuropathogenesis. Proceedings of the National Academy of Sciences of the United States of America 110: 14753-14758.
[0219] 70. Lin YW, Yu SL, Shao HY, Lin HY, Liu CC, Hsiao KN, Chitra E, Tsou YL, Chang HW, Sia C, Chong P, Chow YH. (2013). Human SCARB2 transgenic mice as an infectious animal model for enterovirus 71 . PloS one 8:e57591. [0220} 71. Victorio CB, Xu Y, Ng Q, Chow VT, Chua KB. (2014). Phenotypic and genotypic characteristics of novel mouse cell line (NIH/3T3) -adapted human enterovirus 71 strains (EV71 :TLLm and EV71 :TLLmv). PLoS One 9:e9271 .
[0221] 72. Yamayoshi S, lizuka S, Yamashita T, Minagawa H, Mizuta K, Okamoto M, Nishimura H, Sanjoh K, Katsushima N, Itagaki T. Nagai Y, Fujii K, Koike S. (2012). Human SCARB2-dependent infection by coxsackievirus A7, A14, and A16 and enterovirus 71. J Virol 86:5686-5696.
[0222] 73. Wilson T, Papahadjopoulos D, Taber T. (1979). The introduction of Poliovirus RNA into cells via lipid vesicles (Liposomes). Cell 17:77-84.
[0223] 74. Collis PS, O'Donnell BJ, Barton DJ, Rogers JA, Flanegan JB. (1992). Replication of Poliovirus RNA and subgenoniic RNA transcripts in transfected cells. Journal of Virology 66:6480-6488.
[0224] 75. van Der Werf S, Bradley J, Wimmer E, Studier FW, Dunn JJ. (1986). Synthesis of infectious poliovirus RNA by purified T7 RNA polymerase. Proceedings of the National Academy of Sciences of the United States of America 83:2330-2334.
[0225] 76. Nishimura Y, Lee H, Hafenstein S, Kataoka C, Wakita T, Bergelson JM, Shimizu H. (2013). Enterovirus 71 binding to PSGL-1 on leukocytes: VP1-145 acts as a molecular switch to control receptor interaction. PLoS pathogens 9:el 003511.
[0226] 77. Dang M, Wang X, Wang Q, Wang Y, Lin J, Sun Y, Li X, Zhang L, Lou Z, Wang J, Rao Z. (2014). Molecular mechanism of SCARB2-mediated attachment and uncoating of EV71. Protein & cell 5:692-703.
[0227] 78. Wang X, Peng W, Ren J, Hu Z, Xu J, Lou Z, Li X, Yin W, Shen X, Porta C, Walter TS, Evans G, Axford D, Owen R, Rowlands DJ, Wang J, Stuart DI, Fry EE, Rao Z. (2012). A sens or- adaptor mechanism for enterovirus uncoating from structures of EV71. Nature structural & molecular biology 19:424-429.
[0228] 79. Lyu K, Ding J, Han JF, Zhang Y, Wu XY, He YL, Qin CF, Chen R. (2014). Human enterovirus 71 uncoating captured at atomic resolution. J Virol 88:3114-3126.
[0229] 80. Ren J, Wang X, Hu Z, Gao Q, Sun Y, Li X, Porta C, Walter TS, Gilbert RJ. Zhao Y, Axford D, Williams M, McAuley K, Rowlands DJ, Yin W, Wang J, Stuart DI, Rao Z, Fry EE. (2013). Picornavirus uncoatmg intermediate captured in atomic detail. Nature communications 4:1929.
[0230] 81. Shingler KL, Yoder JL, Carnegie MS, Ashley RE, Makhov AM, Conway JF, Hafenstein S. (2013). The enterovirus 71 A-particle forms a gateway to allow genome release: a cryoEM study of picornavirus uncoating. PLoS pathogens 9:el 003240.
[0231] 82. Ong KC, Badmanathan M, Devi S, Leong KL, Cardosa MJ, Wong KT. (2008). Pathologic characterization of a murine model of human enterovirus 71 encephalomyelitis. Journal of neuropathology and experimental neurology 67:532-542.
[0232] 83. Lin YW, Lin HY, Tsou YL, Chitra E, Hsiao KN, Shao HY, Liu CC, Sia C, Chong P, Chow YH. (2012). Human SCARB2-mediated entry and endocytosis of EV71. PloS one 7:e30507.
[0233] 84. Bridgen, A (Ed.) (2012) Reverse Genetics of RNA Viruses: Applications and Perspectives, John Wiley & Sons, Ltd, Oxford. [0234] 85. Jackson, D, Cadman, A, Zurcher, T, Barclay, WS (2002) A reverse genetics approach for recovery of recombinant influenza B viruses entirely from cDNA. J Virol 76: 1 1744-1 1747.
[02351 86. Neumann, G, Watanabe, T, Ito, H, Watanabe, S et al. (1999) Generation of influenza A viruses entirely from cloned cDNA. Proc Natl Acad Sci USA 96: 9345-9350.
[0236] 87. Stobart, CC and Moore, ML (2014) RNA virus reverse genetics and vaccine design. Viruses 6: 2531-2550.
[0237] 88. Victorio, C.B., Xu, Y., Ng, Q., Chow, V.T. & Chua, .B. Phenotypic and genotypic characteristics of novel mouse cell line (NIH/3T3)-adapted human enterovirus 71 strains (EV71 :TLLm and EV71 :TLLmv). PloS one 9, e92719 (2014).
[0238] 89. asukawa, T., et al. Quantitative expression profile of distinct functional regions in the adult mouse brain. PloS one 6, e23228 (201 1).
[0239] 90. Lein, E.S., et al. Genome-wide atlas of gene expression in the adult mouse brain. Nature 445, 168-176 (2007).
[0240] 91 . Wong, .T., et al. The distribution of inflammation and virus in human enterovirus 71 encephalomyelitis suggests possible viral spread by neural pathways. Journal of neuropathology and experimental neurology 67, 162-169 (2008).
[0241] 92. Chan, L.G., et al. Deaths of children during an outbreak of hand, foot, and mouth disease in Sarawak, malaysia: clinical and pathological characteristics of the disease. For the Outbreak Study Group. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America 31, 678-683 (2000).
[0242] 93. Hsueh, C, et al. Acute encephalomyelitis during an outbreak of enterovirus type 71 infection in Taiwan: report of an autopsy case with pathologic, immunofluorescence, and molecular studies. Modern pathology : an official journal of the United States and Canadian Academy of Pathology, Inc 13, 1200- 1205 (2000).
[0243] 94. Shieh, W J., et al. Pathologic studies of fatal cases in outbreak of hand, foot, and mouth disease, Taiwan. Emerging infectious diseases 7, 146-148 (2001).
[0244] 95. Wong, K.T., Chua, K.B. & Lam, S.K. Immunohisto chemical detection of infected neurons as a rapid diagnosis of enterovirus 71 encephalomyelitis. Annals of neurology 45, 271 -272 (1999).
[0245] 96. Lu, W.H., et al. Hexamethonium reverses the lethal cardiopulmonary damages in a rat model of brainstem lesions mimicking fatal enterovirus 71 encephalitis. Critical care medicine 41 , 1276-1285 (2013).
[0246] 97. Rogers, F.B., et al. Neurogenic pulmonary edema in fatal and nonfatal head injuries. The Journal of trauma 39, 860-866; discussion 866-868 (1995).
[0247] 98. Yu, P., et al. Histopathological features and distribution of EV71 antigens and SCARB2 in human fatal cases and a mouse model of enterovirus 71 infection. Virus research 189, 121 -132 (2014).
[0248] 99. Gao, L., et al. Pathological examinations of an enterovirus 71 infection: an autopsy case. International journal of clinical and experimental pathology 7, 5236-5241 (2014).
[0249] 100. Jiang, M., et al. Autopsy findings in children with hand, foot, and mouth disease. The New England journal of medicine 367, 91 -92 (2012). [025O] 101. Theodore, J. & Robin, E.D. Speculations on neurogenic pulmonary edema (NPE). The American review of respirator)? disease 113, 405-41 1 (1976).
[0251] 102. Busl, K.M. & Bleck, T.P. Neurogenic Pulmonary Edema. Critical care medicine 43, 1710-1715 (2015).
[0252] 103. Sedy, J., Zicha, J., unes, J., Jendelova, P. & Sykova, E. Mechanisms of neurogenic pulmonary edema development. Physiological research / Academia Scientiarum Bohemoslovaca 57, 499-506 (2008).
[0253] 104. Davison, D.L., Terek, M. & Chawla, L.S. Neurogenic pulmonary edema. Critical care 16, 212 (2012).
[0254] 105. Wang, S.M., Lei, H.Y. & Liu, C.C. Cytokine immunopathogenesis of enterovirus 71 brain stem encephalitis. Clinical & developmental immunology 2012, 876241 (2012).
[0255] 106. Wang, S.M., et al. Pathogenesis of enterovirus 71 brainstem encephalitis in pediatric patients: roles of cytokines and cellular immune activation in patients with pulmonary edema. The Journal of infectious diseases 188, 564-570 (2003).
[0256] 107. Huang, S.W., et al Exogenous interleukin-6, inter! eukin- 13, and interferon- gamma provoke pulmonary abnormality with mild edema in enterovirus 71 -infected mice. Respiratory research 12, 147 (201 1).
[0257J 108. Inobe, J J., Mori, T., Ueyama, H., Kumamoto, T. & Tsuda, T. Neurogenic pulmonary edema induced by primary medullary hemorrhage: a case report. Journal of the neurological sciences 172, 73-76 (2000).
[0258] 109. Blessing, W.W., West, M.J. & Chalmers, J. Hypertension, bradycardia, and pulmonaiy edema in the conscious rabbit after brainstem lesions coinciding with the Al group of catecholamine neurons. Circulation research 49, 949-958 (1981).
[0259] 1 10. Nathan, M.A. & Reis, DJ. Fulminating arterial hypertension with pulmonary edema from release of adrenomedullary catecholamines after lesions of the anterior hypothalamus in the rat. Circulation research 37, 226-235 (1975).
(0260] 111. Wong, K.T., et al. The distribution of inflammation and virus in human enterovirus 71 encephalomyelitis suggests possible viral spread by neural pathways. Journal of neuropathology and experimental neurology 67, 162-169 (2008).
[02611 1 12. Wang, Y.F. & Yu, C.K. Animal models of enterovirus 71 infection: applications and limitations. Journal of biomedical science
[0262] 113. Lein, E.S., et al. Genome-wide atlas of gene expression in the adult mouse brain. Nature 445, 168-176 (2007).
[0263] 1 14. Hashimoto, I. & Hagiwara, A. Pathogenicity of a poliomyelitis-like disease in monkeys infected orally with enterovirus 71 : a model for human infection. Neuropathology and applied neurobiology 8, 149-156 (1982).
[0264] 1 1 . Nagata, N., et al Pyramidal and extrapyramidal involvement in experimental infection of cynomolgus monkeys with enterovirus 71. Journal of medical virology 67, 207-216 (2002).
[0265] 1 16. Nagata, N., et al. Differential localization of neurons susceptible to enterovirus 71 and poliovirus type 1 in the central nervous system of cynomolgus monkeys after intravenous inoculation. The Journal of general virology 85, 2981-2989 (2004). [0266] 117. Arita, M., et al. Temperature-sensitive mutants of enterovirus 71 show attenuation in cynomolgus monkeys. The Journal of general virology 86. 1391-1401 (2005).
[0267] 1 18. Arita, M., et al. An attenuated strain of enterovirus 71 belonging to genotype a showed a broad spectrum of antigenicity with attenuated neurovirulence in cynomolgus monkeys. J Virol 81, 9386-9395 (2007).
[0268] 1 19. Zhang, Y., et al. Pathogenesis study of enterovirus 71 infection in rhesus monkeys. Laboratory investigation; a journal of technical methods and pathology 91, 1337- 1350 (2011).
[0269] 120. Chen, H., et al. The effect of enterovirus 71 immunization on neuropathogenesis and protein expression profiles in the thalamus of infected rhesus neonates. Virology 432, 417-426 (2012).
[0270] 121. Chen, Y.C. A murine oral enterovirus 71 infection model with central nervous system involvement. Journal of General Virology 85, 69-77 (2004).
[0271] 122. Wang, Y.F., et al. A mouse-adapted enterovirus 71 strain causes neurological disease in mice after oral infection. J Virol 78, 7916-7924 (2004).
[0272] 123. Chua, B.H., Phuekies, P., Sanders, S.A., Nicholls, P.K. & McMinn, P.C. The molecular basis of mouse adaptation by human enterovirus 71. The Journal of general virology 89, 1622-1032 (2008).
[0273] 324. Chen, C.S., et al. Retrograde axonal transport: a major transmission route of enterovirus 71 in mice. J Virol 81, 8996-9003 (2007).
[0274] 125. Ong, K.C., et al. Pathologic characterization of a murine model of human enterovirus 71 encephalomyelitis. Journal of neuropathology and experimental neurology 67, 532-542 (2008).
[0275] 126. Wang, W., et al. A mouse muscle-adapted enterovirus 71 strain with increased virulence in mice. Microbes and infection / Institut Pasteur 13, 862-870 (2011).
[0276] 127. hong, W.X., et al. A non-mouse- adapted enterovirus 71 (EV71) strain exhibits neurotropism, causing neurological manifestations in a novel mouse model of EV71 infection. J Virol 86, 2121 -2131 (2012).
[0277] 128. Caine, E.A., Partidos, CD., Santangelo, J.D. & Osorio, J.E. Adaptation of enterovirus 71 to adult interferon deficient mice. PloS one 8, e59501 (2013).
J0278J 129. Arita, M., Ami, Y., Wakita, T. & Shimizu, H. Cooperative effect of the attenuation detemiinants derived from poliovirus sabin 1 strain is essential for attenuation of enterovirus 71 in the NOD/SCID mouse infection model. J Virol 82, 1787-1797 (2008).
[0279] 130. Xu, F., et al. Enterovirus 71 infection causes severe pulmonary lesions in gerbils, meriones unguiculatus, which can be prevented by passive immunization with specific antisera. PloS one 10, e01 19173 (2015).
[0280] 131. Koroleva, G.A., Karmysheva, V.Y. & Lukashev, A.N. 390 Enterovirus 71 pathogenicity in monkeys and cotton rats. Archives of virology 159, 1 133-1 138 (2014).
[0281] 132. Yao, P.P., et al. Enterovirus 71 -induced neurological disorders in young gerbils, Meriones unguiculatus: development and application of a neurological disease model. PloS one 7, e51996 (2012). [0282] 133. Yang, X., et al. A neonatal gnotobiotic pig model of human enterovirus 71 infection and associated immune responses. Emerg Microbes Infect 3, e35 (2014).
[0283] 134. Wang, S.M., et al. Clinical spectrum of enterovirus 71 infection in children in southern Taiwan, with an emphasis on neurological complications. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America 29, 184- 190 (1999).
[0284] 135. Huang, C.C., et al. Neurologic complications in children with enterovirus 71 infection. The New England journal of medicine 341, 936-942 (1999).
[0285] 136. Ho, ., et al. An epidemic of enterovirus 71 infection in Taiwan. Taiwan Enterovirus Epidemic Working Group. The New England journal of medicine 341, 929-935 (1999).
[0286] 137. Chang, L.-Y., et al. Clinical features and risk factors of pulmonary oedema after enterovirus-71 -related hand, foot, and mouth disease. The Lancet 354, 1682-1686 (1999).
[0287] 138. Nishimura, Y., et al. Human P-selectin glycoprotein ligand-1 is a functional receptor for enterovirus 71. Nature medicine 15, 794-797 (2009).

Claims

WHAT IS CLAIMED IS:
1. An animal model of Enterovirus 71 (EV71) neuro-infection comprising a rodent infected with an EV71 modified for infecting the rodent.
2. The animal model of claim 1 , wherein the modified EV71 is a rodent cell line adapted EV71.
3. The animal model of claim 1 or 2, wherein the modified EV71 is a rodent cell line adapted EV71 that is EV71:TLLmv.
4. The animal model of claim 3, wherein EV71 :TLLmv has been deposited with China Center for Type Culture Collection and assigned accession number CCTCC V201438.
5. The animal model of claim 1 or 2, wherein the modified EV71 is a rodent cell line adapted EV71 that is EV71:TLLm.
6. The animal model of claim 5, wherein EV71 :TLLm has been deposited with China Center for Type Culture Collection and assigned accession number CCTCC V201437.
7. The animal model of claim 1 , wherein the modified EV71 is an EV71 clone derived virus (CDV) containing mutations in VP1.
8. The animal model of claim. 1 or 7, wherein the modified EV71 is EV71 CDV CDV:BSVP1[K98E/E145A/L169F] .
9. The animal model of any one of claims 1-6, wherein the rodent is immuno-competent.
10. The animal model of claim 9, wherein the rodent is a mouse.
11. The animal model of claim 10, wherein the rodent cell line is mouse cell line NIH/3T3.
12. The animal model of claim 7 or 8, wherein the rodent is immuno-competent.
13. The animal model of claim 12, wherein the rodent is a mouse.
14. The animal model of claim 13, wherein the rodent cell line is mouse cell line ΝΓΗ/3Τ3 or mouse cell line Neuro-2a.
15. The animal model of claim 1 or 2, wherein the rodent is immuno-compromised.
16. The animal model of claim 15, wherein the rodent is a mouse.
17. The animal model of claim 16, wherein the mouse is a BALB/c mouse.
18. A method to screen antiviral drugs, comprising: providing a test group of animals and a control group of animals, wherein the animals of each group comprise the animal model of any one of claims 1-17; administering to the test group an antiviral drug candidate; monitoring disease progression in the test group and the control group; comparing the disease progression in the test group to the disease progression in the control group; and selecting the antiviral drug candidate that reduces disease progression in the test group relative to the control group.
1 . The method of claim 18, wherein the antiviral drug is first screened in a test rodent cell line infected with the modified Enterovirus 71 before screening in the animals.
20. A method to screen effective antiviral vaccines, comprising: providing a test group of animals and a control group of animals, wherein the animals of each group comprise the animal model of any one of claims 1-17; administering to the test group an antiviral vaccine candidate; monitoring disease progression in the test group and the control group; comparing the disease progression in the test group to disease progression in the control group; and selecting the antiviral vaccine candidate that reduces disease progression in the test group relative to the control group.
21. The method of claim 20, wherein the antiviral vaccine is first screened in a test rodent cell line infected with the modified Enterovirus 71 before screening in the animals.
22. A method to prepare the animal model of claim 1 comprising
infecting a rodent with an EV71 modified for infecting the rodent and
raising the infected rodent,
whereby an animal model of EV71 neuro-infection is prepared.
23. The method of claim 22, wherein the age of the rodent at infection is between about 1 week and about 4 weeks.
24. The method of claims 22 or 23, wherein the infected rodent is raised for up to about 4 weeks.
25. The method of any one of claims 22-24, wherein a median cell culture infectious dose between about 103 and about 307 is used for infecting the rodent.
26. The method of any one of claims 22-25, wherein the modified EV71 is a rodent cell line adapted EV71 that is EV71:TLLmv,
27. The method of claim 26, wherein EV71:TLLmv has been deposited with China Center for Type Culture Collection and assigned accession number CCTCC V201438.
28. The method of any one of claims 22-25, wherein the modified EV71 is a rodent cell line adapted EV71 that is EV71:TLLm.
29. The method of claim 28, wherein EV71:TLLm has been deposited with China Center for Type Culture Collection and assigned accession number CCTCC V201437.
30. The method of any one of claims 22-25, wherein the modified EV71 is an EV71 clone derived virus (CDV) containing mutations in VP1.
3 1 . The method of claim 30, wherein the modified EV71 is EV71 CDV CDV:BSVP1[K98E/E145A/L169F] .
32. The method of any one of claims 22-31 , wherein the rodent is a mouse.
33. The method of claim 32, wherein the mouse is 3 A.LvB/c mouse
PCT/SG2016/050031 2015-01-28 2016-01-25 Enterovirus 71 animal model WO2016122403A1 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
CN201680019293.5A CN107849540B (en) 2015-01-28 2016-01-25 Enterovirus 71 animal model
JP2017540259A JP6772155B2 (en) 2015-01-28 2016-01-25 Enterovirus 71 animal model
AU2016212766A AU2016212766B2 (en) 2015-01-28 2016-01-25 Enterovirus 71 animal model
MYPI2017001107A MY202113A (en) 2015-01-28 2016-01-25 Enterovirus 71 animal model
KR1020177023889A KR20170106473A (en) 2015-01-28 2016-01-25 Enterovirus 71 animal model
SG11201706054QA SG11201706054QA (en) 2015-01-28 2016-01-25 Enterovirus 71 animal model

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201562108828P 2015-01-28 2015-01-28
US62/108,828 2015-01-28
US201562114880P 2015-02-11 2015-02-11
US62/114,880 2015-02-11

Publications (1)

Publication Number Publication Date
WO2016122403A1 true WO2016122403A1 (en) 2016-08-04

Family

ID=56543857

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/SG2016/050031 WO2016122403A1 (en) 2015-01-28 2016-01-25 Enterovirus 71 animal model

Country Status (8)

Country Link
JP (1) JP6772155B2 (en)
KR (1) KR20170106473A (en)
CN (1) CN107849540B (en)
AU (1) AU2016212766B2 (en)
MY (1) MY202113A (en)
SG (1) SG11201706054QA (en)
TW (1) TWI764859B (en)
WO (1) WO2016122403A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022140274A1 (en) * 2020-12-21 2022-06-30 Academia Sinica Novel enterovirus 71 mutations associated with disease severity
CN115211402A (en) * 2022-07-07 2022-10-21 中国医学科学院医学生物学研究所 Construction method and application of CV-B3 infected rodent model

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112094822A (en) * 2019-06-02 2020-12-18 复旦大学 Infectious cDNA clone based on EV71 strain and application thereof
KR102243526B1 (en) * 2020-01-21 2021-04-22 (주)노터스생명과학 Transgenic animal for Nonclinical evaluation of Foot and Mouth Disease Vaccine and producing method thereof
CN114304064A (en) * 2021-12-16 2022-04-12 首都医科大学 Method for establishing animal model with head deformity accompanied with nerve-dyskinesia

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102220288A (en) * 2011-05-04 2011-10-19 中国科学院上海巴斯德研究所 Mouse-addapted enterovirus EV71 strain 573 and use thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102220288A (en) * 2011-05-04 2011-10-19 中国科学院上海巴斯德研究所 Mouse-addapted enterovirus EV71 strain 573 and use thereof

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
LI, Z. ET AL.: "Immunological, endocrinological, and pathological characteristics of the EV71-BJ strain-infected suckling mice", MIANYIXUE ZAZHI, vol. 28, 2012, pages 867 - 871 *
LIU, J. ET AL.: "Lycorine reduces mortality of human enterovirus 71-infected mice by inhibiting virus replication", VIROLOGY JOURNAL, vol. 8, 2011, pages 483 *
ONG, K.C. ET AL.: "Formaldehyde-Inactivated Whole-Virus Vaccine Protects a Murine Model of Enterovirus 71 Encephalomyelitis against Disease", JOURNAL OF VIROLOGY, vol. 84, 2010, pages 661 - 665 *
VICTORIO, C.B.L. ET AL.: "Phenotypic and Genotypic Characteristics of Novel Mouse Cell Line (NIH/3T3)-Adapted Human Enterovirus 71 Strains (EV71:TLLm and EV71:TLLmv", PLOS ONE, vol. 9, 2014, pages e92719 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022140274A1 (en) * 2020-12-21 2022-06-30 Academia Sinica Novel enterovirus 71 mutations associated with disease severity
CN115211402A (en) * 2022-07-07 2022-10-21 中国医学科学院医学生物学研究所 Construction method and application of CV-B3 infected rodent model

Also Published As

Publication number Publication date
TWI764859B (en) 2022-05-21
AU2016212766A1 (en) 2017-09-07
MY202113A (en) 2024-04-04
JP6772155B2 (en) 2020-10-21
AU2016212766B2 (en) 2022-03-24
SG11201706054QA (en) 2017-08-30
KR20170106473A (en) 2017-09-20
JP2018513671A (en) 2018-05-31
TW201702376A (en) 2017-01-16
CN107849540B (en) 2021-12-21
CN107849540A (en) 2018-03-27

Similar Documents

Publication Publication Date Title
Wang et al. Subunit vaccines against emerging pathogenic human coronaviruses
AU2016212766B2 (en) Enterovirus 71 animal model
Ma et al. Novel genotype of infectious bronchitis virus isolated in China
McMinn Recent advances in the molecular epidemiology and control of human enterovirus 71 infection
Yugo et al. Hepatitis virus infections in poultry
Sutton et al. Development of animal models against emerging coronaviruses: From SARS to MERS coronavirus
Fujii et al. VP1 amino acid residue 145 of enterovirus 71 is a key residue for its receptor attachment and resistance to neutralizing antibody during cynomolgus monkey infection
Beall et al. Characterization of a pathogenic full-length cDNA clone and transmission model for porcine epidemic diarrhea virus strain PC22A
Chua et al. The molecular basis of mouse adaptation by human enterovirus 71
Meng Recent advances in Hepatitis E virus
Bailey et al. Functional analysis of RNA structures present at the 3′ extremity of the murine norovirus genome: the variable polypyrimidine tract plays a role in viral virulence
Chang et al. Selection and characterization of vaccine strain for Enterovirus 71 vaccine development
Yugo et al. Naturally occurring animal models of human hepatitis E virus infection
Kenney et al. Hepatitis E virus: animal models and zoonosis
Tee et al. Electrostatic interactions at the five-fold axis alter heparin-binding phenotype and drive enterovirus A71 virulence in mice
AU2018209333A1 (en) Poliovaccine
Zhou et al. Characterization of self-assembled virus-like particles of dromedary camel hepatitis e virus generated by recombinant baculoviruses
Rajkhowa et al. Emergence of porcine circovirus 2g (PCV2g) and evidence for recombination between genotypes 2g, 2b and 2d among field isolates from non-vaccinated pigs in Mizoram, India
Victorio et al. Cooperative effect of the VP1 amino acids 98E, 145A and 169F in the productive infection of mouse cell lines by enterovirus 71 (BS strain)
Yin et al. Isolation and characterization of a novel chicken astrovirus in China
Cifuente et al. Molecular determinants of disease in coxsackievirus B1 murine infection
Victorio et al. Phenotypic and genotypic characteristics of novel mouse cell line (NIH/3T3)-adapted human enterovirus 71 strains (EV71: TLLm and EV71: TLLmv)
Wang et al. Hepatitis E virus
Hu et al. Efficacy of Coxsackievirus A2 vaccine candidates correlating to humoral immunity in mice challenged with a mouse-adapted strain
Yi et al. Role of the conserved E2 residue G259 in classical swine fever virus production and replication

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16743801

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 11201706054Q

Country of ref document: SG

ENP Entry into the national phase

Ref document number: 2017540259

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 20177023889

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2016212766

Country of ref document: AU

Date of ref document: 20160125

Kind code of ref document: A

122 Ep: pct application non-entry in european phase

Ref document number: 16743801

Country of ref document: EP

Kind code of ref document: A1