WO2013138670A1

WO2013138670A1 - Yellow fever virus ns5 mutants as flavivirus vaccine candidates

Info

Publication number: WO2013138670A1
Application number: PCT/US2013/031764
Authority: WO
Inventors: Peter Palese; Adolfo Garcia-Sastre; Juliet Marion MORRISON; Maudry LAURENT-ROLLE
Original assignee: Icahn School Of Medicine At Mount Sinai
Priority date: 2012-03-15
Filing date: 2013-03-14
Publication date: 2013-09-19

Abstract

Provided herein are attenuated yellow fever viruses comprising a genome that encodes a mutated NS5 protein comprising a deletion of the first 10 amino acids or an amino acid substitution of another residue (e.g., arginine or alanine) for the first N-terminal lysine residue. In one embodiment, the attenuated YFV is genetically engineered to also express a heterologous antigen. The heterologous antigen can be any antigen, such as an antigen from a different YFV strain, from a different flavivirus, or from a pathogen, a cancer-associated antigen, or an allergy- related antigen. The attenuated YFVs can be engineered to express the heterologous antigen and mutated NS5 protein using techniques known in the art. Also provided herein are vaccines comprising an attenuated YFV described herein and methods of immunizing a subject (e.g., an animal such as a non-human animal or human) or preventing a disease using the YFV.

Description

YELLOW FEVER VIRUS NS5 MUTANTS AS FLAVIVIRUS VACCINE CANDIDATES

[0001] This application claims priority to U.S. provisional application No. 61/611,287, filed March 15, 2012, which is incorporated herein by reference in its entirety.

[0002] This invention was made with government support under Grant No. U54AI057158 awarded by the National Institute of Allergy and Infectious Diseases and under Fellowship No. FAI077333A awarded by the National Institute of Health. The government has certain rights in the invention.

1. INTRODUCTION

[0003] Described herein are yellow fever viruses engineered to express a mutant form of the NS5 protein and compositions comprising such viruses. Also described herein are chimeric yellow fever viruses engineered to express a mutant form of the NS5 protein and one or more heterologous proteins and compositions comprising such viruses. The mutant yellow fever viruses, chimeric forms thereof, and compositions are useful as vaccines against flaviviruses such as yellow fever virus, dengue virus, Japanese encephalitis virus, and West Nile virus.

2. BACKGROUND

[0004] Yellow fever virus (YFV) is the prototypic virus of the Flaviviridae family.

Flaviviruses include important arthropod-transmitted viruses that cause human disease. The flavivirus genome is a single-stranded, positive-sense RNA of about 11,000 nucleotides. The single open reading frame encodes a polyprotein that is cleaved co- and post-translationally by viral and host peptidases into three structural proteins, C (capsid), prM-M (membrane protein and its precursor) and E (envelope protein), and seven nonstructural (NS) proteins (NS 1 , NS2A, NS2B, NS3, NS4A, NS4B and NS5). The structural proteins form the virion particle while the nonstructural proteins play a role in viral RNA replication, polyprotein processing and host immune evasion (Chambers, et al, 1990, Annu Rev Microbiol 44, 649-688; Rice, et al, 1985, Science 229, 726-733). The approximately 900 amino acid long NS5 protein is the largest and most conserved of the flavivirus proteins, encoding the viral RNA dependent RNA polymerase (RdRp) (Lindenbach & Rice, 2003, Adv Virus Res 59, 23-61). The N-terminal portion of the protein contains an S-adenosyl-methyl-transferase (SAM) domain and is involved in methylation of the 5' RNA cap structure (Egloff, et al, 2002, Embo J 21, 2757-2768; Issur, et al, 2009, RNA 15, 2340-2350; Zhou, et al, 2007, J Virol 81, 3891-3903). The middle region of the protein (residues 320-405) contains at least two nuclear localization sequences whose role in viral replication is still uncharacterized, and the C-terminal portion of NS5 contains motifs characteristic of all RdRps (Brooks, et al, 2002, J Biol Chem 277, 36399-36407; Chu &

Westaway, 1987, Virology 157, 330-337; Jablonski & Morrow, 1995, J Virol 69, 1532-1539).

[0005] Type I IFN (IFN-I) plays a critical role in inducing an antiviral state in cells in order to curb viral replication and dissemination (Platanias, 2005, Nat Rev Immunol 5, 375-386;

Versteeg & Garcia-Sastre, 2010, Curr Opin Microbiol 13, 508-516). Binding of IFN-I to its receptor activates the JAK1 and TYK2 tyrosine kinases, which phosphorylate and activate the STAT1 and STAT2 proteins, resulting in the formation of the IFN-I stimulated gene factor 3 (ISGF3), a transcription factor complex comprised of phosphorylated STAT1, phosphorylated STAT2 and IRF9 (Platanias, 2005). ISGF3 translocates to the nucleus where it binds to IFN-I- stimulated response elements (ISREs), promoting the transcription of IFN-stimulated genes (ISG), many of which have potent antiviral activity (Der, et al., 1998, Proc Natl Acad Sci U S A 95, 15623-15628; Horvath, et al, 1996, Mol Cell Biol 16, 6957-6964; Ihle, 1995, Adv Immunol 60, 1-35; Platanias, 2005). Recent studies have shown that several flaviviruses including dengue virus (DENV), West Nile virus (WNV), Japanese encephalitis virus (JEV), Langat virus (LGTV, a member of the tick-borne encephalitis virus antigen complex) and tick-borne encephalitis virus (TBEV) encode IFN-I antagonists to subvert the host immune response in order to enhance viral replication (Ashour et al, 2009; Best et al, 2005; Jones et al, 2005; Laurent-Rolle et al, 2010; Lin et al, 2006; Liu et al, 2005; Werme et al, 2008). Specifically, the NS5 proteins of these viruses have been shown to either prevent phosphorylation of the STATs (WNV, JEV, LGTV and TBEV) (Best et al, 2005; Laurent-Rolle et al, 2010; Lin et al, 2006; Werme et al, 2008) or mediate STAT2 degradation (DENV) (Ashour et al, 2009).

[0006] Despite the availability of a highly efficacious vaccine, the live attenuated YFV-17D vaccine, YFV is considered a reemerging pathogen with about 200,000 cases of yellow fever reported annually in South America and Africa (Gershman M, Staples JE, 2011, Yellow Fever. In: Brunette GW, editor. CDC Health Information for International Travel 2012: The Yellow Book: Oxford University Press) and more than 900 million people at risk in yellow fever endemic zones (Barrett & Monath, 2003, Adv Virus Res 61, 291-315; Tomori, 2002, Biomedica 22, 178-210). The currently licensed 17D vaccine (YF-VAX®; Sanofi Pasteur) is one of the most successful vaccines ever developed (Monath, et al, 2002, Am J Trap Med Hyg 66: 533- 541), but in recent years an increase in the occurrence of yellow fever vaccine-associated viscerotropic disease (YEL-AVD) and neurotropic disease (YEL-AND) has brought the safety of the vaccine into question, and the vaccine is contraindicated for infants, immunocompromised people, nursing mothers or people over the age of 60 (Gershman & Staples, 2011, Yellow Fever. In: Brunette GW, editor. CDC Health Information for International Travel 2012: The Yellow Book: Oxford University Press). According to the Centers for Disease Control (CDC), 1/125000 patients administered the vaccine develop neurologic disease and 1/250000 develop viscerotropic disease, and more than half of the patients who develop viscerotropic disease die. Gershman & Staples, 2011. Because of these safety concerns, there is a need for improved YFV vaccines.

[0007] YFV-17D has also been tested as the basis for vaccines against dengue virus

(DENV)l-4 (ChimeriVax-Dengue (CYD Dengue); Sanofi Pasteur), Japanese encephalitis virus (ChimeriVax- Japanese encephalitis (Sanofi Pasteur) or IMOJEV®) and West Nile virus

(ChimeriVax-West Nile; Sanofi Pasteur). These YFV-17D-based ChimeriVax vaccines are live, attenuated recombinant viruses constructed from a YFV-17D in which the envelope protein genes (prM and E) of YFV-17D are replaced with the corresponding genes of another flavivirus. Appaiahgari & Vrati, 2010, Expert Rev Vaccines 9: 1371-1384; Biedenbender, et al, 2011, J Infect Dis 203: 75-84; Dayan, et al, 2012, Vaccine 30: 6656-6664; Monath, et al, 2002, Vaccine 20: 1004-1018; Sabchareon, et al, 2012, Lancet 380: 1559-1567.

[0008] However, there are currently no vaccines licensed for the prevention of DENV and West Nile virus infections in humans. There are 50-100 million cases per year of dengue fever and 500,000 cases per year of the more severe dengue hemorrhagic fever. WHO, 2009, Dengue: guidelines for diagnosis, treatment, prevention and control. More than 4,500 people were infected with West Nile virus in the US in the summer of 2012, and of these cases 183 were fatal. Arnold, Lancet Neurol 11 : 1023-1024. Several European countries reported outbreaks of West Nile during that time as well.

[0009] The ChimeriVax-Dengue (CYD) vaccine is a mix of four chimeric YFV-17D viruses expressing prM and E of either DENV1, 2, 3 or 4. Guy, et al, 2011, Vaccine 29: 7229-7241. The results of the most recent CYD phase lib vaccine trial in Thai schoolchildren were, however, disappointing. Sabchareon, et al, 2012, Lancet 380: 1559-1567; Halstead, 2012, Lancet 380: 1535-1536. One or more doses of CYD reduced the incidence of DENV3 and 4 febrile diseases by 80-90%, and the incidence of DENV1 by approximately 60%. However, there was no decrease in febrile disease caused by DENV2. The overall efficacy of the tetravalent virus was calculated to be 30.2%. Sabchareon A, et al., 2012, Lancet 380: 1559-1567. Therefore, improved chimeric YFV-17D vaccines for use against dengue virus and other flaviviruses are also needed.

3. SUMMARY

[0010] Provided herein are attenuated yellow fever viruses (YFV) engineered to express a mutant form of the NS5 protein and compositions comprising such viruses. Also described herein are chimeric yellow fever viruses engineered to express a mutant form of the NS5 protein and one or more heterologous proteins and compositions, e.g., vaccine compositions, comprising such viruses. Provided herein are uses of these mutant yellow fever viruses, chimeric forms thereof, and compositions for inducing an immune response against flaviviruses such as yellow fever virus, dengue virus, Japanese encephalitis virus, and West Nile virus. Provided herein are uses of these mutant yellow fever viruses, chimeric forms thereof, and compositions for vaccinating against flaviviruses, such as yellow fever virus, dengue virus, Japanese encephalitis virus, and West Nile virus.

[0011] The present disclosure is based, in part, on the discovery that YFV NS5 is an IFN-I- signaling antagonist. Removing the first 10 amino acids or mutating a single residue (lysine 6) in NS5 prevents this protein from antagonizing IFN-I signaling in human and non-human primate cells. When a lysine to arginine change was introduced at amino acid 6 (K6R) of NS5 of the YFV-17D vaccine strain, the virus grew to wild-type levels in untreated Vero cells but had a replication defect in IFN-I-treated Vero cells.

[0012] Surprisingly, YFV inhibits antiviral signaling through a unique mechanism that involves the binding of STAT2 by NS5 in cells that have been stimulated with IFN-L- IFN-I treatment of YFV- or YFV NS5-expressing cells results in normal phosphorylation and nuclear translocation of STAT1 and STAT2 in YFV-infected cells. However, IFN-I treatment also activates the ability of YFV NS5 to interact with STAT2 and consequently block binding, preventing transcription of IFN-stimulated genes. The binding of NS5 to STAT2 prevents the interaction of the ISGF3 complex with ISREs, thereby inhibiting transcription of ISGs.

[0013] STAT2 mutants that are unable to be phosphorylated in response to IFN-I treatment still bind YFV NS5 in IFN-treated cells. By contrast, YFV NS5 that is purified from IFN-I- treated STAT2-deficient cells binds STAT2 from both mock-treated and IFN-I-treated STAT2- containing cells. Thus, the ability of IFN-I to promote YFV NS5-STAT2 interaction is not due to STAT2 modification but to activation of YFV NS5.

[0014] The mechanism by which YFV NS5 inhibits IFN-I signaling is unique among flaviviruses. Mutation of lysine 6 of NS5 (K6R), or overexpression of mutant lysine 63 ubiquitin, decreased the IFN-induced NS5-STAT2 interaction, strongly suggesting that K63- linked ubiquitination of NS5 is necessary to promote STAT2 interaction and IFN-signaling inhibition. Further, an engineered YFV encoding NS5 K6R demonstrated increased susceptibility to IFN-I. These results demonstrate the importance of YFV NS5 in overcoming the antiviral action of IFN-I and offer a unique example of a viral protein that is activated by the very host pathway that it inhibits. These results also demonstrate that a single amino acid within NS5 is responsible for YFV's IFN-I-antagonistic properties and demonstrate a role for lysine 63 -linked ubiquitination in YFV NS5-mediated inhibition of IFN signaling.

[0015] In one aspect, provided herein is an attenuated YFV comprising a mutation in the NS5 gene. In one embodiment, the attenuated mutant YFV is genetically engineered. In a particular embodiment, the mutated NS5 gene encodes a mutant NS5 protein.

[0016] In one aspect, an attenuated YFV provided herein comprises a genome, the genome comprising an NS5 gene with one or more mutations, wherein the one or more mutations result in a deletion of one or more amino acids at the amino-terminus of the NS5 protein encoded by the gene. In one embodiment, the one or more mutations result in the deletion of the first 10 amino acids of the NS5 protein encoded by the gene. In specific embodiments, the only NS5 gene encoded by the genome of the attenuated YFV is the NS5 gene with one or more mutations.

[0017] In another aspect, an attenuated YFV provided herein comprises a genome comprising an NS5 gene with one or more mutation(s), wherein the one or more mutations result in one or more amino acid substitutions in the amino-terminus of the NS5 protein encoded by the gene. In one embodiment, the one or more mutations in the NS5 gene results in a single amino acid substitution in the NS5 protein encoded by the gene. In another embodiment, the one or more mutations in the NS5 gene result in an amino acid substitution of another residue for the first N-terminal lysine residue of the NS5 protein encoded by the gene. In a specific

embodiment, the one or more mutations in the NS5 gene results in a substitution of another residue for the lysine at amino acid residue 6 of the NS5 protein encoded by the gene. In certain embodiments, the other residue that is substituted for the lysine residue is arginine or alanine. In a specific embodiment, the one or more mutations in the NS5 gene result in an amino acid substitution of arginine for the lysine at amino acid residue 6 (K6R) of the NS5 protein of YFV 17D. In specific embodiments, the only NS5 gene encoded by the genome of the attenuated YFV is the NS5 gene with one or more mutations.

[0018] In a specific embodiment, an attenuated YFV provided herein comprises a genome which encodes a mutated NS5 protein comprising an amino acid substitution of another residue for the first N-terminal lysine residue of the NS5 protein of a YFV (e.g., YFV 17D). In certain embodiments, the other residue that is substituted for the lysine residue is arginine or alanine. In specific embodiments, the only NS5 protein encoded by the genome of the attenuated YFV is the NS5 gene with one or more mutations.

[0019] In another aspect, an attenuated YFV provided herein is a chimeric YFV that has been engineered to express one or more heterologous amino acid sequences (e.g., a peptide, polypeptide or protein). The heterologous amino acid sequence can be a heterologous antigen, such as an antigen from a pathogen (e.g., a viral, bacterial, fungal or parasitic antigen), a cancer- associated antigen or an allergy-related antigen. In certain embodiments, the heterologous amino acid sequence is a heterologous antigen from a flavivirus other than YFV. In specific embodiments, the heterologous amino acid sequence is a structural protein (e.g., an envelope protein, a prM protein, or capsid protein) from another virus, e.g., another flavivirus, e.g., dengue virus, Japanese encephalitis virus, or West Nile virus (WNV). In one embodiment, a

heterologous envelope protein from another virus replaces the function of a YFV envelope protein. In another embodiment, the heterologous envelope protein is introduced in addition to a YFV envelope protein. In specific embodiments, the heterologous envelope protein is the E or prM from another flavivirus, such as, e.g., dengue virus, Japanese encephalitis virus, or West Nile virus (WNV). In another embodiment, a heterologous prM protein from another virus replaces the function of a YFV prM protein. In another embodiment, a heterologous prM protein is introduced in addition to a YFV prM protein. In specific embodiments, a heterologous prM protein is the prM from another flavivirus, such as, e.g., dengue virus, Japanese encephalitis virus, or West Nile virus (WNV). In specific embodiments, a heterologous envelope (E) protein and heterologous prM protein replace both the YFV E and prM proteins.

[0020] In one embodiment, an attenuated chimeric YFV provided herein comprises a genome, the genome comprising: (i) an NS5 gene with one or more mutations, wherein the one or more mutations result in a deletion of one or more amino acids at the amino-terminus of the NS5 protein encoded by the gene; and (ii) a nucleotide sequence encoding a heterologous amino acid sequence (e.g., a peptide, polypeptide or protein). In one embodiment, the one or more mutations result in the deletion of the first 10 amino acids of the NS5 protein encoded by the gene. In a specific embodiment, the one or more mutations in the NS5 gene results in the deletion of the first 10 amino acids of the NS5 protein of YFV 17D. In specific embodiments, the heterologous amino acid sequence is the E or prM protein from a flavivirus other than YFV, such as, e.g., dengue virus, Japanese encephalitis virus, or West Nile virus (WNV). In specific embodiments, the only NS5 gene encoded by the genome of the chimeric YFV is the NS5 gene with one or more mutations.

[0021] In another embodiment, an attenuated chimeric YFV provided herein comprises a genome, the genome comprising: (i) an NS5 gene with one or more mutation(s), wherein the one or more mutations result in one or more amino acid substitutions in the amino-terminus of the NS5 protein encoded by the gene; and (ii) a nucleotide sequence encoding a heterologous amino acid sequence (e.g., a peptide, polypeptide or protein). In certain embodiments, the one or more mutations in the NS5 gene result in a single amino acid substitution in the NS5 protein encoded by the gene. In certain embodiments, the one or more mutations in the NS5 gene result in an amino acid substitution of another residue for the first N-terminal lysine residue of the NS5 protein encoded by the gene. In specific embodiments, the one or more mutations in the NS5 gene results in a substitution of another residue for the lysine at amino acid residue 6 of the NS5 protein encoded by the gene. In certain embodiments, the other residue that is substituted for the lysine residue is arginine or alanine. In a specific embodiment, the one or more mutations in the NS5 gene results in an amino acid substitution of arginine for the lysine at amino acid residue 6 (K6R) of the NS5 protein of YFV 17D. In specific embodiments, the heterologous amino acid sequence is the E or prM protein from a flavivirus other than YFV, such as, e.g., dengue virus, Japanese encephalitis virus, or West Nile virus (WNV). In specific embodiments, the only NS5 gene encoded by the genome of the chimeric YFV is the NS5 gene with one or more mutations.

[0022] The genome of any strain of YFV known in the art can be engineered to have a mutation in the NS5 gene. In a specific embodiment, the YFV strain is an attenuated strain, for example, a strain suitable for use in vaccination. In a particular embodiment, the YFV strain is YFV-17D. In one embodiment, the genome of the attenuated YFV encodes the structural proteins (envelope, capsid and prM proteins), and non-structural proteins (such as NS 1 , NS2A, NS2B, NS3, 2K, NS4A and NS4B proteins) of the yellow fever virus 17D and a mutated NS5 protein from yellow fever virus 17D. In one embodiment, the genome of the attenuated YFV encodes the structural proteins (envelope, capsid and prM proteins), and non-structural proteins (such as NS1, NS2A, NS2B, NS3, 2K, NS4A and NS4B proteins of the yellow fever virus 17D and a mutated NS5 protein from a different yellow fever virus strain. In another embodiment, the YFV strain is YF-VAX® (Sanofi Pasteur). In another embodiment, the YFV strain is a chimeric YFV, e.g., a chimeric attenuated YFV, wherein the chimeric YFV comprises one or more heterologous amino acid sequences (e.g., peptides, polypeptides or proteins). In another embodiment, the chimeric YFV is ChimeriVax-Dengue (CYD Dengue; Sanofi Pasteur), ChimeriVax- Japanese encephalitis (Sanofi Pasteur), IMOJEV®, or ChimeriVax-West Nile (Sanofi Pasteur).

[0023] In one embodiment, an attenuated YFV with a mutation in the NS5 gene described herein has a reduced ability to antagonize the cellular interferon response as compared to, e.g., wild-type YFV or YFV without the mutation in the NS5 gene. In another embodiment, a mutant NS5 protein encoded by an attenuated YFV described herein has a reduced ability to antagonize the cellular interferon response. In another embodiment, an attenuated YFV described herein has an increased ability to replicate in an interferon deficient substrate compared to a substrate that has been treated with interferon or that expresses interferon. In another embodiment, the attenuation of YFV, or the reduction in the ability of the attenuated YFV with a mutated NS5 protein or mutant NS5 protein encoded by the attenuated YFV to antagonize the cellular interferon response, is measured in cells, e.g., human or non-human primate cells. In another embodiment, the attenuation of YFV, or the reduction in the ability of the attenuated YFV with a mutated NS5 protein or mutant NS5 protein encoded by the attenuated YFV to antagonize the cellular interferon response, is measured in cells, e.g., human or non-human primate cells, that have been treated with IFN-I. In an embodiment, the reduced ability to antagonize the cellular interferon response is a reduced ability to antagonize IFN-I signaling. In another embodiment, the YFV with a mutated NS5 gene has increased sensitivity to interferon compared to YFV in which the NS5 gene has not been mutated. In some embodiments, cells treated with the attenuated YFV provided herein produce more interferon, such as IFN-I, or IFN-I dependent proteins, such as cytokines, such as, e.g., interferon gamma, compared to YFV in which the NS5 gene has not been mutated.

[0024] In one aspect, an attenuated YFV with a mutant NS5 gene provided herein has decreased pathogenicity compared to the YFV without the mutant NS5. In another aspect, an attenuated YFV with a mutant NS5 gene provided herein produces fewer side effects compared to the YFV without the mutant NS5. In another aspect, an attenuated YFV with a mutant NS5 gene provided herein has increased immunogenicity compared to the YFV without the mutant NS5. In another aspect, an attenuated YFV with a mutant NS5 gene provided herein has increased safety compared to the YFV without the mutant NS5.

[0025] In another aspect, provided herein are nucleotide sequences encoding the mutated NS5 proteins described herein. In certain embodiments, provided herein are nucleotide sequences of the genomes of YFV comprising a mutated NS5 gene described herein. In some embodiments, provided herein are nucleotide sequences encoding the genome of a chimeric YFV which encodes a mutated NS5 protein described herein and a heterologous amino acid sequence {e.g. , the E or prM proteins), of a flavivirus other than YFV, such as dengue virus, Japanese encephalitis virus, or West Nile virus.

[0026] In another aspect, provided herein are methods for propagating the attenuated YFVs described herein (including attenuated chimeric YFVs described herein). The attenuated YFVs described herein (including attenuated chimeric YFVs described herein) can be propagated in any substrate - e.g., cell or cell line {e.g., hamster cells {e.g., BHK cells) or Vera cells), subject, tissue or organ - susceptible to a YFV infection. In one embodiment, the substrate is an interferon deficient substrate. In one embodiment, the substrate is a cell line. In a specific embodiment, the cell line is BHK cells or Vera cells. In another embodiment, the attenuated YFVs described herein (including attenuated chimeric YFVs described herein) may be propagated in chicken embryos. In a specific embodiment, the chicken embryos are living avian leukosis virus-free (ALV-free) chicken embryos. In another embodiment, the attenuated YFVs described herein (including attenuated chimeric YFVs described herein) may be propagated in embryonated eggs, e.g., young or immature embryonated chicken eggs. In certain embodiments, provided herein are isolated cells, tissues or organs infected with an attenuated YFV described herein {e.g., an attenuated chimeric YFVs described herein). In certain embodiments, provided herein are cell lines infected with an attenuated YFV described herein {e.g., an attenuated chimeric YFV described herein). In other embodiments, provided herein are chicken embryos infected with an attenuated YFV described herein. In other embodiments, provided herein are embryonated eggs infected with an attenuated YFV described herein.

[0027] In another aspect, provided herein are compositions comprising an attenuated YFV described herein (including attenuated chimeric YFVs described herein). In a specific embodiment, presented herein are pharmaceutical compositions comprising an attenuated YFV described herein and a pharmaceutically acceptable carrier. In another specific embodiment, presented herein are pharmaceutical compositions comprising an attenuated chimeric YFV described herein and a pharmaceutically acceptable carrier. In another specific embodiment, provided herein are immunogenic compositions comprising an attenuated YFV described herein and a pharmaceutically acceptable carrier. In another specific embodiment, provided herein are immunogenic compositions comprising an attenuated chimeric YFV described herein and a pharmaceutically acceptable carrier.

[0028] In one embodiment, provided herein are vaccine compositions comprising an attenuated YFV described herein. In a specific embodiment, provided herein are vaccine compositions comprising an attenuated chimeric YFV described herein.

[0029] In another aspect, provided herein are methods for producing compositions, e.g., pharmaceutical compositions, immunogenic compositions, or vaccines, comprising an attenuated YFV described herein (including attenuated chimeric YFVs described herein). In one embodiment, a method for producing a composition comprises: (a) propagating an attenuated YFV described herein {e.g. , a chimeric attenuated YFV) in a cell line that is susceptible to a YFV infection; and (b) collecting the progeny virus, wherein the virus is grown to sufficient quantities and under sufficient conditions that the virus is free from contamination, such that the progeny virus is suitable for formulation into a composition, e.g., pharmaceutical composition, immunogenic composition, or vaccine. In another embodiment, a method for producing a composition comprises: (a) propagating an attenuated YFV described herein {e.g., a chimeric attenuated YFV) in a chicken embryo that is susceptible to a YFV infection; and (b) collecting the progeny virus, wherein the virus is grown to sufficient quantities and under sufficient conditions that the virus is free from contamination, such that the progeny virus is suitable for formulation into a composition, e.g., pharmaceutical composition, immunogenic composition, or vaccine. In another embodiment, a method for producing a composition comprises: (a) propagating an attenuated YFV described herein (e.g. , a chimeric attenuated YFV) in an embryonated egg that is susceptible to a YFV infection; and (b) collecting the progeny virus, wherein the virus is grown to sufficient quantities and under sufficient conditions that the virus is free from contamination, such that the progeny virus is suitable for formulation into a composition, e.g., pharmaceutical composition, immunogenic composition, or vaccine.

[0030] In another aspect, provided herein are methods of inducing an immune response to one or more infectious agents in a subject, the method comprising administering an effective amount of an attenuated YFV described herein (e.g., a chimeric attenuated YFV). In certain embodiments, the subject is a human subject. In other embodiments, the subject is a non-human primate. In other embodiments, the subject is a non-human mammal. In yet other embodiments, the subject is an avian, insect, or other animal. In certain embodiments, the method of inducing an immune response results in a protective effect against YFV and/or one or more other infectious agents, such as other flaviviruses (e.g., dengue virus, West Nile virus and/or Japanese encephalitis virus). In some embodiments, the method of inducing an immune response results in vaccination against YFV and/or one or more infectious agents, such as other flaviviruses (e.g., dengue virus, West Nile virus and/or Japanese encephalitis virus). In another embodiment, the method of inducing an immune response results in treatment and/or prevention of YFV and/or one or more infectious agents, such as other flaviviruses (e.g., dengue virus, West Nile virus and/or Japanese encephalitis virus), or a disease or condition associated therewith.

[0031] In a specific embodiment, provided herein is a method of inducing an immune response to one or more infectious agents in a human, the method comprising administering an effective amount of an attenuated YFV described herein (e.g., a chimeric attenuated YFV). In certain embodiments, the method of inducing an immune response results in a protective effect against YFV and/or one or more other infectious agents, such as other flaviviruses (e.g., dengue virus, West Nile virus and/or Japanese encephalitis virus). In some embodiments, the method of inducing an immune response results in vaccination against YFV and/or one or more infectious agents, such as other flaviviruses (e.g., dengue virus, West Nile virus and/or Japanese encephalitis virus). In another embodiment, the method of inducing an immune response results in treatment and/or prevention of YFV and/or one or more infectious agents, such as other flaviviruses (e.g., dengue virus, West Nile virus and/or Japanese encephalitis virus), or a disease or condition associated therewith. In certain embodiments, the infectious agent is one or more flaviviruses, e.g., YFV, dengue virus, Japanese encephalitis virus, or WNV. In a specific embodiment, the infectious agent is YFV. In another embodiment, the infectious agent is dengue virus. In another embodiment, the infectious agent is Japanese encephalitis virus. In another embodiment, the infectious agent is WNV.

[0032] In one embodiment, a composition provided herein, e.g. , a pharmaceutical composition, immunogenic composition, or vaccine composition, has increased efficacy against a virus, e.g., flavivirus such as YFV, dengue virus, Japanese encephalitis virus, or WNV, compared to a composition known in the art. In another embodiment, a composition provided herein, e.g., a pharmaceutical composition, immunogenic composition, or vaccine composition, has increased safety against a virus, e.g., flavivirus such as YFV, dengue virus, Japanese encephalitis virus, or WNV, compared to a composition known in the art.

[0033] In another aspect, provided herein are methods of treating and/or preventing an interferon-sensitive disease or condition, the method comprising administering an effective amount of an attenuated YFV described herein. In a specific embodiment, provided herein are methods of treating and/or preventing cancer, the method comprising administering an effective amount of an attenuated YFV described herein.

[0034] In another aspect, provided herein are methods for inducing an immune response to a disease antigen, the methods comprising administering to a subject an effective amount of a chimeric YFV described herein. In certain embodiments, the disease antigen is a flavivirus antigen, such as, e.g., an antigen from YFV, dengue virus, Japanese encephalitis virus, or WNV. In other embodiments, the disease antigen is a cancer-associated antigen, a pathogen antigen (e.g. , a bacterial antigen, a viral antigen, a parasitic antigen or a fungal antigen), or an allergy- related antigen. 3.1 TERMINOLOGY

[0035] As used herein, the term "about" or "approximately" when used in conjunction with a number refers to any number within 1, 5 or 10% of the referenced number.

[0036] As used herein, the phrase "amino terminus" of NS5 refers to the amino acids from the amino terminal amino acid residue (amino acid residue 1) through amino acid residue 900, amino acid residues 1 through 800, amino acid residues 1 through 700, amino acid residues 1 through 600, amino acid residues 1 through 500, amino acid residues 1 through 400, amino acid residues 1 through 400, amino acid residues 1 through 300, amino acid residues 1 through 200, or less, of the YFV NS5 protein. Deletions from the amino terminus can include deletions consisting of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 73, 75, 80, 85, 90, 95, 99, 100, 105, 110, 115, 120, 125, 126, 130, 135, 140, 145, 150, 155, 160, 165, 170 or 175 amino acid residues from the amino terminus of NS5.

[0037] As used herein, the terms "disease" and "disorder" are used interchangeably to refer to a condition in a subject and encompass, but are not limited to, pathological conditions resulting from or associated with an infection by an infectious agent (e.g., a virus, bacteria, parasite, or fungus), or a condition or symptom associated therewith, an interferon-deficient condition or a symptom associated therewith, and cancer or a symptom associated therewith.

[0038] The term "heterologous" as used herein in the context of a proteinaceous agent refers to a molecule that is not found in nature to be associated with YFV (i.e., the backbone of the chimeric virus), such as an envelope protein of a flavivirus other than YFV. The term

"heterologous sequence" in the context of a nucleic acid sequence or nucleotide sequence refers to a nucleic acid sequence or nucleotide sequence that is not found in nature to be associated with the genome of the YFV (i.e., the backbone of the chimeric YFV).

[0039] The term "immunospecifically binds" and analogous terms as used herein refer to molecules that specifically bind to an antigen and do not specifically bind to another molecule (e.g., antigen specific antibodies including both modified antibodies (i.e., antibodies that comprise a modified IgG (e.g., IgGl) constant domain, or FcRn-binding fragment thereof (e.g., the Fc-domain or hinge-Fc domain)) and unmodified antibodies (i.e., antibodies that do not comprise a modified IgG (e.g., IgGl) constant domain, or FcRn-binding fragment thereof (e.g., the Fc-domain or hinge-Fc domain)). Molecules that specifically bind one antigen may be cross- reactive with related antigens. Preferably, a molecule that specifically binds one antigen does not cross-react with other antigens. A molecule that specifically binds an antigen can be identified, for example, by immunoassays, BIAcore, or other techniques known to those of skill in the art. A molecule specifically binds an antigen when it binds to said antigen with higher affinity than to any cross-reactive antigen as determined using experimental techniques, such as radioimmunoassays (RIA) and enzyme-linked immunosorbent assays (ELISAs). See, e.g., Paul, ed., 1989, Fundamental Immunology Second Edition, Raven Press, New York at pages 332-336 for a discussion regarding antibody specificity.

[0040] As used herein, the phrase "interferon antagonist activity" of a proteinaceous agent refers to a protein or polypeptide, or fragment, derivative, or analog thereof that reduces or inhibits the cellular interferon immune response, such as, e.g., interferon induction or interferon signaling. In particular, a protein or polypeptide, or fragment, derivative, or analog thereof {e.g., YFV NS5) that has interferon antagonist activity reduces or inhibits interferon expression and/or activity. In a specific embodiment, the phrase "interferon antagonist activity" refers to virus protein or polypeptide, or fragment, derivative, or analog thereof {e.g., a YFV protein, such as NS5) that reduces or inhibits the cellular interferon immune response. A viral protein or polypeptide with interferon antagonist activity may preferentially affect the expression and/or activity of one or two types of interferon (IFN). In one embodiment, the expression and/or activity of IFN-I is affected. In another embodiment, the expression and/or activity of IFN-a is affected. In another embodiment, the expression and/or activity of IFN-β is affected. In another specific embodiment, the expression and/or activity of IFN-γ is affected. In certain

embodiments, the expression and/or activity of IFN-I, IFN-a, IFN-β and/or IFN-γ in a substrate is reduced approximately 1 to approximately 100 fold, approximately 5 to approximately 80 fold, approximately 20 to approximately 80 fold, approximately 1 to approximately 10 fold, approximately 1 to approximately 5 fold, approximately 40 to approximately 80 fold, or 1, 2, 3, 4, 5, 7, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100 fold by a proteinaceous agent with interferon antagonist activity relative to the expression and/or activity of IFN-a, IFN-β, and/or IFN-γ in a control substrate not expressing or not contacted with such a proteinaceous agent {e.g., a YFV protein, such as NS5) as measured by the techniques described herein or known to one skilled in the art. In certain embodiments, the expression and/or activity of signal transduction molecules {e.g., proteins) downstream of interferon, e.g., IFN-I, in a substrate is reduced approximately 1 to approximately 100 fold, approximately 5 to approximately 80 fold, approximately 20 to approximately 80 fold, approximately 1 to approximately 10 fold, approximately 1 to approximately 5 fold, approximately 40 to

approximately 80 fold, or 1, 2, 3, 4, 5, 7, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100 fold by a proteinaceous agent with interferon antagonist activity relative to the expression and/or activity of signal transduction molecules (e.g., proteins) downstream of interferon, e.g., IFN-I, in a control substrate not expressing or not contacted with such a proteinaceous agent (e.g., a YFV protein, such as NS5) as measured by the techniques described herein or known to one skilled in the art.

[0041] As used herein, the phrases "IFN deficient systems" or "IFN-deficient substrates" refer to systems, e.g., cells, cell lines and animals, such as mice, avians, chickens, turkeys, rabbits, rats, horses, primates, etc., which do not produce one, two or more types of IFN, or do not produce any type of IFN, or produce low levels of one, two or more types of IFN ,or produce low levels of any IFN (i.e., a reduction in any IFN expression of 5-10%, 10-20%), 20-30%), 30- 40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90% or more when compared to IFN-competent systems under the same conditions), do not respond or respond less efficiently to one, two or more types of IFN, or do not respond to any type of IFN, and/or are deficient in the activity of antiviral genes induced by one, two or more types of IFN, or induced by any type of IFN.

[0042] As used herein, the term "elderly human" refers to a human 60 years or older.

[0043] As used herein, the term "human adult" refers to a human that is 18 years or older.

[0044] As used herein, the term "human child" refers to a human that is 1 year to 18 years old.

[0045] As used herein, the term "human toddler" refers to a human that is 1 year to 3 years old.

[0046] As used herein, the term "human infant" refers to a newborn to a 1 year old human.

[0047] As used herein, the term "infection" refers to all stages of a virus' life cycle in a subject (including, but not limited to the invasion by and replication of virus in a cell or body tissue).

[0048] As used herein, the term "isolated," in the context of viruses, refers to a virus that is derived from a single parental virus. A virus can be isolated using routine methods known to one of skill in the art including, but not limited to, those based on plaque purification and limiting dilution. [0049] As used herein, the term "isolated" in the context of nucleic acid molecules refers to a nucleic acid molecule which is separated from other nucleic acid molecules which are present in the natural source of the nucleic acid molecule. Moreover, an "isolated" nucleic acid molecule, such as a cDNA molecule, can be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. In a preferred embodiment, a nucleic acid molecule encoding a viral protein is isolated.

[0050] As used herein, the term "isolated" in the context of proteins refers to a protein (or peptide or polypeptide) which is separated from other proteins which are present in the natural source of the protein. Moreover, an "isolated" protein (or peptide or polypeptide) can be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. In a preferred embodiment, a protein encoding a viral protein is isolated.

[0051] As used herein, the terms "manage," "managing," and "management" refer to the beneficial effects that a subject derives from a therapy (e.g., a prophylactic or therapeutic agent), which does not result in a cure of the disease or infection. In certain embodiments, a subject is administered one or more therapies (e.g., prophylactic or therapeutic agents) to "manage" a virus infection, one or more symptoms thereof, or a disease or condition resulting from, associated with or potentiated by the infection, so as to prevent the progression or worsening of the infection, one or more symptoms thereof, or a disease or condition resulting from, associated with or potentiated by the infection.

[0052] As used herein, the phrase "multiplicity of infection" or "MOI" is the average number of virus per infected cell. The MOI is determined by dividing the number of virus added (ml added x Pfu) by the number of cells added (ml added x cells/ml).

[0053] As used herein, the terms "nucleic acids, " "nucleotide sequences" and "nucleic acid molecules" include DNA molecules (e.g., cDNA or genomic DNA), R A molecules (e.g., mR A), combinations of DNA and RNA molecules or hybrid DNA/RNA molecules, and analogs of DNA or RNA molecules. Such analogs can be generated using, for example, nucleotide analogs, which include, but are not limited to, inosine or tritylated bases. Such analogs can also comprise DNA or RNA molecules comprising modified backbones that lend beneficial attributes to the molecules such as, for example, nuclease resistance or an increased ability to cross cellular membranes. The nucleic acids or nucleotide sequences can be single- stranded, double-stranded, may contain both single-stranded and double-stranded portions, and may contain triple-stranded portions, but preferably is double-stranded DNA.

[0054] As used herein, the terms "prevent," "preventing," and "prevention" in the context of the administration of a therapy to a subject to prevent a disease (e.g., a pathological condition resulting from or associated with a viral infection) refer to the prophylactic benefit a subject receives following the administration of a therapy or a combination of therapies. In a specific embodiment, the terms "prevent," "preventing," and "prevention" in the context of the administration of a therapy to a subject to prevent a disease refer to the prevention of the development, onset or recurrence of the disease, or the prevention or reduction in the

development, onset or recurrence in one or more symptoms of a disease (e.g. , infectious disease) in a subject as result of the administration of a therapy (e.g., a prophylactic or therapeutic agent, such as a pharmaceutical composition, immunogenic composition, or vaccine) or a combination of therapies, or the administration of a combination of therapies (e.g., a combination of prophylactic or therapeutic agents).

[0055] As used herein, the terms "prevent," "preventing," and "prevention" in the context of the administration of a therapy to a subject to prevent an infection (e.g., a viral infection) refer to the prophylactic benefit a subject receives following administration of a therapy or a

combination of therapies. In a specific embodiment, the terms "prevent," "preventing," and "prevention" in the context of the administration of a therapy to a subject to prevent an infection (e.g., a viral infection) refer to the prevention or reduction in the recurrence, development or onset of an infection (e.g., a YFV infection), or the prevention of the recurrence of an infection in a subject resulting from the administration of a therapy (e.g., a prophylactic or therapeutic agent, such as a pharmaceutical composition, immunogenic composition, or vaccine), or the administration of a combination of therapies (e.g., a combination of prophylactic or therapeutic agents).

[0056] As used herein, the term "protective antigen" in the context of an infectious agent includes any molecule which is capable of eliciting a protective immune response when administered to a subject, which immune response is directed against the infectious agent.

[0057] As used herein, the terms "prophylactic agent" and " prophylactic agents" refer to any agent(s) which can be used in the prevention of a disease (e.g., YFV disease or other condition associated with a YFV infection) or a symptom thereof, or an infection (e.g. , a YFV infection) or a symptom thereof. In a specific embodiment, a prophylactic agent is an agent which is known to be useful to, has been or is currently being used to the prevent or impede the onset, development, progression and/or severity of a disease or a symptom thereof.

[0058] As used herein, the phrase "purified" in the context of viruses refers to a virus which is substantially free of cellular material and culture media from the cell or tissue source from which the virus is derived. The language "substantially free of cellular material" includes preparations of virus in which the virus is separated from cellular components of the cells from which it is isolated or recombinantly produced. Thus, virus that is substantially free of cellular material includes preparations of protein having less than about 30%, 20%>, 10%>, or 5% (by dry weight) of cellular protein (also referred to herein as a "contaminating protein"). The virus is also substantially free of culture medium, i.e. , culture medium represents less than about 20%>, 10%), or 5%o of the volume of the virus preparation. A virus can be purified using routine methods known to one of skill in the art including, but not limited to, chromatography and centrifugation.

[0059] As used herein, the terms "subject" or "patient" are used interchangeably. As used herein, the terms "subject" and "subjects" refers to an animal. In some embodiments, the subject is a mammal including a non-primate (e.g. , a camel, donkey, zebra, cow, horse, horse, cat, dog, rat, and mouse) and a primate (e.g. , a monkey, chimpanzee, and a human). In some

embodiments, the subject is a non-human mammal. In certain embodiments, the subject is a pet (e.g. , dog or cat) or farm animal (e.g. , a horse, pig or cow). In certain embodiments, the subject is an avian or an insect. In other embodiments the subject is a human. In certain embodiments, the mammal (e.g. , human) is 0 to 6 months old, 6 to 12 months old, 1 to 5 years old, 5 to 10 years old, 10 to 15 years old, 15 to 20 years old, 20 to 25 years old, 25 to 30 years old, 30 to 35 years old, 35 to 40 years old, 40 to 45 years old, 45 to 50 years old, 50 to 55 years old, 55 to 60 years old, 60 to 65 years old, 65 to 70 years old, 70 to 75 years old, 75 to 80 years old, 80 to 85 years old, 85 to 90 years old, 90 to 95 years old or 95 to 100 years old.

[0060] As used herein, the terms "therapies" and "therapy" can refer to any protocol(s), method(s), and/or agent(s) that can be used in the prevention, treatment, management, or amelioration of a disease (e.g. , YFV disease or other condition associated with a YFV infection) or a symptom thereof, or an infection (e.g. , a YFV infection) or a symptom thereof. In certain embodiments, the terms "therapies" and "therapy" refer to biological therapy, supportive therapy, and/or other therapies useful in treatment, management, prevention, or amelioration of a disease, an infection or a condition or symptom associated therewith, known to one of skill in the art. In one embodiment, a therapy comprises an attenuated YFV (e.g., attenuated chimeric YFV) described herein.

[0061] As used herein, the terms "therapeutic agent" and "therapeutic agents" refer to any agent(s) which can be used in the prevention, treatment, management, or amelioration of a disease (e.g. , YFV disease or other condition associated with a YFV infection) or a symptom thereof, or an infection (e.g., a YFV infection) or a symptom thereof. In a specific embodiment, a therapeutic agent is an agent which is known to be useful for, or has been or is currently being used for the prevention, treatment, management, or amelioration of a disease (e.g. , YFV disease or other condition associated with a YFV infection) or a symptom thereof, or an infection (e.g. , a YFV infection) or a symptom thereof.

[0062] As used herein, the terms "treat", "treatment", and "treating" in the context of administration of a therapy(ies) to a subject to treat a disease or infection (such as a viral infection, e.g., YFV or other flavivirus infection or disease resulting from or associated with said infection) refer to a beneficial or therapeutic effect of a therapy or a combination of therapies. In specific embodiments, such terms refer to one, two, three, four, five or more of the following effects resulting from the administration of a therapy or a combination of therapies: (i) reduction or amelioration in the severity of an infection, a disease or a symptom associated therewith; (ii) reduction in the duration of an infection, a disease or a symptom associated therewith; (iii) prevention of the progression of an infection, a disease or a symptom associated therewith; (iv) regression of an infection, a disease or a symptom associated therewith; (v) prevention of the development or onset of an infection, a disease or a symptom associated therewith; (vi) prevention of the recurrence of an infection, a disease or a symptom associated therewith; (vii) reduction or prevention of the spread of an infectious agent (e.g. , a virus) from one cell to another cell, one tissue to another tissue, or one organ to another organ; (viii) prevention or reduction of the spread/transmission of an infectious agent (e.g., a virus) from one subject to another subject; (ix) reduction in organ failure associated with an infection or disease; (x) reduction in the hospitalization of a subject; (xi) reduction in the hospitalization length; (xii) an increase in the survival of a subject with an infection or a disease; (xiii) elimination of an infection or a disease associated therewith; (xiv) inhibition or reduction in infectious agent (e.g. , viral) replication; (xv) inhibition or reduction in attachment of an infectious agent (e.g., a virus) to a cell(s); (xvi) inhibition or reduction in the entry of an infectious agent (e.g. , a virus) into a cell(s); (xvii) inhibition or reduction of replication of an infectious agent's (e.g. , a virus's) genome; (xviii) inhibition or reduction in the synthesis of an infectious agent's (e.g. , a virus's) proteins; (xix) inhibition or reduction in the assembly of an infectious agent's (e.g. , a virus) particles; (xx) inhibition or reduction in the release of (e.g., a virus) particles from a cell(s); (xxi) reduction in virus titer; (xxii) the reduction in the number of symptoms associated with an infection or a disease; (xxiii) enhancement, improvement, supplementation, complementation, or augmentation of the prophylactic or therapeutic effect(s) of another therapy; (xxiv) prevention of the onset or progression of a secondary infection associated with an infectious agent (e.g. , viral) infection; and/or (xxv) prevention of the onset or diminution of disease severity of other disease or side effects (e.g. , viscerotropic disease or neurotropic disease associated with YFV) occurring secondary to virus infections.

[0063] In specific embodiments, the terms "treat" "treatment", and "treating" in the context of infections (e.g. , YFV virus), refer to the eradication or control of the replication of an infectious agent (e.g. , a virus), the reduction in the numbers of an infectious agent (e.g., the reduction in the titer of virus), the reduction or amelioration of the progression, severity, and/or duration of an infection (e.g. , YFV infection or a condition or symptoms associated therewith, or an infection other than an YFV infection or a condition or symptom associated therewith), or the amelioration of one or more symptoms resulting from the administration of one or more therapies (including, but not limited to, the administration of one or more prophylactic or therapeutic agents).

[0064] In specific embodiments, the terms "treat", "treatment", "treating" in the context of cancer refer to the eradication, removal, modification, or control of primary, regional, or metastatic cancer tissue, or the reduction in tumor growth, or the reduction in the spread of a tumor, or the inhibition of tumor cell proliferation, or the reduction in the size of a tumor that results from the administration of a YFV described herein or a combination of one or more therapies described herein (e.g., therapeutic agents).. In certain embodiments, such terms refer to the minimizing or delaying the spread of cancer resulting from the administration of a YFV described herein or a combination of one or more therapies described herein (e.g., therapeutic agents) to a subject with such a disease. In some embodiments, such terms refer to elimination of disease causing cells.

[0065] As used herein, the term "in combination" in the context of the administration of (a) therapy(ies) to a subject, refers to the use of more than one therapy. The use of the term "in combination" does not restrict the order in which therapies are administered to a subject. A first therapy can be administered prior to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before), concomitantly with, or subsequent to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks after) the administration of a second therapy to a subject.

4. BRIEF DESCRIPTION OF THE FIGURES

[0066] Figure. 1. YFV inhibits type I but not type II interferon signaling. 293T cells were transfected with (A) an IFN-a/ -inducible firefly-luciferase reporter plasmid (pISRE-luc) or (B) an IFN-y-inducible firefly-luciferase reporter (pGAS-luc) along with a constitutively expressed Renilla luciferase gene plasmid. Cells were infected with virus (MOI=5) for 24 hours and treated with IFN-β (1000 U/ml) or IFN-γ (1000 U/ml) for 10 hours prior to assaying for dual luciferase activities. Fold induction of firefly luciferase activity was normalized to Renilla luciferase activity. The bars represent the mean fold induction of 3 independent experiments compared to untreated, mock-infected controls. (C, D) Vero cells were mock-infected or infected with YFV-17D (MOI=5). 24 hours post infection (h.p.i), cells were mock treated or treated with the indicated amounts of (C) IFN-β or (D) IFN-γ for 16 hours, and then infected with NDV-GFP. NDV-GFP replication was monitored by fluorescence microscopy at 14 h.p.i.

[0067] Figure 2. YFV suppresses binding of the ISGF3 complex at the ISRE of interferon-stimulated genes. Cells were infected with the indicated virus for 24 hours then mock treated or treated with 1000 U/ml IFN-β for 30 mins. (A, B) Western blots were performed to monitor steady state levels or tyrosine phosphorylation of the indicated proteins in mock- infected and virus-infected Vero cells (MOI=10). (C) Confocal microscopy images showing subcellular localization of the indicated protein in mock-infected or YFV-17D-infected (MOI=l) Vera cells before or after treatment with 1000 U/ml IFN-β for 30 mins. Additional images can be found in Figure 8A. (D) Intracellular fractionation of He La cells that had been mock-infected or infected with Y FV-17D (MOI=10). The proteins in the cytoplasmic and nuclear fractions were detected by western blotting with the indicated antibodies. The endogenous proteins, β-tubulin and lamin A, were detected as controls for the cytoplasmic and nuclear fractions respectively. (E) Vera cells were mock-infected or infected with the indicated virus for 24 hours (MOI=10) then either mock-stimulated or stimulated with 1000 U/ml IFN-β for 8 hours. Cell extracts were analyzed by EMSA with ISRE elements derived from the 2'-5'oligoadenylate synthetase 1 B (Oaslb) and the interferon-stimulated gene 15 (1SG15) genes. The "ns" band denotes nonspecific binding. A super shift assay confirming the identity of ISGF3 is found in Figure 8B. (F) Vera cells were mock-infected or infected with the indicated virus for 24 hours (MOI 10) then either mock-stimulated or stimulated with 1000 U/ml IFN-β for 24 hours. Cell lysates were analyzed by western blotting with the indicated antibodies.

[0068] Figure 3. YFV NS5 inhibits type I IFN signaling by interacting with STAT2 in type I and type III IFN-treated cells. (A) 293T cells were co-transfected with a plasmid encoding an ISRE-54-CAT-GFP reporter and with a constitutively expressing firefly-luciferase plasmid plus an empty vector (pCAGGS) or pCAGGS encoding the indicated viral proteins. 24 hours post transfection, cells were treated with IFN-β (1000 U/ml) for 16 hours prior to assaying for CAT activity. Induction of CAT activity was normalized to firefly luciferase activity. Fold induction of CAT activity was calculated as the IFN-induced CAT activity of the treated sample normalized to the firefly luciferase value of the sample which was then divided by the normalized value of the unstimulated empty vector control sample. The lower panel of (A) is a western blot showing the relative expression of each viral protein used in the assay, β-actin western blot is used as loading control (B) 293T cells were transfected with the indicated HA- tagged plasmids. 24 hours post transfection, cells were mock-stimulated or stimulated with 1000 U/ml IFN-β for 45 minutes. Cells were lysed and immunoprecipitation was performed against the HA epitope followed by western blot analysis with antibodies against STAT2 and STAT1. TCE, western blots in total cell extracts prior to immunoprecipitation. β -Tubulin western blot is used as a loading control. (C). Transfection and immunoprecipitation of 293T cell as in (B), but cells were lysed under more stringent conditions (see Section 6 below, Materials and Methods). (D) Reciprocal immunoprecipitation. 293T cells were transfected with the indicated HA-tagged constructs. 24 hours post transfection cells were mock-stimulated or stimulated with 1000 U/ml IFN-β for 45 minutes. Cell lysates were immunoprecipitated using a STAT2 polyclonal antibody or a control IgG antibody followed by western blot analysis with the indicated antibodies. (E) Transfection and immunoprecipitation of 293T cell as in B but cells were mock-stimulated or stimulated with 1000 U/ml IFN-β, 1000 U/ml IFN-γ or 1000 U/ml IFN-λ for 45 minutes prior to lysis. Abbreviations: Ig = control rabbit IgG; aS = anti-STAT2; TCE = total cell extract; CAT = chloramphenicol acetyl transferase.

[0069] Figure 4. Activation of YFV NS5 by interferon is essential for its interaction with STAT2. (A) U6A cells were transfected with empty, DENV-2-NS5-HA-tagged or YFV-NS5- HA-tagged plasmids. 24 hours post transfection, cells were mock-stimulated or stimulated with 1000 U/ml IFN-β for 45 minutes. Cells were lysed and immunoprecipitation was performed against the HA epitope for 2 hrs using anti-HA beads. The beads were then washed three times with lysis buffer. 2fTGH cells were then stimulated with 1000 U/ml IFN-β then lysed and added to the NS5 bound anti-HA beads for two more hours. The beads were then washed and boiled, and western blot analysis with antibodies against HA and STAT2 was carried out on the boiled samples. (B). Transfection and immunoprecipitation of U6A cells as in (A), however, 2fTGH cells were mock- stimulated then lysed and added to the NS5 bound anti-HA beads (C) U6A cells were transfected with empty or YFV-NS5-HA-tagged plasmids along with FLAG-tagged wildtype or mutant STAT2. The cells were stimulated with 1000 U/ml IFN-β for 45 minutes, then lysed and incubated on anti-HA beads. The beads were then washed and boiled, and western blot analysis with antibodies against FLAG and HA. TCE, western blots in total cell extracts prior to immunoprecipitation. β-Tubulin western blot is used as a loading control.

[0070] Figure 5. The first ten amino acids of YFV NS5 are required for its interaction with STAT2. (A) A diagram of the full length and truncated YFV NS5 HA-tagged expression constructs used in B and a summary of their ability to bind STAT2 in response to IFN-β stimulation. (B) 293T cells were transfected with the indicated HA-tagged plasmids. 24 hours post transfection, cells were mock-stimulated or stimulated with 1000 U/ml IFN-β, for 45 minutes. Cells were lysed and immunoprecipitation was performed against the HA epitope followed by western blot analysis with the indicated antibodies (C) A diagram of the YFV NS5 chimeras used in D, E and F, highlighting the sequences of their amino termini, and their ability to bind STAT2 in response to IFN-β stimulation. (D) 293T cells were transfected with the indicated HA-tagged plasmids. 24 hours post transfection, cells were mock-stimulated or stimulated with 1000 U/ml IFN-β, for 45 minutes. Cells were lysed and immunoprecipitation was performed against the HA epitope followed by western blot analysis with the indicated antibodies. (E) Vera cells were transfected with empty vector or plasmids that express the indicated viral proteins. 24 hours post transfection, cells were treated with 1000 U/ml IFN-β for 16 hours and then infected with NDV-GFP. NDV-GFP replication was monitored by

fluorescence microscopy at 14 h.p.i. (F) 293T cells were co-transfected with an IFN-α/β- inducible firefly-luciferase reporter plasmid (pISRE-luc) along with a constitutively expressed Renilla luciferase plasmid and empty vector (pCAGGS) or pCAGGS plasmids that encode the indicated viral proteins. 24 hours post transfection, cells were treated with IFN-β (1000 U/ml) for 16 hours prior to assaying for luciferase activities. Fold induction of firefly luciferase activity was normalized to Renilla luciferase activity. The bars represent the mean fold induction of 3 independent experiments compared to the untreated, empty vector controls.

[0071] Figure 6. A single lysine residue at position 6 of YFV NS5 is critical for its interferon antagonist function (A) A diagram of the YFV NS5 mutant constructs used in B and C, highlighting the sequences of their amino termini, and their ability to bind STAT2 in response to IFN-β stimulation. (B) 293T cells were transfected with the indicated HA-tagged plasmids. 24 hours post transfection cells were mock stimulated or stimulated with 1000 U/ml IFN-β, for 45 minutes. Cells were lysed and immunoprecipitation was performed against the HA epitope followed by western blot analysis with the indicated antibodies. (C) 293T cells were co- transfected with an IFN-a^-inducible firefly-luciferase reporter plasmid (pISRE-luc) along with a constitutively expressed Renilla luciferase gene plasmid and empty vector (pCAGGS) or pCAGGS plasmids that encode the indicated viral proteins. 24 hours post transfection, cells were treated with IFN-β (1000 U/ml) for 16 hours prior to assaying for luciferase activities. Fold induction of firefly luciferase activity was normalized to Renilla luciferase activity. The bars represent the mean fold induction of 3 independent experiments compared to the untreated empty vector controls. (D) Vera cells were infected with either wildtype YFV-17D (YFV-17D WT) or YFV-17D with an amino acid substitution from K to R at position 6 of NS5 (YFV-17D K6R) at an MOI of 10. At 8 hours post infection, the cells were either mock-treated or treated with 100 U/ml IFN-β. Virus was harvested at the indicated time points and viral titers were quantified by plaque assay on BHK-21 cells. Each point on the graph represents the mean of 4 independent experiments.

[0072] Figure 7. K63-linked ubiquitination is required for binding of YFV NS5 to STAT2. (A) 293T were transfected with various HA-tagged NS5 mutants. 24 hours post transfection, cells were mock stimulated or stimulated with 1000 U/ml IFN-β for 45 minutes. Cells were lysed and immunoprecipitation was performed against the HA epitope followed by western blot analysis with antibodies against ubiquitin, HA or STAT2. (B) Reciprocal immunoprecipitation. 293T were transfected with FLAG-tagged wildtype YFV NS5 and various HA-tagged ubiquitin mutants. 24 hours post transfection cells were mock stimulated or stimulated with 1000 U/ml IFN-β, for 45 minutes. Cells were lysed and immunoprecipitation was performed against the HA epitope followed by western blot analysis with antibodies against FLAG, HA or STAT2. TCE, western blots in total cell extracts prior to immunoprecipitation. β~ Tubulin western blot is used as a loading control.

[0073] Figure 8. YFV-17D infection does not inhibit IFN-activated STAT1 nuclear localization but does inhibit ISGF3 binding to ISRE (A) Microscopy images showing subcellular localization of the indicated proteins in mock-infected or YFV-17D-infected

(MOI=l) Vero cells before or after treatment with 1000 U/ml IFN-β for 30 mins. (B)

Composition of the ISGF3 complex analyzed with a STAT1 antibody. Vero cells were mock- infected or infected with the indicated virus for 24 hours (MOI=10) then either mock- stimulated or stimulated with 1000 U/ml IFN-β for 8 hours. Cell extracts were analyzed by EMSA with the ISRE element derived the interferon-stimulated gene 15 (ISG15) gene. For samples super-shifted with either STAT1 or control IgG, extracts were incubated with antibody prior to EMSA.

[0074] Figure 9. The NS5 proteins from YFV-17D and YFV-Asibi bind STAT2 in type I IFN-treated cells. 293T cells were transfected with HA-tagged plasmids NS5 constructs. NS5 of YFV Asibi is denoted YFV NS5 while NS5 of YFV-17D is denoted YFV-17D NS5. 24 hours post transfection cells were mock stimulated or stimulated with 1000 U/ml IFN-β, for 45 minutes. Cells were lysed and immunoprecipitation was performed against the HA epitope followed by western blot analysis with antibodies against STAT2 and HA and β-tubulin. TCE, western blots in total cell extracts prior to immunoprecipitation. β-Tubuiin western blot is used as a loading control. 5. DETAILED DESCRIPTION

5.1 ATTENUATED YELLOW FEVER VIRUSES

[0075] Provided herein is an attenuated yellow fever virus (YFV) comprising a mutation in the NS5 gene. In one embodiment, the attenuated mutant YFV is genetically engineered. In a particular embodiment, the mutated NS5 gene encodes a mutant NS5 protein.

[0076] In one aspect, an attenuated YFV provided herein comprises a genome, the genome comprising an NS5 gene with one or more mutations, wherein the one or more mutations result in a deletion of one or more amino acids at the amino-terminus of the NS5 protein encoded by the gene. In one embodiment, the one or more mutations result in the deletion of the first 10 amino acids of the NS5 protein encoded by the gene. In specific embodiments, the only NS5 gene encoded by the genome of the attenuated YFV is the NS5 gene with one or more mutations.

[0077] In another aspect, an attenuated YFV provided herein comprises a genome, the genome comprising an NS5 gene with one or more mutation(s), wherein the one or more mutations result in one or more amino acid substitutions in the amino-terminus of the NS5 protein encoded by the gene. In another aspect, an attenuated YFV provided herein comprises a genome, the genome comprising an NS5 gene with one or more mutation(s), wherein the one or more mutations result in one, two, three or more substitutions in the first 10 N-terminal amino acids of the NS5 protein, and wherein the one or more substitutions eliminates all lysine residues found in the first 10 N-terminal amino acids of the NS5 protein. In one embodiment, the one or more mutations in the NS5 gene results in a single amino acid substitution in the NS5 protein encoded by the gene. In another embodiment, the one or more mutations in the NS5 gene result in an amino acid substitution of another residue for the first N-terminal lysine residue of the NS5 protein encoded by the gene. In a specific embodiment, the one or more mutations in the NS5 gene results in a substitution of another residue for the lysine at amino acid residue 6 of the NS5 protein encoded by the gene. In certain embodiments, the other residue that is substituted for the lysine residue is arginine or alanine. In a specific embodiment, the one or more mutations in the NS5 gene result in an amino acid substitution of arginine for the lysine at amino acid residue 6 (K6R) of the NS5 protein of YFV 17D. In specific embodiments, only NS5 gene encoded by the genome of the attenuated YFV is the NS5 gene with one or more mutations. [0078] In a specific embodiment, an attenuated YFV provided herein comprises a genome which encodes a mutated NS5 protein comprising an amino acid substitution of another residue for the first N-terminal lysine residue of the NS5 protein of a YFV (e.g., YFV 17D). In certain embodiments, the other residue that is substituted for the lysine residue is arginine or alanine. In specific embodiments, the only NS5 protein encoded by the genome of the attenuated YFV is the NS5 gene with one or more mutations.

[0079] In another aspect, an attenuated YFV provided herein is a chimeric YFV that has been engineered to express one or more heterologous amino acid sequences (e.g., a peptide, polypeptide or protein). The heterologous amino acid sequence can be a heterologous antigen, such as an antigen from a pathogen (e.g., a viral, bacterial, fungal or parasitic antigen), a cancer- associated antigen or an allergy-related antigen. In certain embodiments, the heterologous amino acid sequence is a heterologous antigen from a flavivirus other than YFV. In specific embodiments, the heterologous amino acid sequence is a structural protein (e.g., an envelope, prM, or capsid protein) from another virus, e.g., another flavivirus, e.g., dengue virus, Japanese encephalitis virus, or West Nile virus (WNV). In one embodiment, the heterologous amino acid sequence is an envelope protein from another virus that replaces the function of a YFV envelope protein. In another embodiment, the heterologous amino acid sequence is an envelope protein and it is expressed in addition to a YFV envelope protein. In specific embodiments, the heterologous envelope protein is the E protein from another flavivirus, such as, e.g., dengue virus, Japanese encephalitis virus, or West Nile virus (WNV). In one embodiment, the heterologous amino acid sequence is a prM protein from another virus that replaces the function of a YFV prM protein. In another embodiment, the heterologous amino acid sequence is a prM protein and it is expressed in addition to a YFV prM protein.

[0080] In specific embodiments, two heterologous amino sequences are introduced into YFV (e.g., the E protein and prM protein) from another virus, e.g., flavivirus, such as, e.g., dengue virus, Japanese encephalitis virus, or West Nile virus (WNV). In one embodiment, the heterologous E and prM proteins replace the function of a YFV E and prM proteins. In another embodiment, the heterologous E and prM proteins are expressed in addition to YFV E and prM proteins. In specific embodiments, the heterologous envelope proteins replace both the YFV E and prM envelope proteins. [0081] In one embodiment, an attenuated chimeric YFV provided herein comprises a genome, the genome comprising: (i) an NS5 gene with one or more mutations, wherein the one or more mutations result in a deletion of one or more amino acids at the amino-terminus of the NS5 protein encoded by the gene; and (ii) a nucleotide sequence encoding a heterologous amino acid sequence (e.g., a peptide, polypeptide or protein). In one embodiment, the one or more mutations result in the deletion of the first 10 amino acids of the NS5 protein encoded by the gene. In specific embodiments, the heterologous amino acid sequence is the E and/or prM protein(s) from a flavivirus other than YFV, such as, e.g., dengue virus, Japanese encephalitis virus, or West Nile virus (WNV). In specific embodiments, the only NS5 gene encoded by the genome of the chimeric YFV is the NS5 gene with one or more mutations.

In another embodiment, an attenuated chimeric YFV provided herein comprises a genome , the genome comprising: (i) an NS5 gene with one or more mutation(s), wherein the one or more mutations result in one or more amino acid substitutions in the amino-terminus of the NS5 protein encoded by the gene; and (ii) a nucleotide sequence encoding a heterologous amino acid sequence (e.g., a peptide, polypeptide or protein). In certain embodiments, the one or more mutations in the NS5 gene result in a single amino acid substitution in the NS5 protein encoded by the gene. In certain embodiments, the one or more mutations in the NS5 gene result in an amino acid substitution of another residue for the first N-terminal lysine residue of the NS5 protein encoded by the gene. In specific embodiments, the one or more mutations in the NS5 gene results in a substitution of another residue for the lysine at amino acid residue 6 of the NS5 protein encoded by the gene. In certain embodiments, the other residue that is substituted for the lysine residue is arginine or alanine. In a specific embodiment, the one or more mutations in the NS5 gene results in an amino acid substitution of arginine for the lysine at amino acid residue 6 (K6R) of the NS5 protein of YFV 17D. In specific embodiments, the heterologous amino acid sequence is the E and/or prM protein(s) from a flavivirus other than YFV, such as, e.g., dengue virus, Japanese encephalitis virus, or West Nile virus (WNV). In specific embodiments, the only NS5 gene encoded by the genome of the chimeric YFV is the NS5 gene with one or more mutations.

[0082] The genome of any strain of YFV known in the art can be engineered to have a mutation in the NS5 gene. In a specific embodiment, the YFV strain is an attenuated strain, for example, a strain suitable for use in vaccination. In a particular embodiment, the YFV strain is YFV-17D. In one embodiment, the genome of the attenuated YFV encodes the structural proteins (envelope, capsid, and/or prM proteins), and non-structural proteins (e.g., NS l , NS2A, NS2B, NS3, NS4A and NS4B proteins) of the yellow fever virus 17D and a mutated NS5 protein from yellow fever virus 17D. In another embodiment, the genome of the attenuated YFV encodes the structural proteins (envelope, capsid, and/or prM proteins), and non-structural proteins (e.g., NSl , NS2A, NS2B, NS3, NS4A and NS4B proteins) of the yellow fever virus 17D and a mutated NS5 protein from a different yellow fever virus strain. In another embodiment, the genome of the attenuated YFV encodes the structural proteins (envelope, capsid, and/or prM proteins), and non-structural proteins (e.g., NS l , NS2A, NS2B, NS3, NS4A and NS4B proteins) of the yellow fever virus other than 17D and a mutated NS5 protein from the yellow fever virus 17D strain. In another embodiment, the YFV strain is YF-VAX® (Sanofi Pasteur). In another embodiment, the YFV strain is a chimeric YFV, e.g. , a chimeric attenuated YFV, wherein the chimeric YFV comprises one or more heterologous amino acid sequences (e.g., peptides, polypeptides or proteins). In another embodiment, the chimeric YFV is ChimeriVax-Dengue (CYD Dengue; Sanofi Pasteur), ChimeriVax- Japanese encephalitis (Sanofi Pasteur), IMOJEV®, or ChimeriVax- West Nile (Sanofi Pasteur).

[0083] In certain embodiments, an attenuated YFV described herein may be used in the treatment, prevention, and/ or vaccination against YFV or disease or condition associated therewith. In some embodiments, an attenuated YFV described herein may be used in the treatment and/or prevention an interferon-sensitive disease (e.g., a disease responsive to the cellular interferon response induced by infection with an attenuated yellow fever virus described herein). In specific embodiments, In some embodiments, an attenuated YFV described herein may be used in the treatment and/or prevention of cancer.

[0084] In certain embodiments, the chimeric YFV described herein may be used in the treatment, prevention, and/ or vaccination against a virus or disease causing agent other than YFV, or disease or condition associated therewith. In certain embodiments, the chimeric YFV described herein may be used in the treatment, prevention, and/or vaccination against one or more different viruses or disease causing agents other than YFV, or diseases or conditions associated therewith. For example, in certain embodiments, the chimeric YFV described herein is used in the treatment, prevention, and/or vaccination against one or more strains, types, or subtypes of flaviviruses, e.g., dengue (e.g., dengue DENV1, 2, 3, and/or 4), Japanese encephalitis virus, or WNV, or diseases or conditions associated therewith.

[0085] In certain embodiments, the chimeric YFV described herein may be used in the treatment, prevention, and/ or vaccination against YFV and a virus or disease causing agent other than YFV, or disease or condition associated therewith. In some embodiments, the chimeric YFV described herein may be used in the treatment, prevention, and/or vaccination against more than one virus or disease causing agent, or disease or condition associated therewith. For example, in certain embodiments, the chimeric YFV described herein may be used in the treatment, prevention, and/or vaccination against YFV and another flavivirus, for example, dengue virus, Japanese encephalitis virus, or WNV. For example, in certain embodiments, the chimeric YFV described herein may be used in the treatment, prevention, or vaccination against YFV and dengue virus, against YFV and Japanese encephalitis virus, or against YFV and WNV.

[0086] In a specific embodiment, the attenuated YFV described herein is a chimeric YFV in which a structural protein-encoding gene(s) (prM and/or E) of YFV are replaced with the corresponding genes of another flavivirus such as, e.g., dengue virus (e.g., GenBank Accession Nos. AF425630 (DENV 1), D00345 (DENV 2), AF349753 (DENV 3), or JN022608 (DENV 4)), Japanese encephalitis virus (e.g., GenBank Accession No. EF571853), or WNV (e.g., GenBank Accession No. FJ411043). See, e.g., Appaiahgari & Vrati, 2010, Expert Rev Vaccines 9: 1371-1384; Biedenbender, et al, 2011, J Infect Dis 203: 75-84; Dayan, et al, 2012, Vaccine 30: 6656-6664; Monath, et al, 2002, Vaccine 20: 1004-1018; and Sabchareon, et al, 2012, Lancet 380: 1559-1567, the contents of each of which is incorporated by reference herein in its entirety.

[0087] In a specific embodiment, the attenuated YFV described herein is a chimeric YFV in which the prM protein-encoding gene of YFV is replaced with the corresponding gene of another flavivirus such as, e.g., dengue virus, Japanese encephalitis virus, or WNV. In a specific embodiment, the attenuated YFV described herein is a chimeric YFV in which the envelope protein-encoded gene of YFV is replaced with the corresponding gene of another flavivirus such as, e.g., dengue virus, Japanese encephalitis virus, or WNV. In a specific embodiment, the attenuated YFV described herein is a chimeric YFV in which the prM protein-encoding gene and envelope protein-encoding gene of YFV are replaced with the corresponding genes of another flavivirus such as, e.g., dengue virus, Japanese encephalitis virus, or WNV. In certain embodiments, one or more of heterologous genes encoding the envelope and prM proteins of flaviviruses, are introduced into the attenuated YFV such that they are expressed in addition to the endogenous YFV prM and/or E genes. In certain other embodiments, an attenuated YFV described herein is modified such that it expresses an ectodomain of a structural protein (e.g., an envelope protein) of another flavivirus, e.g., dengue, Japanese encephalitis virus, or WNV, such that the ectodomain is sufficient to generate an immune response against an antigen of the heterologous ectodomain. In certain embodiments, the heterologous ectodomain is expressed as a fusion protein with the corresponding YFV structural protein (e.g., YFV envelope protein). In certain embodiments, the fusion protein with the corresponding YFV structural protein (e.g., YFV envelope protein) is expressed in the attenuated YFV in addition to the corresponding endogenous YFV structural protein (e.g., YFV envelope protein).

[0088] In one embodiment, the chimeric YFV comprises a genome that encodes a WNV structural protein (e.g., WNV envelope protein) or fragment thereof. In another embodiment, the chimeric YFV comprises a genome that encodes a dengue virus structural protein (e.g., dengue E protein) or a fragment thereof. In another embodiment, the chimeric YFV comprises a genome that encodes a dengue virus E protein or a fragment thereof. In another embodiment, the chimeric YFV comprises a genome that encodes prM and E proteins of dengue virus type 1, 2, 3, and/or 4. In another embodiment, provided herein is a composition comprising a mixture of more than one chimeric YFV. For example, in one embodiment, provided herein is a

composition comprising four chimeric YFVs expressing prM and E of either dengue virus (DENV) 1, 2, 3 or 4. See, e.g., Guy, et al, 2011, Vaccine 29: 7229-7241, the entire contents of which is incorporated herein by reference.

[0089] In certain embodiments, the heterologous antigen is inserted within an intergenic region or in place of deleted capsid sequences in the attenuated YFV backbone.

[0090] Any strain of YFV known in the art can be engineered to have a mutation in the NS5 gene, but not limited to, naturally occurring strains, variants or mutants, mutagenized viruses, reassortants and/or genetically engineered viruses. In a specific embodiment, the YFV is a naturally occurring virus. In another specific embodiment, the YFV is a genetically engineered virus. In one embodiment, the YFV strain is an attenuated strain, for example, a strain suitable for use in vaccination. In one embodiment, the YFV strain is YFV-17D. In another embodiment, the YFV strain is YF-VAX® (Sanofi Pasteur). In one embodiment, the YFV strain is a chimeric YFV, e.g. , a chimeric attenuated YFV, wherein said chimeric YFV comprises one or more heterologous proteins. In another embodiment, the chimeric YFV is ChimeriVax-Dengue (CYD Dengue; Sanofi Pasteur), ChimeriVax- Japanese encephalitis (Sanofi Pasteur), IMOJEV®, or ChimeriVax-West Nile (Sanofi Pasteur).

[0091] In one embodiment, an attenuated YFV with a mutation in the NS5 gene described herein has a reduced ability to antagonize the cellular interferon response (e.g. , compared to wild-type YFV or YFV without the mutation in the NS5 gene). In another embodiment, a mutant NS5 protein encoded by an attenuated YFV described herein has a reduced ability to antagonize the cellular interferon response. In another embodiment, an attenuated YFV described herein has an increased ability to replicate in an interferon deficient substrate compared to a substrate that has been treated with interferon or that expresses interferon. In another embodiment, the attenuation of YFV, or the reduction in the ability of the attenuated YFV with a mutated NS5 protein or mutant NS5 protein encoded by the attenuated YFV to antagonize the cellular interferon response, is measured in cells, e.g. , human or non-human primate cells. In another embodiment, the attenuation of YFV, or the reduction in the ability of the attenuated YFV with a mutated NS5 protein or mutant NS5 protein encoded by the attenuated YFV to antagonize the cellular interferon response, is measured in cells, e.g., human or non-human primate cells, that have been treated with IFN-I. In an embodiment, the reduced ability to antagonize the cellular interferon response is a reduced ability to antagonize IFN-I signaling. In another embodiment, the YFV with a mutated NS5 gene has increased sensitivity to interferon compared to YFV in which the NS5 gene has not been mutated. In some embodiments, cells treated with the attenuated YFV provided herein produce more interferon, such as IFN-I, or IFN-I dependent proteins, such as cytokines, such as, e.g., interferon gamma, compared to YFV in which the NS5 gene has not been mutated.

[0092] In one aspect, an attenuated YFV with a mutant NS5 gene provided herein has decreased pathogenicity compared to the YFV without the mutant NS5. In another aspect, an attenuated YFV with a mutant NS5 gene provided herein produces fewer side effects compared to the YFV without the mutant NS5. In another aspect, an attenuated YFV with a mutant NS5 gene provided herein has increased immunogenicity compared to the YFV without the mutant NS5. In another aspect, an attenuated YFV with a mutant NS5 gene provided herein has increased safety compared to the YFV without the mutant NS5. [0093] In another aspect, provided herein are nucleotide sequences encoding the mutated NS5 proteins described herein. In certain embodiments, provided herein are nucleotide sequences of the genomes of YFV comprising a mutated NS5 gene described herein. In some embodiments, provided herein are nucleotide sequences encoding the genome of a chimeric YFV which encodes a mutated NS5 protein described herein and a heterologous amino acid sequence (e.g., the envelope proteins, e.g., the E or prM proteins, of a flavivirus other than YFV, such as dengue virus, Japanese encephalitis virus, or West Nile virus.

[0094] Also provided herein are cell lines, e.g., hamster cells (e.g., BHK cells) or Vera cells, infected with an attenuated YFV (e.g. , chimeric YFV) described herein. In other embodiments, provided herein are chicken embryos infected with an attenuated YFV described herein. In other embodiments, provided herein are embryonated eggs infected with an attenuated YFV described herein. For example, provided herein are cells (e.g. hamster cells, (BHK cells), primate cells (e.g., Vera cells), etc.), chicken embryos, and embryonated eggs (e.g., chicken eggs) infected with an attenuated YFV (e.g., chimeric YFV) described herein. Such methods are well-known to those skilled in the art. In certain embodiments, provided herein are embryonated eggs, e.g., from 6 to 14 days old, infected with an attenuated YFV described herein. Provided herein are young or immature embryonated eggs (e.g., less than 10 days old, e.g., 6 to 9 days old, that are IFN-deficient) infected with an attenuated YFV described herein.

5.2 CONSTRUCTION OF ATTENUATED YFV

[0095] The attenuated YFVs described herein can be generated using techniques known in the art. In certain embodiments, a complete cDNA of a YFV is constructed and inserted into a plasmid vector. A heterologous sequence (e.g., a heterologous viral envelope protein) may be inserted into the viral genome. The plasmid vector and expression vectors comprising the necessary viral proteins are transfected into cells leading to production of recombinant viral particles.

[0096] Bicistronic techniques to produce multiple proteins from a single mRNA are known to one of skill in the art. Bicistronic techniques allow the engineering of coding sequences of multiple proteins into a single mRNA through the use of IRES sequences. IRES sequences direct the internal recruitment of ribosomes to the RNA molecule and allow downstream translation in a cap independent manner. Briefly, a coding region of one protein is inserted into the ORF of a second protein. The insertion is flanked by an IRES and any untranslated signal sequences necessary for proper expression and/or function. The insertion must not disrupt the open reading frame, polyadenylation or transcriptional promoters of the second protein.

[0097] In specific embodiments, an attenuated YFV described herein, including mutant NS5 proteins and virus backbones (e.g., YFV- 17 D cDNA clones) can be generated using techniques described in Section 6, infra. In one embodiment, a YFV NS5 (e.g., K6R) mutant virus is made by PCR mutagenesis of a cDNA clone, e.g., the YFV 17-D clone pACNR-YF17D (Bredenbeek, et al, 2003, J Gen Virol 84, 1261-1268; Lindenbach & Rice, 1999, J Virol 73, 4611-4621, which are incorporated herein by reference in their entireties) using the following primers:

Reverse primer: GACTTCACCCAAAGTTCGTCCATTCGCGC

Forward primer: GCGCGAATGGACGAACTTTGGGTGAAGTC

The mutant virus may be rescued by linearizing the cDNA clone and generating viral mRNA using standard methods (e.g., the SP6 Cap-Scribe kit™ (Roche, Germany). Viral mRNA can then be introduced into cells by methods known in the art (e.g., transfection into BHK-21 cells using the Transit® mRNA transfection kit; Minis Bio, USA), and viruses are then harvested from the cells 1, 2, 3, 4, 5, 6, 7, or more days after transfection.

5.3 PROPAGATION OF ATTENUATED YFV

[0098] The attenuated YFVs (e.g. , chimeric YFVs) described herein can be propagated in any substrate that allows the virus to grow to titers that permit the uses of the viruses described herein. In one embodiment, the substrate allows the attenuated YFVs described herein to grow to titers comparable to those determined for the corresponding wild-type viruses.

[0099] The attenuated YFVs described herein may be grown in cells (e.g. hamster cells, (BHK cells), primate cells, etc.) that are susceptible to infection by the viruses, chicken embryos, or embryonated eggs (e.g., chicken eggs). Such methods are well-known to those skilled in the art. In certain embodiments, the attenuated YFVs described herein are propagated in interferon- deficient substrates, such as embryonated eggs or an interferon-deficient cell line. In a specific embodiment, the attenuated YFVs are propagated in Vero cells or BHK cells. In another specific embodiment, the attenuated YFVs are propagated in chicken embryos. In another specific embodiment, the attenuated YFVs are propagated in chicken eggs. In certain embodiments, the attenuated YFVs described herein may be propagated in embryonated eggs, e.g., from 6 to 14 days old. Young or immature embryonated eggs can be used to propagate attenuated YFVs described herein. Immature embryonated eggs encompass eggs which are less than ten day old eggs, e.g., eggs 6 to 9 days that are IFN-deficient. Immature embryonated eggs also encompass eggs which artificially mimic immature eggs up to, but less than ten day old, as a result of alterations to the growth conditions, e.g., changes in incubation temperatures; treating with drugs; or any other alteration which results in an egg with a retarded development, such that the IFN system is not fully developed as compared with ten to twelve day old eggs. The attenuated YFVs described herein can be propagated in different locations of the embryonated egg, e.g. , the allantoic cavity.

[00100] In one embodiment, provided herein are methods for producing attenuated YFVs described herein and compositions thereof, e.g., pharmaceutical compositions, immunogenic compositions, or vaccines, comprising an attenuated YFV described herein. In one embodiment, a method for producing an attenuated YFV described herein or compositions thereof comprises:

(a) propagating an attenuated YFV described herein in a cell line that is susceptible to a YFV infection; and (b) collecting the progeny virus, wherein the virus is grown to sufficient quantities and under sufficient conditions that the virus is free from contamination, such that the progeny virus is suitable for formulation into a composition, e.g., pharmaceutical composition, immunogenic composition, or vaccine. In another embodiment, a method for producing an attenuated YFV described herein or compositions thereof comprises: (a) propagating an attenuated YFV described herein in a chicken embryo that is susceptible to a YFV infection; and

(b) collecting the progeny virus, wherein the virus is grown to sufficient quantities and under sufficient conditions that the virus is free from contamination, such that the progeny virus is suitable for formulation into a composition, e.g., pharmaceutical composition, immunogenic composition, or vaccine. In another embodiment, a method for producing an attenuated YFV described herein or compositions thereof comprises: (a) propagating an attenuated YFV described herein in an embryonated egg that is susceptible to a YFV infection; and (b) collecting the progeny virus, wherein the virus is grown to sufficient quantities and under sufficient conditions that the virus is free from contamination, such that the progeny virus is suitable for formulation into a composition, e.g., pharmaceutical composition, immunogenic composition, or vaccine. [00101] For virus isolation, the attenuated YFVs described herein can be removed from cell culture (e.g., BHK cells) and separated from cellular components, typically by well known clarification procedures, e.g., such as gradient centrifugation and column chromatography, and may be further purified as desired using procedures well known to those skilled in the art, e.g. , plaque assays.

[00102] In a specific embodiment, an attenuated YFV described herein is prepared by culturing the YFV in living avian leukosis virus-free (ALV-free) chicken embryos. The virus is stabilized with sorbitol and gelatin, and reconstituted immediately before use with a sterile sodium chloride solution that is provided with the vaccine packet. See, e.g., Monath, et al, 2002, Am J Trop Med Hyg 66: 533-541 ; and Mason, et al, 1973, Appl Microbiol 25 : 539-544, the contents of each of which is incorporated by reference herein in its entirety.

[00103] In another specific embodiment, an attenuated YFV described herein is propagated in serum- free Vera cells according to the methods described in Guy, et al, 201 1 , Vaccine 29: 7229- 7241 , the entire contents of which is incorporated herein by reference.

5.4 COMPOSITIONS AND USES OF ATTENUATED YFVS

[00104] Encompassed herein are compositions comprising an attenuated YFV (e.g., a chimeric YFV) described herein. In a specific embodiment, provided herein are pharmaceutical compositions comprising an attenuated YFV (e.g. , a chimeric YFV)described herein and a pharmaceutically acceptable carrier. In a specific embodiment, provided herein are

immunogenic compositions comprising an attenuated YFV (e.g., a chimeric YFV)described herein and a pharmaceutically acceptable carrier. In one embodiment, provided herein are vaccine compositions comprising an attenuated YFV (e.g. , a chimeric YFV)described herein.

[00105] In certain embodiments, a composition comprising an attenuated YFV described herein comprises live YFV. In other embodiments, a composition comprising an attenuated YFV described herein comprises inactivated YFV. The YFV can be inactivated by methods well known to those of skill in the art. Common methods use formalin and heat for inactivation. See, e.g., U.S. Patent No. 6,635,246, which is herein incorporated by reference in its entirety. Other methods include those described in U.S. Patent Nos. 5,891 ,705; 5,106,619 and 4,693,981 , herein incorporated by reference in their entireties. [00106] Also provided herein are methods for producing compositions, e.g., pharmaceutical compositions, immunogenic compositions, or vaccines, comprising an attenuated YFV (e.g., a chimeric YFV) described herein. In one embodiment, a method for producing a composition comprises: (a) propagating an attenuated YFV described herein in a cell line that is susceptible to a YFV infection; and (b) collecting the progeny virus, wherein the virus is grown to sufficient quantities and under sufficient conditions that the virus is free from contamination, such that the progeny virus is suitable for formulation into a composition, e.g., pharmaceutical composition, immunogenic composition, or vaccine. In another embodiment, a method for producing a composition comprises: (a) propagating an attenuated YFV described herein in a chicken embryo that is susceptible to a YFV infection; and (b) collecting the progeny virus, wherein the virus is grown to sufficient quantities and under sufficient conditions that the virus is free from contamination, such that the progeny virus is suitable for formulation into a composition, e.g., pharmaceutical composition, immunogenic composition, or vaccine. In another embodiment, a method for producing a composition comprises: (a) propagating an attenuated YFV described herein in an embryonated egg that is susceptible to a YFV infection; and (b) collecting the progeny virus, wherein the virus is grown to sufficient quantities and under sufficient conditions that the virus is free from contamination, such that the progeny virus is suitable for formulation into a composition, e.g., pharmaceutical composition, immunogenic composition, or vaccine.

[00107] In one embodiment, a composition, e.g., pharmaceutical composition, immunogenic composition, or vaccine, comprises an attenuated YFV described herein, and a pharmaceutically acceptable carrier. The compositions provided herein can be in any form that allows for the composition to be administered to a subject. In a specific embodiment, the compositions are suitable for veterinary and/or human administration. As used herein, the term "pharmaceutically acceptable" means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeiae for use in animals, and more particularly in humans. The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the pharmaceutical composition is administered. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E.W.

Martin. The formulation should suit the mode of administration.

[00108] In a specific embodiment, the compositions, e.g., pharmaceutical compositions, immunogenic compositions, or vaccines, are formulated to be suitable for the intended route of administration to a subject. For example, the composition may be formulated to be suitable for parenteral {e.g., subcutaneous, intramuscular, or intravenous) intracerebroventricular, intracerebral, oral, intranasal, intratracheal, intradermal, colorectal, intraperitoneal, topical, or pulmonary administration. In a specific embodiment, the composition may be formulated for subcutaneous administration. In birds, the methods may further include choanal inoculation. As an alternative to parenteral administration, routes of mass administration for agricultural purposes such as via drinking water or in a spray. It may be preferable to introduce an attenuated YFV immunogenic formulation via the natural route of infection of the wild-type virus {e.g. , a virus having the backbone of the attenuated YFV ) . Alternatively, it may be preferable to introduce the virus described herein via the natural route of infection of the agent from which a heterologous amino acid sequence expressed by the virus {e.g. , an envelope protein from another flavivirus) is derived.

[00109] In specific embodiments, provided herein are uses of the attenuated YFVs described herein {e.g., a chimeric YFV) in immunogenic compositions, e.g., vaccine compositions. The compositions may be used in methods of preventing, managing, neutralizing, treating and/or ameliorating YFV infection, and/or infections by another infectious agent and/or a disease. In cases where the immunogenic formulations comprise a chimeric attenuated YFV, the

formulations may be used in methods of preventing, managing, neutralizing, treating and/or ameliorating an infection or disease associated with the chimeric antigen, i.e., a heterologous sequence engineered into the attenuated YFV, for example, an envelope protein from another flavivirus or an antigen therefrom.

[00110] In some embodiments, provided herein are methods of inducing an immune response to one or more infectious agents in a subject, the method comprising administering an effective amount of an attenuated YFV {e.g., a chimeric YFV) described herein. In a specific

embodiment, provided herein is a method of inducing an immune response to one or more infectious agents in a human, the method comprising administering an effective amount of an attenuated YFV described herein. In one embodiment, the method of inducing an immune response results in vaccination against YFV or one or more infectious agents. In one embodiment, the method of inducing an immune response results in treatment or prevention of YFV or one or more infectious agents or a disease or condition associated therewith.

[00111] In some embodiments, provided herein are methods of treating and/or preventing an infection by one or more infectious agents in a subject, the method comprising administering an effective amount of an attenuated YFV (e.g. , a chimeric YFV) described herein. In some embodiments, provided herein are methods of treating and/or preventing an infectious disease resulting from or associated with infection by one or more infectious agents in a subject, the method comprising administering an effective amount of an attenuated YFV (e.g. , a chimeric YFV) described herein. In certain embodiments, the subject is a human subject. In other embodiments, the subject is a non-human primate. In other embodiments, the subject is a non- human mammal. In yet other embodiments, the subject is an avian, insect (e.g., mosquito), or other animal. In certain embodiments, the infectious agent is one or more flaviviruses, e.g., YFV, dengue virus, Japanese encephalitis virus, or WNV. In one embodiment, the infectious agent is YFV. In one embodiment, the infectious agent is dengue virus. In another embodiment, the infectious agent is Japanese encephalitis virus. In another embodiment, the infectious agent is WNV. In certain embodiments, the one or more infectious agents are YFV and another infectious agent, such as another flavivirus, such as, e.g., dengue virus, Japanese encephalitis virus, or WNV.

[00112] In one embodiment, a composition provided herein, e.g., a pharmaceutical composition, immunogenic composition, or vaccine composition, has increased efficacy against a virus, e.g., a flavivirus such as YFV, dengue virus, Japanese encephalitis virus, or WNV, compared to a composition known in the art. In another embodiment, a vaccine provided herein provides 5 years or more, 6 years or more, 7 years or more, 8 years or more, 9 years or more, 10 years or more, 11 years or more, 12 years or more, 13 years or more, 14 years or more, or 15 years or more immunity against a flavivirus such as YFV, dengue virus, Japanese encephalitis virus, or WNV. In one embodiment, a composition provided herein, e.g., a pharmaceutical composition, immunogenic composition, or vaccine composition, has increased safety against a virus, e.g., flavivirus such as YFV, dengue virus, Japanese encephalitis virus, or WNV, compared to a composition known in the art. For example, in one embodiment, administration of a composition provided herein results in less vaccine-associated neurotropic or viscerotropic disease compared to a composition known in the art.

[00113] In another aspect, provided herein are methods of treating or preventing an interferon- sensitive disease or condition, the method comprising administering an effective amount of an attenuated YFV, or composition thereof, described herein. In specific embodiments, provided herein are methods of treating and/or preventing cancer, the method comprising administering an effective amount of an attenuated YFV, or a composition thereof. In certain embodiments, the attenuated YFV is a chimeric YFV that expresses a cancer associated antigen. Exemplary cancer associated antigens include, but are not limited to, MAGE-1, MAGE-3, BAGE, GAGE-1, GAGE-2, N-acetylglucosaminyltransferase-V, p-15, gplOO, MART- 1 /MelanA, TRP-1 (gp75), Tyrosinase, cyclin-dependent kinase 4, beta-catenin, MUM-1, CDK4, HER-2/neu, human papillomavirus-E6, human papillomavirus E7, CD20, carcinoembryonic antigen (CEA), epidermal growth factor receptor, MUC-1, caspase-8, CD5, mucin-1, Lewisx, CA-125, pl85HER2, IL-2R, Fap-alpha, tenascin, antigens associated with a metalloproteinase, and CAMPATH-1. Other cancer associated antigens are well-known to one of skill in the art.

In another aspect, provided herein are methods for inducing an immune response to a disease antigen, the methods comprising administering to a subject an effective amount of a chimeric YFV described herein. In certain embodiments, the disease antigen is a flavivirus antigen, such as, e.g., an antigen from YFV, dengue virus, Japanese encephalitis virus, or WNV. In certain embodiments, the disease antigen is a cancer-associated antigen, pathogen antigen (e.g., a bacterial, viral, parasitic, or fungal antigen), or an allergy-associated antigen..

[00114] In certain embodiments, a composition described herein, e.g., immunogenic composition or vaccine composition, does not result in complete protection from an infection {e.g., a viral infection), but results in a lower titer or reduced number of the pathogen {e.g., a virus) compared to an untreated subject. In certain embodiments, administration of an immunogenic attenuated YFV composition described herein results in a 0.5 fold, 1 fold, 2 fold, 4 fold, 6 fold, 8 fold, 10 fold, 15 fold, 20 fold, 25 fold, 50 fold, 75 fold, 100 fold, 125 fold, 150 fold, 175 fold, 200 fold, 300 fold, 400 fold, 500 fold, 750 fold, or 1,000 fold or greater reduction in titer of the pathogen relative to an untreated subject. Benefits of a reduction in the titer, number or total burden of pathogen include, but are not limited to, less severity of symptoms of the infection and a reduction in the length of the disease or condition associated with the infection.

[00115] Also provided herein are uses of the attenuated YFVs (e.g., chimeric YFVs) or compositions described herein for preventing, treating, and/or managing a symptom or disease or disorder resulting from or associated with a flavivirus infection, such as, e.g., YFV, dengue virus, Japanese encephalitis virus, or WNV. In one embodiment, provided herein is a method of preventing, treating, and/or managing a symptom or disease or disorder resulting from or associated with a flavivirus infection, such as, e.g., YFV, dengue virus, Japanese encephalitis virus, or WNV, comprising administering an effective amount of an attenuated YFV (e.g., chimeric YFV) or composition described herein. Non-limiting examples of such symptoms, diseases or disorders are jaundice, an acute febrile illness, hemorrhagic disease, bleeding (e.g., from nose or gums, petechiae, or easy bruising), low platelet count, easy bruising, internal bleeding, encephalitis, shock, rash, red spots or patches on the skin, black and/or tarry stools (feces, excrement), drowsiness or irritability, stupor, disorientation, coma, tremors, convulsions, muscle weakness, paralysis, severe rigors, malaise, neck rigidity, cachexia, hemiparesis, convulsions, mental retardation, pale, cold, or clammy skin, difficulty breathing, low white cell count, or an illness (which may be mild, severe, and/or last several days) comprising one or more of viremia, fever (e.g., high fever or low fever), chills, headache, severe eye pain (e.g., behind eyes), joint pain, muscle pain, bone pain, abdominal pain, lower back pain, nausea, dizziness, vomiting, vomiting blood, dehydration, hepatic injury (which may be severe), jaundice, kidney injury, renal failure, organ failure (e.g., multiple organ failure), and

hemorrhagic manifestations including epistaxis, petechiae, and hematemesis. In one

embodiment, administration of an attenuated YFV or composition thereof delays or prevents death resulting from a flavivirus infection.

[00116] In certain embodiments, the administration of an attenuated YFV or composition thereof ameliorates, reduces the severity, and/or prevents the onset, development or progression of one or more of the following symptoms a flaviviral disease: jaundice, an acute febrile illness, hemorrhagic disease, and encephalitis. In some embodiments, the administration of an attenuated YFV or composition thereof ameliorates, reduces the severity, and/or prevents the onset, development or progression of one or more of the following symptoms of a flaviviral disease: viremia, fever, chills, and headache occurs. In certain embodiments, the administration of an attenuated YFV or composition thereof ameliorates, reduces the severity, and/or prevents the onset, development or progression of one or more of the following symptoms a flaviviral disease: fevers, chills, headaches, lower back pain, nausea, and dizziness. In some embodiments, the administration of an attenuated YFV or composition thereof ameliorates, reduces the severity, and/or prevents the onset, development or progression of one or more of the following symptoms a flaviviral disease: high fevers, vomiting, dehydration, severe hepatic injury, jaundice, kidney injury resulting in renal failure, hemorrhagic manifestations including epistaxis, petechiae, and hematemesis, and multiple organ failure. In some embodiments, the

administration of an attenuated YFV or composition thereof prevents death of a subject.

[00117] In other embodiments, the attenuated YFVs described herein can be used to produce antibodies which can be used in diagnostic immunoassays, passive immunotherapy, and the generation of antiidiotypic antibodies. For example, an attenuated YFV described herein can be administered to a subject (e.g., a mouse, rat, pig, horse, donkey, bird, insect, non-human primate or human) to generate antibodies which can then be isolated and used in diagnostic assays, passive immunotherapy and generation of antiidiotypic antibodies. The generated antibodies may be isolated by standard techniques known in the art (e.g. , immunoaffinity chromatography, centrifugation, precipitation, etc.) and used in diagnostic immunoassays, passive immunotherapy and generation of antiidiotypic antibodies.

[00118] In certain embodiments, the antibodies isolated from subjects administered an attenuated YFV described herein are used to assess the expression of YFV proteins, the heterologous protein or proteins (e.g. , flavivirus envelope proteins) or both. Any immunoassay system known in the art may be used for this purpose including but not limited to competitive and noncompetitive assay systems using techniques such as radioimmunoassays, ELISA

(enzyme linked immunosorbent assays), "sandwich" immunoassays, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement fixation assays, immunoradiometric assays, fluorescent immunoassays, protein A immunoassays and Immunoelectrophoresis assays, to name but a few.

5.4.1. PATIENT POPULATIONS

[00119] In some embodiments, an attenuated YFV (e.g., chimeric YFV) described herein or a composition thereof, is administered to a subject infected with a flavivirus such as, e.g., YFV, dengue virus, Japanese encephalitis virus, or WNV, or a disease or condition associated therewith. In other embodiments, an attenuated YFV (e.g., chimeric YFV) described herein or a composition thereof, is administered to a subject at risk for or predisposed or susceptible to a flavivirus infection such as, e.g., YFV, dengue virus, Japanese encephalitis virus, or WNV infection, or disease or condition associated therewith. In certain embodiments, an attenuated YFV (e.g., chimeric YFV) described herein or a composition thereof, is administered to a subject who will travel to an area affected by infection with flavivirus, such as YFV, Japanese encephalitis virus, West Nile virus, and dengue virus. In some embodiments, an attenuated YFV (e.g., chimeric YFV) described herein or a composition thereof, is administered to a subject affected by or at risk for vaccine-associated neurotropic or viscerotropic disease. In some embodiments, an attenuated YFV (e.g., chimeric YFV) described herein or a composition thereof, is administered to a subject who has been previously administered a YFV vaccine or vaccine against another flavivirus.

[00120] In certain embodiments, an attenuated YFV (e.g., chimeric YFV) described herein or a composition thereof, is administered to a human that is 0 to 6 months old, 6 to 12 months old, 6 to 18 months old, 18 to 36 months old, 1 to 5 years old, 5 to 10 years old, 10 to 15 years old, 15 to 20 years old, 20 to 25 years old, 25 to 30 years old, 30 to 35 years old, 35 to 40 years old, 40 to 45 years old, 45 to 50 years old, 50 to 55 years old, 55 to 60 years old, 60 to 65 years old, 65 to 70 years old, 70 to 75 years old, 75 to 80 years old, 80 to 85 years old, 85 to 90 years old, 90 to 95 years old or 95 to 100 years old. In some embodiments, an attenuated YFV described herein or a composition thereof is administered to a human infant. In some embodiments, an attenuated YFV described herein or a composition thereof is administered to a human toddler. In some embodiments, an attenuated YFV described herein or a composition thereof is

administered to a human child. In some embodiments, an attenuated YFV described herein or a composition thereof is administered to a human adult. In some embodiments, an attenuated YFV described herein or a composition thereof is administered to an elderly human. In some embodiments, an attenuated YFV described herein or a composition thereof is administered to a pregnant subject. In some embodiments, an attenuated YFV described herein or a composition thereof is administered to a nursing subject.

[00121] In some embodiments, an attenuated YFV (e.g., chimeric YFV) described herein or a composition thereof is administered to a subject in an immunocompromised state or

immunosuppressed state or at risk for becoming immunocompromised or immunosuppressed. In some embodiments, an attenuated YFV described herein or a composition thereof is administered to a subject receiving or recovering from immunosuppressive therapy. In certain embodiments, the subject is, will or has undergone surgery, chemotherapy and/or radiation therapy. In some embodiments, an attenuated YFV described herein or a composition thereof is administered to a subject that has, will have or had a tissue transplant, organ transplant or transfusion.

[00122] In some embodiments, an attenuated YFV (e.g., chimeric YFV) described herein or a composition thereof is administered to a subject who has proven refractory to therapies other than the attenuated YFV or composition, but is no longer on these therapies. In one

embodiment, the subject has previously received a YFV vaccine (e.g., YFV-17D) or a vaccine against another flavivirus, e.g., dengue virus, Japanese encephalitis virus, or WNV. In one embodiment, the subject is administered an attenuated YFV described herein as a booster for a previously received YFV vaccine or a vaccine against another flavivirus, e.g., dengue virus, Japanese encephalitis virus, or WNV. In one embodiment, the subject is administered an attenuated YFV (e.g., chimeric YFV) described herein during or following a period of remission from a disease or disorder associated with YFV or another flavivirus, e.g., dengue virus, Japanese encephalitis virus, or WNV. In one embodiment, a subject already having antibodies or immunity against YFV or another flavivirus (e.g., dengue virus, Japanese encephalitis virus, or WNV) is administered an attenuated YFV (e.g., chimeric YFV) described herein. In certain embodiments, the subject to be treated in accordance with the methods described herein is a subject already being treated with antibiotics, anti-virals, anti-fungals, or other biological therapy/immunotherapy, for example, interferon. Among these subjects are refractory patients, and patients who are too young for conventional therapies. In some embodiments, the subject being administered an attenuated YFV (e.g., chimeric YFV) described herein or a composition thereof has not received therapy prior to the administration of the attenuated YFV or

composition. In some embodiments, attenuated YFVs or compositions are administered to a patient who is susceptible to adverse reactions to conventional therapies. In some embodiments, the subject administered an attenuated YFV described herein or a composition thereof experienced adverse side effects to a prior therapy or a prior therapy was discontinued due to unacceptable levels of toxicity to the subject. 5.4.2. DOSAGE & FREQUENCY

[00123] The amount of an attenuated YFV (e.g., chimeric YFV) or a composition thereof which will be effective will depend on the nature of the virus and or virus associated disease or condition, the route of administration, the general health of the subject, etc. and should be decided according to the judgment of a medical practitioner. Standard clinical techniques, such as in vitro assays, may optionally be employed to help identify optimal dosage ranges. For example, vaccine efficacy can be measured by quantifying the amount of neutralizing antibodies in the sera of vacinees. The standard definition of seroconversion that is used in clinical trials and by the World Health Organization (WHO) is a log 10 neutralization index (LNI, measured by a plaque reduction assay) of 0.7 or greater, as described in Monath, et al, 2002, Am J Trap Med Hyg 66: 533-541, which is incorporated by reference herein in its entirety.

[00124] In one embodiment, administration of an attenuated YFV (e.g., chimeric YFV) described herein to a subject or animal model thereof results in a serum titer of about 1 μg/ml, about 2 μg/ml, about 5 μg/ml, about 6 μg/ml, about 10 μg/ml, about 15 μg/ml, about 20 μg/ml, about 25 μg/ml, about 50 mg/ml, about 75 mg/ml, about 100 mg/ml, about 125 mg/ml, about 150 mg/ml, about 175 mg/ml, about 200 mg/ml, about 225 mg/ml, about 250 mg/ml, about 275 mg/ml, or about 300 mg/ml or more of an antibody that immunospecifically binds to an antigen of the attenuated virus. In one embodiment, administration of an attenuated chimeric YFV described herein to a subject or an animal model thereof results in a serum titer of about 1 μg/ml, about 2 μg/ml, about 5 μg/ml, about 6 μg/ml, about 10 μg/ml, about 15 μg/ml, about 20 μg/ml, about 25 μg/ml, about 50 mg/ml, about 75 mg/ml, about 100 mg/ml, about 125 mg/ml, about 150 mg/ml, about 175 mg/ml, about 200 mg/ml, about 225 mg/ml, about 250 mg/ml, about 275 mg/ml, or about 300 mg/ml or more of an antibody that immunospecifically binds to an antigen of the backbone (i.e., YFV backbone) of the chimeric virus. In other embodiments,

administration of an attenuated chimeric YFV described herein to a subject or animal model thereof results in a serum titer of about 1 μg/ml, about 2 μg/ml, about 5 μg/ml, about 6 μg/ml, about 10 μg/ml, about 15 μg/ml, about 20 μg/ml, about 25 μg/ml, about 50 mg/ml, about 75 mg/ml, about 100 mg/ml, about 125 mg/ml, about 150 mg/ml, about 175 mg/ml, about 200 mg/ml, about 225 mg/ml, about 250 mg/ml, about 275 mg/ml, or about 300 mg/ml or more of an antibody that immunospecifically binds to an antigen of the heterologous protein (e.g., flavivirus envelope protein), e.g., an antigen of the ectodomain of the introduced protein associated with an infectious agent or disease. The immune response may be determined in the subject or in a animal model, which response is then correlated or extrapolated to a predicted response in the subject, e.g., a human.

[00125] Suitable dosage ranges of attenuated YFVs {e.g., chimeric YFVs) for administration are generally about 10², 5 x 10², 10³, 5 x 10³, 10⁴, 5 x 10⁴, 10⁵, 5 x 10⁵, 10⁶, 5 x 10⁶, 10⁷, 5 x 10⁷, 10⁸, 5 x 10⁸, 1 x 10⁹, 5 x 10⁹, 1 x 10¹⁰, 5 x 10¹⁰, 1 x 10¹¹, 5 x 10¹¹ or 10¹² pfu. In one

embodiment, the dosage range is about 10⁴ to about 10¹². The dosage can be administered to a subject once, twice, three or more times with intervals as often as needed. In certain

embodiments, dosages similar to those currently being used as vaccines against YFV or other flaviviruses such as dengue virus, Japanese encephalitis virus, or WNV are administered to a subject. Effective doses may be extrapolated from dose response curves derived from in vitro or animal model test systems. For example, in one embodiment, an effective dose is determined by testing the efficacy of the attenuated YFV in protection against lethal intracerebral challenge with YFV. See, e.g., Mason, et al, 1973, Appl Microbiol 25: 539-544, incorporated herein by reference in its entirety.

[00126] An attenuated YFV {e.g., chimeric YFV) or a composition thereof described herein may be administered as a single dose or in multiple doses, e.g., 2, 3, 4, 5, or more doses. In certain embodiments, an attenuated YFV {e.g. , chimeric YFV) or a composition thereof is administered to a subject as a single dose followed by a second dose 3 to 6 weeks later. In accordance with these embodiments, booster inoculations may be administered to the subject at 6 to 12 month intervals following the second inoculation. Additional boosters may be

administered as indicated, e.g., every 5 years or more, 6 years or more, 7 years or more, 8 years or more, 9 years or more, 10 years or more, or 15 years or more. In one embodiment, the subject is a mammal. In a specific embodiment, the subject is a human.

[00127] In certain embodiments, administration of the attenuated YFV {e.g., chimeric YFV) or composition thereof may be repeated and the administrations may be separated by at least 1 day, 2 days, 3 days, 5 days, 10 days, 15 days, 21 days, 28 days, 30 days, 45 days, 2 months, 75 days, 3 months, or at least 6 months. In other embodiments, administration of the attenuated YFV or composition thereof may be repeated and the administrations may be separated by 1 to 30 days, 15 to 30 days, 15 to 45 days, 15 to 75 days, 15 to 90 days, 1 to 3 months, 3 to 6 months, 3 to 12 months, or 6 to 12 months. In some embodiments, a first attenuated YFV or composition thereof is administered to a subject followed by the administration of a second attenuated YFV or composition thereof. In certain embodiments, the first and second attenuated YFVs or compositions thereof may be separated by at least 1 day, 2 days, 3 days, 5 days, 10 days, 15 days, 21 days, 28 days, 30 days, 45 days, 2 months, 75 days, 3 months, or at least 6 months. In other embodiments, the first and second attenuated YFVs or compositions thereof may be separated by 1 to 30 days, 15 to 30 days, 15 to 45 days, 15 to 75 days, 15 to 90 days, 1 to 3 months, 3 to 6 months, 3 to 12 months, or 6 to 12 months.

5.5 BIOLOGICAL ASSAYS

5.5.1. VIRAL ASSAYS

[00128] Viral assays include those that measure altered viral replication (as determined, e.g., by plaque formation) or the production of viral proteins (as determined, e.g., by western blot analysis) or viral R As (as determined, e.g., by RT-PCR or northern blot analysis) in cultured cells in vitro using methods which are well known in the art.

[00129] Growth of the attenuated YFVs {e.g., chimeric YFVs) described herein can be assessed by any method known in the art or described herein {e.g., in cell culture {e.g., Vera cells or BHK cells), in chicken embryos, or in animals, e.g., primates). Viral titer may be determined by inoculating serial dilutions of an attenuated YFV described herein into cell cultures {e.g. , BHK cells, CEF, MDCK, EFK-2 cells, Vera cells, primary human umbilical vein endothelial cells (HUVEC), H292 human epithelial cell line or HeLa cells), chick embryos, or live animals {e.g., avians or primates). After incubation of the virus for a specified time, the virus is isolated using standard methods. Physical quantitation of the virus titer can be performed using PCR applied to viral supernatants (Quinn & Trevor, 1997; Morgan et al, 1990), tissue culture infectious doses (TCID50) or egg infectious doses (EID50). For example, flavivirus growth can be assessed using a plaque counting assay (see, e.g., Fournier-Caruana et al, 2000, Biologicals 28: 33-40; Husson van Vilet, 1990, Biologicals 18: 25-27; Jordan et al, 2000, J. Infect. Dis. 182: 1214-17; Diamond et al, 2000, J. Virol. 74: 4957-66; Vithanomsat et al, 1984, Southeast Asian J. Trap. Med. Public Health 15: 27-31, which are incorporated herein by reference) or a neutral red dye uptake assay (see, e.g., McManus, 1976, Appl. Environ. Microbiol. 31 : 35-38, incorporated herein by reference). Immuno fluorescence-based approaches may also be used to detect virus and assess viral growth. Such approaches, e.g. , fluorescence microscopy and flow cytometry, are well known to those of skill in the art.

[00130] Incorporation of a YFV protein or heterologous protein into the virion of the attenuated YFVs described herein can be assessed by any method known in the art or described herein (e.g., in cell culture (using, e.g., BHK cells), an animal model or viral culture in embryonated eggs or chicken embryos). For example, viral particles from cell culture of the allantoic fluid of embryonated eggs can be purified by centrifugation through a sucrose cushion and subsequently analyzed for fusion protein expression by Western blotting using methods well known in the art.

5.5.2. ASSAYS FOR VACCINE EFFICACY

[00131] Vaccine efficacy may be measured by quantifying the amount of neutralizing antibodies in the sera of vacinees. The standard definition of seroconversion that is used in clinical trials and by the World Health Organization (WHO) is a log 10 neutralization index (LNI, measured by a plaque reduction assay) of 0.7 or greater (Monath, et al, 2002, Am J Trap Med Hyg 66: 533-541 , incorporated by reference herein in its entirety). This dose of vaccine was shown to protect 90% of monkeys from lethal intracerebral challenge (Mason, et al., 1973, Appl Microbiol 25 : 539-544, incorporated herein by reference in its entirety).

5.5.3. ANTIBODY ASSAYS

[00132] Antibodies generated by the attenuated YFVs (e.g., chimeric YFVs) described herein may be characterized in a variety of ways well-known to one of skill in the art (e.g., ELISA, Surface Plasmon resonance display (BIAcore), Western blot, immunofluorescence,

immunostaining and/or microneutralization assays). In particular, antibodies generated by the attenuated YFVs described herein may be assayed for the ability to specifically bind to an antigen of the virus or other antigen against which the virus is directed (e.g., YFV or another flavivirus). Such an assay may be performed in solution (e.g., Houghten, 1992, Bio/Techniques 13 :412 421), on beads (Lam, 1991 , Nature 354:82 84), on chips (Fodor, 1993, Nature 364:555 556), on bacteria (U.S. Patent No. 5,223,409), on spores (U.S. Patent Nos. 5,571 ,698; 5,403,484; and 5,223,409), on plasmids (Cull et al, 1992, Proc. Natl. Acad. Sci. USA 89: 1865 1869) or on phage (Scott and Smith, 1990, Science 249:386 390; Cwirla et al, 1990, Proc. Natl. Acad. Sci. USA 87:6378 6382; and Felici, 1991, J. Mol. Biol. 222:301 310) (each of these references is incorporated herein in its entirety by reference).

[00133] Antibodies generated by the attenuated YFVs (e.g., chimeric YFVs) described herein that have been identified to specifically bind to an antigen of the virus or other antigen against which the virus is directed can be assayed for their specificity to said antigen. The antibodies may be assayed for specific binding to an antigen and for their cross-reactivity with other antigens by any method known in the art. Immunoassays which can be used to analyze specific binding and cross-reactivity include, but are not limited to, competitive and non-competitive assay systems using techniques such as western blots, radioimmunoassays, ELISA (enzyme linked immunosorbent assay), "sandwich" immunoassays, immunoprecipitation assays, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement-fixation assays, immunoradiometric assays, fluorescent immunoassays, protein A immunoassays, to name but a few. Such assays are routine and well known in the art (see, e.g., Ausubel et al, eds., 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York, which is incorporated by reference herein in its entirety).

[00134] The binding affinity of an antibody to an antigen and the off-rate of an antibody- antigen interaction can be determined by competitive binding assays. Alternatively, a surface plasmon resonance assay (e.g., BIAcore kinetic analysis) or KinExA assay (Blake, et al., Analytical Biochem., 1999, 272:123-134) may be used to determine the binding on and off rates of antibodies to an antigen of the attenuated YFVs described herein.

5.5.4. IFN ASSAYS

[00135] IFN induction and release, or induction of signaling downstream of IFN, by an attenuated YFV (e.g., chimeric YFV) described herein may be determined using techniques known to one of skill in the art or described herein. For example, the amount of IFN induced in cells following infection with an attenuated YFV described herein may be determined using an immunoassay (e.g., an ELISA or Western blot assay) to measure IFN expression or to measure the expression of a protein whose expression is induced by IFN. Alternatively, the amount of IFN induced may be measured at the RNA level by assays, such as Northern blots and quantitative RT-PCR, known to one of skill in the art. In specific embodiments, the amount of IFN released may be measured using an ELISPOT assay. Other specific assays for IFN induction by an attenuated YFV with a mutant NS5 protein described herein (e.g., as compared to an attenuated YFV without mutant NS5) may be carried out as described in Section 6 infra.

5.5.5. TOXICITY STUDIES

[00136] In some embodiments, the attenuated YFVs (e.g., chimeric YFVs) described herein or compositions thereof are tested for cytotoxicity in mammalian, preferably human, cell lines. In certain embodiments, cytotoxicity is assessed in one or more of the following non-limiting examples of cell lines: BHK, Vera, U937, a human monocyte cell line; primary peripheral blood mononuclear cells (PBMC); Huh7, a human hepatoblastoma cell line; HL60 cells, HT1080, HEK 293T and 293H, MLPC cells, human embryonic kidney cell lines; human melanoma cell lines, such as SkMel2, SkMel-119 and SkMel-197; THP-1, monocytic cells; a HeLa cell line; and neuroblastoma cells lines, such as MC-IXC, SK-N-MC, SK-N-MC, SK-N-DZ, SH-SY5Y, and BE(2)-C. In certain embodiments, cytotoxicity is assessed in chicken embryos. In certain embodiments, cytotoxicity is assessed in non-human primates. In some embodiments, the ToxLite assay is used to assess cytotoxicity.

[00137] Many assays well-known in the art can be used to assess viability of cells or cell lines following infection with an attenuated YFV (e.g., chimeric YFV) described herein or

compositions thereof and, thus, determine the cytotoxicity of an attenuated YFV or composition thereof. For example, cell proliferation can be assayed by measuring Bromodeoxyuridine (BrdU) incorporation, (³H) thymidine incorporation, by direct cell count, or by detecting changes in transcription, translation or activity of known genes such as proto-oncogenes (e.g., fos, myc) or cell cycle markers (Rb, cdc2, cyclin A, Dl, D2, D3, E, etc). The levels of such protein and mRNA and activity can be determined by any method well known in the art. For example, protein can be quantitated by known immunodiagnostic methods such as ELISA, Western blotting or immunoprecipitation using antibodies, including commercially available antibodies. mRNA can be quantitated using methods that are well known and routine in the art, for example, using northern analysis, RNase protection, or polymerase chain reaction in connection with reverse transcription. Cell viability can be assessed by using trypan-blue staining or other cell death or viability markers known in the art. In a specific embodiment, the level of cellular ATP is measured to determined cell viability. In preferred embodiments, an attenuated YFV described herein or composition thereof kills virus infected cells but does not kill uninfected cells. In one embodiment, an attenuated YFV described herein or composition thereof preferentially kills interferon-sensitive diseased cells but does not kill healthy cells.

[00138] In specific embodiments, cell viability is measured in three-day and seven-day periods using an assay standard in the art, such as the CellTiter-Glo Assay Kit (Promega) which measures levels of intracellular ATP. A reduction in cellular ATP is indicative of a cytotoxic effect. In another specific embodiment, cell viability can be measured in the neutral red uptake assay. In other embodiments, visual observation for morphological changes may include enlargement, granularity, cells with ragged edges, a filmy appearance, rounding, detachment from the surface of the well, or other changes.

[00139] The attenuated YFVs (e.g., chimeric YFVs) described herein or compositions thereof can be tested for in vivo toxicity in animal models. For example, animals are administered a range of pfu of an attenuated YFV described herein. Subsequently, the animals are monitored over time for lethality, weight loss or failure to gain weight, and/or levels of serum markers that may be indicative of tissue damage (e.g., creatine phosphokinase level as an indicator of general tissue damage, level of glutamic oxalic acid transaminase or pyruvic acid transaminase as indicators for possible liver damage). These in vivo assays may also be adapted to test the toxicity of various administration mode and/or regimen in addition to dosages.

[00140] The toxicity and/or efficacy of an attenuated YFV (e.g., chimeric YFV) described herein or a composition thereof can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Therapies that exhibits large therapeutic indices is preferred. While therapies that exhibits toxic side effects may be used, care should be taken to design a delivery system that targets such therapies to the site of affected tissue in order to minimize potential damage to noncancerous cells and, thereby, reduce side effects.

[00141] The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage of the therapies for use in subjects. The dosage of such agents lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any therapy described herein, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of attenuated YFV that achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in subjects. Levels in plasma may be measured, for example, by high performance liquid chromatography.

5.6 EXEMPLARY EMBODIMENTS

[00142] Specific exemplary embodiments follow.

[00143] 1. An attenuated yellow fever virus comprising a genome which encodes a mutated NS5 protein comprising a deletion of the first 10 amino acids or an amino acid substitution of another residue for the first N-terminal lysine residue of the NS5 protein.

[00144] 2. An attenuated chimeric yellow fever virus comprising a genome which encodes: (i) a mutated NS5 protein comprising a deletion of the first 10 amino acids or an amino acid substitution of another residue for the first N-terminal lysine residue of the NS5 protein; and (ii) a heterologous antigen.

[00145] 3. The attenuated yellow fever virus of embodiment 1, wherein the mutated NS5 protein is a mutant form of the NS5 protein of the yellow fever virus 17D.

[00146] 4. The attenuated yellow fever virus of embodiment 1, wherein the other residue that is substituted for the lysine is arginine.

[00147] 5. The attenuated yellow fever virus of embodiment 1, wherein the other residue that is substituted for the lysine is alanine.

[00148] 6. The attenuated yellow fever virus of embodiment 1, wherein the genome further encodes the structural proteins, envelope proteins, and NS1, NS2A, NS2B, NS3, NS4A and NS4B proteins of the yellow fever virus 17D.

[00149] 7. The attenuated yellow fever virus of embodiment 3, wherein the genome further encodes the structural proteins, envelope proteins, and NS1, NS2A, NS2B, NS3, NS4A and NS4B proteins of the yellow fever virus 17D.

[00150] 8. The attenuated yellow fever virus of embodiment 2, wherein the mutated NS5 protein is a mutant form of the NS5 protein of the yellow fever virus 17D.

[00151] 9. The attenuated yellow fever virus of embodiment 2, wherein the other residue that is substituted for the lysine is arginine. [00152] 10. The attenuated yellow fever virus of embodiment 2, wherein the other residue that is substituted for the lysine is alanine.

[00153] 11. The attenuated yellow fever virus of embodiment 2, wherein the genome further encodes the structural proteins, envelope proteins, and NS1, NS2A, NS2B, NS3, NS4A and NS4B proteins of the yellow fever virus 17D.

[00154] 12. The attenuated yellow fever virus of embodiment 2, 9 or 10, wherein the heterologous antigen is an antigen from a pathogen, a cancer-associated antigen, or an allergy- related antigen.

[00155] 13. The attenuated yellow fever virus of embodiment 2, 9 or 10, wherein the heterologous antigen is from a flavivirus other than yellow fever virus.

[00156] 14. The attenuated yellow fever virus of embodiment 2, 9 or 10, wherein the heterologous antigen is a viral antigen, a bacterial antigen, fungal antigen, or parasitic antigen.

[00157] 15. The attenuated yellow fever virus of embodiment 2, 9 or 10, wherein the heterologous antigen is a dengue virus antigen or an antigen derived therefrom, a West Nile virus antigen or an antigen derived therefrom, a St. Louis encephalitis or another arboviral encephalitis antigen or an antigen derived therefrom, a tick-borne encephalitis virus antigen or an antigen derived therefrom, a Rift Valley Fever virus antigen or an antigen derived therefrom, or a malarial antigen or an antigen derived therefrom.

[00158] 16. The attenuated yellow fever virus of embodiment 15, wherein the dengue virus antigen or antigen derived therefrom is the dengue virus E glycoprotein or a fragment thereof.

[00159] 17. The attenuated yellow fever virus of embodiment 15, wherein the West Nile virus antigen or antigen derived therefrom is a West Nile virus glycoprotein or fragment thereof.

[00160] 18. A mutated yellow fever virus 17D, the genome of which encodes a mutated NS5 protein comprising a deletion of the first 10 amino acids or an amino acid substitution of another residue for the lysine residue at position 6 of the NS5 protein.

[00161] 19. A mutated yellow fever virus 17D, comprising a genome which encodes a mutated NS5 protein comprising a deletion of the first 10 amino acids or an amino acid substitution of another residue for the lysine residue at position 6 of the NS5 protein, and a heterologous antigen.

[00162] 20. The mutated yellow fever virus 17D of embodiment 18, wherein the other residue that is substituted for the lysine is arginine. [00163] 21. The mutated yellow fever virus 17D of embodiment 18, wherein the other residue that is substituted for the lysine is alanine.

[00164] 22. The mutated yellow fever virus 17D of embodiment 19, wherein the other residue that is substituted for the lysine is arginine.

[00165] 23. The mutated yellow fever virus 17D of embodiment 19, wherein the other residue that is substituted for the lysine is alanine.

[00166] 24. The mutated yellow fever virus of embodiment 19, 22 or 23, wherein the heterologous antigen is an antigen from a pathogen, a cancer-associated antigen, or an allergy- related antigen.

[00167] 25. The mutated yellow fever virus of embodiment 19, 22 or 23, wherein the heterologous antigen is from a flavivirus other than yellow fever virus.

[00168] 26. The mutated yellow fever virus of embodiment 19, 22 or 23, wherein the heterologous antigen is a viral antigen, a bacterial antigen, fungal antigen, or parasitic antigen.

[00169] 27. The mutated yellow fever virus of embodiment 19, 22 or 23, wherein the heterologous antigen is a dengue virus antigen or an antigen derived therefrom, a West Nile virus antigen or an antigen derived therefrom, a St. Louis encephalitis antigen or another arboviral encephalitis or an antigen derived therefrom, a tick-borne encephalitis virus antigen or an antigen derived therefrom, a Rift Valley Fever virus antigen or an antigen derived therefrom, or a malarial antigen or an antigen derived therefrom.

[00170] 28. The mutated yellow fever virus of embodiment 27, wherein the dengue virus antigen or fragment antigen derived therefrom is the dengue virus E glycoprotein or a fragment thereof.

[00171] 29. The mutated yellow fever virus of embodiment 27, wherein the West Nile virus antigen or antigen derived therefrom is a West Nile virus glycoprotein or fragment thereof.

[00172] 30. The mutated yellow fever virus of any one of embodiments 19 or 22 to 29, wherein the heterologous antigen is inserted within an intergenic region or in place of deleted capsid sequences.

[00173] 31. The attenuated chimeric yellow fever virus of embodiment 2 or 8 to 17, wherein the heterologous antigen is inserted within an intergenic region or in place of deleted capsid sequences. [00174] 32. A vaccine formulation comprising the attenuated yellow fever virus of any one of embodiments 1 or 3 to 6, and a physiological excipient.

[00175] 33. A vaccine formulation comprising the attenuated yellow fever virus of any one of embodiments 2 or 7 to 17 or 31, and a physiological excipient.

[00176] 34. A vaccine formulation comprising the mutated yellow fever virus of embodiment 18, 20 or 21, and a physiological excipient.

[00177] 35. A vaccine formulation comprising the mutated yellow fever virus of any one of embodiments 19 or 22 to 30, and a physiological excipient.

[00178] 36. An interferon-deficient substrate comprising the attenuated yellow fever virus of any one of embodiments 1 or 3 to 6.

[00179] 37. An interferon-deficient substrate comprising the attenuated yellow fever virus of any one of embodiments 2, 7 to 17 or 31.

[00180] 38. An interferon-deficient substrate comprising the mutated yellow fever virus of embodiment 18, 20 or 21.

[00181] 39. An interferon-deficient substrate comprising the mutated yellow fever virus of any one of embodiments 19 or 22 to 30.

[00182] 40. The interferon-deficient substrate of embodiment 36, 37, 38 or 39 which is an embryonated egg less than 10 days old.

[00183] 41. The interferon-deficient substrate of embodiment 36, 37, 38 or 39 which is an embryonated egg 6 to 9 days old.

[00184] 42. The interferon-deficient substrate of embodiment 40 or 41, wherein the embryonated egg is a chick egg.

[00185] 43. The interferon-deficient substrate of embodiment 36, 37, 38 or 39 which is a cell.

[00186] 44. The interferon-deficient substrate of embodiment 43, wherein the cell is a Vera cell.

[00187] 45. The interferon-deficient substrate of embodiment 36, 37, 38 or 39 which is an insect cell.

[00188] 46. A method for vaccine production, comprising:

(a) propagating in an interferon-deficient substrate the virus of any one of embodiments 38 to 45; and

(b) collecting the progeny virus, wherein the virus is grown to sufficient titers and under conditions that are free from contamination, such that the progeny virus is suitable for formulation into a vaccine.

[00189] 47. A method for immunizing a subject against yellow fever virus, comprising administering the vaccine of any one of embodiments 32 to 35 to the subject.

[00190] 48. A method for preventing yellow fever virus disease, comprising administering the vaccine of any one of embodiments 32 to 35 to a subject in need thereof.

[00191] 49. A method for immunizing a subject against heterologous antigen, comprising administering the vaccine of embodiment 33 or 35 to the subject.

[00192] 50. The method of any one of embodiments 47 to 49, wherein the subject is a human subject.

[00193] 51. The method of any one of embodiments 47 to 49, wherein the subject is a mosquito.

[00194] 52. An attenuated yellow fever virus comprising a genome which encodes a mutated NS5 protein comprising a substitution of one, two, three or more of the first 10 N-terminal amino acids of the NS5 protein, wherein the substitution eliminates all lysine residues found in the first N-terminal amino acids of the NS5 protein.

[00195] 53. A mutated yellow fever virus 17D comprising a genome which encodes a mutated NS5 protein comprising a substitution of one, two, three or more of the first 10 N-terminal amino acids of the NS5 protein, wherein the substitution eliminates all lysine residues found in the first N-terminal amino acids of the NS5 protein.

6. EXAMPLE

6.1 MATERIALS & METHODS

[00196] Cells and Viruses. 293T cells, Vero cells and HeLa cells were cultured in

Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum (FCS). 2fTGH and 2fTGH derivatives were kindly provided by Dr. George Stark and were described previously (Leung et al, 1995; Pellegrini and Schindler, 1993): U6A cells, STAT2-deficient 2fTGH derivatives, were cultured in DMEM supplemented with 10% FCS. A previously described recombinant Newcastle Disease Virus expressing GFP (NDV-GFP) was grown in 10- day-old embryonated chicken eggs (Park et al., 2003). High titer stocks of DENY -2 (DENV-2 16681) were obtained by passage in C6/36 cells (Diamond et al, 2000). High titer stocks of YFV-17D strain were obtained by passage in BHK-21 cells. The YFV17D K6R mutant virus was made by PCR mutagenesis of a YFV-17D cDNA clone, pACNR-YF17D, kindly provided by Dr. Charles Rice (Bredenbeek et al, 2003; Lindenbach and Rice, 1999) using the following primers:

Reverse primer: GACTTCACCCAAAGTTCGTCCATTCGCGC

Forward primer: GCGCGAATGGACGAACTTTGGGTGAAGTC

The mutant virus and wildtype control virus were rescued by linearizing the cDNA clone with Xhol, and using the SP6 Cap-Scribe kit™ (Roche, Germany) to generate RNA. mRNA was transfected into BHK-21 cells using the Transit® mRNA transfection kit (Mirus Bio, USA), and virus was harvested 3 days later.

[00197] Plasmids. All flavivirus genes were cloned in the mammalian expression vector, pCAGGS (chicken-b actin promoter). LGTV NS5 was a kind gift from Dr. Sonja M. Best (Best et al, 2005). Primer sequences used in the generation of the constructs are

Forward primer: ATTAggggtaccTGCATGgggagcgcgaatggaaaaactttgg

Reverse primer: ATTAGGTACCccgataagctcacccggttgcaggtcagc

HA-NiV V plasmid was a kind gift from Dr. Megan Shaw. pCAGGS-Firefly luciferase and ISRE-54-CAT reporter plasmids were kind gifts from Dr. Luis Martinez-Sobrido. HA-ubiquitin expressing plasmids were obtained from Dr. Gijs Versteeg. Mouse STAT2 was kindly provided by Dr. David Levy.

[00198] Virus infections. For virus infections, monolayers of cells were initially adsorbed with virus (YFV-17D or DENV-2 16681) at the indicated multiplicity of infection (MOI) for 1 hour at room temperature. After adsorption, unbound virus was removed from cells by washing and subsequently maintained in DMEM 10% FBS at 37°C. Confirmation of virus infection was assessed by an immunofluorescence assay using virus-specific antibodies: anti-DENV-2 E protein and anti-YFV E protein. For the YFV-17D K6R versus WT growth curves, Vero cells were adsorbed with virus at an MOI of 10 for 1 hour at 37°C. After adsorption, unbound virus was removed from cells and subsequently maintained in DMEM 10% FBS at 37°C. Viral replication was measured by plaque assay on BHK-21 cells.

[00199] Transfections. All transfections were performed using Lipofectamine™ 2000 (Invitrogen, USA) in Opti-MEM® (Invitrogen). 293T cells were transfected using a 1 : 1 ratio of plasmid DNA to Lipofectamine 2000 (lug DNA: lul Lipofectamine 2000). Vero cells were transfected using a 1 :2 ratio. 2fTGH and 2fTGH derivatives were transfected using a 1 :3 ratio.

[00200] Antibodies and Cytokines. The following antibodies were utilized in this study; mouse monoclonal anti-lamin A (Abeam), rabbit polyclonal anti-STATl (BD Biosciences, USA), anti-STAT2 (Santa Cruz Biotechnology, USA), antiphospho-STATl (Tyr 701) (Cell Signaling Technology, USA), antiphospho-STAT2 (Tyr 689) (Upstate Biotechnology, USA), anti-HA (Sigma-Aldrich, USA), anti-FLAG (Sigma-Aldrich, USA), anti-GFP (Sigma-Aldrich, USA), anti-tubulin (Sigma-Aldrich, USA), anti-actin (Sigma-Aldrich, USA), anti-ubiquitin (Enzo Life Sciences, USA), anti-YFV E (Santa Cruz Biotechnology, USA), anti-DENV-2 E (Hybridoma Facility of Mount Sinai School of Medicine, New York, USA). Rabbit antibody raised against DENV-2 NS5 was previously reported (Ashour et al, 2009). Anti-YFV NS5 antibody (YF17D NS5 C7 ) was kindly provided by Dr. Charles Rice (Chambers et al, 1990b). Universal type I IFN, human IFN-β and human IFN-γ (PBL Interferon Source, USA) were used at 1000 U/ml unless otherwise specified.

[00201] Reporter Gene Assays. 1 x 10⁵ 293T cells were cotransfected with 220 ng of HA- tagged plasmids encoding various viral proteins, 250 ng of the IFN-inducible chloramphenicol acetyltransferase (CAT) reporter (ISG54-CAT) and 50 ng of a plasmid constitutively expressing the firefly luciferase protein. 24 hours post transfection, cells were treated with 1000 U/ml of human IFN-β (PBL Interferon Source, USA). 16 hours post treatment cells were lysed and measured for luciferase and CAT activity. A Phosphorlmager was used to quantify CAT activity and was normalized to firefly luciferase activity. The fold induction of each sample was then calculated as the CAT activity of the IFN-treated sample normalized to the firefly luciferase value of that sample. That value was then divided by the normalized value of the untreated empty vector transfected cells. Alternatively, 293T cells were cotransfected with 250ng of an IFN-inducible firefly luciferase reporter plasmid (pISG54-luc) or (pGAS-luc) and 50ng of a constitutive Renilla luciferase plasmid. At 24 hours post transfection cells were either transfected with plasmids as described or infected with YFV-17D or DENV-2. 24 hpi, cells were treated with the appropriate cytokines. Following 10 hrs of treatment with cytokine, cells were lysed and measured for dual luciferase activities according to manufacturer's instructions (Promega Corporation, USA). [00202] NDV-GFP Bioassay. Vero cells were transfected with an empty HA vector or with plasmids encoding various HA-tagged viral proteins. Alternatively, Vero cells were mock infected or infected with YFV-17D. 24 hours post transfection, cells were treated with the appropriate cytokine. 24 hours post-treatment, cells were infected with NDV-GFP. Fluorescence images were obtained 14 hours post infection (Park et al., 2003).

[00203] Electrophoretic Mobility Shift Assays. Binding assays were performed with extracts obtained following lysis of mock-, YFV-17D- or DENV-2-infected Vero cells in buffer containing 50mM Tris (pH 8.0), 280 mM NaCl, 0.2mM EDTA, 0.5% NP-40, 10% glycerol, ImM sodium orthovanadate and a protease inhibitor mixture (Complete; Roche Diagnostics, Germany). Cells were incubated for 15 minutes at 4°C and centrifuged at 15K for 20 minutes. Supernatant was quantified by Bradford assay (BioRad Life Sciences, USA) as per the manufacturer's instructions. Ten micrograms of whole cell extracts were incubated in a total volume of 15 μΕ with buffer containing 50 mM HEPES (pH 7.9), 10% glycerol, 200 mM KCl, 5 mM EDTA (pH 8), 1 mM MgCl₂, 5 mM DTT, and 1 μg of poly (deoxyinosine-deoxycytidylic) acid sodium salt (Sigma-Aldrich, USA) to eliminate non-specific binding. Samples were incubated on ice for 10 min, followed by the addition of 150,000 CPU of ³²P-labeled DNA probe and 20 min of incubation at room temperature. For samples super- shifted with either STAT1 or control IgG, extracts were incubated with 1 ug of antibody (Santa-Cruz Biotechnology, USA) for an additional 10 min. Oligonucleotide probes corresponding to the ISREs of ISG15 and OAS were annealed to their complementary oligonucleotides using annealing buffer containing 100 mM NaCl and 50 mM HEPES (pH 7.6). Forward probe sequences were:

Oaslb ISRE: TTCCCGGGAAATGGAAACTGAAAGTCCCAT

ISG15 ISRE: GATCGGAAAGGGAAACCGAAACTGAAGCC

[00204] T4 PNK (New England Biolabs Incorporated, USA) was used to end label annealed probes with γ3₂ΑΤΡ. Samples were electrophoresed at 180 V in 0.5% Tris Borate-EDTA buffer on a 5% native polyacrylamide gel composed of 49: 1 acrylamide to bis-acrylamide. Gels were dried on Whatman paper at 80°C for 1 h and exposed by autoradiogram.

[00205] Immunofluorescence. To analyze the intracellular localization of endogenous STAT2 and phospho-STATl, Vero cells that had been grown on glass cover slips were mock infected or infected with YFV-17D (MOI 1). After 24 hpi, cells were mock stimulated or stimulated with 1000 U/ml IFN-β for 30 mins. Cells were fixed and permeabilized for 30 mins with ice cold methanol acetone (1 : 1, vol/vol) and 0.5% NP-40, and washed with PBS. Following PBS washes, cells were blocked in blocking buffer (lg cold waterfish gelatin (Sigma- Aldrich, USA) and 2.5g BSA in 500ml IX PBS) for 1 hr at RT, and stained with primary antibodies (anti- phospho-STATl at a 1 : 100 dilution, anti-STAT2 at a 1 : 1000 dilution and anti-YFV E protein at 1 :200 dilution) overnight at 4°C. The cells were washed in PBS and incubated with secondary antibodies to Alexa Fluor 488 and Alexa Fluor 555 (Invitrogen, USA) at 1 :500 dilution in blocking buffer for 1 hr at RT. Nuclear chromatin staining was performed by incubation in blocking solution containing 0.5mg/ml 4',6-diamidino-2-phenylindole, DAPI (Sigma-Aldrich). Cells were washed and covers lips mounted using Prolong antifade reagent (Invitrogen). Images were captured using a Leica SP5-DM confocal microscope at the Microscopy Shared Research Facility at Mount Sinai School of Medicine.

[00206] Immunoprecipitation and Immunoblot Analysis. 1 x 10⁶ indicated cells were transiently transfected with a total of 2 μg of various plasmids using Lipofectamine® 2000. 24 hours after transfection, the cells were mock stimulated or stimulated with 1000 U/ml IFN for 45 mins. Stringent lysis and washes were performed using buffer containing 50mM Tris (pH 8.0), 280 mM NaCl, 0.2mM EDTA, 0.5% NP-40, 10% glycerol, ImM sodium orthovanadate and a protease inhibitor mixture (Complete; Roche Diagnostics, Germany) at 4°C. A less stringent lysis buffer differed from the above buffer by use of 30%> glycerol instead of 10%>. Whole cell lysates were used for immunoprecipitation with the indicated antibodies. In general, 1-2 μg of antibody was added to 1ml of cell lysate and incubated overnight at 4°C followed by incubation with protein A/G agarose beads for 2 hours. Immunoprecipitates were washed extensively and eluted from the beads by boiling with Laemmli sample buffer, separated on a polyacrylamide gel and transferred onto a polyvinylidene difluoride (PVDF) membrane. Membranes were blocked for 1 hour at room temperature (RT) in Tris-buffered saline (TBS) containing 0.5% Tween 20 and either 5% nonfat milk or 5% BSA and then incubated overnight at 4°C in this buffer containing the appropriate primary antibody. Membranes were washed, incubated with horseradish peroxidase-conjugated secondary antibody for 1 hr at RT, washed 3 times and finally developed with ECL (Amersham Biosciences, USA).

[00207] Subcellular Fractionation. HeLa cells were mock infected or infected with YFV- 17D strain (MOI 10). At 24 hpi, cells were mock stimulated or stimulated with 1000 U/ml IFN-β followed by fractionation of the cytoplasm and nucleus using a Nuclear/Cytosol Fractionation kit (Bio Vision, Mountain View, Calif.) according to the manufacturers' instructions. 10 μΐ of each of the extracts were subjected to electrophoresis on a polyacrylamide gel followed by western blotting using appropriate antibodies. Endogenous β-tubulin and lamin A were detected as controls for the cytoplasmic and nuclear fractions respectively.

6.2 RESULTS

YFV antagonizes type I inter fer on-stimulated gene expression

[00208] Several studies have shown that a number of flaviviruses counteract the IFN-induced signaling cascade by targeting different components of the pathway (Ashour et al, 2009; Best et al, 2005; Jones et al, 2005; Laurent-Rolle et al, 2010; Lin et al., 2006; Liu et al, 2005; Werme et al., 2008). Firefly-luciferase expression from IFN-responsive promoters was examined in YFV-17D-infected 293T cells to assess the effect of YFV on IFN-stimulated JAK/STAT pathways (Figure 1A, IB). YFV-17D infection resulted in a 5-fold reduction in ISRE activity compared to uninfected cells treated with IFN-I (Figure 1 A), but did not result in a reduction in type-II-IFN-stimulated GAS activity (Figure IB). Similar results were observed with DENV-2, which has previously been shown to specifically inhibit type I IFN signaling (Ashour et al, 2009; Jones et al, 2005).

[00209] The ability of YFV-17D to promote viral replication in the presence of IFN-I was analyzed to confirm the inhibitory properties of YFV (Figure 1C, ID). Infection of IFN-I-treated Vera cells (which do not produce IFN but respond to exogenous IFN) with a virus encoding an IFN antagonist protein promotes replication of Newcastle disease virus (NDV), an IFN-sensitive virus (Park et al., 2003). When YFV- 17D -infected cells were treated with IFN-β, a recombinant NDV encoding GFP (NDV-GFP) was able to replicate and produce green fluorescence (Figure 1C). By contrast, mock-infected cells treated with IFN-β were unable to support NDV-GFP replication, as evidenced by a lack of GFP expression. However, the antiviral activity of type II IFN prevented NDV-GFP replication in cells that were infected with YFV-17D indicating that YFV does not block type II IFN activity (Figure ID). These results are consistent with the luciferase reporter gene expression data and provide further evidence that YFV-17D inhibits type I but not type II IFN signaling. YFV does not inhibit the expression, IFN-induced phosphorylation or nuclear translocation of STATl and STAT2

[00210] A variety of published reports have shown that different flaviviruses target specific

IFN-I signaling components; e.g. WNV inhibits IFN-I-induced tyrosine phosphorylation of STATl (Guo et al, 2005; Laurent-Rolle et al, 2010; Liu et al, 2005), while DENV-2 reduces STAT2 levels (Ashour et al, 2009; Jones et al, 2005). The effects of YFV on the IFN-I signaling pathway were studied by analyzing the expression and phosphorylation of STATl and STAT2 in response to IFN-I (Figure 2 A, 2B). DENV-2 was used as a positive control for STAT2 inhibition (Ashour et al., 2009; Jones et al., 2005). Immunoblot analysis of Vero cells infected with YFV-17D revealed that the steady- state protein levels of STATl and STAT2 were unaffected by infection with YFV-17D. As expected, the steady state protein levels of STAT2 were reduced by infection with DENV-2. Immunob lotting with phosphotyrosine-specific antibodies showed that the IFN-induced tyrosine phosphorylaton of STATl and STAT2 were unaffected by YFV-17D infection (Figure 2A, 2B). Immunofluorescence analysis in Vero cells (Figure 2C and supplementary figure SI A), as well as cell fractionation studies in HeLa cells (Figure 2D), revealed that IFN-I-induced nuclear translocation of STATl and STAT2 was unaffected in YFV-17D-infected cells. This suggests that the virus interferes with IFN-I signaling at a step after tyrosine phosphorylation and nuclear translocation of the STATs.

YFV suppresses binding of the ISGF3 complex atlSRE

[00211] The results suggest that YFV inhibits IFN-I signaling following ISGF3 activation and nuclear translocation. Electrophoretic mobility shift assays (EMSA) were carried out on lysates from infected cells to determine the effect of YFV on ISGF3 assembly on two canonical ISREs (Figure 2E). The ISGF3 complex failed to bind to ISREs derived from the promoters of Oaslb and ISG15 in extracts from YFV-17D-infected Vero cells. Similar results were observed with the positive control, DENV-2, which reduced STAT2 levels and prevented the ISGF3 complex from assembling. Antibodies against STATl disrupted DNA-protein complex formation, confirming the identity of the complex as ISGF3 (Supplementary figure SIB).

[00212] To further corroborate the results of the EMSA study, protein levels of endogenous ISGs such as RIG-I and IFIT-2 were analyzed in IFN-I-treated YFV-17D-infected cells (Figure 2F). Immunoblot analysis revealed that RIG-I and IFIT-2 levels were decreased in YFV-17D- and DENV-2-infected cells when compared to mock-infected cells. Together these results demonstrate that YFV inhibits IFN-I signaling downstream of STAT tyrosine phosphorylation and translocation, but upstream of ISGF3 binding.

YFVNS5 inhibits IFN-I signaling

[00213] Activation of the ISG54 promoter after stimulation with exogenous IFN-β was examined to test the potential of YFV NS5 (from the YFV Asibi strain) to function as an IFN-I - signaling antagonist (Figure 3A). Expression of YFV NS5 reduced IFN-mediated

chloramphenicol acetyl transferase (CAT) expression from an ISRE-54-CAT reporter plasmid comparable to the positive controls, Nipah virus (NiV) V, DENV-2 NS5 and WNV NS5 (Ashour et al, 2009; Laurent-Rolle et al, 2010; Mazzon et al, 2009; Park et al, 2003; Rodriguez et al, 2002) suggesting that YFV NS5 protein interferes with IFN-I-signaling (Figure 3A). An empty plasmid or a plasmid expressing DENV-2 Core did not inhibit CAT expression (Figure 3A).

YFVNS5 interacts with STAT2 in the presence of type I and type III interferon

[00214] YFV antagonizes IFN-I signaling but not IFN-II signaling suggesting that the virus targets a molecule such as Tyk2, STAT2 or IRF9, that is specific for the type I IFN pathway. Next, whether YFV NS5, like DENV-2 NS5, interacts with STAT2 (Ashour et al, 2009; Mazzon et al., 2009) was examined. Immunoprecipitation experiments were performed in 293T cells expressing YFV NS5, empty plasmid, or DENV-2 NS5, as a positive control for STAT2 binding. When YFV NS5 was precipitated from cells, it did not associate with endogenous STAT1 or STAT2. In contrast, STAT2 bound DENV-2 NS5 consistent with published reports (Ashour et al, 2009; Mazzon et al, 2009) (Figure 3B). In contrast, when YFV NS5 was precipitated from IFN-I-treated cells, STAT2 and STAT1 were bound to the protein (Figure 3B). Since IFN-I induces STAT 1/2 heterodimerization, it was unclear from this experiment whether the primary target for YFV NS5 is STAT1 or STAT2. Thus co-immunoprecipitation experiments were performed using more stringent wash conditions and determined that YFV NS5 interacted with STAT2, suggesting STAT1 association was indirect (Figure 3C). This indicates that YFV NS5 strongly interacts with STAT2 whereas STAT1 binding occurs by means of IFN-I-induced STAT 1/2 dimerization. Further evidence for this IFN-induced interaction of YFV NS5 and STATs was obtained by reversing the immunoprecipitation strategy. When endogenous STAT2 was precipitated from mock-treated cells expressing YFV NS5, no YFV NS5 was found bound to STAT2, but when STAT2 was precipitated from IFN-I-treated cells, YFV NS5 was bound to STAT2 confirming that YFV NS5 interacts with STAT2 in an IFN-I-dependent manner (Figure 3D).

[00215] To test if the YFV NS5/STAT2 interaction could also be stimulated by type II and type III IFN, immunoprecipitation experiments were carried out in cells treated with IFN-I, IFN- II (IFN-γ) or IFN-III (IFN-λ). YFV NS5 associated with endogenous STAT2 when cells were stimulated with type I or type III IFN (Figure 3E). However, YFV NS5 was unable to interact with STAT2 in cells stimulated with IFN-II indicating that this interaction was type I- or type III- IFN dependent (Figure 3E). The NS5 proteins of YFV-Asibi and YFV-17D differ by three amino acids (dos Santos et al, 1995). Since YFV-17D virus inhibits type I IFN signaling, it was confirmed that YFV-17D NS5 recapitulated this phenotype. Both YFV-17D NS5 and YFV NS5 (Asibi) bind STAT2 in an IFN-dependent manner (Figure 9).

Activation of YFV NS 5 by IFN-I is essential for its interaction with STAT2

[00216] IFN-I activates STAT2 by inducing posttranslational modifications such as phosphorylation. Thus, the IFN-mediated interaction of YFV NS5 and STAT2 might be due to specific binding of YFV NS5 to phosphorylated STAT2. On the other hand, it might also be possible that IFN activates YFV NS5 allowing its interaction with STAT2. To distinguish between the two possibilities, a series of experiments depicted in Figure 4A and 4B were conducted. U6A cells, which are a STAT2-deficient line (Leung et al, 1995), were transfected with a construct expressing HA-tagged YFV NS5. After 24 hours, the cells were either mock- stimulated or stimulated with IFN-I. U6A cell lysates were subjected to immunoprecipitation using anti-HA beads to precipitate the NS5 protein. The beads were washed then treated with lysates from IFN-I-treated 2fTGH cells, the parental, STAT2 proficient, line for U6A cells. YFV NS5 interacted with STAT2 only when YFV NS5 had been precipitated from IFN-treated U6A cells, regardless of whether STAT2 came from IFN-treated cells (Figure 4A). To further demonstrate that the IFN-induced YFV NS5-STAT2 interaction was independent of STAT2 modification, U6A cells expressing HA-tagged YFV NS5 were either mock-stimulated or stimulated with IFN-I. The immunoprecipitated NS5 protein was then incubated with lysates from unstimulated 2fTGH cells. YFV NS5 interacted with STAT2 only when YFV NS5 had been precipitated from IFN-treated U6A cells (Figure 4B). This suggests that treatment with IFN leads to a change in the status of the YFV NS5 protein which renders it capable of binding to STAT2, regardless of the STAT2 phosphorylation status (Figure 4A, 4B). Furthermore, this IFN- mediated activation of YFV NS5 is STAT2-independent as YFV NS5 was purified from IFN-I- treated STAT2-deficient cells.

[00217] To further demonstrate that the STAT2/NS5 interaction was independent of STAT2 phosphorylation, coimmunoprecipitation was performed on lysates from U6A cells transfected with YFV NS5 along with WT STAT2 or STAT2 mutants that were incapable of IFN-induced phoshorylation (STAT2 Y690F) or dimerization (STAT2 R601K) (Leung et al, 1995; Qureshi et al, 1996). YFV NS5 associated with WT STAT2-FLAG and also bound the two STAT2 mutants from IFN-I-treated cells supporting the hypothesis that IFN-I-mediated STAT2 modification is not required for this interaction (Figure 4C).

The N-terminus of YFVNS5 is required for IFN-I signaling antagonism

[00218] To identify domains within the YFV NS5 required for IFN-I signaling inhibition, N- terminally truncated, C-terminally HA-tagged YFV NS5 expression constructs were generated (Figure 5A). The ability of these YFV NS5 mutant proteins to bind STAT2 was tested in coimmunoprecipitation assays (Figure 5B). Full-length YFV NS5 protein associated with endogenous STAT2 protein when cells were treated with IFN-I for 45 minutes while all N- terminal truncation mutants tested were unable to associate with STAT2. Removal of even the first ten amino acids of YFV NS5 resulted in a loss of IFN-I-stimulated STAT2 association (Figure 5B).

[00219] The first ten amino acids of YFV NS5 were substituted with the first 10 or 11 amino acids of three different flaviviruses, WNV, DENV-2 and Modoc virus (MODV) (Figure 5C). These chimeric proteins were tested for their ability to inhibit the IFN-I-signaling cascade using co-immunoprecipitation assays (Figure 5D), an NDV-GFP complementation assay (Figure 5E), and reporter gene assays (Figure 5F). The WT YFV NS5 protein associated with STAT2 upon IFN-I stimulation and reduced luciferase expression driven by the ISRE promoter (Figures 5D and 5E). Furthermore, the WT YFV NS5 protein rescued NDV-GFP replication in Vero cells treated with IFN-I (Figure 5F). However, the only chimeric protein that was able to inhibit IFN-I signaling was the one generated by substituting the first ten amino acids of YFV NS5 with the first 10 amino acids of WNV NS5 (WNV-YFV NS5) (Figures 5C-F). Although this chimeric protein had a slightly reduced ability to interact with STAT2 compared to the WT YFV NS5 protein (Figure 5D), it maintained the IFN-I signaling inhibitory properties (Figures 5E and 5F). Both the DENV-2-YFV NS5 chimera and the MOD V- YFV NS5 chimera were unable to associate with STAT2 and inhibit IFN-I signaling (Figures 5C-F). Close examination of the first ten amino acids of YFV NS5 and those NS5 proteins of the flaviviruses used to create the chimeras revealed a lysine (K) residue at position 6 of YFV NS5 and position 4 of WNV NS5 which could have accounted for the ability of YFV NS5 to interact with STAT2.

A single lysine residue at position 6 of YFVNS5 is critical for its interferon antagonist function

[00220] To explore the significance of lysine 6 in the IFN-I-signaling antagonist function of YFV NS5, this residue was mutated to an arginine (YFV NS5 K6R) (Figure 6A). This substitution abolished the ability of YFV NS5 to associate with STAT2 in IFN-I-stimulated cells (Figure 6B). Furthermore, this mutant protein was unable to reduce IFN-I-induced lucif erase expression driven by an ISRE promoter (Figure 6C). To further dissect the contribution of this lysine in IFN-I-mediated NS5-STAT2 interaction, the YFV NS5 chimera containing the first 11 amino acids of the MODV NS5 (MOD V- YFV NS5) was utilized. This MOD V- YFV NS5 chimeric protein is unable to associate with STAT2 or inhibit IFN-I signaling. The first seven amino acids of MODV NS5 are highly dissimilar to those of YFV NS5. Substitution of the proline residue (P) at position 7 of the first 11 amino acids of the MODV- YFV NS5 chimeric protein with a K residue (MODV- YFV NS5 P7K) (Figure 6A) rescued the ability of MOD V- YFV NS5 to associate with STAT2 and to inhibit IFN-induced luciferase expression driven by the ISRE promoter (Figure 6B, 6C). Taken together, these results indicate that K6 of YFV NS5 is critical for IFN-I-mediated NS5-STAT2 interaction and inhibition of IFN-I signaling.

[00221] To test the importance of K6 in viral replication, the K6R mutation was introduced into YFV-17D. When this virus (YFV-17D K6R) was used to infect mock-treated Vero cells, it replicated to similar levels as the wild type virus (YFV-17D WT) (Figure 6D). However, when the cells were treated with IFN at 8 hours post infection, the K6R mutant exhibited reduced replication while replication of the WT virus was unaffected. The K6R mutant replicated to titers that were approximately one log less than wildtype in IFN-treated cells (Figure 6D).

K63-linked ubiquitination promotes YFVNS5 interaction with STAT2

[00222] Lysine residues are critical for the posttranslational modification of proteins through the conjugation of ubiquitin (ubiquitination), small ubiquitin-like modifier (SUMO)

(SUMOylation), Nedd8 (NEDDylation) and interferon-stimulated gene- 15 (ISG15) (ISGylation) (Chen and Gerlier, 2006; Hemelaar et al, 2004). To determine if the K6 residue of YFV NS5 was being ubiquitinated, NS5 and its K6R mutant were examined by western blot using a ubiquitin-specific antibody. To that end, 293T cells were cotransfected with an empty plasmid, or plasmids expressing YFV NS5 wild type and mutant proteins. Immunoprecipitated wildtype YFV NS5 reacted with a ubiquitin-specific antibody before and after IFN-I treatment, but neither the YFV NS5 K6R mutant nor MODV-YFV NS5 associated with ubiquitin (Figure 7A). When the proline to lysine mutant of MODV-YFV NS5 (MODV-YFV NS5 P7K) was precipitated, it also reacted with the ubiquitin antibody (Figure 7A). Thus, the presence of a lysine residue in the first 10 amino acids of the protein is required for YFV NS5 to interact with STAT2 and also to interact with ubiquitin most likely by becoming ubiquitinated (Figure 7A).

[00223] YFV NS5 strongly co-precipitated with an overexpressed FJA-tagged wild-type ubiquitin or a K48R ubiquitin mutant, whereas YFV NS5 was not precipitated by a K63R ubiquitin mutant (Figure 7B). Upon IFN-I treatment, HA-tagged wild-type and K48R but not K63R ubiquitin co-immunoprecipitated both NS5 and STAT2. These results indicate that ubiquitination of YFV NS5 (or a cellular interactor of YFV NS5) occurs via K63-linked ubiquitination, and that K63 -linked ubiquitination is necessary (but not sufficient) for the interaction of YFV NS5 and STAT2.

6.3 DISCUSSION

[00224] The results described herein demonstrate that YFV and its NS5 protein inhibit the cell's antiviral response. IFN-I treatment activates YFV NS5 to bind STAT2 and to inhibit ISGF3 signaling. This is the first example of a viral IFN antagonist becoming activated by IFN-I. IFN-I signaling inhibition occurs at an intranuclear step since STAT protein expression, IFN- induced phophorylation and nuclear translocation are unaffected in cells infected with YFV-17D. YFV-17D efficiently inhibits ISGF3 DNA binding and induction of ISGs in response to IFN. Expression of NS5 from either YFV-17D or YFV-Asibi recapitulates the phenotype of the YFV- 17D strain, inhibiting IFN-I signaling and preventing the induction of ISGs in response to IFN-I. YFV NS5 exhibits functional similarities to DENV-2 NS5, however DENV-2 NS5 binds STAT2 regardless of IFN-I treatment and targets it for proteasome-mediated degradation (Ashour et al., 2009). YFV NS5, on the other hand, binds STAT2 only after IFN-I or IFN-III treatment and appears to inactivate the ISGF3 complex within the nucleus. This mechanism, except for the IFN dependency on binding, is reminiscent of the cytomegalovirus virus, which encodes a protein that binds STAT2 and prevents ISGF3 from binding to ISREs (Paulus et al, 2006).

[00225] Mapping studies identified the first ten amino acids of the YFV NS5 protein as critical for interacting with STAT2 and inhibiting the IFN signaling pathway. The first ten amino acids of DENV-2 NS5 are critical for its ability to mediate the proteasomal degradation of STAT2 although they are dispensable for STAT2 association (Ashour et al., 2009). Therefore, the extreme N-termini of both YFV NS5 and DENV-2 NS5, although using very different mechanisms, contain motifs required for their IFN antagonist function. Studies done with LGTV NS5 (Best et al, 2005; Park et al, 2007) and JEV NS5 (Lin et al, 2006) did not report a similar requirement of the first 10 amino acids of either NS5 protein as being necessary for its IFN-I antagonist activity. It is to be noted however that the first 80 amino acids of JEV NS5 are required for IFN antagonism and that deletions of smaller stretches of the N terminus were not conducted (Lin et al, 2006).

[00226] K6 of YFV NS5 is critical for IFN-induced YFV NS5-STAT2 interaction and IFN- signaling inhibition. When a K6R mutation was placed in the context of YFV-17D, the virus displayed a replication defect in IFN-I-treated cells, indicating that K6 is important for viral replication in the context of IFN-I treatment. As no replication defect was seen in mock-treated cells, it appears that K6 may only be important for IFN-I antagonism. YFV-17D differs from YFV-Asibi by 20 amino acids with most changes occurring in aspartic acid and with three differences in NS5 (dos Santos et al, 1995). These results indicate that differences in NS5 between these two strains do not affect IFN-I antagonism. Importantly, both YFV-17D and YFV-Asibi contain a lysine at amino acid 6 of NS5. YFV-17D can cause neurotropic and viscerotropic disease in immune-compromised individuals (Barrett et al, 2007; Monath, 2005; Monath et al., 2005). In mice, YFV-17D and YFV-Asibi cause viremia and disease only when the mice lack IFN receptors (Meier et al., 2009). Decreasing the ability of YFV-17D to antagonize type I IFN signaling may limit the replication of the vaccine in immune-compromised individuals thereby decreasing the incidence of adverse events. A YFV vaccine that is more attenuated than, but equally immunogenic to, the current YFV-17D vaccine would be an attractive alternative to YFV-17D. The first ten amino acids, and lysine 6 in particular, of YFV NS5 have been identified herein as potential targets for further attenuation of YFV-17D. [00227] Posttranslational modification of proteins by ubiquitination, SUMOylation, NEDDylation and ISGylation usually occur at lysine residues. The data here show a correlation between the ability of YFV NS5 to co-precipitate with ubiquitin and its ability to interact with STAT2. K63 ubiquitination was required for NS5/STAT2 coimmunoprecipitation in an IFN-I dependent manner, but the association of NS5 with K63 ubiquitin chains was not dependent of IFN-I. Without being bound by any theory, the data indicate that ubiquitinated YFV NS5 is modified by IFN to bind STAT2. The data indicate that it is not the sequence at the amino terminus that matters but instead the presence of a lysine in this region. The WNV7YFV NS5 chimera that has a lysine at position 4 instead of position 6 has a different sequence from WT YFV NS5 at its amino terminus but is still able to bind to STAT2. The MODV/YFV chimera also has a strikingly different amino terminus but can bind to STAT2 if a lysine is inserted at position 7, and changing lysine 6 of YFV NS5 to the structurally similar arginine ablates the interaction with STAT2. Alternatively, without being bound by any theory, the ubiquitinated NS5 may interact with a protein that is activated upon IFN treatment via a posttranslational signal such as phosphorylation to bridge YFV NS5 and STAT2; or that YFV NS5 binds to a ubiquitinated cellular partner that is activated by IFN to bind STAT2, which may require that K6 play a structural role in mediating binding to a ubiquitinated cellular partner.

[00228] The precise mechanism by which IFN promotes the modification of YFV NS5 (or a cellular interactor of YFV NS5 that bridges NS5 and STAT2) to allow binding to STAT2 is still under investigation. Without being bound by any theory, this modification may serve to switch NS5 from other roles, such as its involvement in viral RNA synthesis, to inhibit the IFN pathway only when this pathway becomes activated. Interestingly, a significant proportion of YFV NS5 is found in the nuclei of infected cells, while RNA synthesis takes place in the cytoplasm. The inhibition of IFN signaling at a step after STAT translocation, but before DNA promoter binding, supports a role for nuclear YFV NS5 in virus-infected cells.

[00229] It is highly surprising that despite the high level of amino acid conservation of NS5 among flaviviruses, the IFN antagonistic functions of this protein are mediated by different mechanisms according to its viral origin. This would suggest that the ability to inhibit IFN-I signaling evolved independently among flaviviruses, but in spite of that, this function was acquired by the NS5 protein in all cases. It might be that the polyprotein-based strategy of viral protein expression that is common to all flaviviruses results in excess expression of NS5, as only catalytic amounts of this protein are required for RNA synthesis, making it an ideal candidate for acquisition of additional functions. In any case, the ability of flaviviruses to antagonize type I IFN signaling, as previously demonstrated for WNV, JEV, DENV, LGTV and TBEV (Ashour et al, 2009; Best et al, 2005; Laurent-Rolle et al, 2010; Lin et al, 2006; Werme et al, 2008) and now demonstrated in this example for YFV, underscore the importance of this inhibitory activity in the biological cycle of these arboviruses.

6.4 LIST OF REFERENCES

[00230] Ashour, J., Laurent-Rolle, M., Shi, P.Y., and Garcia-Sastre, A. (2009). NS5 of dengue virus mediates STAT2 binding and degradation. J Virol 83, 5408-5418.

[00231] Barrett, A.D., and Monath, T.P. (2003). Epidemiology and ecology of yellow fever virus. Adv Virus Res 61, 291-315.

[00232] Barrett, A.D., Monath, T.P., Barban, V., Niedrig, M., and Teuwen, D.E. (2007). 17D yellow fever vaccines: new insights. A report of a workshop held during the World Congress on medicine and health in the tropics, Marseille, France, Monday 12 September 2005. Vaccine 25, 2758-2765.

[00233] Best, S.M., Morris, K.L., Shannon, J.G., Robertson, S.J., Mitzel, D.N., Park, G.S., Boer, E., Wolfmbarger, J.B., and Bloom, M.E. (2005). Inhibition of interferon-stimulated JAK- STAT signaling by a tick-borne flavivirus and identification of NS5 as an interferon antagonist. J Virol 79, 12828-12839.

[00234] Bredenbeek, P.J., Kooi, E.A., Lindenbach, B., Huijkman, N., Rice, CM., and Spaan, W.J. (2003). A stable full-length yellow fever virus cDNA clone and the role of conserved RNA elements in flavivirus replication. J Gen Virol 84, 1261-1268.

[00235] Brooks, A.J., Johansson, M., John, A.V., Xu, Y., Jans, D.A., and Vasudevan, S.G. (2002). The interdomain region of dengue NS5 protein that binds to the viral helicase NS3 contains independently functional importin beta 1 and importin alpha/beta-recognized nuclear localization signals. J Biol Chem 277, 36399-36407.

[00236] Chambers, T.J., Hahn, C.S., Galler, R., and Rice, CM. (1990a). Flavivirus genome organization, expression, and replication. Annu Rev Microbiol 44, 649-688.

[00237] Chambers, T.J., McCourt, D.W., and Rice, CM. (1990b). Production of yellow fever virus proteins in infected cells: identification of discrete polyprotein species and analysis of cleavage kinetics using region-specific polyclonal antisera. Virology 177, 159-174. [00238] Chen, M., and Gerlier, D. (2006). Viral hijacking of cellular ubiquitination pathways as an anti-innate immunity strategy. Viral Immunol 19, 349-362.

[00239] Chu, P.W., and Westaway, E.G. (1987). Characterization of Kunjin virus RNA- dependent RNA polymerase: reinitiation of synthesis in vitro. Virology 157, 330-337.

[00240] Der, S.D., Zhou, A., Williams, B.R., and Silverman, R.H. (1998). Identification of genes differentially regulated by interferon alpha, beta, or gamma using oligonucleotide arrays. Proc Natl Acad Sci U S A 95, 15623-15628.

[00241] Diamond, M.S., Roberts, T.G., Edgil, D., Lu, B., Ernst, J., and Harris, E. (2000). Modulation of Dengue virus infection in human cells by alpha, beta, and gamma interferons. J Virol 74, 4957-4966.

[00242] dos Santos, C.N., Post, P.R., Carvalho, R., Ferreira, II, Rice, CM., and Galler, R. (1995). Complete nucleotide sequence of yellow fever virus vaccine strains 17DD and 17D-213. Virus Res 55, 35-41.

[00243] Egloff, M.P., Benarroch, D., Selisko, B., Romette, J.L., and Canard, B. (2002). An RNA cap (nucleoside -2'-0-)-methyltransferase in the flavivirus RNA polymerase NS5: crystal structure and functional characterization. Embo J 21, 2757-2768.

[00244] Guo, J.T., Hayashi, J., and Seeger, C. (2005). West Nile virus inhibits the signal transduction pathway of alpha interferon. J Virol 79, 1343-1350.

[00245] Hemelaar, J., Borodovsky, A., Kessler, B.M., Reverter, D., Cook, J., Kolli, N., Gan- Erdene, T., Wilkinson, K.D., Gill, G., Lima, C.D., et al. (2004). Specific and covalent targeting of conjugating and deconjugating enzymes of ubiquitin-like proteins. Mol Cell Biol 24, 84-95.

[00246] Horvath, CM., Stark, G.R., Kerr, I.M., and Darnell, J.E., Jr. (1996). Interactions between STAT and non-STAT proteins in the interferon-stimulated gene factor 3 transcription complex. Mol Cell Biol 16, 6957-6964.

[00247] Ihle, J.N. (1995). The Janus protein tyrosine kinase family and its role in cytokine signaling. Adv Immunol 60, 1-35.

[00248] Issur, M., Geiss, B.J., Bougie, I., Picard-Jean, F., Despins, S., Mayette, J., Hobdey, S.E., and Bisaillon, M. (2009). The flavivirus NS5 protein is a true RNA guanylyltransferase that catalyzes a two-step reaction to form the RNA cap structure. RNA 15, 2340-2350. [00249] Jablonski, S.A., and Morrow, CD. (1995). Mutation of the aspartic acid residues of the GDD sequence motif of poliovirus RNA-dependent RNA polymerase results in enzymes with altered metal ion requirements for activity. J Virol 69, 1532-1539.

[00250] Jones, M., Davidson, A., Hibbert, L., Gruenwald, P., Schlaak, J., Ball, S., Foster, G.R., and Jacobs, M. (2005). Dengue virus inhibits alpha interferon signaling by reducing STAT2 expression. J Virol 79, 5414-5420.

[00251] Laurent-Rolle, M., Boer, E.F., Lubick, K.J., Wolfinbarger, J.B., Carmody, A.B., Rockx, B., Liu, W., Ashour, J., Shupert, W.L., Holbrook, M.R., et al. (2010). The NS5 protein of the virulent West Nile virus NY99 strain is a potent antagonist of type I interferon-mediated JAK-STAT signaling. J Virol 84, 3503-3515.

[00252] Leung, S., Qureshi, S.A., Kerr, I.M., Darnell, J.E., Jr., and Stark, G.R. (1995). Role of

STAT2 in the alpha interferon signaling pathway. Mol Cell Biol 15, 1312-1317.

[00253] Lin, R.J., Chang, B.L., Yu, H.P., Liao, C.L., and Lin, Y.L. (2006). Blocking of interferon-induced Jak-Stat signaling by Japanese encephalitis virus NS5 through a protein tyrosine phosphatase-mediated mechanism. J Virol 80, 5908-5918.

[00254] Lindenbach, B.D., and Rice, CM. (1999). Genetic interaction of flavivirus nonstructural proteins NS1 and NS4A as a determinant of replicase function. J Virol 73, 4611-

4621.

[00255] Lindenbach, B.D., and Rice, CM. (2003). Molecular biology of flaviviruses. Adv Virus Res 59, 23-61.

[00256] Liu, W.J., Wang, X.J., Mokhonov, V.V., Shi, P.Y., Randall, R., and Khromykh, A.A. (2005). Inhibition of interferon signaling by the New York 99 strain and Kunjin subtype of West Nile virus involves blockage of STATl and STAT2 activation by nonstructural proteins. J Virol 79, 1934-1942.

[00257] Mazzon, M., Jones, M., Davidson, A., Chain, B., and Jacobs, M. (2009). Dengue virus NS5 inhibits interferon-alpha signaling by blocking signal transducer and activator of transcription 2 phosphorylation. J Infect Dis 200, 1261-1270.

[00258] Meier, K.C, Gardner, C.L., Khoretonenko, M.V., Klimstra, W.B., and Ryman, K.D. (2009). A mouse model for studying viscerotropic disease caused by yellow fever virus infection. Plos Pathog 5, el 000614.

[00259] Monath, T.P. (2005). Yellow fever vaccine. Expert Rev Vaccines 4, 553-574. [00260] Monath, T.P., Cetron, M.S., McCarthy, K., Nichols, R., Archambault, W.T., Weld, L., and Bedford, P. (2005). Yellow fever 17D vaccine safety and immunogenicity in the elderly. Hum Vaccin 1, 207-214.

[00261] Park, G.S., Morris, K.L., Hallett, R.G., Bloom, M.E., and Best, S.M. (2007).

Identification of residues critical for the interferon antagonist function of Langat virus NS5 reveals a role for the RNA-dependent RNA polymerase domain. J Virol 81, 6936-6946.

[00262] Park, M.S., Shaw, M ., Munoz-Jordan, J., Cros, J.F., Nakaya, T., Bouvier, N., Palese, P., Garcia-Sastre, A., and Basler, C.F. (2003). Newcastle disease virus (NDV)-based assay demonstrates interferon-antagonist activity for the NDV V protein and the Nipah virus V, W, and C proteins. J Virol 77, 1501-1511.

[00263] Paulus, C, Krauss, S., and Nevels, M. (2006). A human cytomegalovirus antagonist of type I IFN-dependent signal transducer and activator of transcription signaling. Proc Natl Acad Sci U S A 103, 3840-3845.

[00264] Pellegrini, S., and Schindler, C. (1993). Early events in signalling by interferons. Trends Biochem Sci 18, 338-342.

[00265] Platanias, L.C. (2005). Mechanisms of type-I- and type-II-interferon-mediated signalling. Nat Rev Immunol 5, 375-386.

[00266] Qureshi, S.A., Leung, S., Kerr, I.M., Stark, G.R., and Darnell, J.E., Jr. (1996).

Function of Stat2 protein in transcriptional activation by alpha interferon. Mol Cell Biol 16, 288- 293.

[00267] Rice, CM., Lenches, E.M., Eddy, S.R., Shin, S.J., Sheets, R.L., and Strauss, J.H. (1985). Nucleotide sequence of yellow fever virus: implications for flavivirus gene expression and evolution. Science 229, 726-733.

[00268] Rodriguez, J.J., Parisien, J.P., and Horvath, CM. (2002). Nipah virus V protein evades alpha and gamma interferons by preventing STAT1 and STAT2 activation and nuclear accumulation. J Virol 76, 11476-11483.

[00269] Tomori, O. (2002). Yellow fever in Africa: public health impact and prospects for control in the 21st century. Biomedica 22, 178-210.

[00270] Versteeg, G.A., and Garcia-Sastre, A. (2010). Viral tricks to grid-lock the type I interferon system. Curr Opin Microbiol 13, 508-516. [00271] Werme, K., Wigerius, M., and Johansson, M. (2008). Tick-borne encephalitis virus NS5 associates with membrane protein scribble and impairs interferon-stimulated JAK-STAT signalling. Cell Microbiol 10, 696-712.

[00272] Zhou, Y., Ray, D., Zhao, Y., Dong, H., Ren, S., Li, Z., Guo, Y., Bernard, K.A., Shi, P.Y., and Li, H. (2007). Structure and function of fiavivirus NS5 methyltransferase. J Virol 81, 3891-3903.

[00273] This invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described will become apparent to those skilled in the art from the foregoing description and accompanying figures. Such modifications are intended to fall within the scope of the appended claims.

[00274] All references cited herein are incorporated herein by reference in their entirety and for all purposes to the same extent as if each individual publication or patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety for all purposes.

Claims

WHAT IS CLAIMED IS:

1. An attenuated yellow fever virus (YFV) comprising a genome which encodes a mutated NS5 protein comprising a deletion of the first 10 amino acids or an amino acid substitution of another residue for the first N-terminal lysine residue of the NS5 protein.

2. An attenuated chimeric yellow fever virus (YFV) comprising a genome which encodes (i) a mutated NS5 protein comprising a deletion of the first 10 amino acids or an amino acid substitution of another residue for the first N-terminal lysine residue of the NS5 protein ; and (ii) a heterologous antigen.

3. The attenuated YFV of claim 1, wherein the residue that is substituted for the first N-terminal lysine residue is arginine or alanine.

4. The attenuated YFV of claim 1 , wherein the mutated NS5 protein is a mutant form of the NS5 protein of the yellow fever virus 17D.

5. The attenuated YFV of claim 1, wherein the genome further encodes the structural proteins, envelope proteins, and NSl, NS2A, NS2B, NS3, NS4A and NS4B proteins of the yellow fever virus 17D.

6. The attenuated YFV of claim 2, wherein the residue that is substituted for the first N-terminal lysine residue is arginine or alanine.

7. The attenuated YFV of claim 2, wherein the mutated NS5 protein is a mutant form of the NS5 protein of the yellow fever virus 17D.

8. The attenuated YFV of claim 2, wherein the genome further encodes the structural proteins, envelope proteins, and NSl, NS2A, NS2B, NS3, NS4A and NS4B proteins of the yellow fever virus 17D.

9. The attenuated YFV of claim 3, wherein the genome further encodes the structural proteins, envelope proteins, and NSl, NS2A, NS2B, NS3, NS4A and NS4B proteins of the yellow fever virus 17D.

10. The attenuated YFV of claim 6, wherein the genome further encodes the structural proteins, envelope proteins, and NSl, NS2A, NS2B, NS3, NS4A and NS4B proteins of the yellow fever virus 17D.

11. The attenuated YFV of claim 2, 6 or 10, wherein the heterologous antigen is from a flavivirus other than YFV, or an antigen derived from said flavivirus other than YFV.

12. The attenuated YFV of claim 1 1 , wherein the flavivirus other than YFV is dengue virus, Japanese encephalitis virus, or West Nile virus (WNV).

13. The attenuated YFV of claim 2, 6 or 10, wherein the heterologous antigen is a St. Louis encephalitis or another arboviral encephalitis antigen or an antigen derived therefrom, a tick-borne encephalitis virus antigen or an antigen derived therefrom, a Rift Valley Fever virus antigen or an antigen derived therefrom, or a malarial antigen or an antigen derived therefrom.

14. The attenuated YFV of claim 12, wherein the dengue virus antigen or antigen derived therefrom is the dengue virus E envelope protein or a fragment thereof.

15. The attenuated YFV of claim 14, wherein the dengue virus E protein replaces the YFV E protein.

16. The attenuated YFV of claim 12, wherein the WNV antigen or antigen derived therefrom is a West Nile virus envelope protein or fragment thereof.

17. The attenuated YFV of claim 16, wherein the West Nile virus E protein replaces the YFV E protein.

18. A mutated YFV 17D, the genome of which encodes a mutated NS5 protein comprising a deletion of the first 10 amino acids or an amino acid substitution of another residue for the lysine residue at position 6 of the NS5 protein.

19. The mutated YFV 17D of claim 18, wherein the genome further encodes a heterologous antigen.

20. The mutated YFV 17D of claim 19, wherein the heterologous antigen is from a flavivirus other than YFV, or an antigen derived from said flavivirus other than YFV.

21. The mutated YFV 17D of claim 20, wherein the flavivirus other than YFV is dengue virus, Japanese encephalitis virus, or WNV.

22. A vaccine composition comprising the attenuated YFV of claim 1, and a pharmaceutically acceptable carrier.

23. A vaccine composition comprising the attenuated YFV of claim 12, and a pharmaceutically acceptable carrier.

24. A vaccine composition comprising the mutated YFV of claim 18, and a pharmaceutically acceptable carrier.

25. A vaccine composition comprising the mutated YFV of claim 21, and a pharmaceutically acceptable carrier.

26. A method for immunizing a subject against YFV, comprising administering the vaccine of claim 22 or 24 to the subject.

27. A method for immunizing a subject against YFV or a heterologous antigen, comprising administering the vaccine of claim 23 to the subject.

28. A method for immunizing a subject against YFV or a heterologous antigen, comprising administering the vaccine of claim 25 to the subject.