CN105267984A - Application of ADP ribosylation factor 6 in prevention and treatment of enterovirus 71 infection - Google Patents
Application of ADP ribosylation factor 6 in prevention and treatment of enterovirus 71 infection Download PDFInfo
- Publication number
- CN105267984A CN105267984A CN201510030998.4A CN201510030998A CN105267984A CN 105267984 A CN105267984 A CN 105267984A CN 201510030998 A CN201510030998 A CN 201510030998A CN 105267984 A CN105267984 A CN 105267984A
- Authority
- CN
- China
- Prior art keywords
- infection
- cell
- arf6
- ribosylation factor
- adp ribosylation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Abstract
The invention relates to the biomedical technology field, and provides a new target and application for enterovirus 71 infection resistance. Human brain microvescular endothelia cell (HBMEC) are employed as target cells, the RNA interference technology is employed to reduce expression of target cell host protein to seek host factors which can inhibit infection of EV 71 to human brain microvescular endothelia cell (HBMEC) effectively, therefore the blood cerebral barrier function is protected, and viruses are prevented from going through blood cerebral barrier to infect the central nervous system. Experiments show that ADP ribosylation factor 6 (ARF6) plays an important role in infection of EV71 to HBMEC, expression of ARF6 is reduced, and infection of EV71 can be inhibited obviously. An application of ARF6 in preparation of medicines preventing or treating enterovirus 71 infection is provided.
Description
Technical field
The present invention relates to field of biomedicine technology, is a kind of novel targets and application of anti-enterovirns type 71 infection.
Background technology
Enterovirns type 71 (enterovirus71, EV71) belongs to Picornaviridae enterovirus genus people intestinal category-A virus, is one of main pathogens causing hand-foot-mouth disease (Hand-foot-mouthdisease, HFMD).At present, hand-foot-mouth disease to be broken out and popular in multiple area in the world, the especially Asian-Pacific area.In China, since 2008 Nian Ji great provinces and cities break out hand-foot-mouth disease epidemic situation, number of the infected and the mortality rate of this disease remain high always, and every annual report morbidity number is more than 1,000,000 examples, and death toll nearly 1000 is routine.Hand-foot-mouth disease principal pathogenetic crowd is 5 years old Infants Below, and clinical manifestation is heating, and the symptoms such as herpes appear in the positions such as hands, foot, buttocks and oral mucosa; Minority infant can develop into patient with severe symptoms, there is central nervous system (centralnervoussystem, CNS) pathological changes, comprise aseptic meningitis, brain stem encephalitis, encephalomyelitis and neurogenic pulmonary edema etc., life and health [the SolomonT1 of infant in serious threat, LewthwaiteP, PereraD, CardosaMJ, McMinnP, OoiMH.Virology, epidemiology, pathogenesis, andcontrolofenterovirus71.LancetInfectDis.2010Nov; 10 (11): 778-90.].Hand-foot-mouth disease particularly severe cases is many caused by enterovirns type 71 (EV71) infects.But, cause the treatment of hand-foot-mouth disease to there is no the antiviral drugs of differential high efficient about EV71 at present, clinically still based on symptomatic treatment, also come out without effective vaccine in prevention.
EV71 infects and has Neural invasion, easily causes serious CNS disease and complication thereof, and this is also cause hand-foot-mouth disease patient evolution for serious symptom even main causes of death.Wherein, brain stem is the most easily by position [Tee that EV71 infects, K.K., etal.Evolutionarygeneticsofhumanenterovirus71:origin, populationdynamics, naturalselection, andseasonalperiodicityoftheVP1gene.JVirol, 2010.84 (7): p.3339-50.], the position such as brain stem neuron that research confirms EV71 patient with severe symptoms all can detect the existence of EV71 gene and antigen, proves that EV71 can enter CNS.EV71 needs to pass through blood brain barrier through blood infection cycle CNS, but how not clear through the mechanism of blood brain barrier intrusion CNS virus is.Blood brain barrier (BloodBrainBarrier, BBB) be barrier main together between blood circulation and central nervous system, it limits different material freely transporting between two positions, vital effect [DyrnaF is played to maintaining in the homoiostasis of CNS and the invasion and attack of protection CNS from extraneous pathogenic microorganism, HanskeS, KruegerM, BechmannI.Theblood-brainbarrier.JNeuroimmunePharmacol.20 13; 8 (4): 763-73.].Blood brain barrier is by the cell conjugate jointly formed without the brain microvessel endothelial cells in vitro of fenestra and compact siro spinning technology therebetween, astroglial foot processes, cell basement membrane and pericyte.In this cell conjugate, topmost structure of matter basis is brain microvessel endothelial cells in vitro (BrainMicrovascularEndothelialCells, BMECs) and compact siro spinning technology, the loss of its property in neat formation is considered to the major reason that viral infection causes brain tissue impairment.Therefore, verify EV71 and infect the mechanism of BMECs and find new antiviral target spot with this, for the function of protection blood brain barrier, and the central nervous system infection that control EV71 causes is most important.
In order to infection cell effectively, virus must utilize the membrane molecule of host cell and vesicular transport system thereof to complete invasion to host cell, could carry out copying in cell and discharge infective progeny virion.Therefore, as the primary link of viruses infect host cells, cell entry has become the important target of antiviral drugs screening.Research shows, EV71 can utilize different host factor and route of infection to invade different types of target cell, the endocytic pathway (clathrin-mediatedendocytosis) that such as EV71 relies on by clathrin infects human rhabdomyosarcoma's cell (rhabdomyosarcoma, RD) [Yamayoshi, S., etal., ScavengerreceptorB2isacellularreceptorforenterovirus71.N atMed, 2009.15 (7): p.798-801.]; Infect endocytic pathway (the caveolar-dependentendocytosis) [LinHY that JurkatT lymphocyte series then mainly utilizes alveole to rely on, YangYT, YuSL, etal.CaveolarendocytosisisrequiredforhumanPSGL-1-mediate denterovirus71infection.JVirol.2013,87 (16): 9064-76.].At present, infect the approach of BMECs about EV71 and mechanism still unclear.
Virus entry target cell mainly by means of the key molecule participating in the transport of host cell Self substances, and these host cell membrane transport molecules, in the cross-film matter transportation of cell, play an important role in the formation of vesicle, endocytosis and secretion.As metalloproteases have adjusted cell adhesion, the degraded of membrane molecule; The endocytic processes that clathrin (clathrin) primary responsibility is receptor-mediated; Caveolin family molecule caveolin-1 (CAV1), caveolin-2 (CAV2), caveolin-3 (CAV3) by matter transportation to Golgi body; Flotillin molecule can interact also with protein molecular in Lipid Rafts and swallow in cell; ADP ribosylation factor 6 molecule participates in actin assembling in the transport of mediates cell plasma membrane and born of the same parents; Gtpase activating protein molecule GRAF1 has important regulating action in the vesicle transport of clathrin independent form; Interleukin-2 Receptor endocytosis have adjusted signal path and have impact on cell proliferation (JasonMercer, MarioSchelhaas, etal.VirusEntrybyEndocytosis.AnnuRevBiochem.2010; 79:803-833.).In these molecules, caveolin-1 and clathrin is proved and take part in the process that EV71 infects JurkatT lymphocyte and RD cell respectively, and the effect of other molecule in EV71 infects also does not have report.
ADP ribosylation factor 6 (ADPribosylationfactor6, ARF6) be a Small GTP-binding proteins in Ras superfamily, belong to ARF subfamily member, be positioned on cytoplasma membrane and endosome film, main participation regulates actin assembling in plasma membrane transport and born of the same parents and relates to different physiological roles (GillinghamAK1, MunroS.ThesmallGproteinsoftheArffamilyandtheirregulators .AnnuRevCellDevBiol.2007; 23:579-611.).Recent study also finds that ARF6 molecule plays an important role in the course of infection of virus,
the people such as O find ARF6 molecular regulation CA 9 type host cells infected (
o1, SusiP, TevaluotoT,
h,
v,
t, KiljunenS.InternalizationofcoxsackievirusA9ismediatedby{ beta}2-microglobulin, dynamin, andArf6butnotbycaveolin-1orclathrin.JVirol.2010; 84 (7): 3666-81.).Human rhabdomyosarcoma RD cell is the sensitive cell line of EV71, but by genomic library screening, Khairunnisa etc. find that ARF6 molecule does not affect the infection (HussainKM1 of EV71 to RD cell, LeongKL, NgMM, ChuJJ.Theessentialroleofclathrin-mediatedendocytosisinth einfectiousentryofhumanenterovirus71.JBiolChem.2011; 286 (1): 309-21.).
At present also without any infecting the report acted in HBMEC at EV71 about ARF6 molecule, this molecule is carried out furtheing investigate the understanding that can not only promote EV71 infection and mechanism of causing a disease, also can infect for prevention and treatment EV71 the thinking and target spot that provide new.
Summary of the invention
The object of the present invention is to provide the novel targets that a kind of anti-enterovirns type 71 infects.
Another object of the present invention is to the novelty teabag that ADP ribosylation factor 6 (ARF6) molecule is provided, the application particularly in anti-enterovirns type 71 infects.
The third object of the present invention is to provide the interference ARF6 siRNA of developed by molecule.
Main technical schemes of the present invention is:
The present invention; using Human Brain Microvascular Endothelial (HBMEC) as target cell; RNA perturbation technique is adopted to lower the expression of target cell host protein; find the host factor that can effectively suppress EV71 to infect Human Brain Microvascular Endothelial (HBMEC), thus the function of protection blood brain barrier.This experimental selection one group of host cell transmembrane transporter molecules screens, these molecules are in the cross-film matter transportation of host cell, play an important role in the endocytosis of vesicle and secretion, they are also often easily by virus " abductions " and the molecule of utilization in virus infection.These molecules comprise: ADAM metalloproteases (ADAM10), ADP ribosylation factor 6 (ARF6), caveolin-1 (CAV1), caveolin-2 (CAV2), caveolin-3 (CAV3), clathrin light-chain A (CLTA), clathrin light-chain B (CLTB), clathrin heavy chain (CLTC), Flotillin albumen 1 (FLOT1), Flotillin albumen 2 (FLOT2), gtpase activating protein (GRAF1), Interleukin-2 Receptor (IL2RB), synaptotagmin 1 (SYT1), synaptotagmin 2 (SYT2).Complete sequence and mRNA sequence is obtained by retrieval NCBIGeneBank, existing Internet resources and popular software is utilized to carry out biological analysis to these genes, select the target sequence that coding region is designed as siRNA, then siRNA is designed, by lowering these molecules, observe the impact that EV71 is infected.
We find that ADP ribosylation factor 6 (ADPribosylationfactor6, ARF6) infects in HBMEC at EV71 and play an important role, and lower the expression of ARF6, obviously can suppress the infection of EV71.
A first aspect of the present invention, provides the novel targets that ADP ribosylation factor 6 (ARF6) infects as a kind of anti-enterovirns type 71.
A second aspect of the present invention, provides the application of ADP ribosylation factor 6 (ARF6) in preparation prevention or treatment enterovirns type 71 infection medicine.
Further, the present invention also provides the application of ADP ribosylation factor 6 (ARF6) in preparation prevention or treatment hand-foot-mouth disease medicine.
The application of ADP ribosylation factor 6 (ARF6) of the present invention in preparation prevention or treatment enterovirns type 71 infection medicine, this medicine specifically refers to the reagent that can suppress or lower the expression of ARF6.
The reagent that the expression of ARF6 is lowered in described suppression can be siRNA, shRNA, comprise the recombinant vector of siRNA, shRNA (as plasmid) etc.
A third aspect of the present invention, the invention provides the application of RNA interfering in preparation prevention or treatment enterovirns type 71 infection medicine of ADP ribosylation factor 6 (ARF6), or the application of ADP ribosylation factor 6 in preparation prevention or treatment hand-foot-mouth disease medicine, described medicine is RNA interfering (siRNA), and its sequence is as follows:
GCUCACAUGGUUAACCUCUAA(SEQIDNO:4)
GUCAAGUUCAACGUAUGGGAU(SEQIDNO:5)
GCAUUAUCAAUGACCGGGAGA(SEQIDNO:6)
Wherein, lower the expression best results of ARF6 with the siRNA such as shown in SEQIDNO:4, and it is the most obvious to the infection of HBMEC cell to reduce EV71.
The present invention screens and EV71 can be suppressed to infect the new host cellular molecules ARF6 of of HBMEC cell.After ARF6 gene deregulation, do not affect the normal physiological function of cell, but obviously inhibit EV71 to the infection of HBMEC cell.
Therefore the anergy that the present invention infects because of EV71 the blood brain barrier caused for clinical prevention and treatment provides new target spot and therapeutic scheme.
Accompanying drawing explanation
Fig. 1 is that jamming effectiveness after the effective siRNA of transfection and cytotoxicity detect, and in figure, primary axis represents jamming effectiveness, and secondary axis represents Cytotoxic impact;
The HBMEC groups of cells (ghost group) of CTRL: any siRNA of not transfection;
The HBMEC groups of cells (negative control group) of NT: transfection non-targetingsiRNA;
SiRNA: transfection is for the HBMEC groups of cells (experimental group) of the siRNA of each genes of interest.
Fig. 2 is the impact infected EV71 after each host molecule of immuno-fluorescence assay is lowered, and wherein A lowers the fluoroscopic examination figure to viral infection after each molecule, and B lowers the suppression ratio figure to viral infection after each molecule;
The HBMEC groups of cells (ghost group) of CTRL: any siRNA of not transfection;
The HBMEC groups of cells (negative control group) of NT: transfection non-targetingsiRNA;
SiRNA: transfection is for the HBMEC groups of cells (experimental group) of the siRNA of each genes of interest.
Fig. 3 is the impact infected EV71 after ARF6 lowers, and wherein A is the expression figure that WesternBlot detects ARF6 albumen, B is that the cytopathic effect figure observing EV71, C are for detecting EV71 virus spirogram;
The HBMEC groups of cells (ghost group) of CTRL: any siRNA of not transfection;
The HBMEC groups of cells (negative control group) of NT-CTRL: transfection non-targetingsiRNA;
ARF6: transfection is for the HBMEC groups of cells of the siRNA (SEQIDNO:4) of ARF6 gene.
Fig. 4 is jamming effectiveness after the disturbance sequence of transfection ARF6 molecule and to the infective effect diagram of EV71, and A is the mRNA level in-site detection figure of ARF6 gene, B is EV71 virus quantity detection figure;
The HBMEC groups of cells (ghost group) of CTRL: any siRNA of not transfection;
The HBMEC groups of cells (negative control group) of NT-CTRL: transfection non-targetingsiRNA;
ARF6-4: transfection is for the HBMEC groups of cells of the siRNA (SEQIDNO:4) of ARF6 gene;
ARF6-5: transfection is for the HBMEC groups of cells of the siRNA (SEQIDNO:5) of ARF6 gene;
ARF6-6: transfection is for the HBMEC groups of cells of the siRNA (SEQIDNO:6) of ARF6 gene.
Detailed description of the invention
Now in conjunction with the embodiments and accompanying drawing, the present invention is described in detail, but enforcement of the present invention is not limited only to this.
Agents useful for same of the present invention and raw material all commercially maybe can be prepared by literature method.The experimental technique of unreceipted actual conditions in the following example, usual conveniently condition is as the people such as Sambrook " molecular cloning: lab guide " (NewYork:ColdSpringHarborLaboratoryPress, 1989) condition described in, or conveniently condition, or according to the condition that manufacturer advises.Unless otherwise indicated, otherwise percentage ratio and number calculate by weight.
Embodiment 1:
1 design, synthesize the specific siRNA sequence of each host cellular molecules.
1.1 for each genes of interest, and retrieval NCBIGeneBank obtains complete sequence and mRNA sequence, utilizes existing Internet resources and popular software to carry out biological analysis to each genes of interest, selects the target sequence that coding region is designed as siRNA.With reference to siRNA design principle, and contrasted by the blast function of GeneBank data base and human genomic sequence, guarantee without homology; Get rid of 5 ' the potential siRNA holding continuous 8 bases and other gene to match of aitisense chain; Get rid of the potential siRNA that any one section continuous 14 bases and other gene match.And utilize design software to carry out Pre-Evaluation mensuration, select 3 best kinetic parameter target spots to enter subsequent experimental flow process, each gene synthesizes 3 interference sequences altogether, in table 1.
Synthesis and the purification of 1.2 strand siRNA are completed by Invitrogen company.
The design of table 1.siRNA target spot
2siRNA sequence screening and interference effect are identified
2.1RNA transfection
Transfection procedure is with reference to Lipofectamine2000 description
1) within 12-16 hour in advance, by HBMEC cell, (purchased from Sciencell, preserving number: 1000) be layered on 24 porocyte culture plates and cultivate, when making transfection, cell density is 80%-90%.
2) get 2 μ LLipofectamine2000 and add also soft mixing in 50 μ Lopti-MEM, incubated at room 5 minutes; Separately getting 5 μ L concentration is that the RNA interfering of 5 μMs and 50 μ Lopti-MEM mix.After hatching end, the Lipofectamine2000 transfection reagent of dilution is added in the RNA of dilution, and soft pressure-vaccum mixing.After incubated at room 20min, add in HBMEC cell, add 400 μ Lopti-MEM, make RNA final concentration be 50nM.
3) within after transfection 6-8 hour, change containing dual anti-fresh culture.
2.2 real-time fluorescence quantitative PCRs (RT-PCR) detect the mRNA level in-site of each host molecule
1) TRIzol extracts the total serum IgE of matched group and interference group cell, and concrete steps are as follows:
Transfection, after 48 hours, goes culture supernatant, in cell, add 1mlTRIzol, abundant mixed room temperature cell lysis 3-5 minute.Add the chloroform of 1/5 volume, manually violent mixing 15 seconds.In 4 DEG C, 12,000 leaves the heart 15 minutes.Get upper strata aqueous phase and transfer in new EP pipe, adding equal-volume isopropyl alcohol, fully mix, precipitation at room temperature 10 minutes.In 4 DEG C, 12,000 leaves the heart 10 minutes.Abandon supernatant, add 75% ethanol of 1ml pre-cooling.In 4 DEG C, 12,000 centrifugal 5 minutes.Fully abandon supernatant, room temperature dries RNA precipitation, adds DEPC process water dissolution precipitation, obtains total serum IgE.
2) utilize takara Reverse Transcription box to obtain the cDNA of matched group and interference group cell, concrete steps are as follows:
Following reaction system is added in PCR pipe,
Soft mixing mixing, is placed in 37 DEG C of reactions 15 minutes, is then placed in 85 DEG C of heating deactivation in 5 seconds reverse transcriptases.
3) fluorescence quantitative RT-RCR detects
Utilize the SYBRPremixExTaq test kit of takara to react, reaction system is as follows,
Utilize RotorGene3000A instrument to carry out two-step method amplification, 95 DEG C of denaturation 2min, carry out 40 PCR circulation, 95 DEG C 5 seconds, 60 DEG C 30 seconds.
3 cytotoxicity experiments
The impact of on cell proliferation after employing CCK-8 method detection transfection siRNA, concrete steps are as follows:
Collect exponential phase cell, be inoculated in 96 orifice plates with the density in 3000, every hole.After cell pellet overnight is adherent, each siRNA of transfection, cultivates and detects cell proliferative conditions after 48 hours.Discard original culture medium, every hole adds the fresh culture 110 μ L containing 10 μ LCCK-8, to cultivate after 3h by multi-functional microplate reader at 450nm wavelength detecting each hole absorbance.Experiment is independent to be repeated 3 times, calculating mean value.
4EV71 viral infection HBMEC cell
The EV71 viral infection experiment of 4.1HBMEC cell
After HBMEC cell transfecting RNA 72 hours, carry out the experiment of EV71 viral infection.By culture supernatant sucking-off, with pre-temperature PBS rinse 2 times, with the virus quantity of MOI=0.1 inoculation EV71,37 DEG C hatch 2h after discard virus liquid, and with pre-temperature PBS rinse 3 times, add fresh culture and continue to cultivate.
4.2 immunofluorescence dyeings detect EV71 antigen presentation
Continue after HBMEC cell infection virus to cultivate 48h, adopt the expression of immuno-fluorescence assay virus antigen, concrete steps are as follows:
1) cell is fixed: removed by the culture fluid in 96 orifice plates, and add PBS and clean cell 2 times, every hole adds the pre-cold methanol of 100 μ l, under-20 DEG C of conditions, fix 20min, cleans cell 3 times with the PBS of pre-cooling.
2) permeable membrane: the cell per well after fixing adds 100 μ l0.1%TritonX-100, incubated at room 15min, washs 3 times with pre-cooling PBS.
3) close: every hole adds 100 μ l3%BSA, in incubated at room temperature 1h.
4) primary antibodie is hatched: every hole adds EV71 specific murine source monoclonal antibody 10F0 (1:2000 dilution) 100 μ l, incubated at room 1h, washs 3 times with the PBS of pre-cooling.
5) two anti-to hatch: every hole adds AF488 fluorescent labeling against murine IgG (1:1000 dilution) 100 μ l, and room temperature lucifuge hatches 1h, washs 2 times by the PBS lucifuge of pre-cooling.
6) labeled cell core: every hole adds nucleus fluorescent dye DAPI (1:5000, PBS dilute), and room temperature lucifuge hatches 15min, washs 3 times by the PBS lucifuge of pre-cooling.
7) detect under fluorescence microscope and calculate green AF488 positive cell clone number.
4.3 protein immunoblot.
(1) total protein of matched group and ARF6 interference group HBMEC cell is extracted respectively with protein lysate.
(2) respectively 30ug albumen is added to electrophoresis in the polyacrylamide gel of 12.5% concentration after quantification of protein, and intercepts respective strap electroporation and forward on pvdf membrane.
(3) non-specific sites of albumen is closed with the skim milk of 5%, and then close with ARF6 antibody, 4 DEG C are spent the night, and wash three times, wash away primary antibodie with TBST buffer.
(4) then use two of HRP labelling anti-incubated at room 2 hours, then wash three times with TBST buffer.
(5) last, utilize nitrite ion to develop the color and photographic analysis.
4.4RT-PCR detects EV71 virus quantity in cell
Continue after HBMEC cell infection virus to cultivate 48h, adopt TRIzol to extract the total serum IgE of matched group and interference group cell, and reverse transcription obtains cDNA, detect EV71 virus quantity by RT-PCR.Concrete steps are with shown in 2.2.
Experimental result:
1 design, synthesize and screen effective siRNA
For each genes of interest sequence, we devise multiple RNA interfered target sequence, and utilize design software to carry out Pre-Evaluation mensuration, select 3 best kinetic parameter target spots to enter subsequent experimental flow process, each gene synthesizes 3 interference sequences altogether, as shown in table 1.
Adopt the method for in-vitro transfection, the RNA interfering of each gene is transfected in HBMEC cell and goes, detected the jamming effectiveness of each RNA interfering by RT-PCR method after 48h, the siRNA sequence (in table 2 overstriking sequence) that finishing screen chooses interference effect the best carries out subsequent experimental, and its jamming effectiveness is as shown in table 2.
Table 2RT-PCR method detects siRNA interference sequence to the downward efficiency of relevant host gene
Note: CTRL: the HBMEC groups of cells (ghost group) of any siRNA of not transfection
The HBMEC groups of cells (negative control group) of NT: transfection non-targetingsiRNA
SiRNA: transfection is for the HBMEC groups of cells (experimental group) of the siRNA of each genes of interest.
Jamming effectiveness after 2siRNA interference and cytotoxicity detect
The effective siRNA transfection HBMEC cell for each host molecule picked out, after transfection, 48h detects the jamming effectiveness of each RNA interfering by RT-PCR method, on the Cytotoxic impact of HBMEC after employing CCK8 detection transfection simultaneously.
As shown in Figure 1, the effective siRNA group of transfection, compared with CTRL group, obviously can suppress the expression (P < 0.01) of corresponding gene to result after each siRNA of transfection.The suppression efficiency of transfection ARF6siRNA (SEQIDNO:4) can reach 61%.
Cytotoxicity experiment shows, does not produce obvious cytotoxicity (P > 0.05), do not have an impact, can be used for subsequent experimental to the normal physiological function of cell after each siRNA transfection.
Impact on EV71 viral infection after 3siRNA interference
After effective siRNA of each host molecule of transfection lowers the expression of host cell correlation molecule, infect the EV71 virus of same dose, after infecting 48h, the impact after adopting each host molecule of immuno-fluorescence assay to lower, EV71 infected, find compared with matched group, after transfection ARF6siRNA (SEQIDNO:4) makes ARF6 gene deregulation, significantly reduce the infection (Fig. 2 A) of EV71 to HBMEC cell.Find by calculating virus quantity, after ARF6 gene deregulation, 87.65% is reached to the suppression ratio of virus, and the downward of all the other molecules does not obviously suppress EV71 to infection (P > 0.05) (Fig. 2 B) of HBMEC cell.
For the inhibitory action that clear and definite ARF6 infects EV71, after transfection ARF6 molecule siRNA, detected the expression of ARF6 protein molecular by immunoblotting, and after infection EV71 observation of cell pathological changes situation, and detect EV71 virus quantity by RT-PCR.Result shows, and after transfection ARF6 molecule siRNA (SEQIDNO:4), obviously can suppress the expression (Fig. 3 A) of ARF6 protein molecular.Compared with matched group, after ARF6 protein expression is lowered, can T suppression cell pathological changes and virus quantity in HBMEC cell also significantly decline (Fig. 3 B, C), consistent with immuno-fluorescence assay result.These results show, compared with compared with control cells, after lowering ARF6 gene, the infection ability of EV71 to HBMEC cell obviously declines, and virus quantity reduces.
Further, the siRNA of transfection three ARF6 molecules observes the impact on viral infection respectively.Result shows the downward efficiency difference (Fig. 4 A) of different siRNA to ARF6 molecule, and wherein the jamming effectiveness of siRNA (SEQIDNO:4) is the highest, consistent with result above.After detecting interference, the infective impact of EV71 is found, article three, the siRNA of ARF6 molecule all can reach more than 65% to the suppression ratio of viral infection, and increasing along with the downward efficiency to ARF6 molecule, also raising (Fig. 4 B) to the suppression ratio that EV71 infects, prompting ARF6 molecule infects in HBMEC at EV71 and plays an important role.Therefore, ARF6 can be used as and suppresses EV71 to new host's target spot of HBMEC cell infection.
By above the results show: the present invention screens and EV71 can be suppressed to infect the new host cellular molecules ARF6 of of HBMEC cell.After ARF6 gene deregulation, do not affect the normal physiological function of cell, but obviously inhibit EV71 to the infection of HBMEC cell.Therefore the anergy that the present invention infects because of EV71 the blood brain barrier caused for clinical prevention and treatment provides new target spot and therapeutic scheme.
Below the preferred embodiment of the invention is illustrated, but the invention is not limited to described embodiment, those of ordinary skill in the art also can make all equivalent modification or replacement under the prerequisite without prejudice to the invention spirit, and these equivalent modification or replacement are all included in the application's claim limited range.
Claims (8)
- The application of 1.ADP ribosylation factor 6 in preparation prevention or treatment enterovirns type 71 infection medicine.
- The application of 2.ADP ribosylation factor 6 in preparation prevention or treatment hand-foot-mouth disease medicine.
- 3. the application of ADP ribosylation factor 6 according to claim 1 in preparation prevention or treatment enterovirns type 71 infection medicine, it is characterized in that, described medicine refers to the reagent that can suppress or lower the expression of ADP ribosylation factor 6.
- 4. the application of ADP ribosylation factor 6 according to claim 3 in preparation prevention or treatment enterovirns type 71 infection medicine, it is characterized in that, the described reagent that can suppress or lower the expression of ADP ribosylation factor 6 is siRNA, shRNA of ADP ribosylation factor 6 or comprises the recombinant vector of siRNA, shRNA.
- 5. the application of ADP ribosylation factor 6 according to claim 1 in preparation prevention or treatment enterovirns type 71 infection medicine, it is characterized in that, described medicine is the RNA interfering of ADP ribosylation factor 6, and the sequence of described RNA interfering is selected from following arbitrary:GCUCACAUGGUUAACCUCUAA(SEQIDNO:4)、GUCAAGUUCAACGUAUGGGAU(SEQIDNO:5)、GCAUUAUCAAUGACCGGGAGA(SEQIDNO:6)。
- 6. the application of ADP ribosylation factor 6 according to claim 2 in preparation prevention or treatment hand-foot-mouth disease medicine, it is characterized in that, described medicine refers to the reagent that can suppress or lower the expression of ADP ribosylation factor 6.
- 7. the application of ADP ribosylation factor 6 according to claim 6 in preparation prevention or treatment hand-foot-mouth disease medicine, it is characterized in that, the described reagent that can suppress or lower the expression of ADP ribosylation factor 6 is siRNA, shRNA of ADP ribosylation factor 6 or comprises the recombinant vector of siRNA, shRNA.
- 8. the application of ADP ribosylation factor 6 according to claim 2 in preparation prevention or treatment hand-foot-mouth disease medicine, it is characterized in that, described medicine is the RNA interfering of ADP ribosylation factor 6, and the sequence of described RNA interfering is selected from following arbitrary:GCUCACAUGGUUAACCUCUAA(SEQIDNO:4)、GUCAAGUUCAACGUAUGGGAU(SEQIDNO:5)、GCAUUAUCAAUGACCGGGAGA(SEQIDNO:6)。
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510030998.4A CN105267984B (en) | 2015-01-21 | 2015-01-21 | Application of the ADP ribosylation factor 6 in prevention and treatment enterovirns type 71 infection |
| PCT/CN2016/000032 WO2016115973A1 (en) | 2015-01-21 | 2016-01-19 | Application of a group of transmembrane transport related molecules in preventing and treating enterovirus 71 infection |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510030998.4A CN105267984B (en) | 2015-01-21 | 2015-01-21 | Application of the ADP ribosylation factor 6 in prevention and treatment enterovirns type 71 infection |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105267984A true CN105267984A (en) | 2016-01-27 |
| CN105267984B CN105267984B (en) | 2018-11-30 |
Family
ID=55138369
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510030998.4A Active CN105267984B (en) | 2015-01-21 | 2015-01-21 | Application of the ADP ribosylation factor 6 in prevention and treatment enterovirns type 71 infection |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105267984B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112057622A (en) * | 2019-06-11 | 2020-12-11 | 中国人民解放军第二军医大学 | Application of ATP (adenosine triphosphate) binding cassette transmembrane transport subfamily C member 3 in preparation of medicine for preventing and treating enterovirus 71infection |
| CN112057621A (en) * | 2019-06-11 | 2020-12-11 | 中国人民解放军第二军医大学 | Application of solute carrier family 7member 7in preparation of medicine for preventing and treating enterovirus 71infection |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008073441A2 (en) * | 2006-12-11 | 2008-06-19 | University Of Utah Research Foundation | Compositions and methods for treating pathologic angiogenesis and vascular permeability |
| CN102083452A (en) * | 2008-12-12 | 2011-06-01 | 犹他大学研究基金会 | Compositions and methods for promoting vascular barrier function and treating pulmonary fibrosis |
-
2015
- 2015-01-21 CN CN201510030998.4A patent/CN105267984B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008073441A2 (en) * | 2006-12-11 | 2008-06-19 | University Of Utah Research Foundation | Compositions and methods for treating pathologic angiogenesis and vascular permeability |
| CN102083452A (en) * | 2008-12-12 | 2011-06-01 | 犹他大学研究基金会 | Compositions and methods for promoting vascular barrier function and treating pulmonary fibrosis |
Non-Patent Citations (3)
| Title |
|---|
| OUTI HEIKKILA等: "Internalization of Coxsackievirus A9 Is Mediated by 2-Microglobulin,Dynamin,and Arf6 but Not by Caveolin-1 or Clathrin", 《JOURNAL OF VIROLOGY》 * |
| 罗文英等: "肠道病毒71型感染人脑微血管内皮细胞的初步研究", 《第二军医大学学报》 * |
| 郭金萍: "不依赖于NF-κB信号通路的细胞因子破坏血管内皮屏障功能", 《中国博士学位论文全文数据库医药卫生科技辑》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112057622A (en) * | 2019-06-11 | 2020-12-11 | 中国人民解放军第二军医大学 | Application of ATP (adenosine triphosphate) binding cassette transmembrane transport subfamily C member 3 in preparation of medicine for preventing and treating enterovirus 71infection |
| CN112057621A (en) * | 2019-06-11 | 2020-12-11 | 中国人民解放军第二军医大学 | Application of solute carrier family 7member 7in preparation of medicine for preventing and treating enterovirus 71infection |
| CN112057621B (en) * | 2019-06-11 | 2021-07-02 | 中国人民解放军第二军医大学 | Application of solute carrier family 7member 7in preparation of medicine for preventing and treating enterovirus 71infection |
| CN112057622B (en) * | 2019-06-11 | 2021-07-06 | 中国人民解放军第二军医大学 | Application of ATP (adenosine triphosphate) binding cassette transmembrane transport subfamily C member 3 in preparation of medicine for preventing and treating enterovirus 71infection |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105267984B (en) | 2018-11-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Chen et al. | Retrograde axonal transport: a major transmission route of enterovirus 71 in mice | |
| Kobayashi et al. | Cellular receptors for enterovirus A71 | |
| Wang et al. | A mouse-adapted enterovirus 71 strain causes neurological disease in mice after oral infection | |
| Lin et al. | Lymphocyte and antibody responses reduce enterovirus 71 lethality in mice by decreasing tissue viral loads | |
| Celma et al. | Interaction of calpactin light chain (S100A10/p11) and a viral NS protein is essential for intracellular trafficking of nonenveloped bluetongue virus | |
| Yamayoshi et al. | Identification of a human SCARB2 region that is important for enterovirus 71 binding and infection | |
| Ludwig-Begall et al. | Noroviruses—the state of the art, nearly fifty years after their initial discovery | |
| Hasebe et al. | Transcellular transport of West Nile virus-like particles across human endothelial cells depends on residues 156 and 159 of envelope protein | |
| Frierson et al. | Utilization of sialylated glycans as coreceptors enhances the neurovirulence of serotype 3 reovirus | |
| Xing et al. | Snake cathelicidin derived peptide inhibits zika virus infection | |
| Choy et al. | A non-structural 1 protein G53D substitution attenuates a clinically tested live dengue vaccine | |
| CN105535975A (en) | Applications of vesicle-associated membrane protein 1 in prevention and treatment of enterovirus 71 infection | |
| CN105435246A (en) | Applications of autophagy-related protein 12 in preventing and treating enterovirus 71 infection | |
| Wang et al. | Recent progress of surface plasmon resonance in the development of coronavirus disease-2019 drug candidates | |
| CN105267948B (en) | Application of the tyrosine kinase substrate that hepatocyte growth factor is adjusted in preparation prevention and treatment enterovirns type 71 infection medicine | |
| CN105267984A (en) | Application of ADP ribosylation factor 6 in prevention and treatment of enterovirus 71 infection | |
| CN105311647A (en) | Application of Cofilin in preventing and treating Japanese encephalitis virus infection | |
| CN105288655B (en) | Application of the vacuole sorting protein 4A in preparation prevention and treatment enterovirns type 71 infection medicine | |
| CN105435245B (en) | Application of the calcium integrin Binding Protein 1 in prevention and treatment enterovirns type 71 infection | |
| Liu et al. | Construction and characterization of an infectious cDNA clone of coxsackievirus A 10 | |
| CN105497918A (en) | Application of dynamin 1 in prevention and treatment on enterovirus type 71 infection | |
| CN105267985B (en) | Application of the n-ethylmaleimide sensitive factor in prevention japanese encephalitis virus infection | |
| Escribano-Romero et al. | Swine vesicular disease virus. Pathology of the disease and molecular characteristics of the virion | |
| CN105311646B (en) | Application of the ezrin in prevention and treatment japanese encephalitis virus infection | |
| CN105288654A (en) | Application of protein tyrosine kinase FYN proto-oncogene in controlling enterovirus 71 infections |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |