CN105288655B - Application of the vacuole sorting protein 4A in preparation prevention and treatment enterovirns type 71 infection medicine - Google Patents
Application of the vacuole sorting protein 4A in preparation prevention and treatment enterovirns type 71 infection medicine Download PDFInfo
- Publication number
- CN105288655B CN105288655B CN201510287415.6A CN201510287415A CN105288655B CN 105288655 B CN105288655 B CN 105288655B CN 201510287415 A CN201510287415 A CN 201510287415A CN 105288655 B CN105288655 B CN 105288655B
- Authority
- CN
- China
- Prior art keywords
- infection
- cell
- sirna
- caco
- vps4a
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
Application of the vacuole sorting protein 4A in preparation prevention and treatment enterovirns type 71 infection medicine.It is novel targets and the application of a kind of anti-enterovirns type 71 infection the present invention relates to field of biomedicine technology.The present invention is using human colon cancer cell (Caco-2) as target cell, the expression of target cell host protein is lowered using RNA perturbation technique, come find can be effectively suppressed EV71 infection human colon cancer cell (Caco-2) host factor, achieve the purpose that from source (enteron aisle) effectively cutting EV71 infection.The present invention is found through experiments that vacuole sorting protein 4A (vacuolar protein sorting 4homolog A, VPS4A) plays an important role in EV71 infection Caco-2, lowers the expression of VPS4A, can obviously inhibit the infection of EV71.The present invention provides application of the VPS4A in preparation prevention or treatment enterovirns type 71 infection medicine.
Description
Technical field
It is novel targets and the application of a kind of anti-enterovirns type 71 infection the present invention relates to field of biomedicine technology.
Background technique
Enterovirns type 71 (enterovirus 71, EV71) belongs to Picornaviridae enterovirus genus people's enteron aisle
A viroid is one of the main pathogens for leading to hand-foot-and-mouth disease (Hand-foot-mouth disease, HFMD).Currently, hand
Sufficient stomatosis breaks out simultaneously prevalence, the especially Asian-Pacific area in the multiple areas in the world.In China, brothers are broken out from 2008 Nian Ji great provinces and cities
Since stomatosis epidemic situation, the number of the infected and the death rate of the disease can not have always been high any more, and every annual report morbidity number is more than 1,000,000, extremely
Die several nearly 1000.Hand-foot-and-mouth disease principal pathogenetic crowd be 5 years old Infants Below, clinical manifestation be fever, hand, foot, buttocks with
And there are the symptoms such as bleb in the positions such as oral mucosa；A small number of infants can develop as patient with severe symptoms, central nervous system occur
(central nervous system, CNS) lesion, including aseptic meningitis, brainstem encephalitis, encephalomyelitis and neural source
Property pulmonary edema etc., seriously threatens life and health [Solomon T, Lewthwaite P, Perera D, the Cardosa of infant
MJ,McMinn P,Ooi MH.Virology,epidemiology,pathogenesis,and control of
enterovirus 71.Lancet Infect Dis.2010Nov；10(11):778-90.].Hand-foot-and-mouth disease especially severe disease
Example is mostly caused by enterovirns type 71 (EV71) infection.However, causing the treatment of hand-foot-and-mouth disease to there is no specifically about EV71 at present
Efficient antiviral drugs also comes out without effective vaccine in terms of prevention clinically still based on symptomatic treatment.
The propagation of EV71 is most wide with fecal oral route, and in this route of transmission, enteron aisle is first that human body resists pathogen
Barrier.Animal experiment study confirms, after EV71 direct oral cavity Mice Inoculated, shows the pathogen positive in small intestine at first
[Chen YC,Yu CK,Wang Y F,et al.A murine oral enterovirus 71 infection model
with central nervous system involvement.Journal of General Virology,2004,85
(1):69-77].Therefore, EV71 is first by infecting intestinal tract, in small enteron aisle a large amount of quick copies into the cell, with
Entering blood afterwards leads to viremia virusemia and causes the infection of other organs.However, how is virus after EV71 reaches human body intestinal canal system
The mechanism for invading intestinal cell is unclear.Small intestine is mainly responsible for disappearing for nutriment as digestion vitals
Change and absorb, Cavity surface outermost layer is small intestinal epithelial cells, for resisting playing a crucial role for pathogen.Make
For human colon cancer cell line, Caco-2 is similar to people's small intestinal epithelial cells in terms of morphology and physiologic function, culture
Mature Caco-2 is fine and close cell monolayer, has polarity identical with normal small intestinal epithelial cells and closely connects
It connects, microvillus structure；And as tumour cell, it is easier to cultivate than small intestinal epithelial cells.Therefore, EV71 infection is verified
The mechanism of Caco-2 simultaneously finds new antiviral target spot with this, most important to the infection of human body for prevention and treatment EV71.
In order to which effectively infection cell, virus must utilize membrane molecule and its vesicular transport system completion pair of host cell
The invasion of host cell could be replicated in the cell and be released the progeny virion of infectious.Therefore, as disease
The primary link of poison infection host cell, cell entry have become the important target of antiviral drugs screening.Studies have shown that EV71
Different types of target cell can be invaded using different host factor and route of infection, for example EV71 is relied on by clathrin
Endocytic pathway (clathrin-mediated endocytosis) infect human rhabdomyosarcoma's cell
(rhabdomyosarcoma,RD)[Yamayoshi,S.,et al.,Scavenger receptor B2 is a cellular
receptor for enterovirus71.Nat Med,2009.15(7):p.798-801.]；And infect Jurkat T lymph
Cell line then mainly using alveole rely on endocytic pathway (caveolar-dependent endocytosis) [Lin HY,
Yang YT,Yu SL,et al.Caveolar endocytosis is required for human PSGL-1-
mediated enterovirus 71infection.J Virol.2013,87(16):9064-76.].Currently, about EV71
Approach and the mechanism for infecting Caco-2 are still unclear.
For Virus entry target cell mainly by means of the key molecule for participating in the transport of host cell Self substances, these hosts are thin
After birth transport molecule plays an important role in the formation of vesica, endocytosis and secretion in the cross-film matter transportation of cell.Such as
Rab5a, Rab5b, Rab5c have mediated transhipment (Gorvel J of batch clathrin clothing vesicle from cytoplasma membrane to early endosome
P,Chavrier P,Zerial M,et al.rab5controls early endosome fusion in vitro.[J]
.Cell,1991,64(5):915-925.)；Clathrin (clathrin) is mainly responsible for receptor-mediated endocytic processes；It is small
Nest protein family molecule caveolin-1 (CAV1), caveolin-2 (CAV2), caveolin-3 (CAV3) by matter transportation extremely
Golgiosome；Flotillin molecule can interact in simultaneously with protein molecular in Lipid Rafts and swallow into the cell；ADP ribosylation
6 molecule of the factor participates in reconciling cytoplasma membrane transport and actin intracellular assembly；Gtpase activating protein molecule GRAF1 is in grid
There is important adjustment effect in the vesicle transport of albumen independent form；Interleukin-2 Receptor endocytosis has adjusted signal path
And affect cell Proliferation (Jason Mercer, Mario Schelhaas, et al.Virus Entry by
Endocytosis.Annu Rev Biochem.2010；79:803-833.).In the above molecule, caveolin-1 and
Clathrin is proved to take part in the process of EV71 infection Jurkat T lymphocyte and RD cell respectively, and other molecules exist
Effect in EV71 infection does not have been reported that also.
Vacuole sorting protein 4A (vacuolar protein sorting 4homolog A, VPS4A) is by VPS4A gene
Coding, another homologous protein are Vps4B, both belong to ATP enzyme 174-263 tPA member, provide energy by hydrolysising ATP, with
Body sorting compound in transhipment is required (Endosomal Sorting Complex Required for Transport,
ESCRT) the GAP-associated protein GAP interaction of third member ESCRT-III, participates in deformation and the shear history of cell membranous structure
In.Its principal biological function include the formation of more vesica bodies, cytoplasm separation, virus budding release etc. (Henne WM,
Buchkovich NJ,Emr SD.The ESCRT pathway.[J].Developmental Cell,2011,21(1):77–
91.Votteler J,Wi.S.Virus budding and the ESCRT pathway.[J].Cell Host&Microbe,
2013,14(3):232-241.)。
Tyrosine kinase substrate (the hepatocyte growthfactor-regulated that hepatocyte growth factor is adjusted
Tyrosine kinasesubstrate, HRS) important molecule as ESCRT-0, it can recognize and raise the modification of model elementization
Substrate, make substrate enter more vesica bodies mediate sorting and degradation pathway (Henne WM, Buchkovich NJ, Emr
SD.The ESCRT pathway.[J].Developmental Cell,2011,21(1):77–91.Votteler J,
Wi.S.Virus budding and the ESCRT pathway.[J].Cell Host&Microbe,2013,14(3):
232-241.)。
Recent study discovery VPS4A and HRS can mediate the thin of a variety of viruses such as Coxsackie virus A 9, rotation virus
Born of the same parents invasion, show VPS4A and HRS virus infection invasion the stage also play an important role (Huttunen M, Waris M,
Kajander R,et al.Coxsackievirus A9infects cells via nonacidic multivesicular
bodies.[J].Journal of Virology,2014,88(9):5138-5151.Silva-Ayala D,López T,
Gutiérrez M,et al.Genome-wide RNAi screen reveals a role for the ESCRT
complex in rotavirus cell entry.[J].Proc Natl Acad Sci U S A,2013,110(25):
10270-10275.)。
Host cell (especially Caco-2 cell) is infected in EV71 about VPS4A and HRS molecule there is presently no any
The report of middle effect is furtherd investigate the two molecules to be promoted to infect EV71 and be recognized with pathogenic mechanism
Know, or prevention and treatment EV71 infection provides new thinking and target spot.
Summary of the invention
The purpose of the present invention is to provide a kind of novel targets of anti-enterovirns type 71 infection.
Another object of the present invention is to provide vacuole sorting protein 4A (vacuolar protein sorting
4homolog A, VPS4A) new application, especially anti-enterovirns type 71 infection in application.
The third object of the present invention is to provide the siRNA of interference VPS4A developed by molecule.
Main technical schemes of the invention are:
The present invention lowers target cell host using human colon cancer cell (Caco-2) as target cell, using RNA perturbation technique
The expression of albumen, to find the host factor that EV71 infection human colon cancer cell (Caco-2) can be effectively suppressed, to reach
The purpose of intestinal tract blocking virus infection human body.This experimental selection one group of host cell transmembrane transporter molecules are sieved
Choosing, these molecules play an important role in the endocytosis of vesica and secretion, they are often in the cross-film matter transportation of host cell
It is also in virus infection easily by viral " abduction " and the molecule that utilizes.These molecules include: ADP ribosylation factor 6
(ARF6), caveolin-1 (CAV1), caveolin-2 (CAV2), caveolin-3 (CAV3), clathrin light-chain A
(CLTA), clathrin light-chain B (CLTB), clathrin heavy chain (CLTC), Flotillin albumen 1 (FLOT1), Flotillin
Albumen 2 (FLOT2), gtpase activating protein (GRAF1), Interleukin-2 Receptor (IL2RB), VPS4A, HRS, Rab5a,
Rab5b,Rab5c.Complete sequence and mRNA sequence are obtained by retrieving NCBI GeneBank, using existing Internet resources and often
Biological analysis is carried out to these genes with software, then the target sequence for selecting code area to design as siRNA designs siRNA,
By lowering these molecules, to observe the influence to EV71 infection.
Present invention discover that vacuole sorting protein 4A (vacuolar protein sorting 4homolog A, VPS4A) exists
It plays an important role in EV71 infection Caco-2, lowers the expression of VPS4A, can obviously inhibit the infection of EV71.
The first aspect of the present invention provides vacuole sorting protein 4A (VPS4A) in preparation prevention or treatment enterovirus
71 types infect the application in (disease) drug.
A kind of novel targets the present invention provides VPS4A as anti-enterovirns type 71 infection.
Further, the present invention also provides vacuole sorting protein 4A (VPS4A) in preparation prevention or treatment hand-foot-and-mouth disease medicine
Application in object.
Vacuole sorting protein 4A (VPS4A) of the present invention is in preparation prevention or treatment enterovirns type 71 infection medicine
In application, which specifically refers to the reagent for being able to suppress or lowering the expression quantity of VPS4A.
The reagent for the expression quantity that VPS4A is lowered in the inhibition can be siRNA, shRNA, comprising siRNA, shRNA
Recombinant vector (such as plasmid).
The second aspect of the present invention, the present invention provides the RNA interferings of vacuole sorting protein 4A (VPS4A) to prevent in preparation
Or the application in treatment enterovirns type 71 infection medicine, the sequence of the RNA interfering (siRNA) are as follows:
Vacuole sorting protein 4A interference RNA sequence:
CCAUGGAGAUGACUUGGAUUU(SEQ ID NO:34)
GUCCCAGUCAAUACAGAGUUU(SEQ ID NO:35)
GGUAUCUCAACCGGAACUACU(SEQ ID NO:36)
Wherein, the expression quantity effect for lowering VPS4A with the siRNA as shown in SEQ ID NO:35 is best, and reduces EV71
It is the most obvious to the infection of Caco-2 cell；
The present invention screens the new host cellular molecules VPS4A for being able to suppress EV71 infection Caco-2 cell.VPS4A base
After lowering, the normal physiological function of cell is not influenced, but obviously inhibit infection of the EV71 to Caco-2 cell.
Therefore hand-foot-and-mouth disease, nervous system and cardiorespiratory system caused by the present invention is clinical prevention and treats because of EV71 infection
Illness provides new target spot and therapeutic scheme.
Detailed description of the invention
Fig. 1 is the jamming effectiveness and cytotoxicity detection after transfecting effective siRNA, and primary axis indicates interference effect in figure
Rate, secondary axis indicate the influence to cytotoxicity；
CTRL: the Caco-2 groups of cells (ghost group) of any siRNA is not transfected；
NT-CTRL: the Caco-2 groups of cells (negative control group) of transfection non-targeting siRNA；
SiRNA: Caco-2 groups of cells (experimental group) of the transfection for the siRNA of each target gene.
Fig. 2 is the influence after each host molecule of immuno-fluorescence assay is lowered to EV71 infection, and wherein A is to lower each molecule
Afterwards to the fluorescence detection figure of viral infection, B is the inhibiting rate figure after lowering each molecule to virus infection；
CTRL: the Caco-2 groups of cells (ghost group) of any siRNA is not transfected；
NT-CTRL: the Caco-2 groups of cells (negative control group) of transfection non-targeting siRNA；
SiRNA: Caco-2 groups of cells (experimental group) of the transfection for the siRNA of each target gene.
Fig. 3 be transfect VPS4A, HRS molecule disturbance sequence after jamming effectiveness and on the infective influence of EV71
Figure, A be VPS4A gene mRNA level in-site detect figure, B be HRS because mRNA level in-site detect figure, C be interference VPS4A gene after
EV71 virus quantity detection figure, D are EV71 virus quantity detection figure after interference HRS gene；
CTRL: the Caco-2 groups of cells (ghost group) of any siRNA is not transfected；
NT-CTRL: the Caco-2 groups of cells (negative control group) of transfection non-targeting siRNA；
VPS4A-34: Caco-2 groups of cells of the transfection for the siRNA (SEQ ID NO:34) of VPS4A gene；
VPS4A-35: Caco-2 groups of cells of the transfection for the siRNA (SEQ ID NO:35) of VPS4A gene；
VPS4A-36: Caco-2 groups of cells of the transfection for the siRNA (SEQ ID NO:36) of VPS4A gene.
HRS-37: Caco-2 groups of cells of the transfection for the siRNA (SEQ ID NO:37) of HRS gene；
HRS-38: Caco-2 groups of cells of the transfection for the siRNA (SEQ ID NO:38) of HRS gene；
HRS-39: Caco-2 groups of cells of the transfection for the siRNA (SEQ ID NO:39) of HRS gene.
Specific embodiment
Now in conjunction with embodiment and attached drawing, the present invention is described in detail, but implementation of the invention is not limited only to this.
The reagents and materials used in the present invention are commercially available or can prepare by literature method.Tool is not specified in the following example
The experimental method of concrete conditions in the establishment of a specific crime, usually according to normal condition such as Sambrook et al. " molecular cloning: lab guide " (New
York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or according to normal conditions, or
According to the normal condition proposed by manufacturer.Unless otherwise stated, otherwise percentage and number are calculated by weight.
Embodiment 1:
1, design, synthesize the specific siRNA sequence of each host cellular molecules.
1.1 are directed to each target gene, and retrieval NCBI GeneBank obtains complete sequence and mRNA sequence, and utilization is existing
Internet resources and popular software carry out biological analysis, the target sequence for selecting code area to design as siRNA to each target gene.
It referring to siRNA design principle, and is compared by the blast function of GeneBank database with human genomic sequence, really
It protects without homology；Exclude the potential siRNA of 5 ' continuous 8 bases in end and the pairing of other genes of aitisense chain；It excludes any
The potential siRNA of one section of continuous 14 base and the pairing of other genes.And Pre-Evaluation measurement is carried out using design software, select 3
A optimal kinetic parameter target spot enters subsequent experimental process, and each gene synthesizes 3 interference sequences altogether, is shown in Table 1.
The synthesis of 1.2 single-stranded siRNA is completed with purifying by Invitrogen company.
The design of table 1.siRNA target spot
2, siRNA sequence screening is identified with interference effect
2.1 RNA transfection
Transfection procedure is referring to 2000 specification of Lipofectamine
1) shift to an earlier date 12-16 hours and Caco-2 cell (purchased from Sciencell, deposit number: 1000) is layered on the training of 24 hole cells
It supports and is cultivated on plate, so that cell density is 80%-90% when transfection.
2) it takes 2 μ LLipofectamine 2000 to be added in 50 μ Lopti-MEM and softly mixes, be incubated at room temperature 5 minutes；
Separately take the RNA interfering and 50 μ Lopti-MEM mixing that 5 μ L concentration are 5 μM.After incubation, by diluted Lipofectamine
2000 transfection reagents are added in diluted RNA, and soft pressure-vaccum mixes.After being incubated at room temperature 20min, it is added in Caco-2 cell,
400 μ Lopti-MEM are added, so that the final concentration of 50nM of RNA.
3) replacement in 6-8 hours contains dual anti-fresh culture after transfecting.
2.2 real-time fluorescence quantitative PCRs (qRT-PCR) detect the mRNA level in-site of each host molecule
1) TRIzol extracts the total serum IgE of control group and interference group cell, the specific steps are as follows:
After transfection 48 hours, culture supernatant is gone, 1ml TRIzol is added in cell, is sufficiently mixed lysis at room temperature cell 3-
5 minutes.The chloroform of 1/5 volume is added, is vigorously mixed manually 15 seconds.It is centrifuged 15 minutes in 4 DEG C, 12,000 turns.Take upper strata aqueous phase
And be transferred in new EP pipe, isometric isopropanol is added, is sufficiently mixed, precipitation at room temperature 10 minutes.It is left in 4 DEG C, 12,000
The heart 10 minutes.Supernatant is abandoned, 75% ethyl alcohol of 1ml pre-cooling is added.In 4 DEG C, 12,000 centrifugation 5 minutes.Supernatant is sufficiently abandoned, room temperature is dried in the air
Dry RNA precipitate is added DEPC processing water dissolution precipitating, obtains total serum IgE.
2) cDNA of control group and interference group cell is obtained using takara reverse transcription reagent box, the specific steps are as follows:
Following reaction system is added in PCR pipe,
Soft mixing mixes, and is placed in 37 DEG C and reacts 15 minutes, is subsequently placed in 85 DEG C of heating, 5 seconds inactivation reverse transcriptases.
3) fluorescent quantitation qRT-PCR is detected
It is reacted using the SYBR Premix Ex Taq kit of takara, reaction system is as follows,
Two-step method amplification is carried out using Rotor Gene 3000A instrument, 95 DEG C of initial denaturation 2min carry out 40 PCR and follow
Ring, 95 DEG C 5 seconds, 60 DEG C 30 seconds.
3, cytotoxicity experiment
The influence of cell proliferation after transfection siRNA is detected using CCK-8 method, the specific steps are as follows:
Logarithmic growth phase cell is collected, 96 orifice plates are inoculated in 3000 density in every hole.After cell pellet overnight is adherent, turn
Each siRNA is contaminated, culture detected cell proliferative conditions after 48 hours.Original culture medium is discarded, every hole is added containing 10 μ L CCK-8
110 μ L of fresh culture uses multi-function microplate reader in each hole absorbance value of 450nm wavelength detecting after cultivating 3h.The independent weight of experiment
It is 3 times multiple, calculate average value.
4, EV71 virus infection Caco-2 cell
The EV71 virus infection of 4.1 Caco-2 cells is tested
60 hours after Caco-2 cell transfecting RNA, the experiment of EV71 virus infection is carried out.Culture supernatant is sucked out, pre-temperature is used
PBS rinse 2 times, EV71 is inoculated with the virus quantity of MOI=0.1, discards virus liquid after 37 DEG C of incubation 2h, and with pre-temperature PBS rinse 3
It is secondary, fresh culture is added and continues to cultivate.
4.2 immunofluorescence dyeings detect EV71 antigen presentation
Continue to cultivate 48h after Caco-2 cell infection virus, using the expression of immuno-fluorescence assay viral antigen, specifically
Steps are as follows:
1) cell is fixed: the culture solution in 96 orifice plates being removed, PBS is added and cleans cell 2 times, it is pre- that 100 μ l are added in every hole
Cold methanol fixes 20min under the conditions of -20 DEG C, is cleaned cell 3 times with the PBS of pre-cooling.
2) permeable membrane: 100 μ l 0.1%TritonX-100 are added in the cell per well after fixed, are incubated at room temperature 15min, with pre-
Cold PBS is washed 3 times.
3) close: 100 μ l 3%BSA are added in every hole, are incubated for 1h at room temperature.
4) primary antibody is incubated for: EV71 specificity source of mouse monoclonal antibody 10F0 (1:2000 dilution) 100 μ l, incubation at room temperature is added in every hole
1h is washed 3 times with the PBS of pre-cooling.
5) secondary antibody is incubated for: the anti-mouse IgG of 488 fluorescent marker of AF (1:1000 dilution) 100 μ l are added in every hole, and room temperature, which is protected from light, incubates
1h is educated, is protected from light washing 2 times with the PBS of pre-cooling.
6) mark nucleus: nucleus fluorescent dye DAPI (1:5000, PBS dilution) is added in every hole, and room temperature is protected from light incubation
15min is protected from light washing 3 times with the PBS of pre-cooling.
7) it is detected under fluorescence microscope and calculates green 488 positive cell clone number of AF.
4.3 qRT-PCR detect EV71 virus quantity in cell
Continue to cultivate 48h after Caco-2 cell infection virus, the total of control group and interference group cell is extracted using TRIzol
RNA, and reverse transcription obtains cDNA, detects EV71 virus quantity by qRT-PCR.Specific steps are the same as shown in 2.2.
5, experimental result:
1, it designs, synthesize and screen effective siRNA
For each objective gene sequence, we devise multiple RNA interfered target sequences, and are carried out using design software
Pre-Evaluation measurement, selects 3 optimal kinetic parameter target spots to enter subsequent experimental process, each gene synthesizes 3 interference altogether
Sequence, as shown in table 1.
Using the method for in-vitro transfection, the RNA interfering of each gene is transfected into Caco-2 cell, is passed through after 48h
QRT-PCR method detects the jamming effectiveness of each RNA interfering, finally screens the optimal siRNA sequence of interference effect and carries out subsequent reality
It tests, jamming effectiveness is as shown in table 2.
2 qRT-PCR method of table detects siRNA interference sequence to the downward efficiency of related host gene
Note: the Caco-2 groups of cells (ghost group) of any siRNA CTRL: is not transfected
NT: the Caco-2 groups of cells (negative control group) of transfection non-targeting siRNA
SiRNA: Caco-2 groups of cells (experimental group) of the transfection for the siRNA of each target gene.
2, the jamming effectiveness after siRNA interference and cytotoxicity detection
The effective siRNA for each host molecule picked out transfects Caco-2 cell, and 48h passes through qRT-PCR after transfection
Method detects the jamming effectiveness of each RNA interfering, while using the influence after CCK8 detection transfection to Caco-2 cytotoxicity.
As a result as shown in Figure 1, transfecting effective siRNA group compared with CTRL group, phase can obviously be inhibited after transfecting each siRNA
Answer the expression (P < 0.01) of gene.Transfect VPS4A siRNA (SEQ ID NO:35) and HRS siRNA (SEQ ID NO:
39) inhibition efficiency is up to 72.17% and 78.88% respectively.
Cytotoxicity experiment does not generate apparent cytotoxicity (P > 0.05) after showing each siRNA transfection, to thin
The normal physiological function of born of the same parents does not have an impact, can be used for subsequent experimental.
3, the influence after siRNA interference to EV71 virus infection
After transfecting expression of the effective siRNA of each host molecule to lower host cell relevant molecule, same dose is infected
EV71 virus, after infecting 48h, to the influence of EV71 infection, discovery after being lowered using each host molecule of immuno-fluorescence assay
Compared with the control group, transfect VPS4A siRNA (SEQ ID NO:35) and HRS siRNA (SEQ ID NO:39) makes respectively
After VPS4A gene and HRS gene deregulation, hence it is evident that reduce infection (Fig. 2A) of the EV71 to Caco-2 cell.By calculating virus
Amount discovery respectively reaches 59.44% and 68.57% to the inhibiting rate of virus after VPS4A and HRS gene deregulation, and remaining molecule
Downward there is no the obvious infection (P > 0.05) (Fig. 2 B) for inhibiting EV71 to Caco-2 cell.
For the inhibiting effect that clear VPS4A and HRS infects EV71, three VPS4A and HRS molecules are transfected respectively
SiRNA observes the influence to viral infection.The result shows that different siRNA is different to the downward efficiency of VPS4A with HRS molecule
(Fig. 3 A, 3B), wherein the jamming effectiveness of VPS4A siRNA (SEQ ID NO:35) and HRS siRNA (SEQ ID NO:39) is most
Height, it is consistent with the result of front.Influence discovery infective on EV71, three VPS4A and three HRS molecules after detection interference
SiRNA 50% or more can reach to the inhibiting rate of virus infection, and with the downward efficiency to VPS4A and HRS molecule
Increase, to the inhibiting rate of EV71 infection also at raising (Fig. 3 C, 3D), VPS4A and HRS molecule is prompted to infect Caco-2 in EV71
In play an important role.
Therefore, VPS4A and HRS, which can be used as, inhibits EV71 to new host's target spot of Caco-2 cell infection.
Pass through the above the results show: the present invention screen be able to suppress two of EV71 infection Caco-2 cell it is new
Host cellular molecules VPS4A and HRS.After VPS4A and HRS gene deregulation, the normal physiological function of cell is not influenced, but obvious
Inhibit infection of the EV71 to Caco-2 cell.Therefore the present invention provides new target for clinical prevention and treatment EV71 infection
Point.
The preferred embodiment of the present invention has been described in detail above, but the invention be not limited to it is described
Embodiment, those skilled in the art can also make various equivalent on the premise of not violating the inventive spirit of the present invention
Variation or replacement, these equivalent variation or replacement are all included in the scope defined by the claims of the present application.
Claims (4)
1. the reagent for inhibiting or lowering vacuole sorting protein 4A expression quantity infects medicine in preparation prevention or treatment enterovirns type 71
Application in object.
2. the reagent of inhibition according to claim 1 or downward vacuole sorting protein 4A expression quantity is in preparation prevention or treatment
Application in enterovirns type 71 infection medicine, which is characterized in that disease caused by the enterovirns type 71 infects is hand
Sufficient stomatosis.
3. it is according to claim 1 or 2 inhibition or downward vacuole sorting protein 4A expression quantity reagent preparation prevention or
Treat the application in enterovirns type 71 infection medicine, which is characterized in that vacuole sorting protein 4A table is lowered in the inhibition
Reagent up to amount is siRNA, shRNA of vacuole sorting protein 4A or the recombinant vector comprising siRNA, shRNA.
4. the reagent of inhibition according to claim 3 or downward vacuole sorting protein 4A expression quantity is in preparation prevention or treatment
Application in enterovirns type 71 infection medicine, which is characterized in that the sequence of the siRNA of the vacuole sorting protein 4A is selected from
It is any below:
GGAUUAUUUACGAAGCAAAUU(SEQ ID NO:34),
CCAUGGAGAUGACUUGGAUUU(SEQ ID NO:35),
GUCCCAGUCAAUACAGAGUUU(SEQ ID NO:36).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510287415.6A CN105288655B (en) | 2015-05-29 | 2015-05-29 | Application of the vacuole sorting protein 4A in preparation prevention and treatment enterovirns type 71 infection medicine |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510287415.6A CN105288655B (en) | 2015-05-29 | 2015-05-29 | Application of the vacuole sorting protein 4A in preparation prevention and treatment enterovirns type 71 infection medicine |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105288655A CN105288655A (en) | 2016-02-03 |
| CN105288655B true CN105288655B (en) | 2019-03-29 |
Family
ID=55186919
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510287415.6A Active CN105288655B (en) | 2015-05-29 | 2015-05-29 | Application of the vacuole sorting protein 4A in preparation prevention and treatment enterovirns type 71 infection medicine |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105288655B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112057621B (en) * | 2019-06-11 | 2021-07-02 | 中国人民解放军第二军医大学 | Application of solute carrier family 7member 7in preparation of medicine for preventing and treating enterovirus 71infection |
| CN112057622B (en) * | 2019-06-11 | 2021-07-06 | 中国人民解放军第二军医大学 | Application of ATP (adenosine triphosphate) binding cassette transmembrane transport subfamily C member 3 in preparation of medicine for preventing and treating enterovirus 71infection |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101402944A (en) * | 2008-11-17 | 2009-04-08 | 中国医学科学院医学生物学研究所 | EV-71 virus seed, inactivated vaccine for human and method of producing the same |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2003301759A1 (en) * | 2002-05-15 | 2004-05-25 | University Of Utah Research Foundation | Human vps4a and vps4b functions in viral budding |
-
2015
- 2015-05-29 CN CN201510287415.6A patent/CN105288655B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101402944A (en) * | 2008-11-17 | 2009-04-08 | 中国医学科学院医学生物学研究所 | EV-71 virus seed, inactivated vaccine for human and method of producing the same |
Non-Patent Citations (3)
| Title |
|---|
| Coxsackievirus A9 Infects Cells via Nonacidic Multivesicular Bodies;Moona Huttunen等;《Journal of Virology》;20140226;第88卷(第9期);第5138-5151页，尤其是第5138页摘要部分，第5147页左栏第2段，图6-7 |
| Echovirus 1 infection depends on biogenesis of novel multivesicular bodies;Mikko Karjalainen等;《Cellular Microbiology》;20110922;第13卷(第12期);第1975-1995页，尤其是第1975页摘要部分，第1978页右栏第3段，图3 |
| EV71小鼠适应株制备及体内外感染特点;朵建英等;《中国实验动物学报》;20101031;第18卷(第5期);383-389页 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105288655A (en) | 2016-02-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Deng et al. | Inhibition of enterovirus 71 by adenosine analog NITD008 | |
| Kramski et al. | A novel highly reproducible and lethal nonhuman primate model for orthopox virus infection | |
| Elsebai et al. | Pan-genotypic hepatitis C virus inhibition by natural products derived from the wild Egyptian artichoke | |
| CN105267948B (en) | Application of the tyrosine kinase substrate that hepatocyte growth factor is adjusted in preparation prevention and treatment enterovirns type 71 infection medicine | |
| CN105288655B (en) | Application of the vacuole sorting protein 4A in preparation prevention and treatment enterovirns type 71 infection medicine | |
| Mi et al. | Isolation and characterization of porcine astrovirus 5 from a classical swine fever virus-infected specimen | |
| CN105435246B (en) | Application of the autophagy correlated protein 12 in prevention and treatment enterovirns type 71 infection | |
| Mutso et al. | Basic insights into Zika virus infection of neuroglial and brain endothelial cells | |
| CN105535975B (en) | Application of the vesicle-associated membrane albumen 1 in prevention enterovirns type 71 infection | |
| Tong et al. | A novel approach to display structural proteins of hepatitis C virus quasispecies in patients reveals a key role of E2 HVR1 in viral evolution | |
| Nam et al. | Radicicol inhibits chikungunya virus replication by targeting nonstructural protein 2 | |
| CN105267984B (en) | Application of the ADP ribosylation factor 6 in prevention and treatment enterovirns type 71 infection | |
| CN105311647B (en) | Application of the Cofilin in prevention and treatment japanese encephalitis virus infection | |
| Wang et al. | Inhibition of lysosome-tethered Ragulator-Rag-3D complex restricts the replication of Enterovirus 71 and Coxsackie A16 | |
| CN105435245B (en) | Application of the calcium integrin Binding Protein 1 in prevention and treatment enterovirns type 71 infection | |
| CN112057621B (en) | Application of solute carrier family 7member 7in preparation of medicine for preventing and treating enterovirus 71infection | |
| CN105288654B (en) | Application of the protein tyrosine kinase FYN oncogene in prevention and treatment enterovirns type 71 infection | |
| CN105497874B (en) | Application of the sorting connection albumen 1 in prevention and treatment enterovirns type 71 infection | |
| CN105267985B (en) | Application of the n-ethylmaleimide sensitive factor in prevention japanese encephalitis virus infection | |
| CN105311646B (en) | Application of the ezrin in prevention and treatment japanese encephalitis virus infection | |
| CN105497918B (en) | Application of dynamin 1in preventing and treating enterovirus 71infection | |
| CN105311645B (en) | Application of the embryo FYN related substrates EFS in prevention and treatment enterovirns type 71 infection | |
| CN112057622B (en) | Application of ATP (adenosine triphosphate) binding cassette transmembrane transport subfamily C member 3 in preparation of medicine for preventing and treating enterovirus 71infection | |
| CN112057453B (en) | Use of ENC002 and its analogues for treating or preventing enterovirus infection | |
| CN113750219B (en) | Application of TMEM184C in preparation of medicine for preventing or treating Japanese encephalitis virus infection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |