CN105311646B - Application of the ezrin in prevention and treatment japanese encephalitis virus infection - Google Patents

Abstract

It is novel targets and the application of a kind of anti-japanese encephalitis virus (JEV) infection the present invention relates to field of biomedicine technology.The present invention is using Human Brain Microvascular Endothelial (HBMEC) as target cell; the expression of target cell host protein is lowered using RNA perturbation technique; to find the host factor that JEV infection Human Brain Microvascular Endothelial (HBMEC) can be effectively suppressed; to protect the function of blood-brain barrier, pre- anti-virus passes through blood-brain barrier and infects central nervous system.The present invention provides application of the ezrin in prevention and treatment japanese encephalitis virus infection, the present invention is found through experiments that ezrin (Ezrin) plays an important role in JEV infection HBMEC, the expression for lowering Ezrin, can obviously inhibit the infection of JEV.The present invention provides application of the Ezrin in preparation prevention or treatment japanese encephalitis virus infection medicine.

Description

Application of the ezrin in prevention and treatment japanese encephalitis virus infection

Technical field

It is novel targets and the application of a kind of anti-japanese encephalitis virus infection the present invention relates to field of biomedicine technology.

Background technique

Japanese encephalitis virus is also known as japanese encephalitis virus (Japanese encephalitis virus, JEV), belongs to Huang Viraceae (Flaviviridae) Flavivirus (Flavivirus), for tunicary single positive chain RNA virus [Gubler, D., G.Kuno,and L.Markoff.Flaviviruses,p.2007.1153-1252.In D.M.Knipe and P.M.Howley(ed.),Fields virology,5th ed.,vol.1.Lippincott-Williams&Wilkins, Philadelphia,PA.].JEV is the pathogen of Japanese Type-B encephalitis, is mainly propagated by medium of mosquito, after infection The serious acute nervous system symptom such as encephalitis or meningitis can be caused, human health is threatened huge.Encephalitis B is main East Asia, Southeast Asia and Oceanian some areas are popular in, current main control means are vaccine prevention and mosquito It eliminates, however the encephalitis B case of the every annual report in the whole world still has 35,000-50,000, death toll is more than 10,000 [Misra,U.K.and J.Kalita.Overview:Japanese encephalitis.Prog.Neurobiol.2010. 91:108-120.], since diagnosis and report mechanism are not perfect, actual infection and death will be more than these numbers, it is seen that Encephalitis B is still to endanger the significant problem of public health, thus study JEV pathogenesis and preventive means, finds new resist Viral strategy, it has also become advanced subject urgently to be resolved.

JEV infection has Neural invasion, easily causes serious central nervous system (CNS) disease and its complication, this It is that Patients with Encephalitis B development is caused to be the main reason for severe is even dead [Denizot M, Neal JW, Gasque P.Encephalitis due to emerging viruses:CNS innate immunity and potential therapeutic targets.J Infect.2012.65(1):1-16.].JEV needs to pass through blood through blood infection cycle CNS Brain barrier, however the mechanism how virus passes through blood-brain barrier intrusion CNS is not clear.Blood-brain barrier (Blood Brain Barrier, BBB) it is the main barrier together between the circulatory system and central nervous system, it limits different material and exists Freely transporting between two positions to the homeostasis for maintaining CNS and protects CNS from the invasion of extraneous pathogenic microorganism In play a crucial role [Dyrna F, Hanske S, Krueger M, Bechmann I.The blood-brain b arrier.JNeuroimmunePharmacol.2013；8(4):763-73.].Blood-brain barrier is by the cerebral microvascular of no fenestra The cell that endothelial cell and close connection therebetween, astroglial foot processes, cell basement membrane and pericyte collectively constitute Complex.In this cell conjugate, most important structure of matter basis is brain microvessel endothelial cells in vitro (Brain Microvascular Endothelial Cells, BMECs) and its close connection, the loss for rectifying property strictly is considered as virus Infection causes a major reason of brain tissue impairment.Therefore, it verifies the mechanism of JEV infection BMECs and is found with this new disease-resistant Malicious target spot, it is most important for the function of protection blood-brain barrier, and central nervous system infection caused by prevention and treatment JEV.

In order to which effectively infection cell, virus must utilize membrane molecule and its vesicular transport system completion pair of host cell The invasion of host cell could be replicated in the cell and be released the progeny virion of infectious.Therefore, as disease The primary link of poison infection host cell, cell entry have become the important target of antiviral drugs screening.Studies have shown that JEV Target cell can be invaded using different host factor and route of infection, the endocytic pathway that need to be relied on by clathrin such as JEV (clathrin-mediated endocytosis) infects African green monkey kidney cell (Vero cell) [Nawa M, Takasaki T,Yamada K,Kurane I,Akatsuka T.Interference in Japanese encephalitis virus infection of Vero cells by a cationic amphiphilic drug,chlorpromazine.J Gen Virol.2003,84 (Pt 7): 1737-41.], but infect nerve cell do not need rely on clathrin [Kalia M, Khasa R,Sharma M,Nain M,Vrati S.Japanese encephalitis virus infects neuronal cells through a clathrin-independent endocytic mechanism.J Virol,2013,87(1): 148-62.].JEV can to infect aedes albopictus cells, (C6/36 be thin with heat shock protein 70 interaction by its envelope protein Born of the same parents) [Chuang CK, Yang TH, Chen TH, Yang CF, Chen WJ.Heat shock cognate protein 70isoform D is required for clathrin-dependent endocytosis of Japanese Encephalitis virus in C6/36 cells.J Gen Virol.2015,96 (Pt 4): 793-803.] and people liver Cancer cell (Huh7 cell) [Zhu YZ, Cao MM, Wang WB, et al.Association of heat-shock protein 70 with lipid rafts is required for Japanese encephalitis virus infection in Huh7 cells.J Gen Virol.2012,93(Pt 1):61-71.].Currently, about JEV infection The approach and mechanism of BMECs is still unclear.

For Virus entry target cell mainly by means of the key molecule for participating in the transport of host cell Self substances, these hosts are thin After birth transport molecule plays an important role in the formation of vesica, endocytosis and secretion in the cross-film matter transportation of cell.Such as Metalloproteinases has adjusted cell adherence, the degradation of membrane molecule；Clathrin (clathrin) is mainly responsible for receptor-mediated Endocytic processes；Flotillin molecule can interact in simultaneously with protein molecular in Lipid Rafts and swallow into the cell；ADP ribose 6 molecule of the base factor participates in reconciling cytoplasma membrane transport and actin intracellular assembly；Gtpase activating protein molecule GRAF1 exists There is important adjustment effect in the vesicle transport of clathrin independent form；Interleukin-2 Receptor endocytosis has adjusted signal Access simultaneously affects cell Proliferation；Epsin albumen has adjusted the transportational process etc. of clathrin-mediated endocytosis vesica [Doherty GJ,McMahon HT.Mechanisms of endocytosis.Annu Rev Biochem.2009,78: 857-902.].In these molecules, clathrin is proved to take part in the process of JEV infection, and other molecules are in JEV infection In effect do not have been reported that also.

Ezrin (Ezrin) is that theca cell skeleton connects albumen, is the ERM connected between cell membrane and cytoskeleton One of (ezrin-radixin-moesin, ezrin-radixin-moesin) family member.Often with radixin, film dash forward egg It is white to co-express on the inside of cell membrane.Studies have shown that Ezrin mediate film and cytoskeleton connection, be cellular signal transduction and The important relation and adjusting molecule of after birth and cytoskeleton in growth course.Therefore, Ezrin is maintaining cell polarity, is participating in carefully Born of the same parents move, stick, signal transduction, adjust immune cell function etc. and play effect [Neisch AL, Fehon RG.Ezrin,Radixin and Moesin:key regulators of membrane-cortex interactions and signaling.CurrOpin Cell Biol.2011,23(4):377-82.].Recent researches are it has also been found that Ezrin egg The white infection for having also assisted in a variety of viruses and pathogenic course.As Ezrin albumen takes part in immune deficiency as positive regulatory factor Course of infection [Yoshinao Kubo, the Hiroaki Yoshii, HarukaKamiyama, et of viral (HIV-1) al.Ezrin,Radixin,and Moesin(ERM)proteins function as pleiotropic regulatorsof human immunodeficiency virus type 1 infection.Virology,2008,375:130-140.]。 Ezrin albumen can be induced phosphorylated by HCV Envelope 2 protein in the course of infection of Hepatitis C Virus (HCV), phosphorylation Ezrin albumen can adjust cytoskeleton to mediate effective infection [the Terence N.Bukong, Karen of HCV Kodys,and Gyongyi Szabo.Human Ezrin-Moesin-Radixin Proteins ModulateHepatitis C Virus Infection.Hepatology,2013,58:1569-1579].It can be seen that Ezrin albumen participate in virus infection with Important function in pathogenic course.

There is presently no any reports acted in JEV infection about ezrin molecule, which are carried out deep Enter to study the understanding that can not only be promoted to JEV infection and pathogenic mechanism, or prevention and treatment JEV infection provides new Thinking and target spot.

Summary of the invention

The purpose of the present invention is to provide a kind of novel targets of anti-japanese encephalitis virus infection.

Another object of the present invention is to provide the new applications of ezrin (Ezrin) molecule, are especially resisting B-mode brain Application in scorching virus infection.

The third object of the present invention is to provide the siRNA of interference Ezrin protein molecular expression.

Main technical schemes of the invention are:

It is thin to lower target using RNA perturbation technique using Human Brain Microvascular Endothelial (HBMEC) as target cell by the present invention The expression of born of the same parents' host protein, to find the host factor that JEV infection Human Brain Microvascular Endothelial (HBMEC) can be effectively suppressed, To protect the function of blood-brain barrier.The one group of participation of this experimental selection adjusts the molecule of host cell transmembrane transport to carry out Screening, cross-film matter transportation of these molecules in host cell, endocytosis and secretion and the adjusting to cytoskeleton of vesica It is played an important role in journey, they are often also in virus infection easily by viral " abduction " and the molecule that utilizes.This A little molecules include: ADAM metalloproteinases (ADAM10), ADP ribosylation factor 6 (ARF6), clathrin light-chain A (CLTA), Clathrin light-chain B (CLTB), clathrin heavy chain (CLTC), epsin albumen 1 (EPN1), epsin albumen 2 (EPN2), Ades Albumen (Ezrin), Flotillin albumen 1 (FLOT1), Flotillin albumen 2 (FLOT2), gtpase activating protein (GRAF1), Interleukin-2 Receptor (IL2RB), synaptotagmin 1 (SYT1), synaptotagmin 2 (SYT2).By retrieving NCBI GeneBank obtains complete sequence and mRNA sequence, carries out biology to these genes using existing Internet resources and popular software Analysis, then the target sequence for selecting code area to design as siRNA designs siRNA, by lowering these molecules, to observe pair The influence of JEV infection.

We have found that ezrin (Ezrin) plays an important role in JEV infection HBMEC, the table of Ezrin is lowered It reaches, can obviously inhibit the infection of JEV.

The first aspect of the present invention provides ezrin (Ezrin) as a kind of the new of anti-japanese encephalitis virus infection Target spot.

The second aspect of the present invention provides ezrin (Ezrin) in preparation prevention or treatment japanese encephalitis virus sense Contaminate the application in drug.

Further, the present invention also provides ezrins (Ezrin) in preparation prevention or treatment encephalitis B drug Using.

Ezrin (Ezrin) of the present invention answering in preparation prevention or treatment japanese encephalitis virus infection medicine With the drug specifically refers to the reagent for being able to suppress or lowering the expression quantity of Ezrin.

The reagent for the expression quantity that Ezrin is lowered in the inhibition can be siRNA, shRNA, comprising siRNA, shRNA Recombinant vector (such as plasmid).

The third aspect of the present invention, the present invention provides the RNA interferings of ezrin (Ezrin) in preparation prevention or treatment Application or ezrin (Ezrin) in japanese encephalitis virus infection medicine is in preparation prevention or treatment encephalitis B drug Application, the drug be RNA interfering (siRNA), sequence is as follows:

GUUGGAAUACCUGAAGAUUGC(SEQ ID NO:22)、

GCGGCAACAGCUGGAAACAGA(SEQ ID NO:23)、

CCUGAUUCUCGCGAUUAUUCU(SEQ ID NO:24)。

Wherein, the expression quantity effect for lowering Ezrin with the siRNA as shown in SEQ ID NO:23 is best, and reduces B-mode Encephalitis viruses is the most obvious to the infection of HBMEC cell.

The present invention screens a new host cellular molecules for being able to suppress japanese encephalitis virus infection HBMEC cell Ezrin.After Ezrin gene deregulation, the normal physiological function of cell is not influenced, but obviously inhibit japanese encephalitis virus pair The infection of HBMEC cell.

Therefore the present invention is clinical prevention and treatment because the disability of the blood-brain barrier caused by japanese encephalitis virus infection mentions New target spot and therapeutic scheme are supplied.

Detailed description of the invention

Fig. 1 is the jamming effectiveness and cytotoxicity detection after transfecting effective siRNA, and primary axis indicates interference effect in figure Rate, secondary axis indicate the influence to cytotoxicity；

CTRL: the HBMEC groups of cells (ghost group) of any siRNA is not transfected；

NT: the HBMEC groups of cells (negative control group) of transfection non-targeting siRNA；

SiRNA: HBMEC groups of cells (experimental group) of the transfection for the siRNA of each target gene.

Fig. 2 is the influence after each host molecule of immuno-fluorescence assay is lowered to JEV infection, and wherein A is to lower each molecule The Immunofluorescence test figure influenced afterwards on viral infection, fluorescence show the cell of the JEV envelope protein positive, and B is to lower respectively To the inhibiting rate figure of virus infection after molecule；

CTRL: the HBMEC groups of cells (ghost group) of any siRNA is not transfected；

NT: the HBMEC groups of cells (negative control group) of transfection non-targeting siRNA；

SiRNA: HBMEC groups of cells (experimental group) of the transfection for the siRNA of each target gene.

Fig. 3 is the influence after Ezrin is lowered to JEV infection, and wherein A is the table that Western Blot detects Ezrin albumen Up to figure, B is that fluorescence quantitative PCR method detects JEV virus spirogram；

CTRL: the HBMEC groups of cells (ghost group) of any siRNA is not transfected；

NT-CTRL: the HBMEC groups of cells (negative control group) of transfection non-targeting siRNA；

Ezrin: HBMEC groups of cells of the transfection for the siRNA (SEQ ID NO:23) of Ezrin gene.

Fig. 4 is that the jamming effectiveness and influence diagram to JEV infection, A after the disturbance sequence for transfecting Ezrin molecule are The mRNA level in-site of Ezrin gene detects figure, and B is JEV virus quantity detection figure；

CTRL: the HBMEC groups of cells (ghost group) of any siRNA is not transfected；

NT-CTRL: the HBMEC groups of cells (negative control group) of transfection non-targeting siRNA；

Ezrin-22: HBMEC groups of cells of the transfection for the siRNA (SEQ ID NO:22) of Ezrin gene；

Ezrin-23: HBMEC groups of cells of the transfection for the siRNA (SEQ ID NO:23) of Ezrin gene；

Ezrin-24: HBMEC groups of cells of the transfection for the siRNA (SEQ ID NO:24) of Ezrin gene.

Specific embodiment

Now in conjunction with embodiment and attached drawing, the present invention is described in detail, but implementation of the invention is not limited only to this.

The reagents and materials used in the present invention are commercially available or can prepare by literature method.Tool is not specified in the following example The experimental method of concrete conditions in the establishment of a specific crime, usually according to normal condition such as Sambrook et al. " molecular cloning: lab guide " (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or according to normal conditions, or According to the normal condition proposed by manufacturer.Unless otherwise stated, otherwise percentage and number are calculated by weight.

Embodiment 1:

1 design, the specific siRNA sequence for synthesizing each host cellular molecules.

1.1 are directed to each target gene, and retrieval NCBI GeneBank obtains complete sequence and mRNA sequence, and utilization is existing Internet resources and popular software carry out biological analysis, the target sequence for selecting code area to design as siRNA to each target gene. It referring to siRNA design principle, and is compared by the blast function of GeneBank database with human genomic sequence, really It protects without homology；Exclude the potential siRNA of 5 ' continuous 8 bases in end and the pairing of other genes of antisense chain；It excludes any The potential siRNA of one section of continuous 14 base and the pairing of other genes.And Pre-Evaluation measurement is carried out using design software, select 3 A optimal kinetic parameter target spot enters subsequent experimental process, and each gene synthesizes 3 interference sequences altogether, is shown in Table 1.

The synthesis of 1.2 single-stranded siRNA is completed with purifying by Invitrogen company.

The design of table 1.siRNA target spot

The screening of 2 siRNA sequences is identified with interference effect

2.1RNA transfection

Transfection procedure is referring to 2000 specification of Lipofectamine

1) shift to an earlier date 12-16 hours and HBMEC cell (purchased from Sciencell, deposit number: 1000) is layered on 24 hole cell culture It is cultivated on plate, so that cell density is 80%-90% when transfection.

2) it takes 2 μ LLipofectamine 2000 to be added in 50 μ Lopti-MEM and softly mixes, be incubated at room temperature 5 minutes； Separately take the RNA interfering and 50 μ Lopti-MEM mixing that 5 μ L concentration are 5 μM.After incubation, by diluted Lipofectamine 2000 transfection reagents are added in diluted RNA, and soft pressure-vaccum mixes.It after being incubated at room temperature 20min, is added in HBMEC cell, mends Add 400 μ Lopti-MEM, so that the final concentration of 50nM of RNA.

3) replacement in 6-8 hours contains dual anti-fresh culture after transfecting.

2.2 real-time fluorescence quantitative PCRs (RT-PCR) detect the mRNA level in-site of each host molecule

1) TRIzol extracts the total serum IgE of control group and interference group cell, the specific steps are as follows:

After transfection 48 hours, culture supernatant is gone, 1ml TRIzol is added in cell, is sufficiently mixed lysis at room temperature cell 3- 5 minutes.The chloroform of 1/5 volume is added, is vigorously mixed manually 15 seconds.It is centrifuged 15 minutes in 4 DEG C, 12,000 turns.Take upper strata aqueous phase And be transferred in new EP pipe, isometric isopropanol is added, is sufficiently mixed, precipitation at room temperature 10 minutes.It is left in 4 DEG C, 12,000 The heart 10 minutes.Supernatant is abandoned, 75% ethyl alcohol of 1ml pre-cooling is added.In 4 DEG C, 12,000 centrifugation 5 minutes.Supernatant is sufficiently abandoned, room temperature is dried in the air Dry RNA precipitate is added DEPC processing water dissolution precipitating, obtains total serum IgE.

2) cDNA of control group and interference group cell is obtained using takara reverse transcription reagent box, the specific steps are as follows:

Following reaction system is added in PCR pipe,

Soft mixing mixes, and is placed in 37 DEG C and reacts 15 minutes, is subsequently placed in 85 DEG C of heating, 5 seconds inactivation reverse transcriptases.

3) fluorescence quantitative RT-RCR detects

It is reacted using the SYBR Premix Ex Taq kit of takara, reaction system is as follows,

SYBR Premix Ex Taq10μL

Two-step method amplification is carried out using Rotor Gene 3000A instrument, 95 DEG C of initial denaturation 2min carry out 40 PCR and follow Ring, 95 DEG C 5 seconds, 60 DEG C 30 seconds.

3 cytotoxicity experiments

The influence of cell proliferation after transfection siRNA is detected using CCK-8 method, the specific steps are as follows:

Logarithmic growth phase cell is collected, 96 orifice plates are inoculated in 3000 density in every hole.After cell pellet overnight is adherent, turn Each siRNA is contaminated, culture detected cell proliferative conditions after 48 hours.Original culture medium is discarded, every hole is added containing 10 μ L CCK-8 110 μ L of fresh culture uses multi-function microplate reader in each hole absorbance value of 450nm wavelength detecting after cultivating 3h.The independent weight of experiment It is 3 times multiple, calculate average value.

4 JEV virus infection HBMEC cells

The JEV virus infection of 4.1HBMEC cell is tested

72 hours after HBMEC cell transfecting RNA, the experiment of JEV virus infection is carried out.Culture supernatant is sucked out, with pre-temperature PBS Rinse 2 times, JEV is inoculated with the virus quantity of MOI=1, discards virus liquid after 37 DEG C of incubation 2h, and with pre-temperature PBS rinse 3 times, is added Enter fresh culture to continue to cultivate.

4.2 immunofluorescence dyeings detect JEV antigen presentation

Continue to cultivate 48h after HBMEC cell infection virus, using the expression of immuno-fluorescence assay viral antigen, specifically Steps are as follows:

1) cell is fixed: the culture solution in 96 orifice plates being removed, PBS is added and cleans cell 2 times, it is pre- that 100 μ l are added in every hole Cold methanol fixes 20min under the conditions of -20 DEG C, is cleaned cell 3 times with the PBS of pre-cooling.

2) permeable membrane: 100 μ l 0.1%TritonX-100 are added in the cell per well after fixed, are incubated at room temperature 15min, with pre- Cold PBS is washed 3 times.

3) close: 100 μ l 3%BSA are added in every hole, are incubated for 1h at room temperature.

4) primary antibody is incubated for: JEV specificity source of mouse monoclonal antibody (1:500 dilution) 100 μ l, incubation at room temperature 1h is added in every hole, with pre- Cold PBS is washed 3 times.

5) secondary antibody is incubated for: the anti-mouse IgG of 488 fluorescent marker of AF (1:1000 dilution) 100 μ l are added in every hole, and room temperature, which is protected from light, incubates 1h is educated, is protected from light washing 2 times with the PBS of pre-cooling.

6) mark nucleus: nucleus fluorescent dye DAPI (1:5000, PBS dilution) is added in every hole, and room temperature is protected from light incubation 15min is protected from light washing 3 times with the PBS of pre-cooling.

7) it is detected under fluorescence microscope and calculates green 488 positive cell clone number of AF.

4.3 protein immunoblot.

(1) total protein of control group Yu Ezrin interference group HBMEC cell is extracted respectively with protein lysate.

(2) 30ug albumen is added to electrophoresis in the polyacrylamide gel of 12.5% concentration respectively after quantification of protein, and Interception respective strap is gone on pvdf membrane with electroporation.

(3) non-specific sites of albumen are closed with 5% skim milk, are then closed with Ezrin antibody, and 4 DEG C are overnight, It is washed three times with TBST buffer, washes away primary antibody.

(4) it is then incubated at room temperature 2 hours with the secondary antibody of HRP label, is then washed three times with TBST buffer.

(5) finally, utilizing developing solution colour developing and photographic analysis

4.4RT-PCR detects JEV virus quantity in cell

Continue to cultivate 48h after HBMEC cell infection virus, the total of control group and interference group cell is extracted using TRIzol RNA, and reverse transcription obtains cDNA, detects JEV virus quantity by RT-PCR.Specific steps are the same as shown in 2.2.

Experimental result:

1 design synthesizes and screens effective siRNA

For each objective gene sequence, we devise multiple RNA interfered target sequences, and are carried out using design software Pre-Evaluation measurement, selects 3 optimal kinetic parameter target spots to enter subsequent experimental process, each gene synthesizes 3 interference altogether Sequence, as shown in table 1.

Using the method for in-vitro transfection, the RNA interfering of each gene is transfected into HBMEC cell, is passed through after 48h RT-PCR method detects the jamming effectiveness of each RNA interfering, finally screens the optimal siRNA sequence of interference effect and carries out subsequent reality It tests, jamming effectiveness is as shown in table 2, and wherein overstriking data are expressed as jamming effectiveness highest, and corresponding sequence is to inhibit corresponding base Because of the best siRNA sequence of expression.

2 RT-PCR method of table detects siRNA interference sequence to the downward efficiency of related host gene

Note: the HBMEC groups of cells (ghost group) of any siRNA CTRL: is not transfected

NT: the HBMEC groups of cells (negative control group) of transfection non-targeting siRNA

SiRNA: HBMEC groups of cells (experimental group) of the transfection for the siRNA of each target gene.

Jamming effectiveness and cytotoxicity detection after 2 siRNA interference

The effective siRNA for each host molecule picked out transfects HBMEC cell, and 48h passes through RT-PCR method after transfection The jamming effectiveness of each RNA interfering is detected, while using the influence after CCK8 detection transfection to HBMEC cytotoxicity.

As a result as shown in Figure 1, transfecting effective siRNA group compared with CTRL group, phase can obviously be inhibited after transfecting each siRNA Answer the expression (P < 0.01) of gene.The inhibition efficiency of transfection EzrinsiRNA (SEQ ID NO:23) can reach 61%.

Cytotoxicity experiment does not generate apparent cytotoxicity (P > 0.05) after showing each siRNA transfection, to thin The normal physiological function of born of the same parents does not have an impact, can be used for subsequent experimental.

Influence after 3 siRNA interference to JEV virus infection

After transfecting expression of the effective siRNA of each host molecule to lower host cell relevant molecule, same dose is infected JEV virus, after infecting 48h, influence after being lowered using each host molecule of immuno-fluorescence assay to JEV infection, discovery with Control group is compared, and after transfection EzrinsiRNA (SEQ ID NO:23) makes Ezrin gene deregulation, JEV envelope protein antigen is positive Cell number significantly reduce, prompt Ezrin gene downward can reduce infection (Fig. 2A) of the JEV to HBMEC cell.Pass through meter It calculates virus quantity to find, to the inhibiting rate highest of virus infection after Ezrin gene deregulation, reaches 62.35%, and lower remaining host It is lower to the inhibiting rate of JEV infection (Fig. 2 B) after molecule.

Western blot is passed through after transfecting Ezrin molecule siRNA to the inhibiting effect of JEV infection for clear Ezrin The expression of Ezrin protein molecular is detected, and JEV virus quantity is detected by RT-PCR after infecting JEV.The results show that transfection After Ezrin molecule siRNA (SEQ ID NO:23), it can obviously inhibit the expression (Fig. 3 A) of Ezrin protein molecular.With control group It compares, after Ezrin protein expression is lowered, the virus quantity in HBMEC cell is also remarkably decreased (Fig. 3 B), with immuno-fluorescence assay As a result consistent.These results indicate that compared with control cell, infection energy of the JEV to HBMEC cell after downward Ezrin gene Power is decreased obviously, and virus quantity is reduced.

Further, influence of the siRNA observation of three Ezrin molecules to viral infection is transfected respectively.The result shows that not With siRNA it is different (Fig. 4 A) to the downward efficiency of Ezrin molecule, wherein the jamming effectiveness of siRNA (SEQ ID NO:23) is most Height, it is consistent with the result of front.Influence discovery after detection interference to JEV infection, as the downward to Ezrin molecule is imitated Rate increases, and to the inhibiting rate of JEV infection also at raising (Fig. 4 B), certain dose gradient effect is presented, prompts Ezrin molecule It is played an important role in JEV infection HBMEC.Therefore, Ezrin, which can be used as, inhibits JEV to the new place of HBMEC cell infection Main target spot.

Pass through the above the results show: the present invention screens a new place for being able to suppress JEV infection HBMEC cell Chief cell molecule Ezrin.After Ezrin gene deregulation, the normal physiological function of cell is not influenced, but obviously inhibit JEV pairs The infection of HBMEC cell.Therefore the disability of blood-brain barrier of the present invention for clinical prevention and caused by treating because of JEV infection provides New target spot and therapeutic scheme.

The preferred embodiment of the present invention has been described in detail above, but the invention be not limited to it is described Embodiment, those skilled in the art can also make various equivalent on the premise of not violating the inventive spirit of the present invention Variation or replacement, these equivalent variation or replacement are all included in the scope defined by the claims of the present application.

Claims (1)

1. application of the RNA interfering of ezrin in preparation prevention or treatment japanese encephalitis virus infection medicine, described is dry The sequence of RNA is disturbed selected from following any:

GUUGGAAUACCUGAAGAUUGC(SEQ ID NO:22)、

GCGGCAACAGCUGGAAACAGA(SEQ ID NO:23)、

CCUGAUUCUCGCGAUUAUUCU(SEQ ID NO:24)。