AU2016212766A1 - Enterovirus 71 animal model - Google Patents

Abstract

The present invention relates to Enterovirus 71 (EV71), the development of an animal model and screening of candidate anti-EV71 compounds. More specifically, the present invention relates to the discovery that Enterovirus 71 (EV71 ) strains that have been adapted to infect rodent cell lines or cloned derived virus containing mutations in VP1 can cause disease in immuno-competent rodents.

Description

wo 2016/122403 PCT/SG2016/050031 1

ENTCROVIRUS 71 ANIMAL MODEL CROSS-REFERENCE TO RELATED APPLICATIONS 00011؛ The present application is relate to and claims priority to U.S. provisional patent application Serial No. 62/114,880 filed on 11 February 2015 and to U.S. provisional patent application Serial No. 62/108,828 filed on 28 January 2015. Each application is incorporated herein in its entirety.

SUBMISSION OF SEQUENCE LISTING

[00021 The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is entitled 2577243PCTSequenceListing.txt, created on 29 December 2015 and is 32 kb in size. The information in tire elechonic fonnat of the Sequence Listing is incorporated herein by reference in tlreir entirety.

BACKGROUND OF THE MENTION 00031؛ The present inveirtion relates to Enterovims 71 (EV71), the development of an. animal model and screening of candidate anti-EV71 compounds. 0004؛] The publications and other materials used, herein to illuminate the backgroujrd of the invention, aird iir particular, cases to provide additional details respecting the practice, are incorporated by reference, and for convenience are referenced in the following text by author and date and are listed alphabetically by author in the appended bibliography. 0005؛] Enterovinis 71 (EV71) is a sntall non-enveloped virus approximately 30 nm in diameter. The viral capsid exilibits icosahedral symmetry and is comprised of 60 identical 'units (protomers), with each consisting of four viral structural protens VP1-VP4. The capsid surrounds a core ofa single-stranded positive-sense RNA genome of 7,450 nucleotides (nt) long. The genome contains a single open reading frame which encodes a pol^rotein of 2193 amino acids (aa) and is flanked by a long 5ء untranslated region (UTR) of 745 nt aird a shorter 3' UTR of 85 nt with a poly-Α tract of variable length at its 3' terminus. The polyprotein is divide into three regions, i.e., PI, Ρ2 and Ρ3. PI encodes four viral stmctural proteins 1A-1D (VP4, VP2, VP3 and ^1); Ρ2 and Ρ3 encode seven non-stnictural proteins 2A-2C and 3A-3D 3-1؛]. Phylogenetic analysis of the major capsid protein (VPl) gene divided EV71 into six genotypes (denoted A to F) [66], and genotypes B and c are farther subdivided into subgenotypes Bl to Β5 and Cl to C5 [3]. WO 2016/122403 PCT/SG2016/050031 2 [0006أ EV71 causes an array of clinical diseases including hand, foot and mouth, disease (HFMD), aseptic meningitis, encephalitis and poliomyelitis-like paralysis mainly in infants and young children 5 ,4؛]. The virus was first isolated from a child with acute encephalitis hr California, USA in 1969, and subsequently characterized as a new serotype of the genus Enterovirus in 1974 [6]. Outbreaks of II with or witliout neurologic complications and deadrs were reported in various parts of the world [7-20]. Siirce 1997, EV7I infections have been a major public healtlr burden and of constant epidemiologic concent in the Asia-Pacific Region. An HFMD outbreak due to Irighly neurovirulent EV71 enrerged in Malaysia resulting in 48 deatirs in 1997 [21., 22], follow^ by a large outbreak that occurred in Taiwan in 1998 with more than 129,000 cases ofHFMD, 405 severe infections and 78 deaths due to acute brainstem encephalomyelitis with neurogenic cardiac failure aird pulmonary edema [23-26]. hr People's Republic of China, 488,955 HFMD cases with 126 deatirs were recorded iir 2008 [27] and increase to 1,155,525 cases with 353 fatalities in 2009 [28]. In 2010, China experienced tire largest ever HFMD outbreak with more than 1.7 million cases, 27,000 patients with severe neurologic complications, and 905 deatirs [29].

[0007] Similar to other human enteroviruses, EV71 is rmable to infect animals otirer tlran humans, althouglr. rlresus and cynonrolgous monkeys can be experimentally iirfected [3032]. This is primarily due to the inefficient binding of EV71 to its receptor for- unoating and errtry into mouse cells, which had been recently identified as Scavenger Receptor Class B Member-2 ١ protein [47]. The human and m'urine SCARB2 proteins exhibit only 84% arrrino acid sequence identity and tlrerefore display significant structrrral divergerree [49, 67], hence precipitatiirg tire virus-receptor irrcompatibility underlying tire natural resistance of non-human cells to EV71 infectiorr. Once tire virus successfillly engages the SCARB2 receptor on the cellular surface and uncoats into the endoplasm, the viral RNA is translated, resulting in the expression of various viral rron-structural proteirrs. The viral ENA is subsequently replicated, packaged into the capsid, and released into the environment free to re-infect healthy cells.

[.0.8] finderstanding its pathogenesis and development of specific therapeutics against the virus are hampered by the lack of' suitable snrall animal models, becarrse EV71 is unable to naturally infbet small rodents. Attempts to establish mouse models of EV71 infection and disease have been made, mostly through virus adaptation by serial passages in young suckling juice [33-39]. Although some models were able to recapitulate symptoms of cli.nical illness, none has been reported to cause disease in immuno-competent mi.ee aged 2 weeks old or older. Moreovei', clinical features of disease arrd pathology of EV71 infectioirs in humarrs and wo 2016/122403 PCT/SG2016/050031 3 experimental monkeys could not be replicated in mice, with the exertion of the immunocompromised interferon receptor-deficient AG129 mice 35؛). More receirtly, transgenic mice expressing human PSGL-1 [68] and human SCARB2 [69, 70] proteins have been available, but these exhibit only marginal improvements in susceptibility to EV71 infection. [0009] 1 viruses, by virtue of their enor-prone replication and high mutation rates 40؛- 42], replicate as a swarm of related variant sequences known as qmsispecies [43, 44]. It is comprised of a irraster species exhibiting tire highet fitness in a certain environment, and of a mutant spectrum composed of a ollection of closely related mutant sequences with a certain probability distribution [44, 45]. These endow RNA viruses witli genome plasticity, which is reflected in tlreir ability to quickly adapt to changing environments. 0010؛] The mechanisms by which EV71 infection causes fatal neurological disease are not fiilly understood, lrence several research groups have attempted to reproduce the pathology of human infection iir experimental aifimals including rhesus and cynomolgous monkeys [114-120], laboratory mice [112, 121-129], and other mammals [130-133]. Unfortunately, none of tlrese jnodels exhibits the filll spectrum of neurological features observed in liuman cases, especially those attributable to acute brainstem encephalitis with fillminant neurogenic pulmonary edema (WE) [21, 22, 134-137]. Indeed, even in experimental systems that more accurately replicate the signs and symptoms of EV71 infection, in humans, the underlying mechanisms differ substantially from those tlrat confer disease in human patients. To date, no single animal model has conclusively replicated EV71-induced WE. A key distinction is tlrat EV71 is restricted to CNS tissues iir human patients [92-94, 111], whereas in animal models tire virus can also be detected in non-nervous tissues iircluding the skeletal muscles [33-36, 38, 98] and liver [119]. While there lrave also been efforts to create transgenic mice tlrat express tire human EV71 receptor proteins PSGL-1 (P-selectin glycoprotein ligand-l) and SCARB2 (S 66 cavenger Receptor Class B, jnember 2) [68-70, 47, 138], none of th.ese models exhibits WE, hence tlreir utility for identifying novel interventions for human patients is limited.

[0011] No suitable animal models exist to study infection and disease progression in EV71 infected animals or tlrat could be used to screen anti-viral compounds or anti-viral vaccines. It is desired to develop an animal model for these purposes.

SUMMARY OF THE INVENTION

[0012] The present invention l'elates to Enterovirus 71 (EV71), the development of an aniirral model and screening of candidate anti-EV71 compounds. More specifically, the pi'esent WO 2016/122403 PCT/SG2016/050031 4 invention relates to the discovery that Enterovirus 71 (EV71) strains tliat have been adapted to infect rodent cell lines or cloned derived virus containing mutations in VPl can cause disease in immuno-competent rodents and inununo-compromised rodents. 1.013] In addition, le present invention relates to the development of a clinically authentic model of EV71-induced neurological disease by infecting BALB/c mice with a modified strain (e.g.١ EV71:TLLmv) adapts to infect ΝΙΗ/3Τ3 mouse fibroblasts. Using this approach, the modified EV71 is used to induce acute encephalomyelitis associated with neurogenic pulmonary edema in mice, characterized by lung swelling and increased organ weight compared witli mock-infected lungs. Despite the abseirce of lung or cardiac tissue inflammation, focal hemorrhage and proteinaceous fluid in the alveoli, higlr serum levels of catecholamines, and extensive tissue dajnage in tire brainstem, particularly tire medulla oblongata were observe!. These data demonstrate tlrat the model accurately reproduces the signs and symptoms of human EV71-induct neurogeiric pulmonary edema. ]0014] Thus, in one aspect, the present invention relates to an animal model that comprises a rodejrt infected with an Enterovinrs 71 capable of infectiirg the rodent, sometimes referred to herein as a modified Enterovirus 71. In one embodiment, such an Enterovirus 71 is a rodent cell line adapted Enterovirus 71, In anotlier embodiment, such, an Enterovirus 71 is a clone derived virus (CDV) containing mutations in VPl. In some embodimeirts, the mutatioirs in VPl enable the CDV to use rodent SCARB2 proteins to infect rodent cells. In one ejnbodiment, tire rodent is an immuno-competent rodent. In another embodiment, the rodeirt is an immuno-compromised l'odent. Suitable animals for use as models are preferably mammalian animals, most preferably coitvenient laboratory animals such as rabbits, rats, mice, and the like, hi one embodiment, the aitimal is a mouse. In some embodiments, the mouse is a BALB/c mouse. In another embodiment, the rodent cell line is a mouse cell line. In a firrther embodiment, the mouse cell line is a mouse Nffl/3T3 cell line. In another embodiment, tlie mouse cell line is a mouse Neur0-2a cell line. In one embodiment, the rodent cel.1 line adapted Enteroviras 71is EV71:TLLm. In another embodiment, the rodent cell liite adapted Enterovirus 71 is EV71:TLLmv. Ill one embodiment, the clone derived virus containing mutations in VPl is CDV:BSypi[K98E/E145A/L169F]. The animal model is useful for studying systemic spread of the virus and human disease spectrum in animal models. The animal model is also usefirl for screening antiviral drags and vaccines. 1.015] In another aspect, the present invention provides a method foi* preparing an animal model with tlie fitil-spectrum of EV71-induced neurological infection, disease and pathology WO 2016/122403 PCT/SG2016/050031 5 observed in humans. In some embodiments, the method comprises infecting a rodent described herein with a modified Enteroviras 71 described herein and raising the infected rodent for up to about 4 weeks. ئ some embodiments, tire age oftlie rodent to be infected is between about 1 week and about 4 weeks. In other embodiments, the infected rodent is raised for about 1 week to about 4 weeks, hr some embodiments, the rodent is a mouse as described herein, hr other embodiments, tire rodent is infected by iiroculating the rodent with the modified Enteovirus 71. hr one enrbodiment, the inoculation is intraperitoneal (Ι.Ρ.). In another embodiment, tire inoculation is intramuscular (1,M.). In sonre embodiments, tire vinrs dose inoculated into the rodent is a median cell culture infectious dose (CCID50) between about between about 10إ and about 10؟.

[.016] hr an additional aspect, the present invention provides a method to screen antiviral drugs. l.n accordance with this aspect, the metlrod coirrprises the following steps: providfog a test group of animals and a control group of animals in which, the animals of each group are animals of the animal model described herein؛ administering to tire test group an antiviral drug candidate؛ monitoriirg disease progressioir in the test group and the control group؛ comparing the disease progression in tire test group to the disease profession hr the control group؛ and selecting the antiviral drag candidate that reduces disease profession in the test foup relative to tire control group. In oire embodirrrent, the antiviral drug is first screened in a test rodent cell liire infected with a rodeirt cell line adapted Enterovirus 71 before screening in the aniirrals. Iir another embodiment, the antiviral drug is first screened in a test rodent cell liire iirfected with a clone derived virus (CDV) containing mutations in VPl before screening in the animals.

[0017] hr a forther aspect, the present invention provides a nrefood to screeir effective antiviral vaccines. According to this aspect, tire mefirod comprises the following steps: providing a test group of animals and a coirtrol goup of airimals in which tire anhnals of each goup are animals of the animal model, described heein؛ admiiristeriirg to the test goup air antiviral vaccine candidate; monitoriirg disease progression in the test group and the control group؛ comparing tire disease progessioir in fire test goup to disease progression in tire coirtiOl goup؛ and selecting tire antiviral vaccine candidate tlrat reduces disease progessioir iir the test goup relative to the control group. In one embodimeirt, the antiviral vaccine candidate is first screened iir a test rodeirt cell liire infected with a rodent cell liire adapted Enterovirus 71 before screening in the animals. In another embodiment, foe airtiviral vaccfoe candidate is first screen»! iir a test rodent cell, line infected with clone derived vims (CDV) containing mutations iir VPl before screening in foe aniirrals. WO 2016/122403 PCT/SG2016/050031 6

BRJEF DESCRIPTION OF raE FIGURES

[0018] Figures ΙΑ-ΙΟ show cytopathic effects (CPE) observed following viras infection of various pi٠imate cell lines. Primate cells: RD cells figures A1-1C), HeLa cells (Figures ID-IF), HEp-2 cells (Figure 1 G 11), Vero cells (Figures 1J-1L), and cos-7 cells (Figures 1Μ-10) infected with 1 MOI of either EV71:BS (Figures 1.A, ID, lG, u and 1Μ), EV71:TLLm (Figures IB, IE, 1Η, IK and IN), or EV71 :TLLmv (Figures 1C, IF, II, lL and 10) virus were observed at 48 bpi for cytopathic effects or death of the cell monolayer, hnages are representative of results in three independent experiments.

[0019] Figures 2Α-20 show virus antigen detection in cel lines infected with EV71:BS١ EV71 :TLLm and EV71 :TLLmv. Overnight seeded mammalian cell lines: HeLa (Figures 2Α-2C), HEp-2 (Figures 2D-2F), CHO-K1 (Figures 2G-2LI, NRK (Fibres 2J-2L), and TCMK (Figures 2Μ-20), were infected with 1 MOI of respective vinrs. Cells were harvested at 48 hpi, coated onto Teflon slides and fixed in cold acetone. Cells were probed with pan-enterovirus antibody and stained with FITC-conjugated anti-mouse IgG. Images are representative of two independent experiments.

[0020] Figures 3A-3D slrow growth kinetics of Er/71:BS, EV71:TLLm, and EV71:TLLmv determined in ΝΙΗ/3Τ3 and Vero cells. Supernatants from various mammalian cells infected with 1 MOI of respective viras were harvested at various time poin.ts and subjected to titration and enumerated using the Reed and Muench method. Figure 3A: EV71:BS viras titer determined in Vero cells. Figure 3Β: EV71:TLLm.v virus titer determined in ΝΠΙ/3Τ3 cells. Figures 3C and 3D: EV7]:TLLm viras titer determilted in Ι3Τ3 cells. Growth curves from cell lines that did not exhibit productive infection are not shown.

[0021] Figures 4Α-40 sltow cytopathic effects (CPE) observe following virus infection of various rodent cell lines. Rodent cells: ΝΙΗ/3Τ3 cells (Figures 4A4C), Neuro-2A cells (Figures 4D4F), TCMK cells (Figures 4G4I), CHO-K1 cells Figures (4J4L), and NRK cells (Fibres 4Μ40) infected with 1 MOI of either EV71:BS (Figures 4A, 4D١ 4G, 41 and 4Μ), EV71:TLLm (Figures 4Β, 4Ε, 4Η, 4Κ and 4Ν), or EV71:TLLmv (Figures 4C, 4F, 41, 4L and 40) viruses were obsei'ved at 48 Irpi for cytopathic effects or death of the cell monolayer. Images are represeittative ofresults from three independent experhnente.

[0022] Figures 5A-5D show viras fitness assessment of EV71:BS, EV71:TLLm, and EV71:TLLmv in ΝΙΗ/3Τ3 determined by the titer 1'atio. Viras titer detennined separately in Ν1Η/3Τ3 and Vero cells were used to calculate the viras fitness as log[(titer in ΝΙΗ/3Τ3 WO 2016/122403 PCT/SG2016/050031 7 cells)/(titer in Vero cells)]. Vims fitness of (figure 5Α) EV71-.BS, (Figure 5Β) EWlzTLLmv, and (Figures 5C and 5D) EV7!;TLLm were calculated from the virus titer values shown in Figures 3A-3D. Virus fitness assays obtained from cell lines tltat did not exhibit productive infection are not shown.

[0023] Figures 6Α and 6Β show transfection of ΝΜ/3Τ3 with EV71:BS viral Rl induces productive infection. Overnight seeded ΝΊΗ/3Τ3 aird Vero cells were inoculated with virus supernatant harvested from ΝΠΪ/3Τ3 cells previously transfected viral RNA extracted from EV71.-BS, EV71:TLLm, and EV71:TLLmv. Figure 6Α: Cells were intaged using inverted light microscope at 24 hpi to observe induced, CPE. Figure 6Β: Cells were harvested at 7 dpi, coated onto Teflon slides, probed, with pan-enterovirus antibody, and stained with anti-mouse FITC-conjugated antibody.

[0024] Figures 7Α and 7Β show vims fitness assessment of EV71:BS, EV71:TLLm, and EV71:TLLmv in Ν1Η/3Τ3 and Vero cells at 30٥c. Overnight seeded (Figure 7Α) ΝΙΗ/3Τ3 and (Figure 7Β) Vei'0 cells infected witlr EV7.1:BS (panels a, d, g), EV71:TLLm (panels b, e, h), or EVTlzTLLmv (panels c, f, i) were incubated at 30.C and observed under the light microscope wiflr phase-contrast at 24 hpi (panels a-c), 48 hpi (panels d-f), and 72 hpi (panels g-i). Images taken are representative of two independent experiments.

[0025] Figures 8Α and 8Β show vims fitness assessment of EV7]:BS, EV72:TLLm, and EV71:TLLmv in Nffl/3T3 and Vero cells at 37.C. Overnight seeded, (Figure 8Α) ΝΙ3Τ3 and (Figure 8Β) Vero cells infected with EV71:BS (panels a, d, g), EV72:TLLm (panels b, e, h), or EV71:TLLmv (pairels c, fr i) were incubated at 37.C and observed under the light microscope with phase-contrast at 24 hpi, (pairels a-c)١ 48 hpi (panels d-f), and 72 hpi (panels g-i). Images takeir are representative of two independent experiments.

[0026] Figures 9Α aird 9Β show vims fitaess assessment of EV71:BS, EV71:TLLm, and EV71:TLLmv in ΝΙΗ/3Τ3 and Vero cells at 39.C. Overnight seeded (Figure 9Α) Nffl/3T3 and (Figure 9Β) Vero cells infected with EV71:BS (panels a, d, g), EV7]:TLLm (panels b, e, h), or EV71:TLLm.v (panels c, f, i) were incubated at 39.C and observed uirder the light irricroscope with phase-contrast at 24 hpi (panels ac), 48 hpi (panels d-f), and. 72 lrpi (pairels g-i). Images taken are representative of two iirdependent experiments. 0027؛] Figures 10A-10L show transfection of murine cell lines ΝΠΊ/3Τ3, Neur0-2A, and TCMK rvith EV71.-BS viral RNA for evidence of vims replication. Ovemiglrt seeded ΝΙΗ/3Τ3, Neuro-2A١ and TCMK cells were eitlrer infected with 1000 CCIDso of EV71.-BS vims (Figures 10Α, IOC, and 10Ε) or trairsfected wi,th equivalent amounts of viral RNA (Figures 10Β, 10D, PCT/SG2016/050031 WO 2016/122403 and 10F). and harvests! at 48 hpi for viral antigen detection. Virus in the supernatants were harvested at 7 dpi and passaged onto ftesh Vero (Figures JOG, 101, and 10Κ) and Ν1Η/3Τ3 cells (Fibres 10Η, 10J, and 10L). Cells were harvested and stained for viral antigens at 48 hpi. 0028؛] Figures ΙΙΑ-llD show localization in VPl and VP2 of adaptive mutations in the genomes of EV71:TLLm and EV71:TLLmv. Adaptive mutations observed in the VPl figures 11Α and 11Β) and VP2 (Figures lie and 111)1 regions 0tEV71:TLLm (Figures 11Α and lie) and EV71:TLLmv figures 11Β and HD) were modelled using DeepView/SwissPDBviewer ν3.7 and the 3D structure of EV71 capsid PI region (PDB ID 4AED). The mutations were observed to be mostly localize! to the surface-exposed loops of the protein as shown. 0029؛] Figure 12 shows titer ratio ئ ΝΙ3Τ3 cells relative to titer in Vero ells of virus supernatant harvested from cells either transfected with EV71..BS viral RNA or infected with live virus. Supernatants from ΝΙΗ/3Τ3, Neur0-2A, Vero, and TCMK either transfected with viral RNA or infected with live virus were harvested and subjected to virus enumeration by Reed-and Muencb method. The ratio of the log(titer) determined in Ν1Η/3Τ3 cells relative to the titer detennined in Vero cells is shown. 3T3-TRANS: RNA transfected ΝΙΗ/3Τ3 cells; 3T3-INF: vims infected Ν1Η/3Τ3 cells. Asterisks indicate Student's t-test with p-value <0.05. 0030؛] Figures 13Α and Ι3Β siiow survival analysis of infected animals. Infected animals were observed and weighed daily. Figure 13 A; Kaplan-Meier plot of infected animals showing number of deaths at vai'ious das post-infection. Figure 13Β: Changes in body weight were plotted to determine the general health of the airimals.

[0031] Figures J4A-14D show symptoms and pathology of infected animals. Majority of tlie infected animals displayed symptoms of disease. Figure 14Α: Paralysis of the hind limbs (amow). Figure 14Β: Gross anatomy of the inflated lungs following necropsy (anows). Tissue sections were also stained with Hematoxylin and Eosin staining (Figure 14C at lOx and Figure 14D at 20x). Black arrows point to the mucous substance infiltrating the alveolar spaces. 0032؛] Fibres 1.5Α-15Ε show that transfection of viral genomic RNA into both primate and rodent cells yields viable virus. Figure 15Α: Genomic RNA extracted from, either EV71.-BS, EV71:TLLmء or EV71:TLLmv were individually transfected into Vero, ΝΙΗ/3Τ3, and Neur0-2a cells (Ρ0). Transfection supernatants were harvested and inoculated onto either Vero or ΝΙΗ/3Τ3 cells (PI) to assess for viability of vims progeny. Infection of Ρ0 cells was assessed by observation ofcytopathic effects (CPE) (Figure 15Β) and immunofluoresence detection of viral antigens (Figure 15C). Similarly, infection ofPl cells from EV71:BS RNA-transfected cells was WO 2016/122403 PCT/SG2016/050031 9 assessed by CPE induction (Figure 15D) and immunofluorescence detection of expressed viral antigens (Figure 15Ε).

[0033] Fibres I6A-I6F show that tlie capsid-encoding region of mouse cefl-adapted EV71:TLLm drives productive infection of mouse cefls with EV71:BS. Figure 16A: Infectious cDNA clones oftlie full genome of EV71:BS were generated, and the PI regioir replaced with sequences from EV71:TLLm capsid to generate chimeric virus, EV71:BS[M-P]J. Figure 16Β: Cells were infected with clone-derived virus (CDV) from either EV71.-BS or EV71:BS[M-P1], and infection was assess^ by induction of lie lopathic effects (CPE) (Figure 16C) and viral antigen expression (Figure 161)). Supernatants were re-inoculated onto fresh cells, and vims titers were measured from passages (PI and Ρ2) obtained from infected Vero (Figure 16Ε), as well as passage 'PI. of ΝΙΗ/3Τ3 (313) and Neur0-2A (N2a) cells (Figure 16F). Error bars indicate SD. * ρ<0,05.

[0034] Figures 17A-17G show that the VP1-L169F amino acid substitution in the capsid is sufficient to enable EV71:BS entry into murine cells. Figure 17Α: Various mutant cDNA clones were generated by incorporating amino acid substitutions in VPl: Κ.98Ε, Ε145Α, and L169F: and VP2: S1.44T and Κ149Ι; into the foil-length EV71:BS genome. Mutations corresponding to amino acid substitutions are written in parentheses, infection of various cell lines with clone-derived vims (CDV) was monitored, by assessing inductioir of Iric cjdopathic effects (CPE) (Figures 17Β and 17C) and expression of viral antigens (Figures 17D and 17Ε). Virus titers from infected Vero cells (Figure 17F) and Nffl/3T3 and Neuj*0-2a cells (Figure 17G) were detennined to assess generation ofviable vims progeny. Error bars indicate SD.

[0035] Figuresl8A-18E show that EV71:BS vims with combined VPl amino acid substitutions in the capsid exhibit improved infection of mouse cells. Figure 18Α: Various mutant cDNA clones were generated by inorporating combinations of amino acid substitutions in VPl and VP2 into the foil-length EV71:BS genome. Mutations correspondiirg to amino acid substitutions are writteir in parentheses. Infection of various cell lines with clone-derived vims (CDV) was monitored by assessing cjdopathic effects (Figure 18Β), viral airtigen expression (Figure 18C), aitd vims yield from infected Vero (Figure 18D), and ΝΙΗ/3Τ3 (3Τ3) and Neuro-2a (Ν2Α) cells (Figure 18Ε). Other clones with no vims yield are not showir. Error bars indicate SD.

[0.36] Figures 19A-19C show tliat EV71..BS vims with combined, VP1-K98E, Ε145Α, L169F amino acid substitutions in the capsid could be stably passaged in mouse neuronal cell line N'euro-2a. Clone-derived vimses were passaged twice in N'euro-2a and Ι/3Τ3 cells. At wo 2016/122403 PCT/SG2016/050031 10 each passage, infection was monitored by assessment of viral antigen expression (Figure 19A) and virus titer measured in Vero cells (Figure 19Β). Error bars indicate SD. * p < 0.05; **p< 0.005; *** p < 0.0005. Figure 19C: Genome sequences of representative ... were determined to assess evidence of amino acid substitutions Κ98Ε (A2734G), Ε1.45Α (A2876C), and L1.69F (C2947T). The mutation site is marked with an asterisk 10037) Figures 20Α-20 F show tliat EV71:TLLmv utilize SCARB2 to infect both primate and murine cells. Pre-incubation of Ν1Τ3 cells (Figure 20Α) and Vero cells figure 20Β) fixed onto Teflon slides with murine SCARB2 (mSCARB2) antisennn inhibits EV71:TLLmv binding, as determined by reduced fluorescence signals. Fluorescence intensity on membranes was measured using Imaris imaging software (n = 100). NSP (non-specific rabbit serum). Pre-incubation 0fEV71:TLLmv with recombinant soluble protein of either mSCARB2 (Figure 20C) or human SCARB2 (hSCARB2) (Figure 2011) prior to inoculation onto ΝΙΗ/3Τ3 cells reduces virus infection severity, as assessed by immunofluorescence assay. Pre-incubation of live ΝΜ/3Τ3 cells with either hSCARB2 (Figure 20Ε) ormSCARB2 (Figure 20F) antiserum prior to infection with EVTETLLmv reduces the virus titer in culture supernatant. * ρ<0.05; ** ρ<0.005;***ρ<0.0005.

[0038] Figures 21A-21D show that incubation of Neuro-2A cells witlr murine SCARB2 rabbit antiserum reduced severity of infection witli CDV mutants. Infection severity in cells pre-incubated with rabbit mSCARB2 antiserum prior to iirfectioit with CDV:BSypi[K98E/E145A/Ll69Ε] (Figures 21Α and 21Β 01' CDV:BS[M-P1] (Figures 21C aitd 21D) was monitored by assessing induction of cytopathic effects (CPE) (Figures 21Α and 21C) and vims yield at 7 days post-infection (Figures 21Β and 21D). Error bars indicate SD; * p < 0.05؛ ** p < 0.005. Degree ofCPE: 1 (0-25% cell death), 2 (25-50%), 3 (50-75%), 4 (75-100./.).

[0039) Figures 22a٠22c show that EV71.:TLLmv is the most virulent of the three modified viral strains as evidenced by induction of severe disease in 1-week old BALB/c mice. Figure 22a: Neutralizing antibody titers in sera collected from mice infected (intraperitoneal; 1,p.) witit either EV71:BS (n=6), EV71:TLLm (n=5) or EV71:TLLmv (,1=7) as assessed at the end of tlie observation period. Fibres 22b and 22c: Kaplan-Meier survival curves of mice inoculated with 10ة CCID50 (median cell culture infective dose) of EV71.-BS, EV71:TLLm, or EV71:TLLm.v either via Ι.Ρ. route (Figure 22b) or inframuscular (Ϊ.Μ.) route (Figure 22c). Statistical significance was detennined using t-test with Welch's correction for unequal variance (Figure 22a) or tlie Mantel-Cox log-rank test (Figures 22b and 22c). *p<0.05, **ρ<0.005, ***ρ<0-0005. wo 2016/122403 PCT/SG2016/050031 11 [0040] Figures 23a-23h show that EV71:TLLmv infection in mice is characterized by acute severe disease resembling the human disease spectrum. Figure 23a and 23b: Dose-dependent lethality of EVlhTLLmv infection in 1 week-old mice. Figure 23a: Kaplan-Meier survival curve of 6 day-old pups Ι.Ρ. injected with various doses of EV71:TLLmv. Figure 23b: The median humane endpoint (HD50) was equivalent to a virus dose of 3.98 X 10ت CCIDso. Figure 23c: Kaplan-Meier survival curves of 1. week-old mice inoculated with EV71zTLLmv via Ι.Ρ. or Ι.Μ. route. Figure 23d: Age- and route-dependent lethality induced by EV71zTLLmv infection in mice inoculated with a virus dose of 10٥ CClDso- Figures 23e and 23f: Clinical signs observed in tenninally-ill mice, some of which presented with paralysis of the hind limbs (gray arrow) and/or forelhnbs. Others also exhibited small, hairless lesions on the toi'so {black arrow). Figures 23g and 23h: Disease classification of 1 week-old mice inoculate with EV71:TLLtnv via the Ι.Ρ. route (Figure 23g), or Ι.Μ. route (Figure 23h).

[0041.1 Figures 24a-24e sliow that Severity of EV71zTLLmv infection in BALB/c mice depends on host age, virus dose, and route of administration. Figures 24a and 24b: Groups of 8-10 mice were inoculated with 10(’ CCIDso of virus by Ι.Ρ. route (Figure 24a) or Ι.Μ. route (Figure 24b) and tire '.Kaplan-Meier survival curves determined for animals of different age groups. Figares 24c and 24d: Neutralizing, antibody titers in sera collected at the end of the observation period from mice of various ages iiroculated vi.a either Ι.Ρ. route (Figure 24c) or Ι.Μ. 1'oute (Figure 24d); 1 week (Ι.Ρ. η=7; Ι.Μ. n=4), 2 weeks (η=5, n=7), 3 weeks (η=4؛; n=8), and 4 weeks (η=4; n=6). Figure 24e: Neutralizing antibody titers in sera collected from, mice iiroculated (Ι.Ρ.) witlr various doses of EV71zTLLmv; CCID50 102 (n=5), 103 (n=4), 104 (n=4), 105 (n=5), or 106 (n=7). Statistical significance was determined by Mantel-Cox log-rank test (Figures 24a aitd 24b) or t-test with Welch's correction for unequal variance (Figures 24c, 24d and 24e). *ρ<0.05, **ρ<0.005, ***ρ<0.0005.

[0042] Figures 25a-2Sk show Signs of EV71-induced neurogenic pulmonary edema (NPE) in Class IA mice. Figures 25a-25d: Representative gross patliology of the lungs obtained froitt mock-infected nrice (Figure 25a), or EV7lzTLLmv infected mice presenting with signs ofthsease Class IA (Figure 25b), Class IB (Figure 25c), or Class II (Figure 25d). Images show top- and sid.e_views. Note tire incomplete collapse of tire lungs apparent in Figure 25b (white arrows). Figure 25e: Wet weight comparison of lung harvested from mock-infected mice (n=4), OI" EV71:TLLmv-']\]{'cc[cd mice presenting with signs of disease Class IA (n=8). Class IB (η==9), or Class II (n=4). (Figures 25fi25i: Representative images of lung tissue sections (5pm) stained with hematoxylin &amp; eosin (Η&amp;Ε). Showir are low- and high magnification images of lungs WO 2016/122403 PCT/SG2016/050031 12 obtained from mock-infected mice (Figure 25. or £77ا7٧:ذ;-infected mice presenting Will signs of disease Class IA (Figure 25g), Class IB (Figure 25h), or Class II (Figure 25i). Note the presence of pink proteinaceous fluid in the alveolar spaces (iasterisk in Figure 25g, high mag.), some of which were also filled with erythrocytes (gray arrows in Figure 25g, high mag.). Figures 25) and 25k: Seram levels of adrenaline/epinephrine (Figure 25j) and ٩ (Figure 25k) as determined in mock-infected mice (n=9), or EV71: 7LLmv-infected mice presenting with signs of disease Class ΙΑ (n=8), Class IB (n=9), or Class II (n=3). Error bars indicate SEM. Statistical significance was determine by Mann-Wliitney test (Figure 25e) or /-test with Welch's correction for unequal variance (Figures 25j and 25k). *p<0.05, **ρ<0.005. إ0043ء Figures 26a and 26b show tlie absence of viral replication 01- inflammation in the lung and. heart tissues of Class IA mice. Figure 26a: Representative images of lung tissue sections (5 pm) derived from various groups of mice infected witli EVIlzTLLmv and stained with either Hematoxylin &amp; Eosin (Η&amp;Ε) for histopathological examination, or labelled using rabbit seram against EV71 antigens (EV71 IHC) for virus antigen localization. Figure 26b: R^resentative images ofheart tissue sections (5 pm) processed for Η&amp;Ε and EV71 IHC. ا0044أ Figures 27a-27d show representative maps depicting the localization and distribution of EV71 antigens and viras-induced lesions in different regions of Class IA and Class IB mouse brains. Tlie cerebellar cortex (CTX) (Figures 27a, 27b and 27c); hjpothalamus (HY) (Figures 27a and 27b); hippocampus (HP) (Fibres 27b and 27c); tlialamus (TH) (Figure 27b); midbrain (MB) and pons (p) (Figure 27c); and cerebellum (CBX) and medulla oblongata (MY) (Figure 27d) are indicated. Areas where viral antigens and pathologic lesions were detected are marked accordingly. Larger dots indicate stronger signalsrtesion size. Template images were downloaded from brainstars.orgl and licensed under the Creative Commons ofJapan. The brain tissue coronal, section maps were obtaiired from the interactive Mouse Brain Atlas (http colon slash slash mouse dot brain-map dot org slaslt static slash atlas) [113]. 1.045] Figures 28a-28n show that EVJL'TLLmv infection in mice is associated with nervous tissue destraction and extensive viral I'eplication. Figures 28a-281: Representative images of hi'ain, tissue sections (5pm) stained with hematoxylin and eosin (Η&amp;Ε) 01' immunostained with rabbit seram against EV71 antigens (ΕΥ71 IHC). Sections were derived from mice presenting with, signs of disease Class IA (left panels), or Class IB (right panels). Pathologic lesions in the brain included edema (dashed boxes), infiltrating cells (diagonal area in upper left quadrairt of left panel and diagonal area in lower right quadrant of Figure 28k), neuronophagia (in left panels WO 2016/122403 PCT/SG2016/050031 13 of Figures 28a-28c), neurodegeneration {black asterisk), and degeneration of Purkinje cells (gray asterisk). (Figures 28m and 28n: Representative maps of spinal cord coronal sections from mice in disease Class 1Α (Figure 28m) or Class IB (Figure 28n). Highlighted are areas where viral antigens and pathologic lesions were detected. Larger dot sizes indicate more extensive signals! esitrns. V, ventral side؛ D, dorsal side. 1.0461 Figures 29a-29c show EV71 antigens and virus-induced lesions in otlier areas of the hindbrain of Class IA mice. Figure 29a: Representative images of the dentate nucleus stained with either Hematoxylin and Eosin (Η&amp;Ε) for histopatliological examination or rabbit serum against EV71 antigens (EV71 HC) for virus antigen localization. Boxed areas are shown magnified in the inset. Figure 29b: Representative images of the caudal brainstem from Class 7 mice. Images depict the cerebellar cortex (CBX) and medulla oblongata (1). The area prostrcma (AP; asterisk) and nucleus of the solitary tract (NTS; daslied circle) are also labelled for reference. Areas where viral antigens and pathologic lesions were detected .are indicated. Larger dots present stronger signalsdesion size. Template images were downloaded from * and licensed under tire Creative Commons of Japan. The brain tissue coronal section maps were obtained from the Mouse Brain Atlas (http colon slash slash mouse, dot .brain-map dot org slash static slash atlas) (113). Figure 29c: Representative images of the medulla from. Class IA mice depicting the Η&amp;Ε and EV71 IHC staining patients in the AF and NTS. f00471 Figures 3Oa-30f show histological sections of nervous tissues from mock-infected mice (healthy controls). Representative images of normal mouse tissue sections (5 pm) stained witir either Hematoxylin &amp; Eosin (Η&amp;Ε) for histopathological examination, or rabbit serum against EV71 atttigens (EV71 IHC) for vints antigen localization. Brain sections show CA.3 pyramidal neurons in the hippocampus (Figure 30a); reticular neurons in the hypothalamus (Figure 30b) and thalamus (Figure 30c)؛ neurons in the periaqueductal gray matter (Figure 30d); Purkinje cell layer in the cerebellar ortex (Figure 30e). Note the irormal Purkinje cell morphology (black asterisks in left paitel of Figure 30e)؛ and reticular neurons in the medulla oblongata (Figure 30.. I0048J Fibres 31a-31e slrow El'71:TLLm]}-'\mk\c&amp;\\ pathology and viral atttigen distribution in other nervous tissues. Representative images of mouse tissue sections (5 pm) stained with either Hematoxylin &amp; Eosin (Η&amp;Ε) for histopathological examination or rabbit semrn against EV71 antigens for immunohistochemical analysis (EV71 IHC). Brain tissues were obtained from EV71: TLLmvAnikied or mock-infected mice. Brain coronal sections depict motor cortex WO 2016/122403 PCT/SG2016/050031 14 pyramidal neurons (Figure 31a.)؛ pontine gray neurons (Figure 31b); and spinal cord coronal sections from the cervical rigure 31c), thoracic (Figure 31d), and lumbar columns (Figure 31e). Note the cellular infiltrate (lower riglit quadrant of left panel in Fi^rre 31a) and ireuronal necrosis (black asterisks in second panel of Figure 31a) apparent in the motor cortex,. Boxed areas in Fibres 31c-31e are shown magnified in the respective insets.

DETAILED DESCRIPTION OF THE INVENTION

[0049] The present invention relates to Enterovirus 71. (EV71), the development of an animal model and screening of candidate anti-EV71 impounds. More specifically, the present invention relates to tire discovery that Enterovirus 71 (EV71) sfraiits that have been adapts to infect rodeirt cell Iin.es or cloned derived virus containing mutatioirs in VPl can cause disease in immunocompetent rodents and immuno-compromised rodents. These EV71 sfrains are sometimes referred to as modified Enterovims 71 herein.

[0050] In additioir, the preseirt invention relates to tire development of a clinically authentic model of EV71-induced neurological disease by infecting BALB/c irrice with a modified strain (eg., EV71:TLLmv) adapted to infect ΝΓΗ/3Τ3 mouse fibroblasts. Using this approach, tire modified EV71 is used to iirduce acute encephalomyelitis associated witlr neurogenic pulmonary edema in mice, characterized by lung swelling and increased organ weight conrpared with mock-infected lungs. Despite the absence oflung or cardiac tissue inflamnration, focal hemorrhage and proteinaceous fluid in the alveoli, lrigh serum levels of catecholamines, and extensive tissue damage in tire brainstem, particularly the medulla oblongata were observed. Tlrese data demonstrate that tire model, accurately l'eproduces the signs and symptoms of human EV71-induced neurogenic pulmonary edema.

[0051[ Thus, in one aspect, the present invention, relates to an animal model that comprises a rodent infect^ witlr an Enterovirus 71 capable of infecting the rodent, sometimes referred to herein as a modified Enterovirus 71.. In one enrbodinrent, suclr a nrodified Enterovirus 71 is a rodent cell line adapted Enterovirus 71. I.n another embodiment, such a modified Enterovirus 71 is a clone derived virus (CDV) containing mutations in VPl. hr some embodiments, tire mutations in VRl enable the CDV to use rodent SCARB2 proteins to infect rodent cells. In one embodiment, the rodent is an imnruno-competent rodent, hr anotlrer embodiment, the rodent is an immuno-compromised rodent. Suitable animals for' use as models are preferably mammalian animals, most preferably convenient laboratory animals suclr as rabbits, rats, mice, and the like. In one embodiment, the animal is a mouse, hr another embodiment;, the rodent cell line is a WO 2016/122403 PCT/SG2016/050031 15 mouse cell line. In a firrther embodiment, the mouse cell line is a mouse Ν1Ή/3Τ3 cell line. In another embodiment, the mouse cell line is a mouse Neuro-2a cell line. In one embodiment, the rodent cell line adapted Enterovirus 71is EVlETLLm. In another embodiment, the rodent cell line adapted Enterovirus 71 is EV71:TLLm. In one embodiment, the clone derived vims containing mutations in VPl is CDV:BSm[K98E/E145A/L169F]. The animal model is usefill for studying systemic spread of the vims anti liuman disease spectrum in animal models. The animal model is also usefirl for screening antiviral drugs and vaccines. 1.052] Tire animal model is prepared on an as needed basis. A large standardized stock of rodent cell liire-adapted EV7I strains is prepared, titrated aird kept in a deep fteezer (miirus 80.C). A “standardized" (based oir statistical calculatioir) number of rodents, such as BALB/c mice or NSG jnice, are infects with a standardize titer of tire vims strains to produ.ee tire animal model. Tire animal model of the present; iirvention develops neurological symptoms (similar- to those tlrat carr develop irr humans) upon infectiorr. As showir hereirr, tire modified Enterovirus 71, such as rodeirt cell line-adapted EV71 vims strains, affect brain and a variety of neurological diseases tlrat are irranifested in mice. 10053.1 In some embodiments, the rodent cell line adapted Enterovirus 71is EV71:TLLm. EV71:TLLm was derived, following serial passage of the hunran. EV71 BS strain in ΝΙΗ/3Τ3 mouse cell line for a minimum of 60 cycles. Irr one embodiment, EV7]:TLLm was deposited on 12 January 201.5 uirder tenns of the Budapest Treaty with Clrirra Center for Type Cultrrre Collection located at Wuhan University, Wuhan 430072 Poples Republic of Clrina, and assiged Accession Number CCTCC V201437. Irr another embodiment, EV71:TLLm can be recover'ed using advanced reverse genetics if tire viral RNA is synthesized using the viral RNA sequence (GenBank Accession No. ΚΕ514879; SEQ D NO: 1). Techniques for advanced reverse genetics are well known iir the art [84-87]. 0054؛] In. airotlrer embodiment, the rodent cell line adapted Enterovirus 71 is EV71:TLLmv. EV71:TLLmv was deiived ftonr firrther passage of EV71:TLLm in ΝΙΗ/3Τ3 mouse cell line for another 40 cycles. In one embodiment, EV71:TLLmv was deposited, on 1.2 January 2015 under terrrrs of the Budapest Treaty with China Center for Type Culture Collection located at Wuhan University, Wuhan 430072 Peoples Republic of China, aird assigned Accession Number CCTCC V201438. Iir another eirrbodimeirt, EV7ETLLmv can be l'ecovered using advanced reverse genetics if the viral RNA is synthesized using the viral RNA sequence (GerrBairk Accession No. ΚΕ514880; SEQ ID NO:2). Teclrniques for advanced reverse genetics are well known in tire art. WO 2016/122403 PCT/SG2016/050031 16 ل55؛؛لا؛ In a farther embodiment, the modified Enterovirus 71 is a clone derived virus (CDV) having mutations in the apsid protein VPl which enables the modified Enterovirus 71 to use rodent SCARB2 proteiirs to infect rodent cells. A modified Enterovirus 71 lraving mutations in VPl is made by preparing a fall length genomic cDNA clone usfag techniques known to the skilled artisan or as described herein. Mutations in VPl or other proteins of Enterovirus 71 are made using site-directed mutagenesis or CRISPR technology (see, e.g., PCT Publication No. W02014/127287). Live vims (clone derived vims (CDV)) is prepared from the cDNA clones clone using techniques known to the skilled artisan or as described herein. CDVs having different mutations or collections of mutations are then tested for faeir ability to infect rodent cells. Alternatively, CDVs having different mutations or collections ofmutations are then tested for their ability to bind to rodent SCARB2 proteins as an initial screening. Aity suitable Enterovirus 71 strains can be used to develop CDVs having mutations in VPl. The number of mutations may and specific mutations vary for each strain in order to produce CDVs that are sufficient to produce a fall blown infection in the target rodent cell. Thus, nrultiple rodeirt viraleirt EV71 strains can be produced that can infect several, many or all types of rodent, e.g., mouse, cell lines. In embodiment, the EV71. sfraitt used to produce a CDV having mutations in VPl is Enterovirus 71 BS strain. ئ one embodiment, the ntodified Enterovirus 71 is CDV:BSypiK98EE145ALi69F).

[0O56J In another aspect, the pr'esent invention provides a method for preparing an animal model with the fall-spectrum of EV71-induced neurological infection, disease and pathology observed in humans. In some embodiments, tire metlrod comprises infecting a rodent described lrei'ein with a modified Enterovirus 71 described herein aird raising the infected rodent for up to about 4 weeks. In oite embodiment, tire modified Enterovirus 71 is EV71:TLLmv. In anothei" embodiment, the modified Enterovirus 71 is EV71:TLLm. In a farther embodiment, the ltrodified Enteroviras 71 is CD V:BSvpi[K98E/E145A/L169F], ئ some embodiments, the age of the rodent to be infected is between about 1 week and about 4 weeks. In other embodiments, the age of the rodent to be infbcted is betrveen about 1 week and about 3 weeks. In other * the age of tire rodent to be infected is betweeir about 1 week and about 2 weeks.

In one embodiment, the age of the rodent to be infected is about 1 week, fa anofaer' embodiment, the age oftlie rodent to be infected is about 2 weeks, fa a farther embodiment, tire age of tire rodent to be iirfected is about 3 weeks, hr some embodiments, tire iirfected rodent is raised for about 1 week to about 4 weeks. In otlrer embodiments, the infected rodeirt is raised for about 1 week to about 3 weeks. Iir other, embodiments, the infected rodent is raised for about WO 2016/122403 PCT/SG2016/050031 17 1 week to about 2 weeks. In one embodiment, the infected rodent is raised for about 1 week. In another embodiment, the infected rodent is raised for about 2 week's. In an additional embodiment, the infected rodent is raised for about 3 weeks. In a filrther embodiment, the infect^ rodent is raised for about 4 weeks. In some embodiments, the rodent is an immune-compromised rodent. In some embodiments, the rodent is a mouse as described herein, hr one embodiment, the immune-compromised mouse is a BALB/c mouse. In other embodiments, the rodent is infected by inoculating the rodent with tire modified Enterovirus 71. In one embodiment, tire inocidation is intraperitoneal (Ι.Ρ.). In anothei" embodiment, the inoculation is intramuscular (Ι.Μ.). In some embodiments, the vims dose inoculated into he rodeirt is a median cell culture infectious dose (ccroso) between about between about 103 and about 107. ,In other embodiments, the virus dose inoculated into the rodent is a CCIDio between about between about 103 and about 10٥. hr OJre embodiment, the vims dose inoculated into tire rodent is a CC1D50 between about 4 X 103 and about 106. In another embodiment, fire vims dose inoculated iirto the rodent is a CCID50 behveen about 1.4 aird about 106. hr an additional embodiment, the vims dose inoculated into tire rodent is a CCID50 between about 10و and about 106. In OJre embodimeirt, tire vims dose inoculate into tire rodent i.s a CCID50 of about 106. 1..057] The animal model prejrared in. tlris manner is air authentic mouse model of EV71 neuro-infection that exhibits face validity, /.،?., these animals display the entire range of clinical signs tlrat can be obserwed across the fifil spectmm of neurological disease induced by EV71 iirfection iir lrumair patients, including NPE. This animal model also displays coirstuict validity with respect to fire gross and histopaihological features of disease, which closely resemble those reported in fatal hunran cases. This irew in vivo nrodel presents a powerful tool for identifying fire key events iir EV71 neuro-pathogenesis, for dissecting the mechanism of EV71-induced NPE, developing novel, treatment modalities and potential antiviral, therapies, and for conducting pre-clinical evaluation of novel, vaccines. (0058] In. an additional aspect, tire present invention provides a method to screen antiviral drugs. In accordance with tlris aspect, tire metlrod comprises tire following steps: providing a test gJOUp of animals and a control group of animals in which the anhrrals of each group are animals of the animal model desci'ibed herein; administering to the test group an antiviral drug candidate; monitoring disease progression in the test group and the control group; comparing fire disease progressioir in the test group to tire disease progression irr the control group; and selectirrg the antiviral drug candidate that reduces disease progression in fire test group relative to the control group. In one embodimerrt, the arrtiviral dmg is first screened in a test rodnt cell WO 2016/122403 PCT/SG2016/050031 18 line infected with the rodent cell line adapted Enterovirus 71 before screening in the animals. In another embodiment, the antivil'al drug is first screened in a test rodent cell line infected with a clone derived vims (CDV) containing mutations in VPl before screening in the animals. 111 !0059؛ a fiirtlrer aspect, the present inventioir provides a ineth antiviral vaccines. According to this aspect, the method comprises the following steps: providing a test group of animals and a control group of animals in which the animals of each group are animals of the animal model described herein.; administering to the test group an antiviral vaccine candidate; monitoring disease progression in the test group and the control group; comparing the disease progression in tlie test group to disease progression in die ontrol group; and selecting the antiviral vaccine candidate tliat reduces disease progression ئ die test group relative to the control group. In one embodiment, the antiviral vaccine candidate is first screened in a test rodent cell line infected, with the rodent cell line adapted Enterovirus 71 before screening ill tlie animals. In anodier embodiment, the antiviral vaccine candidate is first screened in a test rodent cell line infected with clone derive! virus (CDV) containing mutations in VPl before screening in tlie animals, [0060] l.n accordance with the mediods of the present invention, a large standardized stock of rodent cell line-adapted EV71 strains is prepared, titrated and kept in a deep freeze (minus 80.C). Alternatively, a large standardized stock of clone derived virus (CDV) containing mutations in, VPl strains is prepared, titrated and kept i.n a deep freezer (minus 80.C). A “standardized” (based, on statistical calculation) number of animals, such as Balb/c mice or NSG mice, are infected with a standardize! titer of the virus sfrains. The candidate antiviral drug or antiviral vaccine is administered to the infected rodents at various standardize dosages at before appearance of illness (for assay of preventive effect) or at onset of illness (for assay of therapeutic effect of the drug). In one embodiment, high through-put ،'« vitro screening of anti-EV71 compounds is performed using tissue culture cell lines susceptible to cytolytic infetion by the rodent cell lined adapted EV71 virus sfrains, such as those described herein, including tlrose describe! in the Examples. In another embodiment, high through-put in vitro screening of anti-EV71 compounds is performed using tissue culture cell, lines susceptible to cytolrfic infection by clone derived virus (CDV) containing mutations in VPl straiits, such as those described herein, including the Examples. The in vitro screening is performed using techniques well known in the art. The selected promising compounds from tlie in vitro screening are then screened in vivo in tlie animal model described lierein. WO 2016/122403 PCT/SG2016/050031 19 [.061] As shown ill Examples 2-8, sequential passage of the human EV71 isolate (.EV71:BS) generated virus strains tliat gained the ability to infect in vitro cultured rodent cell lines. The mouse adherent fibroblast cell line ΝΜ/3Τ3, wliich was derived from the ΝΙΗ/Swiss mouse embryo [46], was used to adapt the liuman EV71 strain to infect rodent cells. Two such. l/3T3-adapied strains are described - EV71:TLLm and EV71:TLLmv, where EV71;TLLm represents the early stage (passage number 60) and EV71:TLLmv represents tlie late stage (passage numbei-100) oftlie adaptation process. Based on the appearance of virus-induced CPE, measurement of high titer valu.es, and positive detection of viral antigen through immunostaining, we categorized the virus-induced infection in cells as either productive or non-productive. Productive infection exhibits positive vil'al antigen detection as well as high virus titers, regardless of observation of CPE. On the other hand, non-productive infection is characterized by immeasurable virus titer at cut-off assay limit despite viral antigen detection and/or observation of CPE. 0062؛] Whereas the clinical isolate EV71.-BS infects only pri.mate cell lines, EV71:TLLm productively infects both primate and rodent cell lines. It is worth noting tlrat altliough EV71:TLLm vims has successfully acilieved the ability to iirfect rodent cells, tire degree of adaptation to Ν1Η/3Τ3 cells is less pronounced. The viras titer detenmined using Vero cells is much, higlrer than that determined in ΝΠΕ3Τ3 cells, as indicated by negative values in relative replication rates P) assay (Figures 5C and 5D). Iir addition, EV71:TLLm successfillly infects Vero cells leading to frill CPE at various incubation temperatures whereas it can only achieve frill CPE in infected ΝΙΗ/3Τ3 at 37.C (Tiible 1). Further adaptation in mouse cells, wlrich yielded the EV71:TLLmv vims, resulted in a virus strain that displays a higher degree of adaptation to mouse cells (Figure 5Β) but at the cost of narrowing down the spectrum of permissible host cells. EV71:TLLm.v does not infect primate cell lines as effectively as mouse cells although it exilibits successfill infection leading to frill CPE of ΝΙΗ/3Τ3 cells incubated at a broader range of temperatures (Table 1). Howeve, compared to the predecessor EV71:TLLm, EV71:TLLmv seemed to have lost the ability to enter and replicate in monkey kidney cos-7 cells, as well as human HeLa and Hep-2 cells (Figures 3B-3C؛ Figures 2B-2C, 2E-2F, and 2Η-2Ι). It also lost the ability to replicate efficiently witilin hamster CHO-K1 and rat NRK cells (Figures 3B-3D; Figures 2K-2L and 2Ν-20). Tliese observations indicate tliat filrtlier passage of the vims in ΝΙΗ/3Τ3 cells increases the degree of adaptation in mou.se cells at the cost of losing infective abtiity in cell lines of other origin. WO 2016/122403 PCT/SG2016/050031 20 (.063] Although It Is not possible to pinpoint which amino acid substitutions are adaptive to the mouse ΝΙΗ/3Τ3 host cell, viral whole genome sequencing may sired light to potential adaptive meclranisms. Most of the amino acid substitutions identified l'eside in tire PI (capsid) and RNA polymerase (3D l'egion) proteins (Table 2, 3), suggesting possible altered vims protein activity in lrost cell entry and replication. The accumulation of nrutations in the PI. region is expected from the acquired ability ofEVJlzTLLm ajrd EWlzTLLmv strains to infect new host cells. Capsid proteins fonrr the stnrctural context with which the vinrs initiates interaction with tire pennissive host cell through the vinrs receptor, which had heeir identified recently as Scavenger Receptor Class B Member 2 (SCARB2) (47] atrd later characterized as the main vinrs uncoating l'eceptor of EV71 (48] and whiclr is also utilized by some nr embers of Human Enterovirus A (HEV-Α) species. The human SCARB2 piOteiir shares approximately 99% sequence iderrtity with that of other prinrates. Oir the other hand, mouse SCARB2 protein exhibits 1.5% sequence dissimilarity compared to the primate protein (49], implying significant stnrctural deviatiorrs from primate SCARB2 and pehaps contributing to fire recalcitrance of rodent cells to rrative EV71. irrfectiorr. It is plausible that adaptive mutations in the vinrs capsid may rerrder the vinrs competent to bind tire mouse cell receptor and result in successfirl entry arrd infection of novel hosts.

[0064] Majrping of the capsid protein nrutations indicate tlrat majority of the identified amino acid substitutions in the viral PI. region reside in exposed regions of the protein (Figrrres llA-llD), specifically in tire BC, D-E, E-F, and G-.H loops on tire surface ofVPl. The VPl residues 150-180 harbour the viral capsid canyon tlrat engages SCARB2 protein. This region centred at Gln-172 coirtaiirs a major VPl neutralization epitope at amino acids 163-177 [32]. Both EV71:TLLm and EV71:TLLmv exhibited substitutions E167D and L169F in the E-F loop of the VPl carryon (Figures 11Α-11Β), loci which have not been previously reports. Other significant amino acid substitutions near the SCARB2 docking site ijrclude N104D widrin the B-C loop arrd S241L in the G-H loop, which are located within a 20 A radius from Gln-172. The VPl S241L mutation, in associatiorr with the Κ244Ε, lrad been previously reported arising fronr mouse passage of a CHO cell line-adapted EV71 [50]. This mutatioir, ijr combination witlr a VP2 Κ1491, was fouird to be associated with a ηοη-Wruleirt phenotype in 5-day mouse pups. However, a reverse mutation at VPl 241 from Leu to Ser [51.] was reported arising from adaptation in NOD/SCID mouse brain tissues and fouird to be associated, with a mouse virulent phenotype. The VPl Ε145Α mutatioir, which is far from the SCARB2 docking site and located in the D-E loop, is anothei- cairdidate for* conferring the ability to iirfect muriire cells. Tire VPl WO 2016/122403 PCT/SG2016/050031 21. 145 mutation had been previously reported 37 ,34؛] and a single Ε145Α mutation, leads to virulence in NOD/SCID mice [51]. Another mutation in VPl of a C4 genotype EV71, Q145E, was associated with vimlence in 5-day old mice [52], The mouse cell-adaptive mutations in ٧P2, particularly those within the neutralizing epitope of residues 136-150 [53], may also contribute to the virus ability to infect rodent cells. Two substitutions in VP2 E-F loop were observed in EV71:TLLm (Figure lie), while three substitutions were present in EV71:TLLmv (Figure HD). None of these mutations have been previously described, although a nearby locus at VP2 149 in the E-F loop had been mentioned in the literature [34, 50, 54] and described as an adaptive mutation to passage in PSGL-1 overexpressing cells [55].

[0065] To explore the possible role of the PI region mutations in binding he virus receptor for host cell entry, EV7LBS viral RNA was transfects into murine cells. Direct introduction of E]'71:BSh\ into the mouse cell cytoplasm results to productive infection in Ν13Τ3 cells, as suggested by the observation of virus-induced CPE and. measurable vinrs titers in the culture supernatant as assayed in Veo cells (Figure 12). Re-inoculation, of the virtts supernatant onto fresh ΝΠΤ3Τ3 cells, however, fails to induce productive infection (Figure 6Α) and no viral antigens were detected (Figure S4H). Similarly, transfection of EV71:BS RNA into N'euro-2A ceils, but not direct virus infectioir, resulted in positive antigen staining in N'euro-2A cells (Figures IOC and, 10D) and measurable virus titers (Figure 12). Vims supernatants passaged onto fresh Vero and Ν1Ή/3Τ3 cells resulted to positive antigen staining in Vero (Figure 10Τ) but not in ΝΙΗ/3Τ3 cells (Figure 10J). These data indicate tltat circumventing the requirement of receptor engagemeirt for ltost cell entry led to successful infection and production of vims progenies in Ν1Η3Τ3 and Neuro-2A cells. These data also support that human EV71:BS canitot successfolly enter mouse Ν1Η/3Τ3 and Neu.ro-2A cells through murine cellular receptor. Moreover, these data suggest that mutations within the PI region of EV71:TLLm and EV7J:TLLmv genomes confer the vims with the ability for efficient receptor engagement, aitd consequently host cell entry.

[.066] Several amino acid mutations were also observed in the Ρ2 and Ρ3 regions, which encode vims proteins that are cmcial for vims replication and hijacking the host cell protein translation jnachinery [56]. These adaptive mutations may fonction in optimizing EV71 geitome replication and franslation within mouse cells. Tlte viral 3D protein alone accumulated 8 antino acid substitutions in EV71:TLLmv and 4 in EV71:TLLm, and both sfrains exhibited 1 mutation each in 3Β and 2 mutations eaclr in 3C. Direct inoculation of viral RNA into TCMK cells give insiglrt into the possible role of the adaptive mutations in the nonstmctural proteins of the vims. WO 2016/122403 PCT/SG2016/050031 22

Although, TCMK cells have been shown to be permissible to EV71:TLLm and EV71:TLLmv infection (Fibres 3Β and 3D؛ Figures 4Q and 4R), transfection ofEV7TBS viral RNA into TCMK cells did not result to successful infection. Viral antigen signals were not detected in infected and transfected cells (Fibres 1OE-10F), and passage of viras supernatant onto fresh ΝΜ/3Τ3 and Vero cells did not yield positive viral antigen detection (Figures 10Κ and 10L). Moreover, there was no assayable virus titer in botlr infected and trairsfected cells (Figure 12). These data suggest that apart from mutations in tire capsid region, mutatioirs within the Ρ2 and Ρ3 regions, which are fouird in EV71:TLLm and EV71:TLLmv, are requil'ed to successfully infect TCMK cells.

[00671 It is believed that tlris is the first report of EV71 strains originally deiived fi'om human clinical sample that have successfirlly gained the ability to productively ijrfect several rodent cell hires following successive passages in a nrouse cell line. The relatively higlr mutation rates during RNA replication results in variant genomes that serve as genetic reservoirs of phenotypic fraits for future adaptive potential, and fire consequential replication as a quasispecies distribution [57, 58] leads to the dynamic plasticity of RNA viral genomes conferring adaptability to changing environments [59, 60]. Although EV71 infecting suckling mice [34, 37, 38,51] and other rodents (e.g., gerbils) [39] have beeir reports previously, none was reported to productively infect in vitro cultured rodent cells. This may be due to the high genetic barrier associated with major changes in phenotype and host range [58]. Interestingly, this is the first report of a large number of adaptive mutations witlrin the consensus firll genome sequence of EV71. Whereas previously documents mouse-adapted EV71 reported less than 10 amino acid substitutions in the genome [34, 38, 51], we report 21 in EV71:TLLm and 36 in EV71:TLLmv, still more than the most number of adaptive mutations previously identified [37]. These suggest that few passages of tire virus in mouse tissues [34, 36, 37] nray not be sufficient to break fire genetic barrier and successfillly adapt fire viras to infect cultured mouse cells. Instead, hundreds of successive passages might be necessary, as is observed in this sfirdy.

[0068] The host cell restriction of EV71 had receirtly beeir explained witlr tire demonsfration that EV71 utilizes Scaveirger Receptor Class B Mtmrber-2 (SCARB2) as its fimctional receptor for host cell entry [47] and viras uncoating in the endosome [72]. The human aird murine SCARB2 proteins exhibit only 84% amino acid sequence identity [67] suggesting stractural differerrees between the two proteins. This sceirario explaiirs the general inability of EV71 clinical isolates to infect mouse-derived cells, as well as tire general resistance of mice and othe WO 2016/122403 PCT/SG2016/050031 23 rodents to EV71 experimental infections, which complicates efforts in developing small animal models of EV71 infetion. Despite this virus-receptor incompatibility, however, we have shown that some murine cells support Ε٧71 infection when the initial stage of infetion, i.e. receptor-mediate cell entry, is bypassed through viral RNA tiansfection into cells. EV7!:BS does not infect Neur0-2a and ΝΙΗ/3Τ3 cells [71], but transfection of viral genomic RNA results to expression of EV71 proteins, induction of lytic c^opathic effects (CPE), and production of viable virus progeny. Similarly, live viius had been previously generated following transfection of Poliovirus RNA into mammalian cells [73-75], though the cells used (HeLa) were known to be permissive to Poliovirus infection. In our experiments, non-permissive mouse neuronal Neur0-2a and fibroblast ΝΙΗ/3Τ3 cells were demonstrated to support viral replication and, generate live virus progeny upon transfection of EV7!:BS RNA into the cjrtoplasm, suggesting tlrat the internal environment of murine cells contain host factors required for EV71 infection and support completion of tlie virus infection cycle, and that EV71 proteins are fimctional in murine cytosol. Tlrese findiirgs also imply that the absence of Ν1Η/3Τ3 and Neur0-2a cellular infection upon virus inocidation may be due to a defect in receptor-mediated host cell entry aird uncoating, whicli is mainly tire fitnetion of the capsid protein. These results were sinrilar to our previous observations (above 01. [71]) and led US to the h^othesis that certain amino acid substitutions in the EV71.-BS capsid protein may enable it to bind its receptor, tlius leading to vims entry and uncoating, and subsequently infect mouse cells. Two unique tools - the mouse cell line (NIH/3T3)-adapted EV71 sfiains (EV7!:TLLm and EV71:TLLmv) and the two mouse cell lines (Ncur0-2a and Nffl/3T3), provide the opportunity to investigate this hypothesis.

[0069] The infection phenotype of chimeric clone-derived vims exhibiting EV71:TLLm capsid proteins but expressing EV71:BS non-structural proteins (iCDV:BS[M-P1J) confinned tlrat the "mouse cell-entry phenotype" coidd be conferred by the capsid protein derive! fiom mouse cell line-adapted EV71 strains.. Tlrese chimeric CDV behaved similar to mouse cell-adapted EV71 strains and induced productive infection in Vero, as well as Nffi/3T3 and Nemo-2a cells, with direct evidence for completion of virus infection cycle, i.e. generation of viable vims progeny. Furtlter, mutageiresis of EV71-.BS VPl to introduce amino acid substitutions Κ98Ε, Ε145Α, and L169F aitd in VP2 S144T and Κ149Ι led to limited infection of murine cells. Only CDV witlr EV71:TLLm PI region replacement (CDV:BS[M-P1]) aird CDV having the combined amino acid substitutions VP 1-Κ98Ε/Ε145 A/L169Ε 0CDV:BSypi[K98E/E145A/L169E7) could be successfolly passaged in Neur0-2a and ΝΙΗ73Τ3 cells ،0 produce viable vims progenies in the resultant cidture supenatant. The rest oftlre CDVs WO 2016/122403 PCT/SG2016/050031 24 containing otlier amino acid substitutions, either individually or in various combinations, exhibited limited entry into murine cells leading to one cycle of replication, as supported by the observation of CPE and detection of viral antigens in the inoculated cells, live virus progeny were absent in the infected cell cultiire supernatants, as its re-inoculation onto healthy mouse cells failed to induce infection. The reason precipitating the failure of viable vinis progeny production in the culture supernatant of cells infected with these CDV is unclear, but one possibility may be due to structirral instability of the resultant capsid following the mutations. We suspect that the introduced amino acids may be incompatible witlr other amino acids comprising tire protein, tltus affecting the entire capsid protein fold and altering the capsid structure. This assumption highlights the complexity of capsid protein assembly, where four viral proteins (VP 1-4) cooperatively interact to generate a ftjnctional capsid. Thus, amino acid substitutions that may enable the virus to bind irew receptors could also have catastrophic consequences, especially if it inadvertently destabilizes the capsid complex because of incompatibility with otlier amino acid residues in tlie protein. 007.1؛ The results shown in Examples 10-17 reveal that three VPl substitutions; Κ98Ε, Ε145Α, and 1,-1691 are necessary and sufficient to bind its receptor on mouse cells and enable EV71 entry. Although the VPl-169 residue had not been previously mentioned in the literature, the VPl-98 and VPl-145 residues had been previously implicated as markers tbr binding human PSGL-1 receptor proteins on leukocytes [76]. Analysis of 1,702 VPl sequences of EV71 clinical isolates published in Genbank confirmed the viability, albeit rarity, of the mutant combination VPl 98Ε/145Α, which appeared in only 5 isolates (0.3% of the database). On the other hand, the VP1-169F variant was not observed in the surveyed database of EV71 VPl sequences, demonstrating its extrene rarity. The CDV;BSypi[K98E/E145A/L169F] could be stably passaged onto Neur0-2a cells and consistently produced live vims progeny while retaining he introduced mutations into tlie virus genome for three passages, suggesting hat this vims is viable and stable at least in Neur0-2a cells. Thus, it is possible hat introducing hese three residues: VPl 98Ε, 145A, and 169Γ, into other EV71 clinical isolates could enable it to infect murine cells, although this remains to be demonstrated.

[0071] Similar- to previous findings that EV71 utilizes Scavenger Receptor Class B Member-2 (SCARB2) protein as its receptor for host cell entry anti uncoating into the cytosol [47, 72, 77], our data also demonstrate that the mouse cell-adapted EVUzTLlmv utilize mouse SCARB2 (rnSCARB2) to infect murine cells. The virus dhectly bound recombinant soluble mSCARB2 in vitro, and pre-incubation of live virus witli he protein prior to inoculation onto healthy cells WO 2016/122403 PCT/SG2016/050031 25 reduced the severity of celiular infection. Further, blocking the free surfaces of mSCARB2 on host cells by binding with polyclonal antibodies against nrSCARB2 reduced both virus binding on fixed cells and inhibited the infection of live cells. The results also exhibit EVlhTJimv binding to human SCARB2 (hSCARB2) protein, which the virus use to infect primate cells. Binding to aird infection ofprimate cells with EV71:TLLmv is also blocked by antibodies against hSCARB2. While the data presented here only showed EV71:TLLnrv, the results are also extended to EWJrTLLm. EV71:TLLmv was derived from further passage of EV71:TLLm in Nffl/3T3c cells, and only a few amino acid substitutions wee obseived between tire two mouse cell line-adapted EV71 straiits. Therefore, these indicate that both EV71:TLLm and EV71:TLLmv utilize cellular mSCARB2 for infection of rodent cells.

[0.721 Similarly, both CDV:BS[M-P1J and CDV:BSVpi[K98E/E145il69F] utilize mSCARB2 to infect murine cells. Pre-incubation of Neuro-2a cells with mSCARB2 antiserum blocked cellular infection witlt the virus, as supported by reduced CPE induction and lower virus titers compared to control. Receirt data showed SCARB2 binding to EV71 canyon triggers the release of tire "pocket factoi‘," a lipid within tire capsid canyon tlrat stabilizes the mature virion and is presumed to be sphingosine in EV71, [78], precipitahirg a series of events iir virus uircoating: capsid expansioir (to fonrr the 135-S or A-particle), extnrsion of the VPl N-terminus and VP4 from tire five-fold axis capsid junction into the eirdosome membrane, and release ofthe viral genomic RNA into he host cell cytoplasm [78-81]. The recent human SCARB2 crystal stracture data also l'eveals a lipid tunnel fraversing the entire protein [67], whiclr in the context of SCARB2 fimetion ofdeliveriirg β-glucocerebrosidaseto the lysosome has no relevance, but to which Dairg et al. [72] proposed that it selves as a conduit for removal and fransport of sphingosine from the capsid canyon during SCARB2 binding. The SCARB2 amiiro acid residues 140-151, whose sequences are highly divergent behveen he human and murine proteins, are the main biirding site for EV71 [49]. This same region acts as a gate controlling the opening and closing of tire SCARB2 lipid tunnel, an event trigger^ by acidic pH during vims uncoating. The V.Pl-169 residue lies witlriir the capsid canyon, aird probably has a direct firnctioir in SCARB2 binding. The drastic change from Leucine to Phenylalanine in this position may have altered the carryon strticture resulting to a better fit wih murine SCARB2 protein. The VPl 98 and 1,45 residues, on the other hand, lie oir he ftiirge surrounding he capsid canyon arrd may have another firnctioir aside fioirr SCARB2 biirding. These are simply hypotheses, and it would be necessary to solve the struettrre of murine SCARB2 protein and map tire interactions WO 2016/122403 PCT/SG2016/050031 26 with the virus capsid in order to elucidate the exact mechanism by wliich, the tliree VPl amino acids substitutions could arnfer he "mouse cell-entry phenotype." [0073] It is believed that this is the first scientific exploration of EV71 capsid site-specific mutations that induce productive infection of naforally non-permissible murine cells. Previous studies attempted to overcome virus liost restriction through eitlier selective virus adaptation, as iir the case of passage in live animals to generate mutants with improved infection profile in mice [34, 37, 38, 82], or cellular alteration by ectopic expression of human SCARB2 protein [47, 69, 70, 83]. The iircompatibility of EV71 to murine SCARB2 generally accounts for the resistance of mice to EV71 infection, thus impeding the development ofmo'use nrodel of EV71 infectioirs. Tlris probably also explains wiry most mouse models of EV71 infection firat use either wild type or mouse-adapted vims strains fail to recapitulate the spectmm of diseases observed iir severe human iirfections [34, 37, 38]. Otr tire other hand, transgenic mice expressing human SCARB2 exlribited featmes of more exteirsive EV71 infection witlrout he need for mouse adaptatioir of the vims, but the foil spectmm of human diseases still could not be clearly reproduced [69, 70]. The demoirstration herein that certain amfoo acid substitutions in EV71 enable it to infect murine cells provides the first step in understanding tire molecular mechanisms tlrat eirable the mou.se cell line-adapted EV71:TLLm aird EVJlzTLLmv to efficiently infect cultured rodent cells. ئ addition, it may provide another approach to generating a mouse model of EV71 infection to study detailed pathogenesis and reproduce the foil spectrum of neurological diseases seen in lrunran infections.

[0074] In Exairrples 22-25, it is denronstrated for the first ti.nre tlrat young BALB/c nrice hroculated witlr a mouse cell-adapted enterovirus 71 (EV71) exhibit an acute eirceplralomyelitis associated with neurogenic pulmonary edenra (NPE) tlrat closely reserrrbles foe pathology observed in infectetl Irunrarr patients. Animals challenged, witlr the adapted viral strain EV7J:TLLmv displayed varying levels of virus-induced tissue damage in both tire pyramidal and extrapyramidal regions of foe braiir, presenting as paralysis, ataxia and tremors, and corrsistent with the CNS-localized pafoology idejrtified in fatal cases of EV71 infection [91-95]. Furthennore, sotne mice display^ respiratory distress coirrpatible witlr autonomic nervous dysfirnction. Based on disease presentation at the tinre of euthanasia, animals could be readily classified into four groups: Class IA, Class IB, Class II and Survivors. While Survivors did not present si^rs of disease, mice iir Class 77 exhibited persistent flaccid paralysis and severe weiglrt loss, wlrereas Class 74 and Class IB mice additionally suffered from acute neurologic disease WO 2016/122403 PCT/SG2016/050031 27 that was universally lethal within 3-7 DPI. Class IA mice also exhibited patent severe respiratory distress that was not due to either congestive heart failure or pneumonitis. Instead, airimals in Class IA exhibited extensive tissue damage in the caudal brainstem, particularly the medulla, along with high serum levels of catecholamines, strongly suggesting that the respiratory signs observed in these mice were a consequence of neurogenic pulmonary edema (WE). Gross pathological comparison of lungs from Class IA mice with, those from other' groups revealed incomplete lung collapse at necropsy, as well as significantly increased lung wet weight, likely due to hemorrhage and fluid leakage into the alveolar spaces, Tlrese features closely resembled those observed in experimental animal models of non-virally-induced NPE and, fatal human cases with firlminant NPE (96) 97], Indeed, histopathological analyses of Class IA animals firrther revealed focal areas of alveolar spaces filled with proteinaceous and crythrocyfe-filled transudate consistent witlr observations in fatal human cases [21, 98-10.1.

[.075] Pubnonary edema (PE) is typically defined as an extravascular increase in the water content of the lungs,48 and can be subcategorized on the basis of cardiogenic or neurogenic origin. Since Class IA mouse heart tissues exhibited nonnal histology and lacked overt signs of disease we were able to exclude cardiogenic PE, and the absene of viral replication or inflammation in the lung parenchyma exclude, diret virus-induced tissue injury. Instead, we detected high serum levels of catecholamines in Class IA mice, sfrongly indicating that flriis group exilibited neurogenic PE (NPE), which has previously been demonstrated as a cons٩uence ofcatecliolamine storm induced by severe sympathetic discharge [96, 101]. In this scenario, ariritonomic nervous system dysfimetion diggers a catecholamine stonn, resulting in systolic and pulmonary vasoconstriction. This leads to a shift in blood volririme from systemic to pulmonary circulation, wilieh culminates in plasma leakage and hemoirhage into the alveolar spaces either through a hydrostatic mechanism or due to direct; pulmonary endotlielial, injury [101-104]. While several experimental animal models of non-virally-induced WE have been developed in recent years (see Sedy [103] and Davison [104] for review), ours is the first: to successfully induce the classical signs of pulmonary edema using EV71 infection alone. Thus, our new model constitutes a significant advance iir the pursuit of antiviral therapies and freatment regimens that can limit EV71 infection and preveririt the onset of firlminant NPE in human patients. Although it is possible that pulmonary edema can also be induced by host cytokine stomi in response to EV71 infection [105-107], the data strongly suggest that a major mechanisnr of EV71-induced WE does not involve a massive inflammatory response and i,s instead associated with tissue damage in specific regions of the brain. WO 2016/122403 PCT/SG2016/050031 28 (0070) Brain regions associated with NPE induction have been designated as trigger zones, which encompass the hypothalamic paraventricular and dorsomedial nuclei [101, 103], and, the ventrolateral and dorsal medulla, including the NTS and AP regions [96, 104, 108-110]- EV71-induced NPE has previously been attributed to extensive damage of brainstem tissue [21, 22, 93, 111], and in our novel murine model we detected both viral antigens and extensive damage in the brainstem and spinal cord. While Class IA and Class IB mice exhibited similar distributions of lesions and vil'al antigens in the brainstems and spinal cords, as well as comparable up-regulation of serum catecholamines, the absence ofNPE in Class IB animals might be explained by the reduced number and severity ofbraiir lesions and/or the lower viral antigen intensity in the NTS, medullary reticulai' iruclei (MdRN), and AP regions of the medulla, the dentate nucleus in the cerebellum, and the dorsomedial nuclei of the anterior hypothalamus. We therefore propose that acute, severe destmction of brainstem tissue, particularly those associated with the vasomotor areas, leads to a catecholamine S'torm in EV71-infected hosts, and that this can progress to NPE ifknown trigger zones are sufficiently damaged, [0077] in summary, the present invention is an authentic mouse model of EV71 neuro-infection tliat exhibits face validity [112], i.e.١ these animals display the entire range of clinical signs that can be obsened across the foil spectrum of neurological disease induced by EV71 infection in human patieirts, iitcluding NPE. Hallmark observations in EV7I:TLLmv-infcctcd mice presenting Class IA signs of disease were made by video comprising two video clips of two different Class IA mice. Botli animals were unable to self-right and were in a state of coma. Severe respiratory distress presenting as tachypnea with subcostal recession was evident in the first mouse. Gasping, subcostal recession and a frothy fluid emanating from the nostrils were seen in the second mouse. Hallmark observations in EV71:TLLmv-mkdd mice presenting Class IB signs of disease were made by a video of one Class IB mouse. The animal was unable to self-right and was in a state of stupor. Ipsilateral paralysis oftlie right limbs and persistent tremor of the left hind-limb were also observed. This model also displays construct validity[l 12] with respect to the gross and histopathological features of disease, which closely resemble those reported in fatal human cases. This new in vivo nrodel represents a powerfill tool for identifying the key events iir EV71 neuro-pathogenesis, for dissecting the mechanism of EV71-induced NPE, developing novel treatment modalities and potential antivil'al thei'apies, and for conducting pre-clinical evaluation of novel vaccines. WO 2016/122403 PCT/SG2016/050031 29

[0078] The practice of the present invention employs, unless otherwise indicated, conventional techniques of chemistry, moleculai' biology, microbiology, recombinant DNA, genetics, immunology, cell biology, cell culture and transgenic biology, which are within the skill of the art. See, e.g., Maniatis et al., 1982, Molecular Cloning (Cold spring Harbor Laboratory Press, Cold spring Harbor, New York); Sambrook el ،?/., 1989, Molecular Cloning, 2nd Ed. (Cold spring Harbor Laboratory Press, Cold Spring Harbor, New York); Sambrook and Russell., 2001, Molecular Cloning, 3rd Ed. (Cold spring Harbor Laboratory Press, Cold Spriirg Harbor, New York); Green and Sambrook, 2012, Molecular Cloning, 4th Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); Ausubel et al., 1992), Current Protocols in Molecular Biology (J'ohn Wiley &amp; Sons, including periodic updates); Glover, 1985, DNA Cloning (IRL Press, Oxford); Russell, 1984, Molecular biology of plants: a laboratory course manual (Cold Spring Harbor Laboratory Press, Cold spring Harbor, N.Y.); Anand, Techniques for the Analysis of Complex Genomes, (Academic Press, New York, 1992); Guthrie and Fink, Guide to Yeast Genetics and Molecular Biology (Academic Press, New York, 1991); Harlow aitd Lane, 1988, Antibodies, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New Yoi'k); Nucleic Acid Hybridization (B. D. Hames &amp; s. j. Higgins eds. 1984); Transcription And Translation (B. D. H'ames &amp; s. JT. Higgins eds. 1984); Culture Of Animal Cells (R. 1. Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. ’؟erYval A Practical Guide To Molecular Cloning (My, tk treatise, Methods In Ensymology (Academic Press, lnc.١ N.Y.); Methods In Enzymology, Vols. 1.54 aitd 155 (Wu et al. eds.). Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds.. Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes Ι-ΐν (D. M. Weil" and c. c. Blackwell, eds., 1986); Riott, Essential Immunology, 6th. Edition, Blackwell Scientific Publications, Oxford, 1988; Fire et al., 1 Interference Technology: From Basic Science to Drug Development, Cambridge University Press, Cambridge, 2005; Schepers, RNA Interference in Practice, Wiley-VCH, 2005; Engelke, RNA Interference βΑΐ): The Nuts &amp; Bolts ofsiRNA Technology, DNA Press, 2003; Gott, RNA Interference, Editing, and Modification: Methods and Protocols (Methods in Molecular Biology), Human Press, Totowa, NJ', 2004; Sohail, Gene Silencing by RNA Interference: Technology and Application, Cl,IV

EXAMPLES

[0079] The present invention is described by reference to the fo offered by way of illustration and are not intends to lijnit the invention iit any manne. WO 2016/122403 PCT/SG2016/050031 30

Standard techniques weli known in the art or the techniqu.es specifically described below were utilized EXAMPLE 1

Materials and Methods for Examples 2-8 [008.1 Cell ةج„'؛إ and virus strains: All cell lines used in this study were purchased from tlie American Tissue Type Culture Collection (ATCC, USA), Studies were performed using various mammalian cell lines; human adenocarcinoma cel.1 lines HeLa (CCL-2) and HEp"2 (CCL-23), and rhabdomyosarcoma RD (CCL-136); African green monkey kidney Vero (CCL-81), and Vervet monkey kidney fibroblast COS-7 (CRT-1651); mouse neuroblastoma Neuro2A (CCL-131.), embryonic fibroblast ΝΙΗ/3Τ3 (CRL-1658), and kidney epithelial TCMK (CCL-139); hamster ovarian epithelial-like CHO-K1 (CCE61), and normal rat kidney epithelial NRK (CRL-6509).

[0081[ The h.uman EV71 BS strain (EV71.-BS) was previously isolated from the brainstem of a deceased patieitt infected with EV71. The viras was passaged in Vero cells for four cycles prior to storage at ~80٠c unti.1 forther use. The mouse cell (N!:H3T3)-adapted EVJlzTLLm strain was derived from the EV7!:BS strain via continuous serial passage (>60 cycles) in mouse ΝΙΗ/3Τ3 cells. The EV71zTLLm strain was further passaged (40 cycles) in Ν1Η/3Τ3 cells to generate the mouse cell-adapted vimlent strain iEV71zTLLmv).

[0082[ Maintenance of cell lines and infection with vim: All cell ].ines were grown in Dulbecco’s Modified Eagle’s Medium (DMEM, Gibco, USA) supplemented with 10% (V/v) of fetal bovine sentm (FBS, i-DNA Singapore) and 0.22% (W/v) sodium bicarbonate (NaHC٧3, Sierra Aldrich, USA) and incu.bated at 37٥c and 5% c٥2, unless otherwise stated. All iirfected cells were incubated in maintenance medium (DMEM supplemented with 1% FBS and 0.22% NaHC.3.).

[٠083ل Cells (2.5-5.Ox 105 cells per well) were seeded in tissue culture-treated six-well plates (Nunc, Fisher Scieirtific) overnight, infected, witli 500 μΐ of virus suspension (MOI 1), and iircubated at 30.C, 37.C, or 39.C for 2 hours. Cells were washed twice in sterile Phosphate Buffered Saline (PBS, pH 7.4) solution before addition of fresh mainteirance medium (DMEM, 1% FBS). Infected cells were observed daily for appearance of distinct lytic cytopathic effects (CPE).

[0084[ For virus growth kinetic studies, plates containing the infected cells were frozen at -80.C at various time-points: 0, 6, 12, 24, 36, 48, an.d 54 hours post-infection (hpi). Plates were WO 2016/122403 PCT/SG2016/050031 31 subjected to three cycles of fieezing aid thawing, and lysates were harvested and cleared by vigorous vortexing follow^ by centrifirgation at l,50()xg for 10 minutes. Cleared supernatants were stored in cryovials (Nunc, Fisher Scientific) at -80.C until filrther use.

[0085] For temperature adaptation assays, inoculated Vero and ΝΙΗ/3Τ3 cells were incubated at 30.C, 37٥c, and 39.C and observed daily for appearance of CPE. Respective culture supernatants were harvested at 48 lipi and stored in cryovials at -80.C until filrtliei. use.

[0086J Various mammalian cell lines, i.e. RD, HeLa, and HEp-2 (human), Vero and COS-7 (monkey), ΝΙΗ/3Τ3, Neur0-2A, and TCMK (mouse), CHO-K1 (hamster), and NRK cells (rat), were infected with either parental EV7I.-BS or derived NM/3T3-adapted EV71 strains at MCI (multiplicity of infection) of 1 and incubated at 37.C for 10 days. Cultures were observed daily for appearance of CPE.

[0087] Determimtion of virus titer and relative replication rates (.RRR): Virus supernatants were subjected to endpoint titration an.d assays! in both Nff:f/3'1'3 and Vero cells. The virus titer was enumerated using the Reed and Muench method [61] and the Reed and Muench calculator [62]. Briefly, -/3Τ3 (lx 10^cells per well) and Vero cells (4x1.5 cells per well) were seeded overnight in a 96-well plate. Frozen virus thawed to room temperature were diluted (Id؛) in sterile 1% aqueous sodium deoxycholate (Sigma Aldrich, USA), and vigorously mixed for 15 minutes to disaggregate viros. Disaggregated virus was subjected to ten-fold serial dilution in maintenance medium, and 100 μΐ diluted vims from 10؛ dilution onwards was added onto eaclr well of cells. Plates were incubated at 37.C and observed daily under inverted light microscopy for the appearance of distinct CPE. Virus titer was reported as 50% cell culture-infectious doses per volume (CCIDso/ml).

[0088] To assess the degree of adaptation 0fEV71:TLLm and EV71zTLLmv iir ΝΙΗ/3Τ3 cells, virus supernatants harvested from previously infected primate and rodent cell lines were subjected to virus titer assay using both Nffl/3T3 and Vero cells. The titer 1'atio used to measui'e relative replication rates (RRR) in ΝΙΗ/3Τ3 and Vero cells tvas calculated using tire following formula: RRR : log (Α/Β) where A is tire vims titer assayed in ΝΙΗ/3Τ3 cells, and B is the vims titer assayed in Vero cells. [0089] Virus antigen detection by immunofluorescence assay. For infected cells that did not exhibit significant C.PE, immunofluorescence (IE) staining was perform«! to verify infection. Cells were trypsirrized at 72 lrpi, washed twice in sterile PBS, aird coated onto Teflon slides (Erie, USA). Slides were air-dried inside the biosafety cabinet arrd UV-treated for 15 minutes to WO 2016/122403 PCT/SG2016/050031 32 inactivate live virus prior to fixation in cold acetone at 4.C for 10 minutes. Slides were probed with pan-Enterovirus antibody (Merck Millipore, USA) and subsequently with FITC-conjugated mouse IgG (DAKO Cytomation, Denmark) mixed with 0.01% (W/v) Evan’s blue co'unter stain. [0090] Transfection ofcells with EV71 viral RNA: Vero and ΝΙΗ/3Τ3 cells (310^ cells pel' well) seeded overnight in 24-well plates were transfected with viral RNA extracted from 4*10٥ CCID50 virus using Lipofectamine 2000 (Life technologies, USA) following the manufacturer’s protocol. RNA ftom EV71.-BS, EV71:TLLm, and EV71:TLLmv was extracted using Viral RNA kit (Qiagen, Germany) and incubated with Lipofectamine 2000 on cells for 6 hours at 37.C. Transfected cells were observed daily for appearance of CPE. At 7 dpi, supernatant was harvested from, infected cells and passaged onto fteslrly seeded Vero and Ν1Η/3Τ3 cells. Cells were observed daily for appearance of CPE, and at 7 dpi, cells were trypsinized and processed for immunofluorescence viral antigen detection. \11و\ Full genome sequencing and genetic mapping ي EV71 strains'. \Γ'؛Γά\ 1Α of EV7EBS, EV7];TLLm, and EV71:TLLmv strains was extracted usiirg Viral RNA kit (Qiagen, Germany) and reverse-transcribed using Superscript II (SII-RT, Life Technologies, USA). The cDNA obtained was amplified with GoTaq Green (Promega, U'SA) and degenerate EV71 primei'S (primers' sequences are available upon request). The amplicon was purified using PCR clean up kit (Geireaid Biotech, Taiwan) and cloned into pZero2 vectoi" (fdfetech, USA). Clones were selected from Kanamycin plates, inoculated into LB broth (50 pg/ml Kanamycin) and allowed to grow overniglrt at 37.C for plasmid extraction with QiaSpin Miniprep kit (Qiagen, ) Plasmids were subsequently sequenced by the BigDye tenninator method (Applied Biosystems, USA) using the same primers. The 500-bp fragment sequences obtained were aligned using BioEdit V7.0.9.0 [63] against the whole genome sequence of an EV71 Singapore isolate 3799-S1N-98 (GenBank accession no. DQ341354.1) to reconstruct the foil genome sequences of EV71:BS, EV71:TLLm, and EVTlzTLLmv. Molecular modelling of the piotomers of EV71:TLLm, and EV71:TLLmv was performed using Deepview/Swiss pdbviewer ver. 3.7 (http colon slash slash expasy dot org slash spdbv slash) and the SWISS-MODEL sewer [64, 65]. WO 2016/122403 PCT/SG2016/050031 33 EXAMPLE 2

Primate Cell Lines but not Rodent Cell, Lines Permissible to Infection by EV71.-BS [0092] الار primate cell lines used in this study were permissible to infection ردئ virus. Human RD cells, as well as monkey Vero and cos-7 cells, exhibitd fell lytic cytopathic effects (CPE) within 48 hours post-infection (hpi) (Figures 1Α, lJ, and 1Μ), and viral antigens were detected in fixed infected cells (Figures 2A-2L; data not shown foi- RD, cos-7 and Vero cells). Growth kinetic curves of the virus harvested from supernatant of various infected cell lines confirmed productive infection in RD, Vero, and COS-7 cells (Figure 3Α). Virus harvested from RD and Vero cells reached an endpoint titer of 3x1.9 CCIDso/ml, while viras titer from COS-7 was 10٥ CCIDitfinl (Figure 3Α). EV7LBS did not induce fell CPE in HeLa and Hep-2 cells (Figures ID and IG), and the resulting viral titer was not measurable witilin the assay cut-off limit. However, viral antigen was detected by indirect immunofluorescent staining in both HeLa cells (Figure 2a) and Hep-2 cells (Figure 2D) indicating successfol virus entry into the cells but inefficiejit or defective replication may have resulted in immeasurable virus titer.

[٥٠93] All the rodent cell lines tested were determined to be non-permissive to EV71:BS infection. Lytic CPE of cells was absent following infection (Figures 4Α, 4D, 4G, 4J and 4Μ), virus titer from supenatants was not measurable, and viral antigens could not be detected in inoculated cells (Figures 2G, 21 and 2Μ؛ Figures 10Α, IOC and 10Ε). EXA^LE3

Mouse Cell (NK/3T3)-adapted EV71:7lLm Viras Productively Infects both Primate and Rodent Cell Lines [0094] EV71:TLLm was derive! following serial passage of EV7I.-BS in ΝΙΗ/3Τ3 mouse cell liire foi" a minimum of 60 cycles. All primate and rodent cell lines tested, wife the exception of NRK cells, were permissible to productive infection by EV71:TLLm. Full CPE was obscured in RD, Vero, and COS-7 .figures IB, IK, and IN), as well as ΝΙΗ/3Τ3 and Neui٠o-2A cells (Figures 4Β, E) at 48 hpi, Higli vinrs titer was measurable in supernatants harvested fronr all infected cel.1 lines except NRK (Figures 3C and 3D), and the iirfected cells were tested positive for viral antigen by indirect immunofluorescent assay (Figures 2Β, 2Ε, 2Η, 2Κ and 2Ν). Full CPE and measurable viral titer were not observe! in NRK cells (Figure 4Ν: Figure 3D), but viral antigens could be detected (Figure 2Κ), iirdicating successfel viras entry into NRK cells by EV71:TLLm but inefficient vims replication could have suited in non.measurable viras titer. WO 2016/122403 PCT/SG2016/050031 34 EXAMPLE 4

Mouse CelJ (Nm/3T3)-adapted£L7A-rLLm! Virus Productively Infected Rodent Cell Lines but not Α.1.1 Primate Lines [0095] The EV71zTLLmv virus strain was derived from forther passage of EV71:TLLm in ΝΙΗ/3Τ3 cells for another 40 cycles. EV71;TLLmv caused lytic CPE in fewer number of cell lines - RD, Vero, Nffl/3T3, Neur٥-2A, and TCMK cells (Figure 3Β), and foil CPE was only observed in RD, ΝΙΗ/3Τ3, and Neur0"2A cells figure 1C4 ؛C, F). LCMK, CHOKl and M cells were also noted to be pennissible to infection without processing to foil CPE (Figure 41, L, O), as shown by positive viral antigen detection in tile infected cells (Figures 2L, 20, and 2R).

[0096] On the othei' hand, the primate cell lines HeLa, Hep-2, and cos-7 were observed to be non-permissible to EV71:TLLmv infection, as shown by the absence of CPE (Fibres IF, II, and 10), Unmeasurable vinrs titers (Figure 3Β), and negative viral antigen detection (Figures 2C, 2F, and data not shown). EXAMPLE 5 EV71:TLLmv Virus Exhibited a Higher Degree of Adaptation to ΝΙΗ/3Τ3 Cells, While EV71:TLLm was More Adapted to Replicate in Vero Cells [0097] Tlie amount of viable virus in supernatants harvested from infected cells at various time points was determined by enumerating the virus tite in botli Vero and ΝΙΗ/3Τ3 cells. Te relative reproductive ratio (1). calculated by taking the ratio of virus titer values assayed in ΝΙΗ/3Τ3 to the titer values assayed in Vero, was used as a surrogate measure of the degree of virus adaptation to ΝΙΗ/3Τ3 cells. The parental EV71:BS virus displayed highly negative RRR values for RD, Vero, and cos-7 (Figure 5Α), indicating that the virus titer assayed in Vero cells far exceeds foe titer assayed in ΝΙΗ/3Τ3 cells. The relative reproductive ratio values for ofoer cell lines could not be determined since tlie virus titers could not be measured. On the other hand, EV71:TLLmv vims exhibited positive RRR values, with the exception of virus propagated in Vero cells (Figure 5Β). The positive RRR val'ues were indicative of more efficient replication, and therefore higher titei- values, in ΝΙΗ/3Τ3 cells compared to Vero cells. The negative RRR value determine for EV7J:TLLmv harvested from Vero cells was consistent wifo the observed slow growth kinetics (Figure 3Β) and lower virus titer. EV7];TLLm exhibited negative RRR valu.es (Figures 5C and 5D), although of lesser degree than tlie RRR values for EV7LBS. This suggested that although EV71:TLLm could productively infect a few rodent cell lines, it was still more adapted to replicate in Vero than ΝΙΗ/3Τ3 cells. WO 2016/122403 PCT/SG2016/050031 35 EXAMPLE ة EV71:TLLm Exhibited Bettci Adaptability to Changing Temperatures than EWlzTLLmv ا8و0ءءا Vero and ΝΜ/3Τ3 cells infected witli the parental EV71:BS and the derived NIH/3T3-adapted EV71:TLLm. and EV7]:TLLmv strains were incubated at various temperatures -30.C, 37٥c, and 39٠CS to determine vinrs adaptability to temperature variation or changes. EV71:BS displayed the most linrited adaptability, with fell CPE observed only in Vero cells incubated at 37.C (Figure 8Β; Table 1). EV?l:TLLmv displayed nroderate adaptability, based on the observed fell CPE induction in Vero cells at 37.C (Figure S2B) and in Χ1Η/3Τ3 cells in both 37.C and 39.C (Figure 8Α, Figure 9A؛ Table ]). EV71:TLLm, on fee other hand, displayed the greatest adaptability, where it induced fell CPE in Veo cells for all incubation temperatures (Figure 7Β, Figure 8Β, Figure 9Β) though only at 37.C in NIH3T3 cells (Figure 8A; Table 1),

Assessment of Virus Adaptability o_fEV71:BS١ EV71:TLLm and EVThTLLmv Grown in Nffl/3T3 and, Vero Cells to Various Incubation Temperatures TABLE 1

Induction ofFull Cytopathic Effect (CPE) within 48 Hours Following Infection) incubation EV71..BS EF71:TLLm Ε¥71:ΊΙΙιν Temperature (٥C) Vero ΝΙΗ/3Τ3 Vero ΝΙΗ/3&amp;3 Vero ΝΙΗ/3Τ3 30 2 + (30./.)3 ٠ - 37 دب - ب ب - 39 (20./.)4 ؛ 3(ه/0٠.ل>)

Infected cells were observed daily for signs oflyfic cell deafe and time of appearance offirll CPE. 2 Indicates absence offirll CPE in infected cells. 3 Indicates observation of fell CPE. 4 Indicates absence of full CPE, wlrile number in parenthesis indicates the maximum degree of CPE observed in cells. WO 2016/122403 PCT/SG2016/050031 36 EXAMPLE 7

Viral Genomes ofEVTlzTLLm and EV71:TLLm,v Accumulated Multiple Missense Mutations as a Result of Adaptation to ΝΙΗ/3Τ3 Cells [00991 Viral RNA of EV71:BS, EV71zTLLm, EV71:TLLmv were subjected to Sanger sequencing to determine the consensus genome sequence and identify possible adaptive mutatioirs arising from the adaptation process in Μ3Τ3 cells. The consensus sequences of he genomes representing dominant population of the quasi-species have been deposits in he GenBank, NCBI (National Center for Biotechnology Information). Alignment of the foil genome sequences of EV71:TLLm (GenBank Accession. No. KF514879; SEQ ID ΝΟ:1) against EV71.BS (GenBank Accession N'o. KFS14878; SEQ ID NO:3) revealed 60 nucleotide mutations, 21 of which resulted in amino acid substitutions (Table 2). On the other hand, 83 mutations with 36 amino acid substitutions, were noted between he genomes of EV71:TLLmv (Genbank Accession N'o. KF514880؛ SEQ ID NO:2) and EV71:BS. Majority of he missense mutations wee locate! in tlte PI (capsid protein genes) region (Table 2), particularly within the VPl protein gene (Table 3).

[00100] Amino acid changes were also observed wihin he Ρ2 and Ρ3 regions, most notably in the RNA-dependent RNA polymerase (3D region). EV71:TLLm acquired four atnino acid changes, mostly in the palm and thumb domains of the enzyme (Table 4). EV71:TLLm\\ on he other haird, accumulated eight amino acid changes, mostly also in the palm and thumb domains of the polymerase. Nucleotide mutations were also observed in he 5' unfranslated region (UTR) of the genome. Apart from base changes, a 1-base insertion was found in EV71zTLLm, while a 4-bp insertion and a 20-bp deletion were observed in EV71zTLLmv 5'UTR (Tables 2 and 3). On he other hand, no amino acid substitutions were observed in the VP3 and 3Α regions of EV71:TLLm, as well as in tire 3'UTR ofki\iEV71zTLLm andEV71:TLLm.

Nucleotide and Amino Acid Changes in tine Genomes ofEV71zTLLm and EV71zTLLmv Compared to EVllzBS TABLE 2 ΕΡ71 :BS vs ΕΤ71 .'TLLm EV71:BSvs EVTLTLLf Genomic Region No. Nucleotide Changes No. Amino Acid Changes No. Nucleotide Changes No. Amino Acid Changes 5’UTR 11 NA 11 NA 1 bp Insertion 4 bp Insertion PCT/SG2016/050031 37 20 bp Deletion PI 22 12 39 12 Ρ2 ؛1 2 11 2 Ρ3 16 ٦ دة 12 3'UTR 0 NA () NA TotaJ 60 21 83 36 WO 2016/122403 TABLEة

Adaptive Mutations Observed in the SIR and PI Regions of EV71:TTLm and EV71:].lLmv Virai Genomes EV71 ·,TLLm ةل٦ ΕΥ71 :BS ΕΥ71 :TLLv لآب٦ ΕΥ71 :PS Amino Acid Changes Amino Acid Changes Genome Region Nucleotide Changes Polyprotein؛ Matare Protein؛ Nucleotide Changes Polyprotein Mature Protein Cloverleaf C140G ؛IRES A141G A141C G195C T209C T209C G258A G258A C370T C370T G448A G448A A502C T502C τ؟π> CIT lie Α671Τ CUT G675T C709T T678Insertion 678-681 Insertion 726-745 Deletion PCT/SG2016/050031 38

VP4 A809G E21G E21G A809C E21G E21G VP2 G1359A V204I V135I G1359A ٧2041 3/1351 G1385C S213T S144T G1385C S213T S144T Α1400Τ Κ218Ι Κ149Ι Α1400Τ Κ218Ι Κ149Ι T1428C Ε228Ρ Ε159Ρ G1429C Ε228Ρ Ε159Ρ VP3 G1900C Α385Ρ Α62Ρ AUG 7514Α Τ191Α Α2420 Ι558Μ Ι235Μ ΝΡ1 T2462C V572A V7A T2462C V572A V7A C2725T L660F L95F C2530A Q595K Q30K ΚΠ1، Κ663Ε Κ98Ε A2719G IN I93V ATISIG N669D N104D Τ2724Α D659E D64E A2876G Ε71.0Α Ε145Α C2725T L660F L95F Α2943Τ E732D E167D A2734G Κ663Ε Κ98Ε C2947T L734F L169F A2752G C3165 S806L S241L A2753G N669G bI104G A2876C Ε710Α Ε145Α Α43Τ E732D E167D C2947T L734F L169F C3I65T S806L S241L T3175C Υ810Η Υ245Η G3148A V8I3I V248I G3319T A858S A293S WO 2016/122403 أ Numbering of amino acids in the uncleaved polyprotein prior to manrration. 2 Numbering of amino acids in the mature piutein. 5 Internal Ribosome Entty Site.

Mutations are based on. alignment with refei'ence EVJlzBS genome. WO 2016/122403 PCT/SG2016/050031 39

Adaptive Mutations Observed in the Ρ2 and Ρ3 Regions 0iEV71:nLm and EV7LTLLmv Viral Genomes TABLE 4

ΕΥ71: BS vs EV71 :TLLm EV71:BSvsEV71:mmv Amino Acid Changes Amino Acid Changes Genome Region Nucleotide Changes Polyprotein' Mature Protein2 Nucleotide Changes Polyprotein Mature Protein 2Α G3772A G992E G130E G3772A G992E G130E 2C A4366G Τ1207Α Τ96Α A4366G Τ1207Α Τ96Α 3Α C5117T A1457V A17V 3Β T5357C ΙΤ537Ρ Ε119 T5357C L1537P L119 3C A557G I1604V I56V A557G I1604V I56V A5569G I1608V I60V A5569G I1608V I60V 3D A6211G N1822D N91D Α6070Τ T1775S T44S3 T6S35A S2030T S299T3 T6137C V1797A V66A A7128G R2127S R396S A6211G N1S22D N91D TTTAIC V2167A N43hK C6404G S1886C S155C T6592G W1949G. ؛W218G 13SA S2030T S299T R2127S R396S٥ TTiAlC V2167A V436A ' Numbering of amino acids in the uncleaved polyprotein prior to maturation. 2 Numbering of amino acids in the mature protein. 3 Mutation located in the Ring finger domain ot'the RNA-dependent RNA polymerase. 4 Mutation located, in the Palm domain of the RNA-dependent RNA polymerase. و Mutation located in the Thumb domain of the RNA-dependent RNA polymerase. Mutations are based on alignment with, reference EV71:BS genome. WO 2016/122403 PCT/SG2016/050031 40 EXAMPLE 8

Transfection of EV71:BS Viral RNA into Murine Cells Resulted in Productive .Infection but the Virus Progeny could not Re-infect tlie Same Mouse Cells ]0100] Vero and ΝΙΗ/3Τ3 cells transfects! with viral RNA exhibited foil CPE at 7 days post-transfection (dpt) (data not shown). Viral antigens were detected in ΝΙΗ/3Τ3 cells transfected with viral RNA of EV71:BS (Figure 10Β), but not in ΝΙΗ/3Τ3 cells subjected to infection with tire virus (Figure 10Α). Virus supernatants re-inoculated onto fresh Vero and ΝΠΙ/3Τ3 cells resulted in productive infection (100% CPE) only in Vero but not in ΝΙΗ/3Τ3 cells (Figure 6Α), and viral antigen detection con firmed iirfection in Vero cells, Irut not ΝΙ3Τ3 (Figure 6Β). EXAMPLE 9

Materials and Methods for Exanrples 10-17 [0101] Plasmids, viruses, bacteria, and cell lines‘. Tire plasmid encoding murine SCARB2 cDNA (pMD18-mSCARB2) (Genbank accession no. NP 031670.1) was purclrased from Sino Biological, Inc. (Beijing, China). The pQE30 vector (Qiagen, Germany) for recombirrant expression of soluble nrSCARB2 protein iir E. coli cells was a generous gift from Dr. Kian Hong Ng (Temasek L.ifesciences Laboratory, Singapore). Plasmids encoding the full-length cDNA of EV71 were generated using the low-copy iro. plasmid pACYC177 (New England Biolabs, Siirgapore). A plasmid constract expressing Τ7 polymerase (pCMV-T7pol) was a generous gift frorrr Dr. Pete McMinn ofUiriversity of Sydney, New South Wales. The plasmid pZero-2 used for fragment sequencing of clone-derived viruses was purchased from hrvitrogen (Life Technologies, USA). 10102] Tire clinical isolate EV71-.BS (Geirbank accession no. ΚΕ514878), EV71:TLLm (Genbank Accession No. KF514879.1), and EVTLTLLmv (Genbank Accession No. KF5148S0,1) used in this study were described above or previously [71].

[0103] All cell lines used, in tlris study - African green monkey kidney Vero (CCL-81): mouse neuroblastoma Neur0-2a (CCL-131), and fibroblast ΝΓΗ/3Τ3 (CRL-1658) cells were purchased, from tire Anrerican Tissue Culture Collection (ATCC®, USA). Cells were grown and. maintained as described above or previously [71]. ]0104] E. coli cells BL21 sfrain (New England Biolabs, Singapore) was used for high-level protein expression, ΤΟΡ10 strain (Life Technologies, USA) for fragment sequencing of individual clones, and XL-10 Gold ultracompetent sfrain (Stratagene, USA) for geireration of fidl-length. genoirric cDNA cloires. WO 2016/122403 PCT/SG2016/050031 41.

[OIOS] Construction of EV71:BS full-length genomic cDNA clones, capsid-chimeric clones, and VP1/VP2 mutant clones: EV7!:BS cDNA clones were generated by two-step cloning. Viral RNA extraction (Qiagen Viral RNA kit, Gcnnany) and conversion to cDNA (Life Technologies Superscript-! RT, 'USA) have been describe above or previously [71]. The genome proximal fragment encoding the 5'UTR and PI regions was amplified using the primer pair: Εν?1_ΒαΜΗΪ-Ρβ and EVTl Pf-AatllR (Table 5), which contains and Aatllrestriction sites foi' cloning into the plasmid pACYC177. The distal fragment encoding tlie Ρ2, Ρ3, and 3’UTR was amplified with the primer pair EV71_HindIII-DF and EV71JD-BamHIR, whiclr also contains Hindlll and 7سءو restriction sites for cloning. Tire proximal fragment contains a Τ7 polymerase promoter region upstream oftlie 5'UTR to facilitate trairscription. The proximal fragment was ligated to the distal fra^nent following digestion with EagI and Aatll, and the foil-length EV71:BS cloire was produced.

TABLES

Primers

Primer name Sequence (SEQIDNO:) Remarks ΕΥ71_ΒιΗΙ٠ PfF :::::: For cloning EV71.’BS proximal fragment' (i5'UTR-PI regions) into the pACYC177 plasmid EV71_Pf-AatIIR TGGCAGTACGACTAGTGCC (5) EV71HindIII- DF GTG (6) ا ء For cloning EV7!:BS distal fragment {P2-3VTR) into the pACYC177 plasmid EV71_D- BumHIR GGTTATAACAAATTTACCCCCAC (7) SDMMluIF CCAATTCAGCTACAGAAGGCTCC (8) For introducing Mlul restriction site into the proxhnal fragment clone S.M.MImIR GGCTCCCACG (9) Mlul-TLLm-PlF AGCTACAGAAGGC (10) For amplifying foe PI gene sequences of EV71:TLLm flanked by Mlul and EagI restriction sites Eagl-TLLm-PIR GTACGACTAGTGCC (11) PCT/SG2016/050031 42 VP2_G1385C-F CCTGGCGCC (12) For introducing die GJ3S5C mutation (VP2 S144T substitution) VP2_GU85C-R (13) VP2_A1400T-F (14) For introducing tile Α1400Τ mutation (VP2K149I substitution) VP2...A1400T-R cc (15) yPl_A27S4G-F GCCAACTGGG{16) For introducing the A2734G mutation (VPl Κ98Ε substitution) VP1_A27B4G-F AACCTGCCC (17) FP1„A2876C-F TGTTTGTTCCCCCTGG(18) For introducing die A2876C mutation (VPl Ε145Α substitution) FP1.A2876C-R AAGTGAATT (19) FPl C2947T-F AGAGAATCAJTTGCTTGGCAGACAGCCACAAACCC c (20) For intoducing the C2947T mutation (VPI L169F substitution) FPIC2947T-R GCCAAGCAAATGATTCTCTAGACTCTGGTTTGGGA GCACC (21) pQE-mSCARB2F ATTAGGATCCGTCTTTCAGAAGGCGGTAGACCAG (22) For cloning mouse SCARB2 gene into pQE30 protein expression plasmid pQJE-mSCARB2R AGCCAAAG (23) WO 2016/122403 [0106] To replace the PI region ofEV7]:BS with, the PI of EV71 :TLLnr, an Arfirf restriction site was engineered within the boundary between 5'LJTR and PI (primer pair SDMjlluIF and SDXfJfliil-R). The PI cDNA sequence of EV71:TLLm was amplified (primer pair Mini-TLLm-PlF and Eagl-TLLm-PlR), digested with Mild and EagI, and cloned into fire consfiuct harbouring tire proximal fra^ent. This modified proximal fragment was subsequently ligate to fire distal fiagment as described.

[0107] To generate clones witlr amino acid substitutions in the VP2 and VP) proteins, site-directed mutagenesis was performed Ur the proximal fra^rrent prior to ligatioir to the distal WO 2016/122403 PCT/SG2016/050031 43 fragment. The VP2 S144T (lit G1385C) amino substitution was introduced into the proximal fragment with the specific primer pair VP2 G1385C-F and VP2_ GJ385€-11. The VP2 S144T (nt G1385C), ٧Ρ1 Κ98Ε (nt A2734G), Ε145Α (nt A2876C), and E167D (lit C2947T) were also generated in a similar manner using different piimer pairs (Table 5), 01.8؛] Assessment of "mouse cell-entry phenotype To generate live virus, the cDNA clones were co-transfected with another construct expressing the Τ7 RNA polymerase ئ into Vero cells using Lipofectamine 2000 (Life Technologies, USA) following the manufacturer's recommended protocol. Transfection supernatants were harvested 7-10 days post-transfection and inoculated onto overnight seeded cell lines at 1 MOI as described above or previously [71], Cells were incubated witlr vinrs supernatant at 37 c for 1, hour and. waslred twice with PBS prioi' to replacement of media with fresh DMEM, 1% FBS. 01091؛ hr order to assess the infection phenotype, profession of lytic cytopathic effects (CPE) induction was recorded, and images were taken at various time points. Infected cells were also harvested and processed for immunofluorescence detection of viral proteins as described above 01- previously [71]. Briefly, adhei'ent cells were trypsinized and combiired with pelleted cells from culture supernatant, washed twice in sterile phosphate buffered saline (PBS), and fixed onto Teflon slides. Fixed cells were incubated with pan-Enterovirus monoclonal antibodies (Merck Millipore, USA) and detected with standard FITC-conjugated anti-mouse IgG antibodies. Infect^ cell culture supernatants were also harvested, cleared, and subjects to serial dilutions for virus titer determination using foe Reed and Muench metlrod [61]. Once the titer is known, tire supernatants were passaged onto freshly seeded ΝΠ4/3Τ3 and Neur0-2a cells at 1 MOI, and the infection phenotype was again assessed usfog the method described here. 0110؛] Recombinant protein expression of soluble SCARB2 proteins and production of SCARB2 rabbit anti-sera: The plasmid pMD18٠mSCARB2 encoding tire extiacellular donrain of mouse SCARB2 (aa Arg27 - Thj" 432) was amplified with the primer pairpQE-mSCARB2F and pQE-mSCARB2R to introduce Rumiff and 77/u،/7/7 restriction sites to facilitate cloiring iirto foe pQE30 protein expression vector. The clones were transformed into BL21 E. coli cells, and protein expression was induced witlr ImM IPTG overnight. Harvested cells were lysozyme (1 mg/ιηΐ) digested, and the CTude extract was purified using a Ni-NTA column (Qiagen®, Germany). Cleared !,ysate was incubated overnight in 1 ml of 50% Ni-ΝΤΛ sluiry at 4. c with gentle shaking. The protein was washed 5 times iir Waslr Buffer (50 nrM ΝΗ2ΡΟ4, 300 mM NaCl, 20mM imidazole, pH 8.0) and eluted with Elution Buffer (50 mM NaH2P04, 300 mM NaCl, 250mM imidazole, pH' 8.0. WO 2016/122403 PCT/SG2016/050031 44 [0111] Two healthy male rabbits were immunized with. 1.4 μδ purified mouse SCARB2 protein mixed with Freund's complete adjuvant (Sigma-Aldrich®) at day 0. Boostej- containing 0.8 jig antigen mixed with Freund's incomplete adjuvant (Sigma-Aldrich®) was injected at days 21, 42, 63, 84, and 105. Teminal bleed by cardiac puncture was performed at day 117, and collected blood was incubated overnight at 4٥ c prior to centrifugation at 3,000 rpm for 30 minutes. Cleared serum was collected and stored at -20٥ c until further use. Production of SCARB2 rabbit antiserum was approved by the Temasek Lifesciences Laboratory Institution Animal Care and Use Committee (TLL-IACUC) [Approval No. 047/12]. Y؛VLY1،\ Virus competition assay with murine SCAR2 protein'. In vitro hYing ،\ةلاهةلآ were performed to confirm the interaction ofEV7].:TLLmv with mouse and human SCARB2 proteins. ΝΙΗ/3Τ3 cells (6000 per well) were seeded, overnight onto sterile Teflon coated slides (Erie, USA), Prior to viras inoculation, 100 MOI EV71:TLLmv was incubated with various concentrations of recombinant mouse SCARB2 (mSCARB2) or human SCARB2 (hSCARB2) proteins (4.0 pg, 2.0 μg, 1.0 pg, 0.5 pg, 0.25 pg, 0.125 pg, and 0 pg) for 2 hours at 37٥ c in a shaking platfom. Infected cells were observed daily for signs ofCPE and fixed at 48 hours post-infection.in absolute acetone (4٥ c, 10 mins). Fixed cells were immunofluorescently assayed with pan-Enterovirus antibody (Merck Miilipore®, USA). Slides were imaged with an upright fluorescence microscope (Nikon, Japan).

[0113] VirusSCARB2 binding assays: Antibody-mediated SCARB2 blocking assays were performed on fixed cells to assess whether masking cell surface SCARB2 proteins affects binding virus binding. Ν1Η/3Τ3 and Vero cells cultured on Teflon slides were fixed (4% PFA, 25 minutes, room temp.), and blocked with 5% BSA in PBS for 1 hour at 37. c. Slides were incubated in polyclonal rabbit sera raised against mSCARB2 (1:100) for 1 hour at 37. c. For negative controls, cells were incubated with polyclonal rabbit sera raised agaiirst Saffold Virus L protein. Slides were washed in PBS prior to incubation with live EV71:TLLmv (1000 MOI) for 1 hour at 37٥ c and probed with pan-Enterovirus antibody and detected with FITC-onjugated Ab. Slides were imaged with Zeiss LSM 510 Meta invaded confocal laser microscope (Zeiss, Germany), and fluorescence intensities were measured using the Itnaris (BitPlane Scientific Software, Germany) imaging software. Statistical analyses of fluorescence intensity differences were performed using Prism GraphPad ver. 6.01 (GrapliPad Software, Inc., USA).

[0114] Assay of cell protection from virus infection using rabbit anti- SCARB2 polyclonal .؟era: Antibody-mediated SCARB2 blocking assays were also perfonned on live cells to assess its effect on cellular infection. Overnight seeded ΝΙΗ/3Τ3 cells (1x1Q4 cells per well in, 96-well WO 2016/122403 PCT/SG2016/050031 45 plates) were incubated with Iwo-fold serial dilutions (1:20 to 1:640) of rabbit polyclonal sera raised against either mouse or human. SCARB2 proteins for 1 hour at 37٥ c. Cells were subsequently inoculated with 100 MCI EV71:TLLmv or clone-derived, virus mutants CDV:BS[M-P]J and CDV:BSvpi[K98E/E145A/L169F] for 1 hour at 37. c. Cells were washed twice in PBS prior to replacement with fresh DMEM (1% BBS). Cells were observed daily for signs of CPE, and infected cell culture supernatants were harvested at 3 days post-infection (dpi). Supernatants were subjected to vims titration, with prior vims disaggregation process by vigorous vojfexing for 15 minutes at room temperature 'in 1% sodium deoxycholate, as previously [6, 71}. Virus titers were enumerated with die Reed and Muench metliod [61} and reported as CCID50/ ml with the Infectivity Calculator [62}. EXAMPLE 10

Transfection oiEVJlzBS Genomic RNA into Mouse Neuronal Neuro-2a and Fibroblast ΝΙΗ/3Τ3 Cells Generate Viable Vims Progeny [0110] Murine fibroblast ΝΙΗ/3Τ3 and neuroblastoma Neur0-2a cells were previously demonstrated, as nonpennissible to EVJlzBS iirfection, wliile Vero cells are (above or [71}). Two strains, EV71:TLLm and EVJlzTLLmv, both derived from EV7LBS successfilly entered and replicated witlrin tlrese muj'ine cells. To determine whether the EV71:BS genome can replicate in these ]ton-permissible cells, genomic RNA from EV7]:BS was exfracted and transfected into Vero, ΝΙΗ/3Τ3, and Neur0-2a cells. Similarly, genomic RNA. from EV71:TLLm and EV71:TLLmv were transfected into these three cell lines foi" comparison. To assess the viability of tile virus progeny generated, transfection supernatants were subsequently re-inoculated onto fresh cells (Figure 15Α), [0111} Geitomic RNA ' of all tliree vims sfraiits iitto Vero cells resulted in lytic cytopathic effects (CPE) in the transfected cell monolayer (Figure 15Β). Viral antigen expression, was also obseived in dead cells (Figure 15C), indicating successfitl. virus replication. Similar results were obseived fi'om transfection of eitlrei' EV71:TLLm or EV71:TLLmv viral RNA into ΝΠΕ3Τ3 and Neuro-2a cell monolayers (Figures 15Β and 15C). On the other hand, transfection of EV71:BS RNA into ΝΙΗ/3Τ3 and Neur0-2a cells led to death of some cells that exhibited viral antigen expression, but did not 1'es'ult in full CPE of the cell monolayer. Fuifher passage of EV71:BS transfection supernatants from botli Nffl/3T3 and Neuro-2a cells onto fresh Vero cells led to induction offilll lysis of the cell monolayer (Figure 15D) and detection of viral WO 2016/122403 PCT/SG2016/050031 46 antigens in dead cells (Figure 15Ε). However, passage of the transfection supernatants onto fresh ΝΙΗ/3Τ3 cells yielded neither CPE (Figure 15D) nor viral antigen expression figure 15Ε). EXAMPLE 11

Tire Capsid-Encoding PI Region of Mouse Cell Line-Adapted /?L7/:7LLw Is Responsible for Successfid Virus Entry into Murine ΝΙΗ/3Τ3 and Neur0-2a Cells 10112] The previous analysis suggests tlrat the capsid protein of EV71:TLLm and EV7J:TLLmv may be responsible for successfol enfry into ΝΠ1/3Τ3 and Neur0-2a cells )above or [71]). To confirtn this, filll-length cDNA clones of EV71 :BS genome were generated by standard revese genetics. The PI (capsid) region of die foil-length cDNA clone of EV71 :BS was subsequently replaced with the genetic sequence ofEV71-.TLLm PI to generate a chimeric plasmid clone (Figure 16Α). The EV71-.BS cDNA clone was transfects into Vero cells to generated clone-derived viius (CDV:BS). Similarly, the clrimeric clone was transfected to generate CDV:BS[M-P]J that exhibits tlie capsid protein of EV71:TlTm and expresses the non-structural proteins 0iEV71:BS. These CDV were re-inoculated onto various cell lines to assess the infection phenotype (Figure 16β).

[0113] EV7!:BS clone-derived vims (jCDV:BS) induced CPE in Vero cells but not ΝΜ/3Τ3 aird Neuro-2a cells, while CDV:BS[MjPI] induced CPE in all three cell lines at 48 hours post-inoculation (hpi) (Figure 16C). Murine cells infected with CDV:BS[M-P1], but not with CDV:SS, resulted in detection of viral antigens in dead cells (Figure 16D). To assess the production aird release of viable virus progeny in tire first passage (PI), clarified culhrre supernatants from infected cells were re-inoculated onto fresh, monolayers of the same cell line, and viral yields were measured at 72 hpi. Passage of both CDVzBS atrd CDV:BSfMrPl] onto Vero cells exhibited high vims titers, and a significant riter increase was observe! after further passage (Ρ2) (Figure 16Ε). Meanwhile, passage (PI) of CDV:BS[M-P1], but not CDV.BS, produced high virus yield in both Ν1Η/3Τ3 and Neur0-2a cells (Figure 16F). EXAMPLE 12

The VP1.-L169F Airrino Acid Substitution in EV71:BS Capsid Enables the Vims to Enter and hrduce Limited Infection in Murine Cells [0114] The capsid protein of mouse cell-adapted E¥71:TLLm enables entry oiEV71:BS into murine cells, and we are interested in the identity of specific residues tlrat confer dris novel phenotype. Previous data on the comparison of polyprotein sequence alignments of EV71.-BS and mouse cell-adapted EV71 strains showed multiple amino acid substitutions in VPl and VP2 WO 2016/122403 PCT/SG2016/050031 47 proteins that may be involved in virus receptor engagemeirt on host cells (above or [71)). These residues include VPl Κ98Ε, Ε145Α, and L169F, as well as VP2 S144T and Κ149Ι. To determine whiclr of these amino acid substitutions is/are necessary for mouse cell entry, individual mutations resulting in these amino acid substitutions were introduced into the EV71.BS foil-length cDNA clone via standard site-directed mutagenesis (Figure 17Α). These modified cDNA clones were independently transfected into Vero cells to generate clone-derived virus (CDV), and harvested supernatants were inoculate onto fi-eshly-seeded Vero, ΝΙΗ/3Τ3, and Neur0-2a cells to assess the infection phenotype.

[0115) Vero cells infected with all the mutant clone-derived viruses (CDV) exhibit^ 100% CPE, but only foose CDV harbouring VPl amino acid substitution - CDV:BSm[K98E], .. .. and CDV:BSyp][L169F] - resulted in 100% CPE inNeuro-2a cells (Figures 17Β and 17 c). Viral antigen expression was detected in Vero and Neur0-2a cells infected with CDV containing amino acid substitutions in VPl ([CDVzBSvpi) and VP2 (CD¥:BSyp2), but only tire Nffl/3T3 cells infected with CDV:BSvp2 exhibited viral antigen expression (Figures 17D and 17Ε). Furthermore, Vero cells infected with all tire mrttant CDV yielded measurable virus titers (Figure 17F), suggesting virus viability, but only CDV:BSvpi[L169F] generated measurable virus titer itr tire culture supernatant of infects Ν1Ή/3Τ3 and Neur0-2a cells (Figure 17G) as assayed iir Vero cells. However, foriher passage onto healthy murine cells, of culture supernatants from ΝΙΗ/3Τ3 and Neur0-2a cells infected with CDV:BSvpi[L169F7, failed to induce infection. EXAMPLE 13

Efficient Productive Infection in Murine Cells Requires tire Combined Amiiro Acid Substitutions at VPl [0116] To assess whether combining tire amino acid substitirtions in VPl and VP2 could also enable EV71:BS to enter mouse cells, foil-length genomic cDNA clones of EV71:BS with various combinations of amino acid substitutions (BSyp2[S144T/K149IJ, BSypi[K98E/E145A]t BSvpi[K98E/E145A/L169F7, and BS[VP1/VP2]) were generated (Figure 18A). The plasnrid clones were independently transfected onto Vei٠0 cells, and the resulting supernatant was used to inoculate Vero, ΝΠΙ/3Τ3, and Neuro-2a cells to assess the infection phenotype.

[0117] All the assayed CDV, except CDV:BSyp2[S144T/K149I], induced CPE in Vero id Xeur٥-2a cells (Figure 18Β). Viral antigens were also detect^ in all cells infected with the various CDV, although immunostaining was more prominent in Neuro-2a than ΝΙΗ/3Τ3 cells WO 2016/122403 PCT/SG2016/050031 48 when comparing the murine ceJJ lines (Figure 180). High virus titer was measurable in the culture supernatants of Vero cells infected with all the CDV (Figure 18D), but only CDV.lyp؛[Kl/E145AMCDV;BSypi[Kl/E145A/U69F]#؛&amp;i.'i#؛V\m\ire in the culture supernatant of infected Nffl/3T3 and Neui٠0-2a cells (Figure 18Ε)؛ as assayed in Vero cells. EXAMPLE 14 EV71:BSVim with the Combined Amino Acid Substitutions at VPl Κ98Ε, Ε145Α, and L169F Could Be Successfully Passaged in Mouse Neur0-2a Cells [0118] Four of the clone-derived virus isolates have so far enabled EV71-.BS to enter and iirfect cultui'ed mouse cell lines: CDV:BS[M-P1], CDV:BSvpi[L169F], CDV.-BSyp:(K98E/E145Al١ and CD:BS٣pi[K98EG145A/L169FJ. To ه# لائد٠ oi these CDV could stably infect irrouse cells for multiple cycles, virus supernatants were passaged twice in the same cell line, i.e, from Neur0-2a to fiesh Neuro-2a cells. Infection was monitored by assessment of CPE induction and viral antigen expression, and production of viable virus progeny.

[0119J Only CDV:BSypi[K98E/E145A/L169F] and CDV.BSfM-ΡΙ] could be successfolly passaged consecutively in Neur0-2a cells as demonstrated by detection of viral antigens (Figure 19Α) and measurable viras titers (Figure 19Β). Positive staining was observed in both passage No. 2 and 3, and an increase in viius titer was record«! in passage No. 2 compared to the first passage. On the other hand, oitly CDV:BSfM-PlJ was able to induce expression of viral antigens in ΝΗΤ3Τ3 cells, (Figure 19Α), but no viable viras progeny was detected. Genomic sequencing of CD V:BS]/pi[K98E/E145A/L169F] derived from the third passage i,n Neuro-2a cells exhibits no change in the introduced amino acid mutations (Figure 19C). EXAMPLE 15

The Mouse Cel.1 Line-Adapted Sti'ain EVYIrTLLmv Binds SCARB2 Protein Botlr In Vivo and In Vitro 1.12.1 EV71 was recently demonstrated to utilize Scavenger Receptor Class B Member-2 (SCARB2) protein as its receptor for host cell entry [47). To confinu whethei' the mouse cell line-adapted EV71 strains also utilize SCARB2 during infectioir of mouse cells, competitive virus binding assays were performed. Firstly, ΝΙΗ/3Τ3 and Vero cells grown overnight in Teflon-coated slides and fixed gently with 4% paraformaldehyde were iircubated with rabbit sera against mouse SCARB2 pi'otein (mSCARB2) prior to in vitro bindijig witli live EV7I:TLLmv. WO 2016/122403 PCT/SG2016/050031 49

Bound cells were fluorescently delated using pan-Enterovirus monoclonal antibodies, and the fluorescence intensity was quailtiiied. Pre-incubation of ΝΜ/3Τ3 cells with the anti-mSCARB2 sera resulted in significant reduction of EVJLTLLmv binding (Figure 20Α), which was not observed when cells were pre-incubated with nonspecific seram (NSP). Similar results were observed using Vero cells (Figure 20Β). 1.121) In the second experiment, live EV71:TLLmv was incubated with, reombinant soluble SCARB2 proteins prior to inoculation onto seeded ΝΙΗ/3Τ3 cells, and infection was assessed by fluorescence tagging of bound pan-Enterovirus monoclonal antibodies. Pre-incubation of virus with soluble nnSCARB2 reduced tire severity of cellular infection in a dose-dependent manner (Figure 20C-). Similar results were obtained when using liutnan SCARB2 (hSCARB2) protein in tire pre-incubation (Figure 20D). EXAMPLE 16

Cellular Infection witlr EV71:TLLmv Is Blocked by Pre-Incubation of Mouse Cells witlr Serum Raised Agairrst SCARB2 Protein 0122؛) hr order to assess whether cellular infection is reduced by blocking the interaction of EV7J:TLLmv rvith SCARB2, seeded Ν1Η/3Τ3 cells were incubated witir various dilutions of SCA.R.B2 protein antiserum prioi' to inoculation with live EV71:TLLm.v, and infection was assessed by measuring the titer of live virus progeny. Pre-incubation of cells witlr low dilutions of lrSCARB2 antiserum (1:20 to 1:80) resulted in significant dose-dependent reduction of virus titer compared witb control (Figure 20Ε). Sinrilar results were obtained wlren cells were pre-incubated with mSCARB2 antiserum (Figure 20F). EXAMPLE 17

The CDV:BS(M-P1] and CDV:BSypi[K98E/E145A/L169F]m\ize Murine SCARB2 Protein as Their Functional Receptor for Entry into Murine Cells (0123) Both CDV:BS[M-P1] and CDV:BSypi[K98E/E145A/L169F] stably infect mouse ١٣ cells. In order to detenrrine whether these CDV, like the rnouse cell-adapted EVVLTLLmv strain, also utilize mSCARB2 for virus entry and uncoating, Neur0-2a cells were incubated with mSCARB2 antiserum prior to infection witir the CDV mutants. Dose-dependent reduction of lytic CPE was observed in cells infected witir eilher CDV:BSypi[K98E/E145il69F] (Figure 21Α) or CDV:BS[M-P1] (Figure 21Β). Titration of culture supernatants at 7 days post-infection (dpi) reveal no significant difference in CDV:BSvpi[K98E/E145A/L169F] virus titer in cells pre-incubated witlr SCARB2 antiserum WO 2016/122403 PCT/SG2016/050031 50 compared to controls (Figure 21C). On other hand, significant virus titer reduction was detected in CDV:BS[M-Pl]-\idtd cells pre-incubated with sera with respect to controls (Figure 21D). EX^dPLE 18

Materials and Methods for Example 19 (0124( Animal model: To determine tire animal infection phenotype of the mouse cell-adapted strains (,EV71:TLLm and EV71:TLLmv), 5-6-day old Balb(c mice were infected with 10٥ CCE>50 of the virus and observed for symptoms of disease and neurological complications. The animals were followed up for a maximum of 28 days, after whiclr the animals were sacrificed and sei'a wei'e collected foi' detection ofEV71,-specific antibodies. EXAMPLE 19

Neuro-Virulence Study ofMouse Cell Line-Adapted EV71 (EV71:TLLm wdEV71:TLLmv) In Balb/c Mice [0125] Of the immuno-competent animals infected with Li'7/.’FLLj (n = 7), two died (29%) of severe and persistent (> 24 hours) paralysis at 8 days post-infection (Figure 13Α). Of the other surtdving mice, 5 (5(7, 71.4%) exilibited tremors and ataxia, 5 exhibits! paresis in either one or botli hind limbs, and 4 (4(7, 57.1%) exhibits temporary paralysis in either one or both hind limbs. On the other hand, animals infected with EV71zTLLmv exhibited a more severe clinical manifestation of tire disease. Nine out often (90%) infected aninrals succumbs! to the disease witlrin 8 days ofinfectioir (Figure 13Α), with 6 of the 9 (66.7%) deaftrs occuming within the fourth day post-infection. Other syjnptoms presejrted include tremors (5(10, 50%), paresis in either oire or both hind limbs (6(10, 60%), and paralysis in eitlrer one or both hind limbs (5(10, 50). While thee seems to be iro difference in the body weights of mice infected with EV71:TLLm compared to mock-infected animals, mice infected witlr EV?l:TLLmv exhibited a drastic reduction in body weiglrt within the first 10 days of infection (Figure 13Β). More interestingly, we observed a novel symptom in EV71-infected mice, whereby tire paralyzed animals (Figure 14Α, arrow) present^ with tachypnea with promiirent subcostal recession. Further, 6 of the 9 (66.7%) fatalities present^ this symptom piiorto euthanasia. Upon necropsy, we also observed failure of tire lungs to collapse 'upon opening oftlroracic cavity (Figure 14Β, arrows), a nonnal procedure in necropsy wlren collecting lung and heart tissues, suggesting he existence of pulmonary edema. Histological examination of the tissues revealed features of pulmonary edema and hemorrhage in the alveolar spaces of the lungs (Figure 14C), and higlrer WO 2016/122403 PCT/SG2016/050031 51 magnification images show the present of homogenous proteinaceous material (Figure 14D, arrows). (0126) This Example is also performed using imnmno-ccnnpromised mice, such as NSG mice. Similar results are obtained except tliat severity of disease i.s greater and, the mortality rate is higher. EXAMPLE 20

Screening Candidate Anti-EV71 Compounds (0127) High through-put in vitro screening of candidate anti-EV71 impounds is performed using the mouse ΝΠ1/3Τ3 cell line which has been shown to be susceptible to cytolytic infection by EV71:TLLm or EV71:TLLmv virus strains. The selected promising compounds from the in vitro screening are then in vivo tested in the animal model. To accomplish the in vivo screening, a standardized (based on statistical calculation) irumber of BALB/c mice are infected with a standardized tite of the vims strains taken, from a standardized stock of mouse cell line-adapted EV71 strains (EV71:TLLm and EV7hTLLmv) tliat is prepared, titrated and kept in a deep freezer (-80.C). The candidate anti-EV71 compoimd is administered to tire infected mice at various standardized dosages eitlier before appearance of illness for assaying a potential preventive effect of the candidate compound or after onset of illnes for assaying a potential therapeutic etfect of the candidate compound. EXAMPLE 21

Materials and Methods for Examples 22-25 (0128) Mouse and virus strains'. Adult BALB/c mi.ee were purchased from InVivos (Singapore), and mated to obtain pups. EV71 strains used for inoculation included EV71:BS, EV71:TLLm, and EVTJrTLLmv, whose details and characteristics have been described herein. (0129) Ethics statement: The animal procedures were approved by tire Institutional Care and Use ofAninral Committee (IACUC) ofTetnasek Lifesciences Laboratory (approval no. TLL-14-023). Infected animals that becanre moribund wee euthanized by injection wih 90 mg/kg pentobarbitone via the Ι.Ρ. route. Neurologic examination was perforjned following the guidelines and standard procedures set by The Institutional Care and Use of Animals Committee (IACUC) of Univesity of California Sair Franciso. Criteria for euthanasia included previously set sidelines (34): (1) loss of> 20% maximum recorded body weight, (2) paralysis lasting >48 h, (3) absence of feeding or inability to feed, (4) inability to self-right, and (5) altered state of WO 2016/122403 PCT/SG2016/050031 52 consciousness presenting as either stupor or coma. Pups were observed for 28 days total, and animals tliat survived throughout this pnod were euthanized by Ι.Ρ. injection of pentobarbitone. 1.130] Animal handling and infection: Groups of eight mice of varying age (6, 14, 21, or 28 days old) were inoculated, witlr EV71:TLLmv (dose 10٥ CCIDso) either by 1.p. or Ϊ.Μ. injection. To determine the optimum dose oiEVJlzTLLmv, groups of 6-day old pups (n=8 per group) were challenged witli varying doses of virus (101.5 لء, ΙΟ41.2 .01 لق10 ؛ CCID50) via the Ι.Ρ. route. Infected animals were observed twice daily for disease presentation during tire first week post-infection, Botlr moribund animals and drose that survived the observation period were euthanized as described above. Tenninal blood collection was performed via cardiac puncture using a 26G needle. \h\3Y\ Necropsy, gross pathological observations, and tissue collection'. MVinxd ϋ؛ were necropsied using standard protocols to haivest organs. Gross pathologic examination was also perfonned and photographs were taken with IACUC approval. Lungs were superficially flushed twice with sterile PBS, and then blotted dry on filtei* papei' prior to meaning the wet weight, Haivested organs for histological shidies were stored in 1,0% neufial buffers! fonnalin (NBF) fori week at 4. c.

[0132] Determination: of tissue viral load. Frozen tissues were macerated using a Teflon pestle and reconstituted in. lml DMEM (1% FBS). Samples were then mixed, for lh and centrifirged twice (20 g, 30 min, 4. C) to renrove tissue debris aird obtain clarified virus. Tire virus sample was disaggregated in 1% sodium deoxycholate [88] prioi* to ten-fold snal dilution aird transfer onto ΝΙΗ/3Τ3 cells. Infected cells were observed daily for cytopathic effects (CPE), and cells were stained witli pan-enteroMras monocloiral airtibody (Merck Millipore, USA) [88]. Virus titers were enumerated, and reported as CCIDsij per g tissiie.

[0133] Tissue processing for histological analyses: Fixed tissues were delrydrated in a series of increasing concentrations of 70%, 95% and 100% ethanol. Tissues were incubated in two changes of alcohol and three changes ofHistoclear II (Electron Microscopy Sciences, USA), and finally infiltrated with four changes of melted paraffin wax. All iircubations were performed for 1 h at room teirrperature with geirtle rocking at 100 rpm. Paraffin infiltrations were perform^ in an oven set at 65. c. Paraffin-embedded tissue blocks were sectioned (5 pm) using a microtome, loaded onto poly-lysine-coated, glass slides, dried overnight at 42٥ c, and tlren stored at room tempeature uirtil firrther use.

[0134] Staining of tissue sections: Tissue sectioirs were de-waxed by incubation in two changes of Histoclear II and then slowly rehydrated iir decreasing alcohol concentrations of WO 2016/122403 PCT/SG2016/050031 53 100%, 95%, 70%, and 50%. Slides were incubated in PBS for lOmin prior to staining. Hematoxylin and eosin (Η &amp;Ε) staining was performed by first flooding the slides with Harris' henatoxylin (Sigma Aldrich, USA.) and incubating at room temperature (RT) foj- 15 min. The slides wei'e then rinsed in water, de-stained in 1% acid alcohol (95% ethanol, 1% HCl), dipped, in 0.2% ΝΗ40Η, and rinsed in water for 10 min prior to counterstaining in eosin solution. The slides were next de-stained in 95% ethanol, dehydrated by three changes of absolute alcrrbol and two changes of Histoclear II. Tiss'ues were finally set in DPX mounting fluid (Sigma Aldrich, USA).

[0135] Immunohistochemistry: Following de-waxing and rehydration, slides were subjected to heat-induced antigen retrieval by incubation in a histology-grade microwave oven and citrate buffer (pH 6.0) for 30 min at 96. c. Slides were allowed to cool to RT over 3h. and were subsequently blocked with 5% normal pig serum for 1 h at RT. Without further wasliing, the slides were then incubated at 4. c overnight in rahbit serum containing polyclonal antibodies against EV71 (a generous gift fiom Dr. Hiroyuki Shimizu ofNIID, Japan). The slides were then washed 5 times in Tris-lmflbred saline (pH 7.4), 0.05% Tween-20 (TBS-Τ), and rinsed twice in TBS prior to quenching endogenous peroxidases by addition of 3% Η2Ο2 for 1 h at RT. Slides were subsequently washed twice in TBS prior to incubation with swine-anti rabbit Ig-HRP (Dako Cytomation, Denmark) for lh at RT. After washing, slide were incubated in diaminobenzidine (DAB) substrate, and counterstained with hematoxylin. \ϋ€،\ Mapping viral antigens and virus-induced lesions in tissue seeflons.. Tem\١v،i.te لآجا؟ةا٠ of representative coronal sections of the mouse brain were downloaded from WWW dot brainstars dot org [89]. Tliese images are free to be used and modified under license from the Creative Commons ofj'apan. Tire observed lesions and viral, antigens were marked onto template images. Affected brain regions were identified using the mouse brain atlas of coronal sections (www dot mouse dot brain-map dot Ol'g slasli. static slash atlas) [90]. Similarly, a representative coronal section of the thoracic spinal cord was used as the template for spinal cord maps. Areas depicting the presence of viral antigens and virus-induced lesions were then marked onto the template images.

[0137] Measurement of serum catecholamine levels: Blood samples were collected by cardiac puncture of moribund animals during necropsy. Serum was obtained by centrifoging coagulated blood, sanrples at 3000 g, 4٥ c, for 30 min, then stoi'ed at -20. c until determination of catecholamine levels using the 2-CAT (Α-Ν) ELISA kit (Labor Diagnostika Nord, Germany) according to the manufacturer's pi'otocols. WO 2016/122403 PCT/SG2016/050031 54 [0138] Statistical analyses: All graphs were created and statistical analyses performed using GraphPad Prism (version 6.01) for Windows (GraphPad Software, USA, WWW dot graphpad dot com). \ΙΒΛ Comparison 0.( the infection phenotypes induced by viral, strains EV71:TLL ةا EV71:TLLmv\ Gi'oups of 6-day old BALB/c pups were inoculated witlt a 106 ccroso dose of EV71.-BS, EV71:TLLmf or EV71;TLLmv via the intraperitoneal (Ι.Ρ.) or intramuscular (Ι.Μ.) route (η=10 mice per group). Animals were observed twice daily for signs of disease during the first week post-inoculation and, euthanized when, critical, signs were detected as already described. \40\لأ\ Measurement of neutralizing antibody levels in sera from infected mice'. Blood samples were collected by cardiac puncture at necropsy before being clotted at room temperature and the serum obtained by centrifogation for 20min at 3000g١ 4٥ c. Samples were stored at -20. c until, further analysis. Random samples of the frozen stocks were assayed for neutralizing antibody titers. Two-fold serial dilutions of serum (1:20 to 1:1280) were prepared in 96-well plates aitd mixed with 100 CCIDso virus. The mixhrre was incubated for 1 h at 37. c prior to addition of ΝΙΗ/3Τ3 cells (6,000 cells/well). Plates were incubated at 37. c foi" seveal days and obseived for CPE between days 4-10. Neutralizing antibody titers were determined using the Reed and Muench metlrod (reported as units ,per ml sera). EXAMPLE 22

Infection Dynamics of Modified EV71 Strains in Murine Hosts (0141¾ Cureent animal models of enterovirus 71 (EV71 )-induced neurological disease and pathology only partially replicate the human disease. We therefore aimed to develop a clinically authentic model of disase pathology using the jnouse cell (Ν1Η/3Τ3 )-adapted virus strains EV7]:TLLm and EV71:TLLmv, which can productively infect both rodent and primate cell lines [88(. First, tire relative virulence of EV71:TLLm and EV71:TLLmv compared with the parental strain EV71.-BS was assessed by assessing disease pathology in 1-week old BALB/c mice infected with vims via tire infraperitoneal (Ι.Ρ.) route. While seroconversion was observed in all tire inoculated animals, only mice infected with eidrer EF7];TLLm or EV71:TLLmv progressed to ledral disease (Figures 22a and 22b). Siirrilarly, wheir the adapted sfrains were admiltistered via the alternative intramuscular (Ι.Μ.) route, these were again associated with reduced host survival relative to the parental strain EV71:BS (57% survival؛ Figure 22c). When the Ι.Ρ. and Ι.Μ. infection routes were considered togetlrer, the median survival time after inoculation was 4 WO 2016/122403 PCT/SG2016/050031 55 days post-infection (DPI) for EV71:TLLmv infection and 7 DPI for EV71:TLLm infection (X2 = 6.840؛ p = 0.0089). Together, these data indicate! tiiat mouse cell-adapted viral strain EV71:TLLtnv was associated with the greatest levels of lethality, and was therefore used in all subsequent experiments. (0142) Tlie optimal virus dose, inoculation, route, and mouse age to use for farther model development were next assess^!. First, i.t was continued that disease severity in EV71:TLLmv-infected mice was dependent on virus dose؛ minimum survival rate was observed in animals inoculated with a median cell culture infectious dose (CCID50) of 10٥ (Figure 23a) and the median humane endpoint (HD50) was equivalent to 3.98 X 10ة CCID50 (Figure 23b). The influence of animal age and fafection route on host surcival was tlien evaluated; the survival curves of 1 week-old mice injected with EV71:TLLmv were not sigrificantly affected by inoculation route (Figure 23c), but young animals exhibited consistently poorer survival than did older animals, inespective of virus injection site (Figure 23d). Only in older animals was it possible to discern any effect of infection route on disease severity; while 3 week-old mice were completely resistant to Ι.Ρ. infection, some animals did not survive virus injection via the Ι.Μ. route (Figures 24a and 24b). Seroconversion, was detected in all mice that survived tire infection, including tlrose tlrat did not exhibit any signs of disease (Figures 24c, 24d and 24e). These data demonstrated that EV71:TLLm.v induces acute and severe infection faat is lethal in mice aged 1-3 weeks old. Of the conditions tested here, disease severity was greatest in 1 week-old nrice injected with a virus dose of 10ج CCID.؛)؟ either into tire peritoneal cavity or muscle tissue. EXAMPLE 23

Disease Progression \nEV71:TLLmv-[nk{td Mice (0143) The majority of 1-week old nrice inoculated with EV71:TLLmv succumbed to disease and exhibited myriad clinical signs of neurological illness. Infected animals exhibits ataxia, localized or wlrole-body tremors, unsteady gait, and lfarb paresis and paralysis either transiently or' persisting until the time of euthanasia. Based on clinical presentation, tire sick aninrals ould be readily categorized into four groups (Table 6). Survivors included mice faat did not appear mortiburrd at any point during the observation period of 28 days. Class I animals present^ after just 3-7 DPI with severe signs iircluding an inability to self-right arrd either stupor or coma. All nrice in tiris group exhibited spastic limb pai'esis and/or paralysis (fore-limbs, hind-limbs, or botlr), but while some animals were devoid of respiratory symptoms (Class IB), otirei's were additioirally characterized by sigirs of respiratory distiess, iircluding tachypnea, hiccupping, WO 2016/122403 PCT/SG2016/050031 56 gasping, and subcostal recession (Class IA). Hallmark (observations in EV71:TLLmv-mkled mice presenting Class 1Α signs of disease were made by video comprising two video clips of two different Class IA mice. Both animals were unable to self-right and were iir a state of coma. Severe respiratory distress presenting as tachypnea with subcostal recession was evident in the first mouse. Gasping, subcostal recession and a frothy fluid emanating from tlie nostrils were seen ئ the second mouse. Hallmark observations in EV71:TLLmv-infected mice presenting Class IB signs of disease were made by a video of one Class IB mouse. The animal was unable to self right and was in a state of stupor. Ipsilateral paralysis of the right limbs and persistent fremor of the left liind-limb were also observed. Finally, Class II mice presented after 7 DPI with signs ofinfection including persistent flaccid paralysis of the limbs (>48h duration) (Figure 23e) together with severe weight loss (>20% jnax. body weight). In all disease classes, some of the infected anintals displayed hairless lesions or bald spots on their backs that persisted for a few days (Figure 23f). Tlie majority of pups inoculated Ι.Ρ. witlt EV71:TLLmv were categorized into Class I (Figure 23g); Class IA animals com'prised 13.و% (η=11؛ patent respiratory signs), while Class IB animals comprised 43.9% (η=25; no overt respiratory signs). Class 774 animals represented just 12.3% (n=7) of the infected pups, and Survivors constituted 24.5% (η=14) of all infected mice. A similar pattern of distribution between disease categoi'ies was observed in pups inoculated via the Ι.Μ. route (Figure 23h). Together, these data indicated that mice infected with EV71:TLLmv exhibit variable incidence and severity of both neurological and respiratory symptoms that reflect tire full spectrtrm of disease observed in human patients.

Clinical Features of EV777 : لXmv-Infected BALB/c Mice at the Time of Euthanasia TABLE 6

Class IA Class IB ClasslI Survivorsa Time to onset of signs [days post-infection (DPI)] Within 3-5 Within 3-7 >7 Ν/Α Level of consciousness Stupor^ / Coma. Stupor^ Active Active Weight loss < 20% body weight < 20% body weight >20% body weight None or <20% body weight Limb ftrnction (>48 h) Spastic limb paresis / paralysis Spastic limb paresis / paralysis Flaccid limb paralysis Normal Breathing function Tachpnea/ gasping/ Regular Regular Re^ilar PCT/SG2016/050031 57 hiccupping Cardiac function Tachycadia Tachycardia^ / Regular Regular Regular Limb tremors May be present Maybe present Absent Absent WO 2016/122403 ع Animals were assessed at the end of the observation period (28 DPI) '٥ Animal was unable to self-right, but responded to physical stimulation of the toes, ء Animal was uirable to self-right and did not respond to physical stimulation of the toes. ٥ Tachycardia was observed in 35% oi Class IB mice EXAMPLE 24

Neurogenic Pulmonary Edenra in Mice Presenting Class IA Signs [01.44] Whether tire respiratory distress observed in Class IA mice was a sign of virus-induced pulmonary edema (PE) was fiirther investigated. Comparison of gross lung pathology between Class IA, Class IB, and Class II mice revealed that Class IA lungs were swollen, incompletely collapsed at necropsy (Figures 25a-25d), and displayed increase wet weight relative to luirgs from other groups (Figure 22Ε). Comparison of lung tissue sections from sham-inoculated (Figure 25ft and Class IA lungs revealed focal areas of hemorrhage and accumulation of proteinaceous and erythrocyte-filled fluid in tire alveolar spaces of the infected animals only (Figure 25g). These pathological features were absent frotrr the lungs of Class IB and. Class II mice (Figures 25h and 25i). Furthermore, we found no evidence of inflammatory infiltrate or viral, antigens in the lungs collected from any group of mice (Figure 26a). Similarly, histochemical analyses of the cardiac luuscles in each class ofiirfected mice were also unable to uncover any evidence of an inflammatory infllfrate, cardiac muscle necrosis, or viral antigens (Figure 26b). Together, flrese data demonstrated that the respiratory distress evident in Class IA mice could not be attributed to either pneumonitis or congestive heart failure. We therefore sought to determine whether the PE observed in this group was of neurogenic origin, so we next measuretl serum levels of catecholamines to determine whether neurotransmitter eoncenfrations were modulate in EV71: TLLmv-'mfecteA mice with respiratory signs (jClass IA). Using this approach, we observed that blood concentrations of both adrenaline (epinephrine) and noradrenaline (norepinephrine) were significantly higher in Class IA mice than those detected in either Class II mice or mock-infected animals (Figures 25j and 25k). These data strongly indicated that Class IA mice exhibited EV71-induced neurogenic pulmonary edema (NPE) prior to death. WO 2016/122403 PCT/SG2016/050031 58 EXAMPLE 25 EV71:TLLmv Viral Neurotropism in Class IA, Class IB, and Class //Mice 0145؛] The distribution of EV71:TLLmv and virus-induced lesions in the brains and spinal cords of animals from each disease group were next assessed in order to identify factors hat might contribute to tire selective development of NPE in Class IA mice only. The majority of animals in Class IA. and Class IB exlribited ubiquitous staining of viral antigens (>10 positive neurons detected) and mild pathological lesions (>5 lesions observed) in all of the CNS regions assessed (Table 7). in contrast, only 1 of 5 mice Wth Class II disease exhibits viral antigens and/or lesions in the sensory cortex, hippocampus, diencephalon, mesencephalon, medrdla oblongata, or lumlrar spinal cord. We were unable to detect viral antigens in airy tissues tested outside of the CNS (except foi' the skeletal muscles after inoculation via tire Ι.Μ. route; data not shown). CNS Distribution ofEV71 Antigens and Virus-induced Lesions in Terminally-Infected BALB/c .Mice TABLE 7 Class ΙΛ ClassIB Class 11 EV71 Antigens Pathology EV71 Antigens Pathology EV71 Antigens Pathology Cerebral Cortex Motor cortex + ++٥ (5/5) ة%100 ءببب٠ (4/5) ه%80 ++.+ 1؟!Q٠M٩% +-++ 80% (4/5) 0./.(0/5) 0./.(0/5) Cerebral Cortex Sensory cortex +-+ 1/. (3151 .ft 80% (4/5) + ا ¾¾./.(4(51 + ا 80% (4/5) ٠ 20./.(1/5) ٠ 20% (1/5) Hippocampus ++ 15١ة)ا1 ؛ 60./.(3/5) + (2/5) ء/ه40 ا 20./.(1/5) + 20% (1/5) ا 20% (1/5) Diencephalon Thalamus ر-. 100./.(5/5) +++ 60% (3/5) ++ 60./.(3/5) +ر 20% (1/5) + 20./.(1/5) + 20% (1/5) Diencephalon Hpthalamus ++.+ 80./.(4/5) +-+.+ 80% (4/5) ++ 60% (3/5) ب٠ب٠ 60% (3/5) + 20% (1/5) + 20% (1/5) Mesencephalon 1++ 100% (5/5) .+++ 100% (5/5) +. 60% (3/5) ++ 60% (3/5) -+ 1./.(1151 ..+ 20% (1/5) Metencephalon Cerebellum '*f"*4*' 80% (4/5) ٩٠زا 80% (4/5) + 40./.(2/5) -+ ا5أ3)ل٠ 0% (0/5) ¾./.(.151 Metencephalon Pons ++ 80% (4/5) 80% (4/5) ب٠ب 20% (1/5) ++ 60./.(3/5) 0% (0/5) 0%(0/5) Myelencephalon Medulla ~Η“ + 100% (5/5) +'ءأ + 100% (5/5) +"؛- 40./.(2/5) ++ 60% (3/5) 20%(1/5) + 20./.(1/5) Spinal Cord Cejvical 100./.(5/5) 100./.(5/5) 80% (4/5) +-ا- 60./.(3/5) 0./.(0/5) 0%(0/5) Spinal Cord Thoracic 100% (5/5) (5/5) ه/100٠ ++ 80% (4/5) ,+- 80./.(4/5) 0%(0/5) 0%(0/5) Spinal Cord Lumbar ++ 100./.(5/5) ++ 100./.(5/5) + ؛ 80% (4/5) +-+ 60% (3/5) + 20./.(1/5) + 20% (1/5) : Density of viral antigens detect«! per slide: +, < 10 positive netnons; ++, 10-20 positive neurons: +++, > 20 positive neurons ٥ Percentage of animals exhibiting viral antigens in the specified brain region (n — 5) ء Distribution of pathologic lesions in nervous tissu.es: +, <5 lesions10-5 ,++ ؛ lesions10< , + ++ ؛ lesions ٥ Percentage of animals exhibiting lesions in the specified brain region (n = 5) wo 2016/122403 o ٠١ ٠ WO 2016/122403 PCT/SG2016/050031 60 [0146] When CNS pathology between Class IA and Class IB mice was compared, it was obseved that both tissue lesions and viral antigens were localized to the same areas within tire hippocampus, diencephalon, mesencephalon, cerebellum, and medulla, but pathology was more severe in animals with Class IA disease (Table 7 and Figures 27a-27d). Indeed, when compared with Class IB mice, animals in Cl«.؟,؟ IA displayed more extensive neuronal degeneration, phagocytosis, and necrosis in CA3 neurons of the hippocampus (Figures 28a and 28b). Class IA mice also exhibit«! intense viral antigen staining in hypothalamus, accompanied by marked tissue inflammation and neuronal necrosis, whereas these pathological features were limits in 61«.؟,؟ IB animals (Figures 28c and 28d and Figure 27b). Similarly, 67«.؟.؟ IA mice also presented features of more severe virus-induced patlrology and viral antigen intensity in the ventro-posterior complex of the thalamus (Figures 28e and 28fand Figure 27b), the mesencephalon-associated tissues including the peri-aqueductal gray (PAG) jnatter, midbrain reticular area, and motor-related superior collicidus figures 28g and 28h and Figure 27c), as wel.1 as in tlie Purkinje cells and dentate nucleus of the cerebellum (Figures 28i and 28j, Figure 27d and Figure 29a.

[0147] In both disease ^oups (iClass IA aird 67«.؟.؟ IB), the most exteitsive distribution of viral antigens and patltological lesions involving neuronal damage and tissue inflammation were detected in tire medulla oblongata (Figures 28k and 281), particularly in the motor-related areas of the intermediate reticular- nuclei (H), parvicellular reticular nuclei (PARN), and spi-nal nucleus of the trigeminal nerve (sptV) (Figure 27d and Figure 29b). However, only 6.7«ة'ذ IA mice exlribited viral antigens and tissue lesions in tire ventral and dorsal regions of the medullary reticular nucleus (MdRN), the nucleus of tire solitary tract (NTS) and area prostiema (AP) (Figures 29b and 29c). For amparison, representative inrages of the hippocampus, hypothalamus, thalamus, midbrain, cerebellum, and medulla from mock-infected mice are also shown (Figures 30a-30fy In contrast. Class IA and Class IB mice did not differ with repect to the distribution, localization or extent of tissue lesions or viral antigen staining witlrin the nrotor cortex, somatosensory cortex, pons or ventral homs of the spinal cord gray matter (Figures 28m and 28n, Figures 27a-27c and Figures 31a-31e), consistent with the concept that NPE is caused by virally trigger^ damage to specific brain regions rathe tlran a unifonn increase in EV71-induced pathology across all tissues.

[0148] The use of tire terms “a” and “an" and “the” aird similar referents in tire context of describing the invention (especial ly in the context of the followiirg claims) are to be consirued to WO 2016/122403 PCT/SG2016/050031 61 cover both the singular and tlie plural, unless otherwise indicated herein or clearly contradicted by context. Tlie tenns “comprising," “having," "including," and “containing” are to be construed as open-ended terms (i.e., meaning “including, but not limited to,") unless otherwise noted.. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling witlrin the range, unless otherwise indicated, herein, and each separate value is incorporated into the specification as if it were individually recite Irerein. All methods desCTibed lrerein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of airy and all examples, or exemplary language (eg, “such as") provided herein, is intended merely to bette illuminate the invention and does not pose a limitation on tire scope of the invention unless otherwise claimed. No language in tire specification slrould be construed as indicating any ηοη-claimed element as esseirtial to tire practice of tire invention.

[0149] Embodiments of this invention are described Irerein, including the best mode known to the inventors for carding out the invention. Variatioirs of those enrbodiments nray become apparent to tlrose of ordinal skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically describe herein. Accordingly, this inventioir iircludes all modifications and equivalents of the subject matter !.ecited in tire claims appended, h.ereto as pennitted by applicab Moreover, airy combiiration of the above-described elements in all possible variations thereof is encompassed by the invention unless othewise indicated herein or otherwise clearly contradicted by context.

BffiLIOGRAPHY

[.150] 1. Alexander .IP, Baden L, Pallansch MA, Anderson LJ (1994) Enterovirus 71 infections and neurologic diseaseUnited States, 1977-1991. ل Infect Dis 1.69: 905-908.

[0151'] 2. Melnick JL (1996) Enteroviruses: Polioviruses, Coxsackieviruses,

Echovimses, and Newer Enteroviruses. In: Fields B N KDM, Howley p M, et al.., editor. Fields Virology. Philadelphia,: Lippincott-Raven. 655-712.

[0152] 3. Bible JM, Iturriza-Gomara M, Megson B, Brown D, Pantelidis p, et al. (2008)

Molecular epidemiology of human enterovirus 71 in the United. Kingdom fronr 1998 to 2006. ل Clin Microbiol 46: 31923200.

[0153] 4. Ooi MH, Wong sc, Lewthwaite p, Cardosa MJ, Solomon T (2010) Clinical features, diagnosis, and management of enterovirus 71. Lancet Neurol 9: 1097-1105.

[0154] 5, Solomon T, Lewthwaite p, Perera D, Cardosa MJ', McMinn p, et al. (2010)

Vii'ology, epidemiology, pathogenesis, and contiol of enterovirus 71. Lancet hrfect Dis 10: 778- 1%. WO 2016/122403 PCT/SG2016/050031 62 [01556 إ. Schmidt NJ, Lennette EH, Ho HH (1974) An apparently new enterovirus isolated from patients with, disease of the cenfral nervous system. ل Infect Dis 129: 304-309. {01,561 7. Blomberg j, Lycke E, Ahlfors K, Johnsson T, Wolontis s, et al. (1974) Letter:

New enterovims type associated with epidemic of aseptic meningitis and-or hand, foot, and mouth disease. Lancet 2: 112. 8 ل0157ء. Kennett ML, Birch CJ, Lewis FA, Yung AP, Locarnini SA, et al. (1974) Enterovirus type 71 infection in Melbourne. Bull World Health Organ 51: 609 615.

[01581 9. Deibel R, Gross LL, Collins DN (1975) Isolation of a new enterovirus (38506). Proc SocExp Biol Med 148: 203-207. 10 او015أ. Hagiwara A, Tagaya I, Yoneyama T (1978) Epidemic ofliand, foot and mouth disease associated witir enterovirus 71 infection. Intervirology 9: 6063.

[01601 11. Chumakov M, Voroshilova M, Shindarov L, Lavrova 1, Gracheva L, et al. (1979) Enterovirus 71 isolated from cases of ؟identic poliomyelitis-like disease iir Bulgaria, ^ch Virol 60: 329-340.

[01611 12. Shindarov LM, Chumakov MP, Voroshilova MK, Bojinov s, Vasilenko SM, et al. (1979) Epidemiological, clinical, and pathomorphological characteristics of epidemic poliomyelitis-like disease causal by enterovirus 71. ل Hyg Epidemiol Microbiol hnmunol 23: 284-295.

[0162} 13. Nagy G, Takatsy s, Kukan E, Mihaiy I', DOmOk I (1982) Virological diagnosis of enterovirus type 71 infetions: experiences gained during an epidemic of acute CN'S diseases in Hungary in 1978. Arch Virol 71:217-227.

[.0163] 14. Chonmaitree T, Menegus MA, Schervish-Swierkosz EM, Schwalenstocker E (1981) Enterovirus 71. infection: ,report of an outbreak with two cases of paralysis and a review of the literature. Pediafrics 67: 4894 93.

[0164] 15. Samuda CiM, Chang ١VK١ Yeung CY; Tang PS (1987) Monoplegia caused by Enterovirus 71: an outbreak in Hong Kong. Pediatr Infect Dis 208-206 :6 ل.

[0165] 16. Gilbert GL, Dickson KE, Waters Μ.Τ., Kennett ML, Land SA, et al. (1988) Outbreak: of enteroviius 71 infectioir in Victoria, Australia, with a lrigh incideirce of neurologic involvement. Pediafr Infect Dis I 7: 48 4488.

[0166] 17. Hazard J'C, Gillespie SM, Kaplan KM, Packei' R, Pallansch M, et al. (1989) Outbreak of poliomyelitis-like paralysis associated with enteoviius 71. Pediatr Infect Dis I 8: 611416.

[0167] 18. Tagaya I, Takayama R, Hagiwara A (1981) A large-scale epidemic of hand, foot and mouth disease associated witlr enterovirus 71 infection in J'apan in. 1978. Jpn ل Med Sci Biol 34: 191-196.

[0168[ 19. Ishimaru Y, Nakano s, Yamaoka K, Takami s (1980) Outbreaks of hand, foot, and mouth disease by enterovirus 71. High incidence of complication disorders of central neivous system. Arch Dis Child 55: 583-588.

[0169] 20. Hagiwara A, Yoneyama T, Hashimoto I (1983) Isolation of a temperature-sensitive strain of enteroviius 71 with reduced neurovimlence for monkeys. ل Gen Virol 64 (Pt 2): 499-502.

[0170] 21,. Lum LC, Wong KT, Li SK, Chua KB, Goh AY, et al. (1998) Fatal enterovirus 71 encephalomyelitis. ل Pediatr 133: 795-798. WO 2016/122403 PCT/SG2016/050031 63 [0171] 22. Lum LC, Wong KT, Lam SK, Chua KB, Goh AY (1998) Neurogenic pulmonary oedema and enterovirus 71 encephalomyelitis. Lancet 352: 1391.

[0172] 23. Clrang LY, Huang YC, Lin TY (1998) Fulminant neurogenic pulmonary oedema with hand, foot, and mouth disease. Lancet 352: 367-368, [0173] 24. Yan JJ, Wang JR, Liu cc, Yang HB, Su IJ (2000) An outbreak of enterovinis 71 infection in Taiwan 1998: a comprehensive pathological, virological, and molecular study on a case offillminant encephalitis. ل Clin Virol 17: 13-22.

[0174] 25. Liu cc, Tseng HW, Wang SM, Waitg JR, Su u (2000) An outbreak of enterovirus 71 iirfection in Taiwan, 1998: epidemiologic and clinical manifestations. ل Clin Virol 17:23-30.

[0175] 26. Wang JR, Tsai IIP, Chen PF, Lai YJ, Yan JJ, et al. (2000) An outbreak of enteroviius 71 infection in Taiwan, 1998. Π. Laboratory diagnosis and geitetic aitalysis. ل Cliir Virol 17: 91-99.

[01.76] 27. China c (2008) Report on tire hand, foot and mouth disease outbreak in

Fuyang City, Anhui Province and he prevention and control, in China. Beijing, Ch.ina: Office of the World Health Organization, China.

[0177[ 28. Yang F, Zhang T, Hu Y, Wang X, Du j, et al. (2011) Survey of enterovirus infectiojrs from hand, foot and moutir disease outbreak in China, 2009. Virol 508 :8 ل.

[0178[ 29. Zeng M, El Khatib NF, Tu s, Ren p, Xu s, et al. (2012) Seroepidemiology of

Enterovirus 71 infection prior to the 2011. season in children in Shanghai. ل Clin Virol 53: 285-289.

[01.79[ 30. Zhang Y, Crti w, Liu L, Wang j, Zhao H, et al. (2011) Pathogenesis study of enteroviius 71 infection in rhesus monkeys. Lab Invert 91: 1337-1350.

[01.80] 31.. Arita M, Slrimizu H, Nagata N, Ami Y, Suzaki Y, et al. (2005) Temperature- sensitive mutants of enterovirus 71 show attenuation in cynomolgus monkeys, j Gen Virol 86: 1391-1401.

[0181] 32. Chen p. Song Z, Qi Y, Feng X, Xu N, et al. (2012) Molecular determinants of enterovirus 71 viral entry: cleft around GLN-172 on VPl piOtein interacts with variable region on scavenge receptor B 2. j Biol Chem 287: 6406 6420.

[0182] 33. Chen YC, Yu CK, Wang YF, Liu cc, Su IJ, et al. (2004) A murine oral enterovirus 71 infection model witir central nervous system involvement, j Gen Virol 85: 69-77.

[0183] 34. Chua BH, Phuektes p, Sanders SA, Nicholls PK, McMinn PC (2008) The molecular basis of mouse adaptation by human enterovirus 71.j Gen Virol 89: 1622-1632.

[0184] 35. Khong I, Yan B, Yeo H, Tarr EL, Lee JJ, et al. (2012) A iron-mouse-adapts enterovirus 71 (EV71) stiain exhibits neurotropism, causing neurological irranifestations iir a irovel mouse nrodel of EV71 infection, j Virol 86: 2121—2131.

[0185] 36. Ong KC, Badmanathan M, Devi s, Leong KL, Cardosa MJ, et al. (2008) Patlrologic characterization of a murine model of human enterovirus 71 encephalonryelitis. j' Neuropathol Exp Neurol 67: 532-542.

[0186] 37. Wang w. Do j, Liu j, Ma c, Zlrang L, et al. (2011) A lirouse muscle-adapted enterovirus 71 strain with increased virulence in. mice. Microbes Infect 13: 862-870. WO 2016/122403 PCT/SG2016/050031 64 [01871 38. Wang YF, Chou CT, Lei HY, Liu cc, Wang SM, et al. (2004) A mouse- adapts enterovirus 71 strain causes neuroJogical disease in mice after oral infection. ل Virol 78: 79167924.

[0188] 39. Yao pp, Qian L, Xia Y, Xu F, Yang ZN, et al. (2012) Enterovims 71-induced neurological disorders in. young gerbils, Meriones unguiculatus: development and application of a neurological disease model. PLoS One 7: e51996.

[0189] 40. Borrego B, Novella IS, Giralt E, Andreu ٠, Domingo E (1993) Distinct repertoire of antigenic variants of foot-and-mouth disease virus in the presence or absence of immune selection. ل Virol 67: 6071 6079.

[0190] 41. Burch CL, Chao L (1999) Evolution by small steps and rugged landscapes in the RNA virus phi6. Genetics 151: 921.-927.

[0191] 42. Steinhauer DA, Domhrgo E, Holland JJ (1992) Lack of evidence for proofreading mechanisms associated with an 1 virus polymerase. Gene 122: 281-288.

[0192] 43. Biebricher c. Eigen M (2006) What is a Quasispecies. In: Domingo E, editor. Quasispecies: Concept and Implications for Virology. Heidelberg: Springer-Verlag. 1-31.

[0193] 44. Eigen M, Schuster p (1977) The hypercycle. A principle of natural selfr organization. Part A: Emergence of the hypercycle. Naturwissenschaften 64: 541-565.

[0194[ 45. Eigen M, Biebricher c (1988) Sequence space and Quasispecies Distribution.

In: Domingo E, Holland j, Alrlquist p, editors. RNA Genetics. Boca Raton: CRC Press. 211- 14¾.

[0195] 46. ATCC ΝΠΕ3Τ3 ATCC CRL-11658.

[0196] 47. Yamayoslri s, Yamashita Y, Li j, Hanagata N, Minowa T, et al. (2009)

Scavenger receptor Β2 is a cellular receptor for enterovirus 71. Nat Med 15: 798-801.

[0197] 48. Yamayoshi s, Ghka s, Fujii K, Koihe s (2013) Functional comparison of SCARB2 and PSGLl as receptors for enterovirus 71.1' Virol 87: 3335-3347, [,0198] 49. Yamayoshi s, Koike s (201,1) Identification of a human SCARB2 region that is important tbr enterovirus 71 binding and infection. I Virol 85: 49374.946.

[0199] 50. Zaini z, Phuektes p, McMinn p (2012) Mouse adaptation of a sub-geno^oup Β5 strain of human enterovirus 71 is associated with a novel lysine to glutamic acid substitution at position 244 iir protein VPl. Virus Res 167: 86-96.

[0200] 51,. Arita M, Ami Y, Wakita T, Shimizu H (2008) Cooperative effect of the attenuation determinants derived from poliovirus sabin 1 straiir is essential for attenuation, of enteroviius 71 in tire NODSCID mouse infection model, j Virol 82: 1,787-1797. ]0201] 52. Zaini Zj McMinn p (2012) A single mutation iir capsid protein VPl (Q145E) of a geirogroup C4 straiir ofltuman enterovims 71 generates a mo'use-virulent phenotype, j Gen Virol 93:1935-1940.

[0202] 53. Liu cc, Cltou AH, Lien SP, Lin HY, Liu SJ, et al. (2011) Identification and characterization of a cross-neufralization epitope of Enterovirus 71. Vaccine 29: 43624 372. [0203.] 54. Zaini Z, Phuektes p, McMinn p (2012) A reverse genetic shidy of the adaptation of human enterovirus 71 to growth in Chinese hamster ovary cell cultures. Virus Res 165:151-156. WO 2016/122403 PCT/SG2016/050031 65 55 ل0204إ. Miyamura K, Nishimura Yj Abo M, Wakita T, Shimizu H (2011) Adaptive mutations in the genomes of enterovirus 71 strains following infection ofmouse cells expressing human p-selectin glycoprotein, I,igand-1. ل Gen Virol 92: 287-291. ]0205) 56. Lin JY, Chen TC, Weng KF, Chang sc, Chen LL, et al. (2009) Viral and host proteins involved in picontavirus life cycle. ل Biomed Sci 16: 103. ]0206) 57. Eigen M (1993) Tire origin of genetic information: viruses as models. Gene 135: 3747.

[0207] 58. Domingo E, Sheldon j, Perales c (2012) Viral quasispecies evolution. Microbiol Mol Biol Rev 76: 159-216.

[0208] 59. Domingo E, Mendndez-Arias Lj Holland JJ (1997) RNA virus fitness. Rev Med. Virol 7: 87-96.

[0209] 60. Domingo E (2002) Quasispecies theory in. virology. Journal of Virology 76: 463465.

[0210] 61. Reed L, Muench H (1938) A sijnple method of estimating fifty per cent endpoints. The Annerican Journal of Hygiene 27: 493 497.

[0211] 62. Lindenbach BD, Evans MJ, Syder AJ, Wdlk B, Tellinghuisen TL, et al. (2005) Connplete replication of hepatitis c virus in cell culture. Science 309: 623-626.

[0212] 63. Hall T (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/ΝΤ. Nucleic Acids Symposium Series 41: 95-98.

[0213] 64. Arnold K, Bordoli L, Kopp j, Schwede T (2006) The SWISS-MODEL workspace: a web-based environment for protein structure homology modelling. Bioinformatics 22: 195-201. ]021.4] 65, Guex N, Peitsch. MC (1997) SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling. Electrophoresis 18: 2714-2723.

[0215] 66. Bessaud M, Razafindratsimaindresy R, Nougairede A, Joffret ML؛ Deshpande JM, Dubot-Peres Aj Heraud JM, de Lamballerie X, DelpeyTOUX F, Bailly JL. (2014). Molecular comparison and evolutionary analyses of VPl nucleotide sequences of new African human enterovirus 71 isolates reveal a wide genetic diversity. PloS one 9:e90624. ]0216] 67. Neculai D, Scbwake M, Ravichandran M, Zunke F, Collins RF, Peters j,

Neculai M, Plumb j, Loppnau p, Pizareo JC, Seitova A, Trimble ws, Saftig p, Grinstein S, Dhe-Paganon s. (2013). Structure of LIMP-2 provides fonctional iirsiglits with implications foi' SR-Bl and CD36. Natiire 504:172-176.

[0217] 68. Liu j, Dong w, Quan X, Ma c, Qin c, Zhang L. (2012). Transgenic expression of human p-selectin glycoprotein ligand-l is not sufficient for enterovirus 71 infection in mice. Archives of virology 157:539-543.

[0218] 69. Fujii K, Nagata. N, Sato Y, Ong KC, Wong KT, Yamayoshi s, Shimanuki M, Shitara H, Taya C, Koike s. (2013). Transgenic mouse model for foe stiidy of enterovirus 71 neuropathogenesis. Proceedings of the National Academy of Sciences of the United States of America 110:14753-14758.

[0219] 70. Lin YW, Yu SL, Shao ΗΎ, Lin HY١ Liu cc) Hsiao KN, Chitra E, Tsou YL, Chang HW, Sia c, Chong p, Chow YH. (2013). Human SCARB2 transgenic mice as an infectious animal model for enterovirus 71. PloS one 8:e57591. WO 2016/122403 PCT/SG2016/050031 66 [0220] 71. Victorio CB, Xu Y, Ng Q, Chow VT, Chua KB. (2014). Phenotypic and genotypic characteristics of novel mouse cell line (N!H/3T3)-adapted human enterovirus 71 strains ٩ andEV71:TLLmv). PLoS One9:c92719.

[0221] 72. Yamayoshi s, Iiaika s, Yamashita T, Minagawa H, Mizuta K, Okamoto M, Nishimura H, Sanjoh K, Katsushima N, Itagaki T, Nagai Y, Fujii K, Koike s. (2012). Human SCARB2-dependent infection by coxsackievirus Α7, Α14, and Α16 and enterovirus 71. ل Virol 86:5686-5696.

[0222] 73. Wilson T, Papahadjopoulos D, Taber T. (1979). The introduction of Poliovirus RNA into cells via lipid vesicles (Liposomes). Cell 17:77-84.

[0223] 74. Collis PS, O'Donnell BJ, Barton DJ, Rogers JA, Flanegan IB. (1.992). Replication of Poliovirus RNA and su-bgenomic RNA transcripts in transfected cells. Journal of Virology 66:6480-6488.

[0224] 75. van Der Werf s, Bradley j, Wimmer E, Studier FW, Dunn JJ. (1986). Synthesis of infectious poliovirus RNA by purified Τ7 RNA polymease. Proceedings of the National Academy of Sciences of the United States of America 83:2330-2334.

[0225] 76. Nishimura Y, Lee H, Hafenstein s, Kataoka c, Wakita T, Bergelson JM, Shimizu H. (2013). Enterovirus 71 biltding to PSGL-1 on leukoc^es: VPl-145 acts as a molecular switch to conhol receptor interaction. PLoS patlrogens 9:el003511.

[0226] 77. Dang M, Wang X, Wang Q, Wang Y, Lin j. Sun Y, Li X, Zhang L, Lou z, Wang j, Rao z. (2014). Molecular mechanisnt of SCARB2-mediated attachment and uncoating ofEV71. Protein &amp; cell 5:692-703.

[0227] 78. Wang X, Peng w, Ren j, Hu z, Xu j, ئ z, Li X, Yin w, Shen X, Porta c, Walter TS, Evans G, Axford D, Owen R, Rowlands DJ, Wang j, Stuart Dl, Fry EE, Rao z. (2012). A sensor-adaptor mechanism for enterovirus uncoating from stnrctures of EV71. Natirre structural &amp; molecular biology 19:424-429.

[0228] 79. Lyu K, Ding j, Han JF, Zhang Y, Wu XY, He YL, Qin CF, Clren R. (2014). Human enterovirus 71 uncoating captured at atomic resolution, j Virol 88:31.14-3126.

[0229] 80. Ren j, Wang X, Hu z, Gao Q, Sun Y, Li X, Porta c, Walter TS, Gilbert RJ, Zhao Y, Axford D, Williams M, McAuley K, Rowlaitds DJ, Yin w, Wang ءو Stiiart DI, Rao z. Fry EE. (2013). Picornavirus uncoating intermediate captured in atomic detail. Nature communications 4:1929.

[0230] 81. Slringler KL, Yoder JL, Carnegie MS, Ashley RE, Makhov AM, Conway JF, Hafenstein S. (2013). The enterovirus 71 A-particle fonns a gateway to allow genome release: a cryoEM study of picornavirus uncoatiirg. PLoS pathogens 9:el003240.

[0231] 82. Ong KC, Badmanathan M, Devi S, Leong KL, Cardosa MJ, Wong KT. (2008). Pathologic characterization of a murine model of human enterovims 71 encephalomyelitis. Journal of neuropathology and experimental neurology 67:532-542. 1.0232] 83. Lin YW, Lin HY, Tsou YL, Chitra E, Hsiao KN, Shao HY, Liu cc, Sia c,

Chong p, Chow YH. (2012), Human SCARB2-mediated entry and cndocytosis of EV71. PloS one 7:e30507.

[0233] 84. Bridgen, A (Ed.) (2012) Reverse Genetics of RNA Viruses: Applications and

Perspectives, John Wiley &amp; Sons, Ltd, Oxford. WO 2016/122403 PCT/SG2016/050031 67 [0234] 85. Jackson, Dj Cadman, A, Zurcher, T, Barclay, ws (2002) A reverse genetics approach for recovery of recombinant influenza B vinrses entirely from cDNA. ل Virol 76: 11744-11747.

[0235] 86. Neumann, G, Watanabe, T, Ito, H, Watanabe, s et al. (1999) Generation of influenza A viruses entirely from cloned cDNA. Proc Natl Acad Sci USA 96: 9345-9350.

[0236] 87. Stobart, cc and Moore, ML (2014) RNA virus reverse genetics and vaccine design. Viruses 6: 2531-2550.

[0237] 88. Victorio, C.B., Xu, Y., Ng, Q., Chow, V.T. &amp; Chua, Κ.Β. Phenotypic and genotypic characteristics of novel mouse cell line (N!H/3T3)-adaptcd human enterovirus 71 strains (EV71:TLLm and EV71:TLLmv). PloS one 9, e92719 (2014), [0238] 89. Kasukawa, T,. et al. Quantitative expression profile of distinct firnctional re^ons in the adult mouse brain. PloS one 6, e23228 (2011).

[0239] 90. Lein, E.S., et al Genome-wide atlas of gene expression in the adult mouse brain, v./wre 445, 168-176 (2007), [0240] 91,. Wong, Κ.Τ., et al. The distribution of inflammation and virus in lruman enterovinrs 71 encephalomyelitis suggests possible viral spread by neural pathways. Journal of neuropathology and experimental neurology (١٦, \CX-i (20¾¾).

[0241] 92. Chan, L.G., et al. Deaths of children during an outbreak of hand, foot, and mouth disease in Sarawak, malaysia: clinical and pathological charactei'isties of the disease. For 0لاةذ١١؛؟ س Gtou؟, Clinical infectious diseases : an official publication of the Infectious Diseases Society of America ¾2, ¾7¾.¾¾¾ (21).

[0242] 93. Hsueh, c.) et al. Acute encephalomyelitis dirring an outbreak of enterovirus type 71 infection in Taiwan: report of an autopsy case with pathologic, immunofluorescence, and imolecular studies. Modern pathology .- an officialjournal ofthe United States and Canadian Academy ofPathology, Inc 13,1200-1205 (2000).

[0243] 94. Shielr, W.J., et al. Pathologic stodies of fatal cases in outbreak of hand, foot, and mouth disease, Taiwan. Emerging infectious diseases 7, 146-148 (2001).

[0244] 95. Wong, Κ.Τ., Chua, Κ.Β. &amp; Lam, S.K. Immunohistochemical detectioir of infected neurons as a rapid diagnosis ofenterovims 71 encephalomyelitis. Annals ofneurology 45, 271-272(1999).

[0245] 96. Lu, W.H., et al. Hexamethonium revetses the lethal cardiopulmonary danrages in a rat model of brainstem lesions mimickiirg fatal enterovirus 71 encephalitis. Critical care medicine 41, 1276-1285 (2013).

[0246] 97. Rogei's, F.B., et al. Neurogenic pulmonary edenra in fatal and noirfatal head injuries. The Journal of trauma 39, 860-866؛ discussion 866-868 (1995).

[0247] 98. Yu, p., et Histopathological feahrres and. .distribution of EV71 antigens and SCARB2 in human fatal cases and a mouse model of enterovirus 71 infection. Virus research 189, 121-132(2014).

[0248] 99. Gao, L., et .لم. Pathological examinations of an enterovirus 71 infection: an autopsy case. International journal of clinical and experimental pathology 7, 5236-5241 (2014).

[0249] 100. Jiang, M.) et .لم. Autopsy findings in children with hand, foot, and mouth disease. The New England journal of medicine 367, 91-92 (2012). WO 2016/122403 PCT/SG2016/050031 68 (02501 101. Theodore, j. &amp; Robin, E.D. Speculations on neurogenic pulmonary edema (NPE). The American review of respiratory; disease 113, 405-411 (1976). 10251.1 102. Busl, Κ.Μ. &amp; Bleck, Τ.Ρ. Neurogenic Pulmonary Edenra. Critical care medicine 43,1710-1715 (2015). J0252J 103. Sedy, ل.ل Zicha, j., Kunes, .1., Jendelova, p. &amp; Sykova, E. Mechanisms of neurogenic pulmonary edema development. Physiological research / Academia Sdentiarum Bohemoslovaca 57,499-506 (2008). (02531 104. Davison, 1).1.., Terek, M. &amp; Cliawla, L.S. Neurogenic pulmonary dema.

Critical care 16, 212 (2012). (02541 105. Wang, S.M., Lei, Η.Υ. &amp; Liu, C.C. Cytokine immunopathogenesis of enterovirus 71 brain stem eneeplialitis. Clinical عء developmental immunology 2012, 876241 (2012). (0255] 106. Wang, S.M., et al. Pathogenesis of enterovirus 71 brainstem encephalitis in pediatric patients: roles of cytokines and cellular immune activation in patients with pulmonary edema. The Journal of infectious diseases 188, 564-570 (2003). (0256( 1.07. Huang, S.W., et al. Exogenous interleukin-6, interleukin-13, and interferon- gamma provoke pulmonary abnormality with mild edema in enterovirus 71.-infected mice. Respiratory research 12, 147(2011). (0257J 108. Inobe, J.J., Mori, T., Ueyama, H., Kumamoto, T. &amp; Tsuda, T. Neurogejiic pulmonary edema induced by primary medullary hemorrhage; a case report. Journal of the neurological sciences 172, 73-76 (2000). (0258( 109. Blessing, ١ν.١١ ,.'١١''cst. h-l.L &amp; Chalmers, L Hypertension, bradycardia, and pulmonary edema in the conscious rabbit after braiirstem lesions coinciding with tire Al group of catecholamine neurorrs. Circulation research 49, 949-958 (1981). (0259] 1.10. Natlran, Μ.Α. &amp; Reis, D.J. Fulminating arterial lrypertension with pulmonary edema from release of adrenoirredullary catecholamines after lesions of tire anterior lr^othalamus in the rat. Circulation research 37, 226-235 (1975). (0260] 111. Wong, Κ.Τ.) et al. The distribution of inflammation and virus in human enterovirus 71 encephalomyelitis suggests possible viral spread by neural pathways. Journal of neuropathology and experimental neurology 621) ؤ٦,٧ا), (02611 112. Wang, Y.F. &amp; Yu, C.K. Animal models of enteroviras 71 infectioir: applications and limitations. Journal of biomedical science 21, 31. (201.4).

[0262] 113. Lein, E.S., et al. Genome-wide atlas of gene expi'ession in the adult mouse brain. Nature 445, 168-176 (2007). (0263( 114. Hashimoto, I. &amp; Hagiwara, A. Pathogenicity of a poliomyelitis-like disease in monkeys infected orally with enterovirus 71: a model for human infection. Neuropathology and applied neurobiology 8, 149-156 (1982). (0264] 115. Nagata, N., et al. Pyramidal and extrapyramidal involvement in experimental infection ofcynomolgus monkeys with enterovirus 71. Journal ofmedical virology 67, 207-216 (21). (0265] 116. Nagata, N., et al. Differential localization of neurons susc^tible to enterovirus 71 and poliovirus type 1 in the cenftal nervous system ofcynomolgus monkeys after infravenous inoculation. The Journal ofgeneral virology 85, 2981-2989 (2004). WO 2016/122403 PCT/SG2016/050031 69 [0266] 17 ذ, Aria, M.) et al. Temperature-sensitive mutants of enterovirus 71 sliow attenuation in cynomolgus monkeys. The Journal of general virology 86: 1391-1401 (2005).

[0267] 118. Arita, M., et al. An attenuated strain of enterovirus 71 belonging to genotype a showed a broad spectrum of antigenicity with attenuated neurovirulence in cynomolgus monkeys. ل Virol 81, 9386-9395 (2007).

[0268] 119. Zhang, Y., et ٥/. Pathogenesis study of enterovirus 71 infection in rhesus moievs. Laboratory investigation; a journal o.f technical methods and pathology ١\و YiTfl-1350 (2011).

[0269] 120. Chen, H., et al Tlte effect of enterovirus 71 immunization on. neuropathogenesis and protein expression profiles in the thalamus of infected rhesus neonates. Virology 432, 417-426 (2012).

[0270] 121. Chen, Y.C. A murine oral enterovirus 71 infection model with central nervous system mvoWemern. Journal of General Virology ¾¾, 7.004) ٦٦-و).

[0271.] 122. Wang, Y.F., et al. A mouse-adapted enterovirus 71 sh'ain causes nemological disease in mice after oral infection. ل Virol 78, 791.6-7924 (2004).

[0272] 123, Chua, Β.Η.. Phuckles, p.١ Sanders, S.A., NichoJls, Ρ.Κ. &amp; McMinn, P.C. The molecular basis of mouse adaptation by human enterovirus 71. The Journal ofgeneral virology 89, 1622-1632 (2008).

[0273] 124. Chen, C.S., et al. Retrograde axonal trairsport: a major transmission route of enterovirus 71 in mice. ل Virol 81., 8996-9003 (2007).

[0274] 125. Ong, K.C., et al. Pathologic characterization of a murine model of human enterovil'us 71. encepltalomyelitis. Journal of neuropathology and experimental neurology 67, 532-542(2008).

[0275] 126. Wairg, w.) et al. A mouse muscle-adapted enterovirus 71 strain with increase virulence in mice. Microbes and infection /Institut Pasteur 1.3, 862-870 (201.1).

[0276] 12.7. Khong, W.X., et al A non-mouse-adapted enterovirus 71 (EV71) strain exhibits neurotropism, causing neurological manifestations in a novel mouse model of ΕΥ71 infection.2012) 2131-2121 ,86 ر).

[0277] 128, Caine, Ε.Α., Partidos, C.D., Santangelo, J.D. &amp; Osorio, J.E. Adaptation of enterovirus 71 to adult interferon deficient mice. PloS one 8, 659501 (2013).

[0278] 129. Arita, M., Ami, Y., Wakita, T. &amp; Shimizu, H. Cooperative effect of the attenuation determinants derived from poliovirus sabin 1 straiir is essential for attenuation of enteroviius 71 in the NODSCff} mouse infection model.ر E'ra/ 82,1787-1797 (2008).

[0279] 130. Xu, F., et al. Enteovirus 71 iirfection cairses severe pulmonary leions in gerbils, meriones unguicnlatus, which can be prevented by passive immunization with specific antisera. PloS one 10, eOl 19173 (2015).

[0280] 131. Koroleva, G.A., Kamiysheva, V.Y. &amp; Lukashev, Α.Ν. 390 Enterovirus 71 pathogenicity in monkeys and cotton rats. Archives ofvirology 159,1133-1138 (2014).

[0281] 132. Yao, Ρ.Ρ., et al Enterovirus 7I-induced neurological disorders in youitg gerbils, Meriones unguiculatus; development and application of a neurological disease model. PloS one 7, e51996(2012). WO 2016/122403 PCT/SG2016/050031 70 [0282] 133. Yang, X., et al. A neonatal gnotobiotic pig model of liuman enterovinis 71 infection and associated immune responses, Emerg Microbes Infect 3, e35 (2014).

[0283] 134. Wang, S.M., et al. Clinical spectri of enterovirus 71 infection in children in southern Taiwan, with an emphasis on neurological complications. Clinical infectious diseases .-an official publication of the Infectious Diseases Society ofAmerica 29, 184-190 (1999).

[0284] 135. Huang, C.C., et al. Neurologic complications in children with enterovirus 71 \ϋ؛\. The New England journal of medicine Ί..ΥΜ.ΥΗ2 (\!y 136 [0285؛. Ho, M., et al. An epidemic of enterovirus 71 infection in Taiwan. Taiwan Enterovinrs Epidemic Working Group. Ik New England journal of medicine 341, 929-935 (1999). 137 [0286؛. Chang, L.-Y.) et al Clinical feahtres and risk factors of pulmonary oedema after ' hand, foot, and mouth disease. The Lancet 354, 1682-1,686 (1999). 138 [0287؛. Nishimura, Y., et al. Human p-selectin glycoprotein ligand-l is a fimctional receptor for enterovirus 71. Nature medicine 15, 794-797 (2009).

Claims (33)

1. WHAT IS CLAIMED IS:

   1. An animal model of Enterovirus 71 (EV71) neuro-infection comprising a rodent infected with an EV71 modified for infecting the rodent.
2. 2. The animal model of claim 1, wherein the modified EV71 is a rodent cell line adapted EV71.
3. 3. The animal model of claim 1 or 2, wherein the modified EV71 is a rodent cell line adapted EV71 that is EV71:TLLmv.
4. 4. The animal model of claim 3, wherein EV7l:TLLmv has been deposited with China Center for Type Culture Collection and assigned accession number CCTCC V201438.
5. 5. The animal model of claim 1 or 2, wherein the modified EV71 is a rodent cell line adapted EV71 that is EV71:TLLm.
6. 6. The animal model of claim 5, wherein EV71 :TLLm has been deposited with China Center for Type Culture Collection and assigned accession number CCTCC V201437.
7. 7. The animal model of claim 1, wherein the modified EV71 is an EV71 clone derived virus (CDV) containing mutations in VP1.
8. 8. The animal model of claim 1 or 7, wherein the modified EV71 is EV71 CDV CD V:BSVpi[K98E/El 45A/L169F].
9. 9. The animal model of any one of claims 1-6, wherein the rodent is immuno-competent.
10. 10. The animal model of claim 9, wherein the rodent is a mouse.
11. 11. The animal model of claim 10, wherein the rodent cell line is mouse cell line NIH/3T3.
12. 12. The animal model of claim 7 or 8, wherein the rodent is immuno-competent.
13. 13. The animal model of claim 12, wherein the rodent is a mouse.
14. 14. The animal model of claim 13, wherein the rodent cell line is mouse cell line NIH/3T3 or mouse cell line Neuro-2a.
15. 15. The animal model of claim 1 or 2, wherein the rodent is i mmuno-compromised.
16. 16. The animal model of claim 15, wherein the rodent is a mouse.
17. 17. The animal model of claim 16, wherein the mouse is a BALB/c mouse.
18. 18. A method to screen antiviral drugs, comprising: providing a test group of animals and a control group of animals, wherein the animals of each group comprise the animal model of any one of claims 1-17; administering to the test group an antiviral drug candidate; monitoring disease progression in the test group and the control group; comparing the disease progression in the test group to the disease progression in the control group; and selecting the antiviral drug candidate that reduces disease progression in the test group relative to the control group.
19. 19. The method of claim 18, wherein the antiviral drug is first screened in a test rodent cell line infected with the modified Enterovirus 71 before screening in the animals.
20. 20. A method to screen effective antiviral vaccines, comprising: providing a test group of animals and a control group of animals, wherein the animals of each group comprise the animal model of any one of claims 1-17; administering to the test group an antiviral vaccine candidate; monitoring disease progression in the test group and the control group; comparing the disease progression in the test group to disease progression in the control group; and selecting the antiviral vaccine candidate that reduces disease progression in the test group relative to the control group.
21. 21. The method of claim 20, wherein the antiviral vaccine is first screened in a test rodent cell line infected with the modified Enterovirus 71 before screening in the animals.
22. 22. A method to prepare the animal model of claim 1 comprising infecting a rodent with an EV71 modified for infecting the rodent and raising the infected rodent, whereby an animal model of EV71 neuro-infection is prepared.
23. 23. The method of claim 22, wherein the age of the rodent at infection is between about 1 week and about 4 weeks.
24. 24. The method of claims 22 or 23, wherein the infected rodent is raised for up to about 4 weeks.
25. 25. The method of any one of claims 22-24, wherein a median cell culture infectious dose Λ between about 10 and about 10 is used for infecting the rodent.
26. 26. The method of any one of claims 22-25, wherein the modified EV71 is a rodent cell line adapted EV71 that is EV71:TLLmv,
27. 27. The method of claim 26, wherein EV71:TLLmv has been deposited with China Center for Type Culture Collection and assigned accession number CCTCC V201438.
28. 28. The method of any one of claims 22-25, wherein the modified EV71 is a rodent cell line adapted EV71 that is EV71:TLLm.
29. 29. The method of claim 28, wherein EV71;TLLm has been deposited with China Center for Type Culture Collection and assigned accession number CCTCC V201437.
30. 30. The method of any one of claims 22-25, wherein the modified EV71 is an EV71 clone derived virus (CDV) containing mutations in VP1.
31. 31. The method of claim 30, wherein the modified EV71 is EV71 CDV CD V:BSyP ;[K98E/E145A/L169F].
32. 32. The method of any one of claims 22-31, wherein the rodent is a mouse.
33. 33. The method of claim 32, wherein the mouse is a BALB/c mouse.