CN105435246B - Application of the autophagy correlated protein 12 in prevention and treatment enterovirns type 71 infection - Google Patents

Abstract

It is novel targets and the application of a kind of anti-enterovirns type 71 infection the present invention relates to field of biomedicine technology.The present invention is using Human Brain Microvascular Endothelial (HBMEC) as target cell; the expression of target cell host protein is lowered using RNA perturbation technique; to find the host factor that EV71 infection Human Brain Microvascular Endothelial (HBMEC) can be effectively suppressed; to protect the function of blood-brain barrier, pre- anti-virus passes through blood-brain barrier and infects central nervous system.The present invention is found through experiments that autophagy correlated protein 12 (autophagy related protein 12, ATG12) plays an important role in EV71 infection HBMEC, lowers the expression of ATG12, can obviously inhibit the infection of EV71.The present invention provides application of the ATG12 in preparation prevention or treatment enterovirns type 71 infection medicine.

Description

Application of the autophagy correlated protein 12 in prevention and treatment enterovirns type 71 infection

Technical field

It is novel targets and the application of a kind of anti-enterovirns type 71 infection the present invention relates to field of biomedicine technology.

Background technique

Enterovirns type 71 (enterovirus 71, EV71) belongs to Picornaviridae enterovirus genus people's enteron aisle A viroid is one of the main pathogens for leading to hand-foot-and-mouth disease (Hand-foot-mouth disease, HFMD).Currently, hand Sufficient stomatosis breaks out simultaneously prevalence, the especially Asian-Pacific area in the multiple areas in the world.In China, brothers are broken out from 2008 Nian Ji great provinces and cities Since stomatosis epidemic situation, the number of the infected and the death rate of the disease can not have always been high any more, and every annual report morbidity number is more than 1,000,000, extremely Die several nearly 1000.Hand-foot-and-mouth disease principal pathogenetic crowd be 5 years old Infants Below, clinical manifestation be fever, hand, foot, buttocks with And there are the symptoms such as bleb in the positions such as oral mucosa；A small number of infants can develop as patient with severe symptoms, central nervous system occur (central nervous system, CNS) lesion, including aseptic meningitis, brainstem encephalitis, encephalomyelitis and neural source Property pulmonary edema etc., seriously threaten infant life and health [Solomon T1, Lewthwaite P, Perera D, Cardosa MJ,McMinn P,Ooi MH.Virology,epidemiology,pathogenesis,and control of enterovirus 71.Lancet Infect Dis.2010Nov；10(11):778-90.].Hand-foot-and-mouth disease especially severe disease Example is mostly caused by enterovirns type 71 (EV71) infection.However, causing the treatment of hand-foot-and-mouth disease to there is no specifically about EV71 at present Efficient antiviral drugs also comes out without effective vaccine in terms of prevention clinically still based on symptomatic treatment.

EV71 infection has Neural invasion, easily causes serious CNS disease and its complication, this is also to lead to hand-foot-and-mouth disease Patient evolution is the main reason for severe is even dead.Wherein, brain stem is position [Tee, K.K., the et most easily infected by EV71 al.Evolutionary genetics of human enterovirus 71:origin,population dynamics, natural selection,and seasonal periodicity of the VP1gene.J Virol,2010.84(7): P.3339-50.], research confirms to be able to detect that EV71 gene at positions such as the brain stem neurons of EV71 patient with severe symptoms and resist Former presence, it was demonstrated that EV71 can enter CNS.EV71 needs to pass through blood-brain barrier through blood infection cycle CNS, however virus how Mechanism across blood-brain barrier intrusion CNS is not clear.Blood-brain barrier (Blood Brain Barrier, BBB) is to be located at circulation Main barrier together between system and central nervous system, it limits different material freely transporting between two positions It is defeated, the homeostasis and protecting in invasion of the CNS from extraneous pathogenic microorganism for maintaining CNS is played a crucial role [Dyrna F,Hanske S,Krueger M,Bechmann I.The blood-brain barrier.J Neuroimmune Pharmacol.2013；8(4):763-73.].Blood-brain barrier is the brain microvessel endothelial cells in vitro and therebetween close by no fenestra The cell conjugate that connection, astroglial foot processes, cell basement membrane and pericyte collectively constitute.It is compound in this cell In body, most important structure of matter basis is brain microvessel endothelial cells in vitro (Brain Microvascular Endothelial Cells, BMECs) and its closely connect, the loss of property in neat formation is considered as that one of virus infection cause brain tissue impairment is important Reason.Therefore, it verifies the mechanism of EV71 infection BMECs and finds new antiviral target spot with this, for protection blood-brain barrier Function, and central nervous system infection caused by prevention and treatment EV71 are most important.

In order to which effectively infection cell, virus must utilize membrane molecule and its vesicular transport system completion pair of host cell The invasion of host cell could be replicated in the cell and be released the progeny virion of infectious.Therefore, as disease The primary link of poison infection host cell, cell entry have become the important target of antiviral drugs screening.Studies have shown that EV71 Different types of target cell can be invaded using different host factor and route of infection, for example EV71 is relied on by clathrin Endocytic pathway (clathrin-mediated endocytosis) infect human rhabdomyosarcoma's cell (rhabdomyosarcoma,RD)[Yamayoshi S,et al.Scavenger receptor B2is a cellular receptor for enterovirus71.Nat Med,2009.15(7):p.798-801.]；And infect Jurkat T lymph Cell line then mainly using alveole rely on endocytic pathway (caveolar-dependent endocytosis) [Lin HY, Yang YT,Yu SL,et al.Caveolar endocytosis is required for human PSGL-1- mediated enterovirus 71infection.J Virol.2013,87(16):9064-76.].Currently, about EV71 Approach and the mechanism for infecting BMECs are still unclear.

For Virus entry target cell mainly by means of the key molecule for participating in the transport of host cell Self substances, these hosts are thin After birth transport molecule plays in the formation and maturation of the vesicas such as inner body, autophagosome important in the cross-film matter transportation of cell Effect.As clathrin (clathrin) is mainly responsible for receptor-mediated endocytic processes；Caveolin family molecule Caveolin-1 (CAV1) is by matter transportation to golgiosome；Polyubiquitinated proteins aggregation is positioned at autophagosome by P62 molecule； The fusion process of small G-protein family molecule RAB7 mediation autophagosome and lysosome；Flotillin molecule can be with albumen in Lipid Rafts It is swallowed in interaction of molecules simultaneously intracellular；(Jason Mercer,Mario Schelhaas,et al.Virus Entry by Endocytosis.Annu Rev Biochem.2010；79:803-833.).In these molecules, caveolin-1 and Clathrin is proved to take part in the process of EV71 infection Jurkat T lymphocyte and RD cell respectively, and other molecules exist Effect in EV71 infection does not have been reported that also.

Cell autophagy is research hotspot of the last decade in life science and medical domain after Apoptosis.Cell is certainly It bites in eukaryocyte as a kind of conservative function, by the isolation of characteristic lipid bilayer vesicle and degrading waste albumen or declines Old cell device maintains the balance and stabilization of metabolism intracellular, and the survival, proliferative capacity with cell are closely related, and swollen in confrontation Take on key player in the disease progressions such as tumor, nerve retrograde affection.In recent years, cell autophagy is found in inherent immunity and fits It equally plays a significant role during answering property is immune.One complete autophagy process is formed and autophagosome two links of degradation by autophagosome Composition, the former mainly includes that autophagy starting, autophagosome extend closure and autophagy body maturation, and it is molten that the latter is mainly responsible for autophagy Task that enzyme body is formed and content is degraded.Confirm that 7 type of echovirus (echovirus 7) invasion Caco-2 cell depends on Core component (Chonsaeng K, the Jeffrey MB.Echovirus 7Entry into Polarized of autophagy machine Caco-2Intestinal Epithelial Cells Involves Core Components of the Autophagy Machinery.JVI.2014；88 (1): 434-443.), and foot and mouth disease virus (foot-and-mouth disease virus, FMDV) autophagy approach (Stephen B, Elizabeth B, the et al.Foot-and- that invasion Chinese hamster ovary celI is then mediated by P62 Mouth Disease Virus Induces Autophagosomes during Cell Entry via a Class III Phosphatidylinositol3-Kinase-Independent Pathway.JVI.2012；86(23):12940- 12953.).However, the invasion stage whether autophagy mechanism participates in EV71 has not yet to see report.

Autophagy is originally found in yeast, there is a autophagy related gene (atg, autophagy-related more than 30 at present Genes it) has been accredited, coded product participates in the formation of autophagy.Mankind's autophagy related gene Atg12 is located at chromosome 5q21- On q22, a length of 4330bp of the cDNA of coding, open reading encoder block expresses the protein comprising 140 amino acid residues. The end C- of its expression product ATG12 is ubiquitin sample bond area, forms one with autophagy GAP-associated protein GAPs such as ATG16 and is positioned at autophagy Ten binary complexs of external film, drive the extension and bending of autophagosome film, and may participate in autophagosome labelled protein LC3 with The esterification of phosphatidyl-ethanolamine.Once being closed, ATG12 will be disengaged from autophagosome and enters the assembling of autophagy machine again autophagosome film Circulation.Therefore, ATG12 is the key-like role of autophagosome building.However during EV71 infection, Atg12 and its expression The effect that product ATG12 is played does not have been reported that also.

There is presently no any reports acted in EV71 infection HBMEC about ATG12 molecule, which is carried out Further investigation can not only promote the understanding to EV71 infection and pathogenic mechanism, or prevention and treatment EV71 infection provides New thinking and target spot.

Summary of the invention

The purpose of the present invention is to provide a kind of novel targets of anti-enterovirns type 71 infection.

Another object of the present invention is to provide the new applications of autophagy correlated protein 12 (ATG12) molecule, especially anti- Application in enterovirns type 71 infection.

The third object of the present invention is to provide the siRNA of interference ATG12 developed by molecule.

Main technical schemes of the invention are:

It is thin to lower target using RNA perturbation technique using Human Brain Microvascular Endothelial (HBMEC) as target cell by the present invention The expression of born of the same parents' host protein, to find the host factor that EV71 infection Human Brain Microvascular Endothelial (HBMEC) can be effectively suppressed, To protect the function of blood-brain barrier.One group of host cell transmembrane transport of this experimental selection and film bubble assembling relevant molecule come into Row screening, these molecules host cell cross-film matter transportation, the formation of vesica with it is mature in play an important role, they Easily by viral " abduction " and the molecule that utilizes often and in virus infection.These molecules include: autophagy GAP-associated protein GAP 12 (ATG12), caveolin-1 (CAV1), P62, RAB7, clathrin heavy chain (CLTC), Flotillin albumen 1 (FLOT1), Synaptotagmin 1 (SYT1).Complete sequence and mRNA sequence are obtained by retrieving NCBI GeneBank, utilizes existing network Resource and popular software carry out biological analysis to these genes, then the target sequence for selecting code area to design as siRNA is set SiRNA is counted, by lowering these molecules, to observe the influence to EV71 infection.

We have found that autophagy correlated protein 12 (autophagy related 12, ATG12) is sent out in EV71 infection HBMEC Important role is waved, the expression of ATG12 is lowered, can obviously inhibit the infection of EV71.

The first aspect of the present invention provides autophagy correlated protein 12 (ATG12) and is used as a kind of anti-enterovirns type 71 sense The novel targets of dye.

The autophagy correlated protein 12 (ATG12), GENBANK ID:NM_004707.

The second aspect of the present invention provides autophagy correlated protein 12 (ATG12) in preparation prevention or treatment enterovirus Application in 71 type infection medicines.

Further, the present invention also provides autophagy correlated protein 12s (ATG12) in preparation prevention or treatment hand-foot-and-mouth disease medicine Application in object.

Autophagy correlated protein 12 (ATG12) of the present invention is in preparation prevention or treatment enterovirns type 71 infection medicine In application, which specifically refers to the reagent for being able to suppress or lowering the expression quantity of ATG12.

The reagent for the expression quantity that ATG12 is lowered in the inhibition can be siRNA, shRNA, comprising siRNA, shRNA Recombinant vector (such as plasmid).

The third aspect of the present invention, the present invention provides the RNA interferings of autophagy correlated protein 12 (ATG12) to prevent in preparation Or the application or autophagy correlated protein 12 treated in enterovirns type 71 infection medicine prevent or treat hand-foot-and-mouth disease medicine in preparation Application in object, the drug are RNA interfering (siRNA), and sequence is as follows:

GCAGCUUCCUACUUCAAUUUU(SEQ ID NO:1)

GCGAACACGAACCAUCCAAUU(SEQ ID NO:2)

GCAGUGAUGGUAAACUGGUUU(SEQ ID NO:3)

Wherein, the expression quantity effect for lowering ATG12 with the siRNA as shown in SEQ ID NO:1 is best, and reduces EV71 pairs The infection of HBMEC cell is the most obvious.

The present invention screens a new host cellular molecules ATG12 for being able to suppress EV71 infection HBMEC cell. After ATG12 gene deregulation, the normal physiological function of cell is not influenced, but obviously inhibit infection of the EV71 to HBMEC cell.

Therefore the disability of blood-brain barrier of the present invention for clinical prevention and caused by treating because of EV71 infection provides new Target spot and therapeutic scheme.

Detailed description of the invention

Fig. 1 is the jamming effectiveness and cytotoxicity detection after transfecting effective siRNA, and primary axis indicates interference effect in figure Rate, secondary axis indicate the influence to cytotoxicity；

CTRL: the HBMEC groups of cells (ghost group) of any siRNA is not transfected；

NT: the HBMEC groups of cells (negative control group) of transfection non-targeting siRNA；

SiRNA: HBMEC groups of cells (experimental group) of the transfection for the siRNA of each target gene.

Fig. 2 is the influence after each host molecule of immuno-fluorescence assay is lowered to EV71 infection, and wherein A is to lower each molecule Afterwards to the fluorescence detection figure of viral infection, B is the inhibiting rate figure after lowering each molecule to virus infection；

CTRL: the HBMEC groups of cells (ghost group) of any siRNA is not transfected；

NT: the HBMEC groups of cells (negative control group) of transfection non-targeting siRNA；

SiRNA: HBMEC groups of cells (experimental group) of the transfection for the siRNA of each target gene.

Fig. 3 is the influence after ATG12 is lowered to EV71 infection, and wherein A is the table that Western Blot detects ATG12 albumen Up to figure, B is the cytopathic effect figure for observing EV71, and C is detection EV71 virus spirogram；

CTRL: the HBMEC groups of cells (ghost group) of any siRNA is not transfected；

NT-CTRL: the HBMEC groups of cells (negative control group) of transfection non-targeting siRNA；

ATG12: HBMEC groups of cells of the transfection for the siRNA (SEQ ID NO:1) of ATG12 gene.

Fig. 4 be transfect ATG12 molecule disturbance sequence after jamming effectiveness and to the infective influence diagram of EV71, A Figure is detected for the mRNA level in-site of ATG12 gene, B is EV71 virus quantity detection figure；

CTRL: the HBMEC groups of cells (ghost group) of any siRNA is not transfected；

NT-CTRL: the HBMEC groups of cells (negative control group) of transfection non-targeting siRNA；

ATG12-1: HBMEC groups of cells of the transfection for the siRNA (SEQ ID NO:1) of ATG12 gene；

ATG12-2: HBMEC groups of cells of the transfection for the siRNA (SEQ ID NO:2) of ATG12 gene；

ATG12-3: HBMEC groups of cells of the transfection for the siRNA (SEQ ID NO:3) of ATG12 gene.

Specific embodiment

Now in conjunction with embodiment and attached drawing, the present invention is described in detail, but implementation of the invention is not limited only to this.

The reagents and materials used in the present invention are commercially available or can prepare by literature method.Tool is not specified in the following example The experimental method of concrete conditions in the establishment of a specific crime, usually according to normal condition such as Sambrook et al. " molecular cloning: lab guide " (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or according to normal conditions, or According to the normal condition proposed by manufacturer.Unless otherwise stated, otherwise percentage and number are calculated by weight.

Embodiment 1:

1 design, the specific siRNA sequence for synthesizing each host cellular molecules.

1.1 are directed to each target gene, and retrieval NCBI GeneBank obtains complete sequence and mRNA sequence, and utilization is existing Internet resources and popular software carry out biological analysis, the target sequence for selecting code area to design as siRNA to each target gene. It referring to siRNA design principle, and is compared by the blast function of GeneBank database with human genomic sequence, really It protects without homology；Exclude the potential siRNA of 5 ' continuous 8 bases in end and the pairing of other genes of aitisense chain；It excludes any The potential siRNA of one section of continuous 14 base and the pairing of other genes.And Pre-Evaluation measurement is carried out using design software, select 3 A optimal kinetic parameter target spot enters subsequent experimental process, and each gene synthesizes 3 interference sequences altogether, is shown in Table 1.

The synthesis of 1.2 single-stranded siRNA is completed with purifying by Invitrogen company.

The design of table 1.siRNA target spot

2siRNA sequence screening and interference effect are identified

2.1RNA transfection

Transfection procedure is referring to 2000 specification of Lipofectamine

1) shift to an earlier date 12-16 hours and HBMEC cell (purchased from Sciencell, deposit number: 1000) is layered on 24 hole cell culture It is cultivated on plate, so that cell density is 80%-90% when transfection.

2) it takes 2 μ L Lipofectamine 2000 to be added in 50 μ L opti-MEM and softly mixes, be incubated at room temperature 5 points Clock；Separately take the RNA interfering and 50 μ L opti-MEM mixing that 5 μ L concentration are 5 μM.It, will be diluted after incubation 2000 transfection reagent of Lipofectamine is added in diluted RNA, and soft pressure-vaccum mixes.After being incubated at room temperature 20min, it is added In HBMEC cell, 400 μ L opti-MEM are added, so that the final concentration of 50nM of RNA.

3) replacement in 6-8 hours contains dual anti-fresh culture after transfecting.

2.2 real-time fluorescence quantitative PCRs (RT-PCR) detect the mRNA level in-site of each host molecule

1) TRIzol extracts the total serum IgE of control group and interference group cell, the specific steps are as follows:

After transfection 48 hours, culture supernatant is gone, 1ml TRIzol is added in cell, is sufficiently mixed lysis at room temperature cell 3- 5 minutes.The chloroform of 1/5 volume is added, is vigorously mixed manually 15 seconds.It is centrifuged 15 minutes in 4 DEG C, 12,000 turns.Take upper strata aqueous phase And be transferred in new EP pipe, isometric isopropanol is added, is sufficiently mixed, precipitation at room temperature 10 minutes.It is left in 4 DEG C, 12,000 The heart 10 minutes.Supernatant is abandoned, 75% ethyl alcohol of 1ml pre-cooling is added.In 4 DEG C, 12,000 centrifugation 5 minutes.Supernatant is sufficiently abandoned, room temperature is dried in the air Dry RNA precipitate is added DEPC processing water dissolution precipitating, obtains total serum IgE.

2) cDNA of control group and interference group cell is obtained using takara reverse transcription reagent box, the specific steps are as follows:

Following reaction system is added in PCR pipe,

Soft mixing mixes, and is placed in 37 DEG C and reacts 15 minutes, is subsequently placed in 85 DEG C of heating, 5 seconds inactivation reverse transcriptases.

3) fluorescence quantitative RT-RCR detects

It is reacted using the SYBR Premix Ex Taq kit of takara, reaction system is as follows,

Two-step method amplification is carried out using Rotor Gene 3000A instrument, 95 DEG C of initial denaturation 2min carry out 40 PCR and follow Ring, 95 DEG C 5 seconds, 60 DEG C 30 seconds.

3 cytotoxicity experiments

The influence of cell proliferation after transfection siRNA is detected using CCK-8 method, the specific steps are as follows:

Logarithmic growth phase cell is collected, 96 orifice plates are inoculated in 3000 density in every hole.After cell pellet overnight is adherent, turn Each siRNA is contaminated, culture detected cell proliferative conditions after 48 hours.Original culture medium is discarded, every hole is added containing 10 μ L CCK-8 110 μ L of fresh culture uses multi-function microplate reader in each hole absorbance value of 450nm wavelength detecting after cultivating 3h.The independent weight of experiment It is 3 times multiple, calculate average value.

4EV71 virus infection HBMEC cell

The EV71 virus infection of 4.1HBMEC cell is tested

72 hours after HBMEC cell transfecting RNA, the experiment of EV71 virus infection is carried out.Culture supernatant is sucked out, pre-temperature is used PBS rinse 2 times, EV71 is inoculated with the virus quantity of MOI=0.1, discards virus liquid after 37 DEG C of incubation 2h, and with pre-temperature PBS rinse 3 It is secondary, fresh culture is added and continues to cultivate.

4.2 immunofluorescence dyeings detect EV71 antigen presentation

Continue to cultivate 48h after HBMEC cell infection virus, using the expression of immuno-fluorescence assay viral antigen, specifically Steps are as follows:

1) cell is fixed: the culture solution in 96 orifice plates being removed, PBS is added and cleans cell 2 times, it is pre- that 100 μ l are added in every hole Cold methanol fixes 20min under the conditions of -20 DEG C, is cleaned cell 3 times with the PBS of pre-cooling.

2) permeable membrane: 100 μ l 0.1%TritonX-100 are added in the cell per well after fixed, are incubated at room temperature 15min, with pre- Cold PBS is washed 3 times.

3) close: 100 μ l 3%BSA are added in every hole, are incubated for 1h at room temperature.

4) primary antibody is incubated for: EV71 specificity source of mouse monoclonal antibody 10F0 (1:2000 dilution) 100 μ l, incubation at room temperature is added in every hole 1h is washed 3 times with the PBS of pre-cooling.

5) secondary antibody is incubated for: the anti-mouse IgG of 488 fluorescent marker of AF (1:1000 dilution) 100 μ l are added in every hole, and room temperature, which is protected from light, incubates 1h is educated, is protected from light washing 2 times with the PBS of pre-cooling.

6) mark nucleus: nucleus fluorescent dye DAPI (1:5000, PBS dilution) is added in every hole, and room temperature is protected from light incubation 15min is protected from light washing 3 times with the PBS of pre-cooling.

7) it is detected under fluorescence microscope and calculates green 488 positive cell clone number of AF.

4.3 protein immunoblot.

(1) total protein of control group Yu ATG12 interference group HBMEC cell is extracted respectively with protein lysate.

(2) 30ug albumen is added to electrophoresis in the polyacrylamide gel of 12.5% concentration respectively after quantification of protein, and Interception respective strap is gone on pvdf membrane with electroporation.

(3) non-specific sites of albumen are closed with 5% skim milk, are then closed with ATG12 antibody, and 4 DEG C are overnight, It is washed three times with TBST buffer, washes away primary antibody.

(4) it is then incubated at room temperature 2 hours with the secondary antibody of HRP label, is then washed three times with TBST buffer.

(5) finally, utilizing developing solution colour developing and photographic analysis

4.4RT-PCR detects EV71 virus quantity in cell

Continue to cultivate 48h after HBMEC cell infection virus, the total of control group and interference group cell is extracted using TRIzol RNA, and reverse transcription obtains cDNA, detects EV71 virus quantity by RT-PCR.Specific steps are the same as shown in 2.2.

Experimental result:

1 design synthesizes and screens effective siRNA

For each objective gene sequence, we devise multiple RNA interfered target sequences, and are carried out using design software Pre-Evaluation measurement, selects 3 optimal kinetic parameter target spots to enter subsequent experimental process, each gene synthesizes 3 interference altogether Sequence, as shown in table 1.

Using the method for in-vitro transfection, the RNA interfering of each gene is transfected into HBMEC cell, is passed through after 48h RT-PCR method detects the jamming effectiveness of each RNA interfering, finally screens the optimal siRNA sequence of interference effect (overstriking sequence in table 2 Column) subsequent experimental is carried out, jamming effectiveness is as shown in table 2.

Table 2RT-PCR method detects siRNA interference sequence to the downward efficiency of related host gene

Note: the HBMEC groups of cells (ghost group) of any siRNA CTRL: is not transfected

NT: the HBMEC groups of cells (negative control group) of transfection non-targeting siRNA

SiRNA: HBMEC groups of cells (experimental group) of the transfection for the siRNA of each target gene.

Jamming effectiveness and cytotoxicity detection after 2siRNA interference

The effective siRNA for each host molecule picked out transfects HBMEC cell, and 48h passes through RT-PCR method after transfection The jamming effectiveness of each RNA interfering is detected, while using the influence after CCK8 detection transfection to HBMEC cytotoxicity.

As a result as shown in Figure 1, transfecting effective siRNA group compared with CTRL group, phase can obviously be inhibited after transfecting each siRNA Answer the expression (P < 0.01) of gene.The inhibition efficiency of transfection ATG12siRNA (SEQ ID NO:1) can reach 80%.

Cytotoxicity experiment does not generate apparent cytotoxicity (P > 0.05) after showing each siRNA transfection, to thin The normal physiological function of born of the same parents does not have an impact, can be used for subsequent experimental.

Influence after 3siRNA interference to EV71 virus infection

After transfecting expression of the effective siRNA of each host molecule to lower host cell relevant molecule, same dose is infected EV71 virus, after infecting 48h, to the influence of EV71 infection, discovery after being lowered using each host molecule of immuno-fluorescence assay Compared with the control group, after transfection ATG12siRNA (SEQ ID NO:1) makes ATG12 gene deregulation, hence it is evident that reduce EV71 pairs The infection (Fig. 2A) of HBMEC cell.By calculating virus quantity discovery, the inhibiting rate of virus is reached after ATG12 gene deregulation 84.33%, and there is no the obvious infection (P > 0.05) (Fig. 2 B) for inhibiting EV71 to HBMEC cell for the downward of remaining molecule.

Pass through Western blot after transfecting ATG12 molecule siRNA for the inhibiting effect that clear ATG12 infects EV71 The expression of ATG12 protein molecular is detected, and observes cytopathy situation after infecting EV71, and EV71 is detected by RT-PCR Virus quantity.The results show that can obviously inhibit ATG12 protein molecular after transfection ATG12 molecule siRNA (SEQ ID NO:1) It expresses (Fig. 3 A).Compared with the control group, after ATG12 protein expression is lowered, the disease that is able to suppress in cytopathy and HBMEC cell Poison amount is also remarkably decreased (Fig. 3 B, C), consistent with immuno-fluorescence assay result.These results indicate that with control cell phase Than EV71 is decreased obviously the infection ability of HBMEC cell after lowering ATG12 gene, and virus quantity is reduced.

Further, influence of the siRNA observation of three ATG12 molecules to viral infection is transfected respectively.The result shows that not With siRNA it is different (Fig. 4 A) to the downward efficiency of ATG12 molecule, wherein the jamming effectiveness of siRNA (SEQ ID NO:1) is most Height, it is consistent with the result of front.Influence discovery infective on EV71 after detection interference, siRNA pairs of three ATG12 molecules The inhibiting rate of virus infection can reach 66% or more, and increasing with the downward efficiency to ATG12 molecule, feel to EV71 The inhibiting rate of dye also at raising (Fig. 4 B), prompts ATG12 molecule to play an important role in EV71 infection HBMEC.Therefore, ATG12, which can be used as, inhibits EV71 to new host's target spot of HBMEC cell infection.

Pass through the above the results show: the present invention screen be able to suppress one of EV71 infection HBMEC cell it is new Host cellular molecules ATG12.After ATG12 gene deregulation, the normal physiological function of cell is not influenced, but obviously inhibit EV71 Infection to HBMEC cell.Therefore the present invention is the disability of clinical prevention and treatment because of the blood-brain barrier caused by EV71 infection Provide new target spot and therapeutic scheme.

The preferred embodiment of the present invention has been described in detail above, but the invention be not limited to it is described Embodiment, those skilled in the art can also make various equivalent on the premise of not violating the inventive spirit of the present invention Variation or replacement, these equivalent variation or replacement are all included in the scope defined by the claims of the present application.

Claims (2)

1. application of the RNA interfering of autophagy correlated protein 12 in preparation prevention or treatment enterovirns type 71 infection medicine；Institute The sequence for the RNA interfering stated is selected from following any:

GCAGCUUCCUACUUCAAUUUU(SEQ ID NO:1),

GCGAACACGAACCAUCCAAUU(SEQ ID NO:2),

GCAGUGAUGGUAAACUGGUUU(SEQ ID NO:3).

2. application of the RNA interfering of autophagy correlated protein 12 in preparation prevention or treatment hand-foot-and-mouth disease drug；The interference The sequence of RNA is selected from following any:

GCAGCUUCCUACUUCAAUUUU(SEQ ID NO:1),

GCGAACACGAACCAUCCAAUU(SEQ ID NO:2),

GCAGUGAUGGUAAACUGGUUU(SEQ ID NO:3).