CN105535975A - Applications of vesicle-associated membrane protein 1 in prevention and treatment of enterovirus 71 infection - Google Patents
Applications of vesicle-associated membrane protein 1 in prevention and treatment of enterovirus 71 infection Download PDFInfo
- Publication number
- CN105535975A CN105535975A CN201510964682.2A CN201510964682A CN105535975A CN 105535975 A CN105535975 A CN 105535975A CN 201510964682 A CN201510964682 A CN 201510964682A CN 105535975 A CN105535975 A CN 105535975A
- Authority
- CN
- China
- Prior art keywords
- vesicle
- infection
- vamp1
- cell
- associated membrane
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
Abstract
The invention relates to the technical field of biomedicine, and particularly relates to a novel target preventing enterovirus 71 infection and applications thereof. Through adopting a human neuroblastoma cell (SH-SY5Y) as a target cell, and reducing expression of target cell host protein by adopting an RNA interference technique, a host factor effectively inhibiting EV71 infection of the human neuroblastoma cell (SH-SY5Y) is searched so as to prevent central nervous system virus infection and reducing damage to the nerve system. Experiments show that vesicle-associated membrane protein 1 (called as VAMP1 for short) plays an important role in EV71 infection of the human neuroblastoma cell (SH-SY5Y) and EV71 infection can be obviously inhibited by reducing expression of the VAMP1. The invention provides applications of the VAMP1 in preparation of medicines preventing and treating the enterovirus 71 infection.
Description
Technical field
The present invention relates to field of biomedicine technology, is a kind of novel targets and application of anti-enterovirns type 71 infection.
Background technology
Enterovirns type 71 (enterovirus71, EV71) belongs to Picornaviridae enterovirus genus people intestinal category-A virus, is one of main pathogens causing hand-foot-mouth disease (Hand-foot-mouthdisease, HFMD).At present, hand-foot-mouth disease to be broken out and popular in multiple area in the world, the especially Asian-Pacific area.In China, since 2008 Nian Ji great provinces and cities break out hand-foot-mouth disease epidemic situation, number of the infected and the mortality rate of this disease remain high always, and every annual report morbidity number is more than 1,000,000 examples, and death toll nearly 1000 is routine.Hand-foot-mouth disease principal pathogenetic crowd is 5 years old Infants Below, and clinical manifestation is heating, and the symptoms such as herpes appear in the positions such as hands, foot, buttocks and oral mucosa; Minority infant can develop into patient with severe symptoms, there is central nervous system (centralnervoussystem, CNS) pathological changes, comprise aseptic meningitis, brain stem encephalitis, encephalomyelitis and neurogenic pulmonary edema etc., life and health [the SolomonT1 of infant in serious threat, LewthwaiteP, PereraD, CardosaMJ, McMinnP, OoiMH.Virology, epidemiology, pathogenesis, andcontrolofenterovirus71.LancetInfectDis.2010Nov; 10 (11): 778-90.].Hand-foot-mouth disease particularly severe cases is many caused by enterovirns type 71 (EV71) infects.But, cause the treatment of hand-foot-mouth disease to there is no the antiviral drugs of differential high efficient about EV71 at present, clinically still based on symptomatic treatment, also come out without effective vaccine in prevention.
EV71 infects and has Neural invasion, easily causes serious CNS disease and complication thereof, and this is also cause hand-foot-mouth disease patient evolution for serious symptom even main causes of death.Wherein, brain stem is the most easily by position [Tee that EV71 infects, K.K., etal.Evolutionarygeneticsofhumanenterovirus71:origin, populationdynamics, naturalselection, andseasonalperiodicityoftheVP1gene.JVirol, 2010.84 (7): p.3339-50.], the position such as brain stem neuron that research confirms EV71 patient with severe symptoms all can detect the existence of EV71 gene and antigen, proves that EV71 can enter CNS.EV71 destroys blood brain barrier through blood dissemination or infects CNS through the reverse aixs cylinder conveying of peripheral nerve approach.But the mechanism of the central nervous system symptom that EV71 causes is still not clear [SolomonT, LewthwaiteP, PereraD, CardosaMJ, McminnP, OoiMH.Virology, epidemiology, pathogenesis, andcontrolofenterovirus71.LancetInfectDis.2010; 10:778-90.].Neuroblastoma cell (SH-SY5Y) is nervous tissue source, has certain neurocyte characteristic.Therefore, verify EV71 and infect the mechanism of SH-SY5Y and find new antiviral target spot with this, the central nervous system infection caused for control EV71 is most important.
In order to infection cell effectively, virus must utilize the membrane molecule of host cell and vesicular transport system thereof to complete invasion to host cell, could carry out copying in cell and discharge infective progeny virion.Therefore, as the primary link of viruses infect host cells, cell entry has become the important target of antiviral drugs screening.Research shows, EV71 can utilize different host factor and route of infection to invade different types of target cell, such as EV71 infects endocytic pathway (the caveolar-dependentendocytosis) [LinHY that JurkatT lymphocyte series mainly utilizes alveole to rely on, YangYT, YuSL, etal.CaveolarendocytosisisrequiredforhumanPSGL-1-mediate denterovirus71infection.JVirol.2013,87 (16): 9064-76.].At present, infect the approach of SH-SY5Y about EV71 and mechanism still unclear.
Virus entry target cell mainly by means of the key molecule participating in the transport of host cell Self substances, and these host cell membrane transport molecules, in the cross-film matter transportation of cell, play an important role in the formation of vesicle, endocytosis and secretion.As metalloproteases have adjusted cell adhesion, the degraded of membrane molecule; Caveolin family molecule caveolin-1 (CAV1), caveolin-2 (CAV2), caveolin-3 (CAV3) by matter transportation to Golgi body; Flotillin molecule can interact also with protein molecular in Lipid Rafts and swallow in cell; Vesicle-associated membrane albumen 1 participates in exocytosis and the re uptake process of synapses synaptic vesicle; Gtpase activating protein molecule GRAF1 has important regulating action (JasonMercer, MarioSchelhaas, etal.VirusEntrybyEndocytosis.AnnuRevBiochem.2010 in the vesicle transport of clathrin independent form; 79:803-833.).In these molecules, caveolin-1 is proved and take part in the lymphocytic process of EV71 infection JurkatT, and the effect of other molecule in EV71 infects also does not have report.
Vesicle-associated membrane albumen 1 (vesicle-associatedmembraneprotein1, VAMP1) be memebrane protein on synaptic vesicle, VAMP1 is mainly present in presynaptic membrane, (YunLiu, YoshieSugiuraandWeichunLin.TheroleofSynaptobrevin1/VAMP1 inCa2+-triggeredneurotransmitterreleaseatthemouseneuromu scularjunction.TheJournalofPhysiology.2011 is played an important role in synapse is transmitted; Pp:1603 – 1618.).Recent study also finds that VAMP1 molecule plays an important role in the course of infection of virus, the people such as JingZhang find VAMP1 molecular regulation infection with hepatitis C virus Huh-7 cell (JingZhang, OsamuYamada, TakashiSakamoto, HiroshiYoshida, TakahiroIwai, YoshihisaMatsushita, HideoShimamura, HiromasaArakiandKunitadaShimotohno.Down-regulationofvira lreplicationbyadenoviral-mediatedexpressionofsiRNAagains tcellularcofactorsforhepatitisCvirus.Virology.320 (2004): 135 – 143.).Human rhabdomyosarcoma RD cell is the sensitive cell line of EV71, but by genomic library screening, Khairunnisa etc. find that VAMP1 molecule does not affect the infection (HussainKM1 of EV71 to RD cell, LeongKL, NgMM, ChuJJ.Theessentialroleofclathrin-mediatedendocytosisinth einfectiousentryofhumanenterovirus71.JBiolChem.2011; 286 (1): 309-21.).
At present also without any infecting the report acted in SH-SY5Y at EV71 about VAMP1 molecule, this molecule is carried out furtheing investigate the understanding that can not only promote EV71 infection and mechanism of causing a disease, also can infect for prevention and treatment EV71 the thinking and target spot that provide new.
Summary of the invention
The object of the present invention is to provide the novel targets that a kind of anti-enterovirns type 71 infects.
Another object of the present invention is to the novelty teabag that vesicle-associated membrane albumen 1 (VAMP1) molecule is provided, the application particularly in anti-enterovirns type 71 infects.
The third object of the present invention is to provide the interference VAMP1 siRNA of developed by molecule.
Main technical schemes of the present invention is:
The present invention, using human neuroblastoma cells (SH-SY5Y) as target cell, RNA perturbation technique is adopted to lower the expression of target cell host protein, find the host factor that can effectively suppress EV71 to infect human neuroblastoma cells (SH-SY5Y), thus reduce nervous system infection and destruction.This experimental selection one group of host cell transmembrane transporter molecules screens, these molecules are in the cross-film matter transportation of host cell, play an important role in the endocytosis of vesicle and secretion, they are also often easily by virus " abductions " and the molecule of utilization in virus infection.These molecules comprise: metalloproteases 10 (ADAM10), caveolin-1 (CAV1), caveolin-2 (CAV2), caveolin-3 (CAV3), Flotillin albumen 1 (FLOT1), Flotillin albumen 2 (FLOT2), gtpase activating protein (GRAF1), synaptotagmin 1 (SYT1), synaptotagmin 2 (SYT2).Complete sequence and mRNA sequence is obtained by retrieval NCBIGeneBank, existing Internet resources and popular software is utilized to carry out biological analysis to these genes, select the target sequence that coding region is designed as siRNA, then siRNA is designed, by lowering these molecules, observe the impact that EV71 is infected.
We find that vesicle-associated membrane albumen 1 (vesicle-associatedmembraneprotein1, VAMP1) infects in SH-SY5Y at EV71 and play an important role, and lower the expression of VAMP1, obviously can suppress the infection of EV71.
A first aspect of the present invention, provides the novel targets that vesicle-associated membrane albumen 1 (VAMP1) infects as a kind of anti-enterovirns type 71.
Described vesicle-associated membrane albumen 1 (VAMP1), GENBANKID:NM_014231.
A second aspect of the present invention, provides the application of vesicle-associated membrane albumen 1 (VAMP1) in preparation prevention or treatment enterovirns type 71 infection medicine.
Further, the present invention also provides the application of vesicle-associated membrane albumen 1 (VAMP1) in preparation prevention or treatment hand-foot-mouth disease medicine.
The application of vesicle-associated membrane albumen 1 (VAMP1) of the present invention in preparation prevention or treatment enterovirns type 71 infection medicine, this medicine specifically refers to the reagent that can suppress or lower the expression of VAMP1.
The reagent that the expression of VAMP1 is lowered in described suppression can be siRNA, shRNA, comprise the recombinant vector of siRNA, shRNA (as plasmid) etc.
A third aspect of the present invention, the invention provides the application of RNA interfering in preparation prevention or treatment enterovirns type 71 infection medicine of vesicle-associated membrane albumen 1 (VAMP1), or the application of vesicle-associated membrane albumen 1 (VAMP1) in preparation prevention or treatment hand-foot-mouth disease medicine, described medicine is RNA interfering (siRNA), and its sequence is as follows:
CAUGACCAGUAACAGACGAUU(SEQIDNO:1)
CAUCGUGGUAGUUAUUGUAUU(SEQIDNO:2)
GCGUUCAUUUGCACUCUGUUU(SEQIDNO:3)
Wherein, lower the expression best results of VAMP1 with the siRNA such as shown in SEQIDNO:1, and it is the most obvious to the infection of SH-SY5Y cell to reduce EV71.
The present invention screens and EV71 can be suppressed to infect the new host cellular molecules VAMP1 of of SH-SY5Y cell.After VAMP1 gene deregulation, do not affect the normal physiological function of cell, but obviously inhibit EV71 to the infection of SH-SY5Y cell.
Therefore the present invention for clinical prevention and treatment provide new target spot and therapeutic scheme because EV71 infects the nervous system damage caused.
Accompanying drawing explanation
Fig. 1 is that jamming effectiveness after the effective siRNA of transfection and cytotoxicity detect, and in figure, primary axis represents jamming effectiveness, and secondary axis represents Cytotoxic impact;
The SH-SY5Y groups of cells (ghost group) of CTRL: any siRNA of not transfection;
The SH-SY5Y groups of cells (negative control group) of NT: transfection non-targetingsiRNA;
SiRNA: transfection is for the SH-SY5Y groups of cells (experimental group) of the siRNA of each genes of interest.
Fig. 2 is the impact infected EV71 after each host molecule of immuno-fluorescence assay is lowered, and wherein A lowers the fluoroscopic examination figure to viral infection after each molecule, and B lowers the suppression ratio figure to viral infection after each molecule;
The SH-SY5Y groups of cells (ghost group) of CTRL: any siRNA of not transfection;
The SH-SY5Y groups of cells (negative control group) of NT: transfection non-targetingsiRNA;
SiRNA: transfection is for the SH-SY5Y groups of cells (experimental group) of the siRNA of each genes of interest.
Fig. 3 is the impact infected EV71 after VAMP1 lowers, and wherein A is the expression figure that WesternBlot detects VAMP1 albumen, B is that the cytopathic effect figure observing EV71, C are for detecting EV71 virus spirogram;
The SH-SY5Y groups of cells (ghost group) of CTRL: any siRNA of not transfection;
The SH-SY5Y groups of cells (negative control group) of NT-CTRL: transfection non-targetingsiRNA;
VAMP1: transfection is for the SH-SY5Y groups of cells of the siRNA (SEQIDNO:1) of VAMP1 gene.
Fig. 4 is jamming effectiveness after the disturbance sequence of transfection VAMP1 molecule and to the infective effect diagram of EV71, and A is the mRNA level in-site detection figure of VAMP1 gene, B is EV71 virus quantity detection figure;
The SH-SY5Y groups of cells (ghost group) of CTRL: any siRNA of not transfection;
The SH-SY5Y groups of cells (negative control group) of NT-CTRL: transfection non-targetingsiRNA;
VAMP1-1: transfection is for the SH-SY5Y groups of cells of the siRNA (SEQIDNO:1) of VAMP1 gene;
VAMP1-2: transfection is for the SH-SY5Y groups of cells of the siRNA (SEQIDNO:2) of VAMP1 gene;
VAMP1-3: transfection is for the SH-SY5Y groups of cells of the siRNA (SEQIDNO:3) of VAMP1 gene.
Detailed description of the invention
Now in conjunction with the embodiments and accompanying drawing, the present invention is described in detail, but enforcement of the present invention is not limited only to this.
Agents useful for same of the present invention and raw material all commercially maybe can be prepared by literature method.The experimental technique of unreceipted actual conditions in the following example, usual conveniently condition is as the people such as Sambrook " molecular cloning: lab guide " (NewYork:ColdSpringHarborLaboratoryPress, 1989) condition described in, or conveniently condition, or according to the condition that manufacturer advises.Unless otherwise indicated, otherwise percentage ratio and number calculate by weight.
Embodiment 1:
1 design, synthesize the specific siRNA sequence of each host cellular molecules.
1.1 for each genes of interest, and retrieval NCBIGeneBank obtains complete sequence and mRNA sequence, utilizes existing Internet resources and popular software to carry out biological analysis to each genes of interest, selects the target sequence that coding region is designed as siRNA.With reference to siRNA design principle, and contrasted by the blast function of GeneBank data base and human genomic sequence, guarantee without homology; Get rid of 5 ' the potential siRNA holding continuous 8 bases and other gene to match of aitisense chain; Get rid of the potential siRNA that any one section continuous 14 bases and other gene match.And utilize design software to carry out Pre-Evaluation mensuration, select 3 best kinetic parameter target spots to enter subsequent experimental flow process, each gene synthesizes 3 interference sequences altogether, in table 1.
Synthesis and the purification of 1.2 strand siRNA are completed by Invitrogen company.
The design of table 1.siRNA target spot
2siRNA sequence screening and interference effect are identified
2.1RNA transfection
Transfection procedure is with reference to Lipofectamine2000 description
1) within 12-16 hour in advance, to be layered on 24 porocyte culture plates by SH-SY5Y cell (purchased from ATCC, preserving number: ATCCCRL-2266) and to cultivate, when making transfection, cell density is 80%-90%.
2) get 2 μ LLipofectamine2000 and add also soft mixing in 50 μ Lopti-MEM, incubated at room 5 minutes; Separately getting 5 μ L concentration is that the RNA interfering of 5 μMs and 50 μ Lopti-MEM mix.After hatching end, the Lipofectamine2000 transfection reagent of dilution is added in the RNA of dilution, and soft pressure-vaccum mixing.After incubated at room 20min, add in SH-SY5Y cell, add 400 μ Lopti-MEM, make RNA final concentration be 50nM.
3) within after transfection 6-8 hour, change containing dual anti-fresh culture.
2.2 real-time fluorescence quantitative PCRs (RT-PCR) detect the mRNA level in-site of each host molecule
1) TRIzol extracts the total serum IgE of matched group and interference group cell, and concrete steps are as follows:
Transfection, after 48 hours, goes culture supernatant, in cell, add 1mlTRIzol, abundant mixed room temperature cell lysis 3-5 minute.Add the chloroform of 1/5 volume, manually violent mixing 15 seconds.In 4 DEG C, 12,000 leaves the heart 15 minutes.Get upper strata aqueous phase and transfer in new EP pipe, adding equal-volume isopropyl alcohol, fully mix, precipitation at room temperature 10 minutes.In 4 DEG C, 12,000 leaves the heart 10 minutes.Abandon supernatant, add 75% ethanol of 1ml pre-cooling.In 4 DEG C, 12,000 centrifugal 5 minutes.Fully abandon supernatant, room temperature dries RNA precipitation, adds DEPC process water dissolution precipitation, obtains total serum IgE.
2) utilize takara Reverse Transcription box to obtain the cDNA of matched group and interference group cell, concrete steps are as follows:
Following reaction system is added in PCR pipe,
Soft mixing mixing, is placed in 37 DEG C of reactions 15 minutes, is then placed in 85 DEG C of heating deactivation in 5 seconds reverse transcriptases.
3) fluorescence quantitative RT-RCR detects
Utilize the SYBRPremixExTaq test kit of takara to react, reaction system is as follows,
Utilize RotorGene3000A instrument to carry out two-step method amplification, 95 DEG C of denaturation 2min, carry out 40 PCR circulation, 95 DEG C 5 seconds, 60 DEG C 30 seconds.
3 cytotoxicity experiments
The impact of on cell proliferation after employing CCK-8 method detection transfection siRNA, concrete steps are as follows:
Collect exponential phase cell, be inoculated in 96 orifice plates with the density in 3000, every hole.After cell pellet overnight is adherent, each siRNA of transfection, cultivates and detects cell proliferative conditions after 48 hours.Discard original culture medium, every hole adds the fresh culture 110 μ L containing 10 μ LCCK-8, to cultivate after 3h by multi-functional microplate reader at 450nm wavelength detecting each hole absorbance.Experiment is independent to be repeated 3 times, calculating mean value.
4EV71 viral infection SH-SY5Y cell
The EV71 viral infection experiment of 4.1SH-SY5Y cell
After SH-SY5Y cell transfecting RNA 72 hours, carry out the experiment of EV71 viral infection.By culture supernatant sucking-off, with pre-temperature PBS rinse 2 times, with the virus quantity of MOI=0.1 inoculation EV71,37 DEG C hatch 2h after discard virus liquid, and with pre-temperature PBS rinse 3 times, add fresh culture and continue to cultivate.
4.2 immunofluorescence dyeing detects EV71 antigen presentation
Continue after SH-SY5Y cell infection virus to cultivate 48h, adopt the expression of immuno-fluorescence assay virus antigen, concrete steps are as follows:
1) cell is fixed: removed by the culture fluid in 96 orifice plates, and add PBS and clean cell 2 times, every hole adds the pre-cold methanol of 100 μ l, under-20 DEG C of conditions, fix 20min, cleans cell 3 times with the PBS of pre-cooling.
2) permeable membrane: the cell per well after fixing adds 100 μ l0.1%TritonX-100, incubated at room 15min, washs 3 times with pre-cooling PBS.
3) close: every hole adds 100 μ l3%BSA, in incubated at room temperature 1h.
4) primary antibodie is hatched: every hole adds EV71 specific murine source monoclonal antibody 10F0 (1:2000 dilution) 100 μ l, incubated at room 1h, washs 3 times with the PBS of pre-cooling.
5) two anti-to hatch: every hole adds AF488 fluorescent labeling against murine IgG (1:1000 dilution) 100 μ l, and room temperature lucifuge hatches 1h, washs 2 times by the PBS lucifuge of pre-cooling.
6) labeled cell core: every hole adds nucleus fluorescent dye DAPI (1:5000, PBS dilute), and room temperature lucifuge hatches 15min, washs 3 times by the PBS lucifuge of pre-cooling.
7) detect under fluorescence microscope and calculate green AF488 positive cell clone number.
4.3 protein immunoblot.
(1) total protein of matched group and VAMP1 interference group SH-SY5Y cell is extracted respectively with protein lysate.
(2) respectively 30ug albumen is added to electrophoresis in the polyacrylamide gel of 12.5% concentration after quantification of protein, and intercepts respective strap electroporation and forward on pvdf membrane.
(3) non-specific sites of albumen is closed with the skim milk of 5%, and then close with VAMP1 antibody, 4 DEG C are spent the night, and wash three times, wash away primary antibodie with TBST buffer.
(4) then use two of HRP labelling anti-incubated at room 2 hours, then wash three times with TBST buffer.
(5) last, utilize nitrite ion to develop the color and photographic analysis.
4.4RT-PCR detects EV71 virus quantity in cell
Continue after SH-SY5Y cell infection virus to cultivate 48h, adopt TRIzol to extract the total serum IgE of matched group and interference group cell, and reverse transcription obtains cDNA, detect EV71 virus quantity by RT-PCR.Concrete steps are with shown in 2.2.
Experimental result:
1 design, synthesize and screen effective siRNA
For each genes of interest sequence, we devise multiple RNA interfered target sequence, and utilize design software to carry out Pre-Evaluation mensuration, select 3 best kinetic parameter target spots to enter subsequent experimental flow process, each gene synthesizes 3 interference sequences altogether, as shown in table 1.
Adopt the method for in-vitro transfection, the RNA interfering of each gene is transfected in SH-SY5Y cell and goes, detected the jamming effectiveness of each RNA interfering by RT-PCR method after 48h, the siRNA sequence (in table 2 overstriking sequence) that finishing screen chooses interference effect the best carries out subsequent experimental, and its jamming effectiveness is as shown in table 2.
Table 2RT-PCR method detects siRNA interference sequence to the downward efficiency of relevant host gene
Note: CTRL: the SH-SY5Y groups of cells (ghost group) of any siRNA of not transfection
The SH-SY5Y groups of cells (negative control group) of NT: transfection non-targetingsiRNA
SiRNA: transfection is for the SH-SY5Y groups of cells (experimental group) of the siRNA of each genes of interest.
Jamming effectiveness after 2siRNA interference and cytotoxicity detect
The effective siRNA transfection SH-SY5Y cell for each host molecule picked out, after transfection, 48h detects the jamming effectiveness of each RNA interfering by RT-PCR method, on the Cytotoxic impact of SH-SY5Y after employing CCK8 detection transfection simultaneously.
As shown in Figure 1, the effective siRNA group of transfection, compared with CTRL group, obviously can suppress the expression (P < 0.01) of corresponding gene to result after each siRNA of transfection.The suppression efficiency of transfection VAMP1siRNA (SEQIDNO:1) can reach 77%.
Cytotoxicity experiment shows, does not produce obvious cytotoxicity (P > 0.05), do not have an impact, can be used for subsequent experimental to the normal physiological function of cell after each siRNA transfection.
Impact on EV71 viral infection after 3siRNA interference
After effective siRNA of each host molecule of transfection lowers the expression of host cell correlation molecule, infect the EV71 virus of same dose, after infecting 48h, the impact after adopting each host molecule of immuno-fluorescence assay to lower, EV71 infected, find compared with matched group, after transfection VAMP1siRNA (SEQIDNO:1) makes VAMP1 gene deregulation, significantly reduce the infection (Fig. 2 A) of EV71 to SH-SY5Y cell.Find by calculating virus quantity, after VAMP1 gene deregulation, 79.25% is reached to the suppression ratio of virus, and the downward of all the other molecules does not obviously suppress EV71 to infection (P > 0.05) (Fig. 2 B) of SH-SY5Y cell.
For the inhibitory action that clear and definite VAMP1 infects EV71, after transfection VAMP1 molecule siRNA, detected the expression of VAMP1 protein molecular by immunoblotting, and after infection EV71 observation of cell pathological changes situation, and detect EV71 virus quantity by RT-PCR.Result shows, and after transfection VAMP1 molecule siRNA (SEQIDNO:1), obviously can suppress the expression (Fig. 3 A) of VAMP1 protein molecular.Compared with matched group, after VAMP1 protein expression is lowered, can T suppression cell pathological changes and virus quantity in SH-SY5Y cell also significantly decline (Fig. 3 B, C), consistent with immuno-fluorescence assay result.These results show, compared with compared with control cells, after lowering VAMP1 gene, the infection ability of EV71 to SH-SY5Y cell obviously declines, and virus quantity reduces.
Further, the siRNA of transfection three VAMP1 molecules observes the impact on viral infection respectively.Result shows the downward efficiency difference (Fig. 4 A) of different siRNA to VAMP1 molecule, and wherein the jamming effectiveness of siRNA (SEQIDNO:1) is the highest, consistent with result above.After detecting interference, the infective impact of EV71 is found, article three, the siRNA of VAMP1 molecule all can reach more than 64% to the suppression ratio of viral infection, and increasing along with the downward efficiency to VAMP1 molecule, also raising (Fig. 4 B) to the suppression ratio that EV71 infects, prompting VAMP1 molecule infects in SH-SY5Y at EV71 and plays an important role.Therefore, VAMP1 can be used as and suppresses EV71 to new host's target spot of SH-SY5Y cell infection.
By above the results show: the present invention screens and EV71 can be suppressed to infect the new host cellular molecules VAMP1 of of SH-SY5Y cell.After VAMP1 gene deregulation, do not affect the normal physiological function of cell, but obviously inhibit EV71 to the infection of SH-SY5Y cell.Therefore the present invention for clinical prevention and treatment provide new target spot and therapeutic scheme because EV71 infects the nervous system damage caused.
Below the preferred embodiment of the invention is illustrated, but the invention is not limited to described embodiment, those of ordinary skill in the art also can make all equivalent modification or replacement under the prerequisite without prejudice to the invention spirit, and these equivalent modification or replacement are all included in the application's claim limited range.
Claims (8)
1. the application of vesicle-associated membrane albumen 1 in preparation prevention or treatment enterovirns type 71 infection medicine.
2. the application of vesicle-associated membrane albumen 1 in preparation prevention or treatment hand-foot-mouth disease medicine.
3. the application of vesicle-associated membrane albumen 1 according to claim 1 in preparation prevention or treatment enterovirns type 71 infection medicine, it is characterized in that, described medicine refers to the reagent that can suppress or lower the expression of vesicle-associated membrane albumen 1.
4. the application of vesicle-associated membrane albumen 1 according to claim 3 in preparation prevention or treatment enterovirns type 71 infection medicine, it is characterized in that, the described reagent that can suppress or lower the expression of vesicle-associated membrane albumen 1 is siRNA, shRNA of vesicle-associated membrane albumen 1 or comprises the recombinant vector of siRNA, shRNA.
5. the application of vesicle-associated membrane albumen 1 according to claim 1 in preparation prevention or treatment enterovirns type 71 infection medicine, it is characterized in that, described medicine is the RNA interfering of vesicle-associated membrane albumen 1, and the sequence of described RNA interfering is selected from following arbitrary:
CAUGACCAGUAACAGACGAUU(SEQIDNO:1)、
CAUCGUGGUAGUUAUUGUAUU(SEQIDNO:2)、
GCGUUCAUUUGCACUCUGUUU(SEQIDNO:3)。
6. the application of vesicle-associated membrane albumen 1 according to claim 2 in preparation prevention or treatment hand-foot-mouth disease medicine, it is characterized in that, described medicine refers to the reagent that can suppress or lower the expression of vesicle-associated membrane albumen 1.
7. the application of vesicle-associated membrane albumen 1 according to claim 6 in preparation prevention or treatment hand-foot-mouth disease medicine, it is characterized in that, the described reagent that can suppress or lower the expression of vesicle-associated membrane albumen 1 is siRNA, shRNA of vesicle-associated membrane albumen 1 or comprises the recombinant vector of siRNA, shRNA.
8. the application of vesicle-associated membrane albumen 1 according to claim 2 in preparation prevention or treatment hand-foot-mouth disease medicine, it is characterized in that, described medicine is the RNA interfering of vesicle-associated membrane albumen 1, and the sequence of described RNA interfering is selected from following arbitrary:
CAUGACCAGUAACAGACGAUU(SEQIDNO:1)、
CAUCGUGGUAGUUAUUGUAUU(SEQIDNO:2)、
GCGUUCAUUUGCACUCUGUUU(SEQIDNO:3)。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510964682.2A CN105535975B (en) | 2015-12-21 | 2015-12-21 | Application of the vesicle-associated membrane albumen 1 in prevention enterovirns type 71 infection |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510964682.2A CN105535975B (en) | 2015-12-21 | 2015-12-21 | Application of the vesicle-associated membrane albumen 1 in prevention enterovirns type 71 infection |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105535975A true CN105535975A (en) | 2016-05-04 |
| CN105535975B CN105535975B (en) | 2018-05-18 |
Family
ID=55815848
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510964682.2A Active CN105535975B (en) | 2015-12-21 | 2015-12-21 | Application of the vesicle-associated membrane albumen 1 in prevention enterovirns type 71 infection |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105535975B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108841822A (en) * | 2018-05-04 | 2018-11-20 | 广州市妇女儿童医疗中心 | Nanometer selenium supported V P1 gene siRNA and the preparation method and application thereof |
| CN112057621A (en) * | 2019-06-11 | 2020-12-11 | 中国人民解放军第二军医大学 | Application of solute carrier family 7member 7in preparation of medicine for preventing and treating enterovirus 71infection |
| CN112057622A (en) * | 2019-06-11 | 2020-12-11 | 中国人民解放军第二军医大学 | Application of ATP (adenosine triphosphate) binding cassette transmembrane transport subfamily C member 3 in preparation of medicine for preventing and treating enterovirus 71infection |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008036060A2 (en) * | 2005-04-05 | 2008-03-27 | Allergan, Inc. | Clostridial toxin activity assays |
| CN103893748A (en) * | 2012-12-27 | 2014-07-02 | 上海吉美生物工程有限公司 | Novel vaccine for hand-foot-and-mouth disease and a preparation method thereof |
-
2015
- 2015-12-21 CN CN201510964682.2A patent/CN105535975B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008036060A2 (en) * | 2005-04-05 | 2008-03-27 | Allergan, Inc. | Clostridial toxin activity assays |
| CN103893748A (en) * | 2012-12-27 | 2014-07-02 | 上海吉美生物工程有限公司 | Novel vaccine for hand-foot-and-mouth disease and a preparation method thereof |
Non-Patent Citations (2)
| Title |
|---|
| XILING DU ET AL: "Enterovirus 71 induces apoptosis of SH‑SY5Y human neuroblastoma cells through stimulation of endogenous microRNA let‑7b expression", 《MOLECULAR MEDICINE REPORTS》 * |
| 陈生林等: "肠道病毒71型复制周期研究进展", 《中国病毒病杂志》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108841822A (en) * | 2018-05-04 | 2018-11-20 | 广州市妇女儿童医疗中心 | Nanometer selenium supported V P1 gene siRNA and the preparation method and application thereof |
| CN112057621A (en) * | 2019-06-11 | 2020-12-11 | 中国人民解放军第二军医大学 | Application of solute carrier family 7member 7in preparation of medicine for preventing and treating enterovirus 71infection |
| CN112057622A (en) * | 2019-06-11 | 2020-12-11 | 中国人民解放军第二军医大学 | Application of ATP (adenosine triphosphate) binding cassette transmembrane transport subfamily C member 3 in preparation of medicine for preventing and treating enterovirus 71infection |
| CN112057621B (en) * | 2019-06-11 | 2021-07-02 | 中国人民解放军第二军医大学 | Application of solute carrier family 7member 7in preparation of medicine for preventing and treating enterovirus 71infection |
| CN112057622B (en) * | 2019-06-11 | 2021-07-06 | 中国人民解放军第二军医大学 | Application of ATP (adenosine triphosphate) binding cassette transmembrane transport subfamily C member 3 in preparation of medicine for preventing and treating enterovirus 71infection |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105535975B (en) | 2018-05-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhang et al. | Understanding the role of SARS-CoV-2 ORF3a in viral pathogenesis and COVID-19 | |
| Chen et al. | Retrograde axonal transport: a major transmission route of enterovirus 71 in mice | |
| Wang et al. | A mouse-adapted enterovirus 71 strain causes neurological disease in mice after oral infection | |
| Ludwig-Begall et al. | Noroviruses—the state of the art, nearly fifty years after their initial discovery | |
| Celma et al. | Interaction of calpactin light chain (S100A10/p11) and a viral NS protein is essential for intracellular trafficking of nonenveloped bluetongue virus | |
| Frierson et al. | Utilization of sialylated glycans as coreceptors enhances the neurovirulence of serotype 3 reovirus | |
| Wang et al. | Comparative study on physical–chemical and biological characteristics of grass carp reovirus from different genotypes | |
| CN105535975A (en) | Applications of vesicle-associated membrane protein 1 in prevention and treatment of enterovirus 71 infection | |
| Xu et al. | Revisiting the Mongolian gerbil model for hepatitis E virus by reverse genetics | |
| Kenney et al. | Therapeutic targets for the treatment of hepatitis E virus infection | |
| CN105435246A (en) | Applications of autophagy-related protein 12 in preventing and treating enterovirus 71 infection | |
| Doszpoly et al. | Isolation and characterization of an atypical Siberian sturgeon herpesvirus strain in Russia: novel North American Acipenserid herpesvirus 2 strain in Europe? | |
| CN105267948B (en) | Application of the tyrosine kinase substrate that hepatocyte growth factor is adjusted in preparation prevention and treatment enterovirns type 71 infection medicine | |
| CN105267984A (en) | Application of ADP ribosylation factor 6 in prevention and treatment of enterovirus 71 infection | |
| CN105311647B (en) | Application of the Cofilin in prevention and treatment japanese encephalitis virus infection | |
| CN105288655B (en) | Application of the vacuole sorting protein 4A in preparation prevention and treatment enterovirns type 71 infection medicine | |
| CN105497918A (en) | Application of dynamin 1 in prevention and treatment on enterovirus type 71 infection | |
| CN105435245B (en) | Application of the calcium integrin Binding Protein 1 in prevention and treatment enterovirns type 71 infection | |
| CN105267985B (en) | Application of the n-ethylmaleimide sensitive factor in prevention japanese encephalitis virus infection | |
| Escribano-Romero et al. | Swine vesicular disease virus. Pathology of the disease and molecular characteristics of the virion | |
| CN105497874A (en) | Application of sorting nexin 1 in prevention and treatment on enterovirus type 71 infection | |
| BR112018072729B1 (en) | Assay to detect flavivirus infection, recombinant DNA expression cassette and recombinant flavivirus genome | |
| Wang et al. | Inhibition of lysosome-tethered Ragulator-Rag-3D complex restricts the replication of Enterovirus 71 and Coxsackie A16 | |
| CN105311646B (en) | Application of the ezrin in prevention and treatment japanese encephalitis virus infection | |
| CN105288654A (en) | Application of protein tyrosine kinase FYN proto-oncogene in controlling enterovirus 71 infections |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |