CN101602809B - Antibody targeted complement inhibitor with anti-inflammatory action - Google Patents
Antibody targeted complement inhibitor with anti-inflammatory action Download PDFInfo
- Publication number
- CN101602809B CN101602809B CN2008102247681A CN200810224768A CN101602809B CN 101602809 B CN101602809 B CN 101602809B CN 2008102247681 A CN2008102247681 A CN 2008102247681A CN 200810224768 A CN200810224768 A CN 200810224768A CN 101602809 B CN101602809 B CN 101602809B
- Authority
- CN
- China
- Prior art keywords
- scfv
- complement inhibitor
- chain antibody
- selectin
- selectin single
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention discloses an anti-P-selectin single-chain antibody targeted complement inhibitor ScFv-CD59 and application thereof. The invention aims to provide an anti-P-selectin single-chain antibody targeted complement inhibitor ScFv-CD59 with specific targeting and the application thereof in preparing medicaments for treating systemic inflammations. The anti-P-selectin single-chain antibody targeted complement inhibitor ScFv-CD59 is a fusion protein obtained by connecting the amino terminal of the anti-P-selectin single-chain antibody ScFv with the complement inhibitor CD59 by using a connecting peptide. The experiment proves that the ScFv-CD59 can obviously improve the efficiency of inhibiting the complement-mediated cell cracking, can achieve high-degree accumulation at the immune injury part, can obviously inhibit the occurrence and degeneration of inflammations and can obviously reduce the side effect of infection caused by the complement inhibitor. Therefore, the ScFv-CD59 can be used as an active ingredient to be prepared into a novel gene engineering targeted protein medicament with a targeted P-selectin complement inhibitor for treating inflammations. The invention plays an important role in the pharmaceutical field and has wide application prospects.
Description
Technical field
The invention belongs to the gene prod field, particularly relate to a kind of anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59 and application in the medicine of preparation treatment body inflammatory reaction thereof with specific target tropism.
Background technology
Inflammation is a modal and complicated case process in the human diseases, can betide any position and any tissue of body.Inflammatory reaction is in various degree all arranged after multiple disease such as tumour, cardiovascular and cerebrovascular diseases, diabetes, autoimmune disorder and wound etc.Nearest discovers, serious or when developing into chronic inflammatory diseases, it also can cause the generation of multiple disease when degree of inflammation.Prevention is the thorny problem of medical field with treatment inflammation and relevant syndromes all the time.Though various inflammation have its singularity, it seems that from partial pathological change they all have a lot of common ground, promptly all be a kind of radical response that damaging action produced of body to pro-inflammatory cytokine.At present, a large amount of data show that the generation of inflammation and P select the activation of plain high expression level and complement closely related.
Inflammatory reaction starts from that inflammatory cell sticks, migration, infiltration, activation and inflammatory factor discharge.Leukocyte recruitment is the basis of Inflammatory response to response organization in circulation, and the adhesion of white corpuscle and endotheliocyte is the initial step of inflammation.White corpuscle and endotheliocyte contact, stick and the rolling on vessel wall mainly by selecting plain mediation.P selects being connected of plain mediation activatory thrombocyte and monocyte and neutrophil leucocyte, and sticking fast of chrotoplast and neutrophil leucocyte also mainly relies on P to select plain mediation.It is that P selects plain high-affinity part that P selects plain glycoprotein ligand-1 (PSGL-1), is expressed in all blood neutrophil leucocyte, monocyte, lymphocyte.After P selects element and PSGL-1 combines, regulate the secretion of cytokine, participate in inflammatory reaction.Combine with PSGL-1 on the monocyte as activated blood platelet, can induce the monocyte superoxide anion to discharge, the expression of tissue factor, the synthetic and phagolysis of platelet increasing activation factor.In addition, can also induce the synthetic of monocyte chemotactic factor-1 (MCP-1), TNF-α, interleukin etc.
P selects plain mainly being distributed in the Weibel palade corpusculum of hematoblastic α particle of tranquillization and endotheliocyte.P selects element not express or low the expression under the normal circumstances, after the factors such as inflammation, damage that are subjected to stimulate, hematoblastic α particle and endotheliocyte Weibel-Palade corpusculum are rapidly and plasma membrane merges and make P select element significantly to express on the surface of thrombocyte and endotheliocyte, and the also appearance of originally not expressing of organizing is expressed.Data shows that P selects the plain pathophysiological process that has participated in multiple disease, its excessively or continuous expression become the sign of some lesion tissue.Existing anti P selectin antibody, the free P of purifying of studies show that selects plain, anti-sLe
XCan suppress being connected of activatory thrombocyte and monocyte and neutrophil leucocyte, thereby the inflammation-inhibiting reaction produces.Therefore, suppress P and select plain express and diagnosis and treatment that the cell adhesion effect can be disease provide new strategy.
Complement is the physiological defensive substance, is again the medium that causes pathologic damage.Complement system can promote to engulf and dissolve target cell, it is the important component part of immunity of organism defense mechanism, offset and remove external antigenic infringement, the balance of safeguarding organismic internal environment has vital role, but then, under the stimulation of some non-immunity factors, the complement system activation can produce inflammatory reaction again, and influence blood coagulation and fibrinolytic system, cause the damage of body normal tissue cell.Produce different proteolytic fragments in the complement activation process, thereby mediate various biological effect regulating effects, reaction causes inflammation.In addition, complement activates at cell surface, forms MAC by C5b-9.MAC is a macromolecular complex, and it forms and strides the lonely L of film road, makes macromolecular substance and ion two-way flow, causes cytolysis; MAC can also promote to discharge cytokine, oxyradical and metal matrix albumen, the aggravation Inflammatory response.Prove at present, all relevant in tumour, cardiovascular and cerebrovascular diseases, diabetes, autoimmune disorder and the inflammatory reaction as multiple disease such as sacroiliitis, Alzheimer's disease, osteoporosis relevant with the activation of complement with the age.
CD59 is a kind of GPI anchoring type glycoprotein that is distributed widely in the histocyte surface, the about 18-20kD of molecular weight.Be made up of 103 aa, contain single N end saccharification site, its C end nationality GPI and cell anchor connect.CD59 has multiple important immunologic function, is a kind of important Complement Regulatory Protein, also is the unique repressible protein that acts on the complement activation final stage of CRPs.Main C9 combines with C5b-8 or the extension of C9 molecule by suppressing, and the activation of blocking-up complement suppresses the formation of MAC.Under the situation that has CD59 to exist, can not successfully finish whole assemblings of MAC on the surface of of the same race or self cell, maybe can not be assembled into the C5b-9 mixture, thereby limit solvency action of the same race or self cell, alleviated inflammatory reaction.The CD59 molecule of evidence sudden change has lost anticomplementary activity, can not suppress MAC and form, and causes MAC to be deposited on blood vessel endothelium in a large number, causes serious inflammatory reaction.Therefore, CD59 guarantees the therapeutic action of autoimmunization and diseases associated with inflammation as can reduce inflammation pathological change due to the reaction of body inhibitor as the potential anti-inflammatory factors.
At present, multiple complement inhibitor is developed, and it is clinical to enter for two, three phases as the monoclonal antibody of existing CR1 of the U.S. and C5a.In addition.Anti-MBLmAb, anti-C5mAb and anti-C9mAb, cobra-venom factor, N-heparan, protein inhibitor FUT-175 etc. also have certain anticomplementary action.Though but this type systematic complement inhibitor has improved inflammatory reaction, because complement system is the important component part of immunity of organism defense mechanism, the complement of general suppresses simultaneously, also can cause infection to wait the potential side effect.
Summary of the invention
The invention provides a kind of anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59 with anti-inflammatory action.
Anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59 provided by the present invention is to connect the fusion rotein that complement inhibitor CD59 obtains by connection peptides at the aminoterminal (N end) of anti P selectin single-chain antibody ScFv.
Specifically, described anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59 is one of following amino acid residue sequences:
1) the SEQ ID NO:1 in the sequence table;
2) with the amino acid residue sequence of SEQ ID NO:1 in the sequence table through replacement, disappearance or the interpolation of one to ten amino-acid residue and have the protein of anti-inflammatory action.
SEQ ID NO:1 in the sequence table is made up of 323 amino-acid residues, is complement inhibitor CD59 from aminoterminal 251-323 amino acids residue, is connection peptides (Gly from aminoterminal 241-250 amino acids residue
4Ser)
2From aminoterminal 1-240 amino acids residue is anti P selectin single-chain antibody ScFv, wherein, from aminoterminal 1-122 amino acids residue is the variable region of heavy chain of anti P selectin single-chain antibody ScFv, is the variable region of light chain of anti P selectin single-chain antibody ScFv from aminoterminal 133-240 amino acids residue.
The encode gene of above-mentioned anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59 is one of following nucleotide sequence:
1) dna sequence dna of SEQ ID NO:2 in the sequence table;
2) dna sequence dna of SEQ ID NO:1 in the code sequence tabulation;
3) with sequence table in the nucleotide sequence that limits of SEQ ID NO:2 have 90% above homology and have the nucleotide sequence of anti-inflammatory action;
4) nucleotide sequence of the dna sequence dna hybridization that under the rigorous condition of height, can limit with the SEQ ID NO:2 in the sequence table.
The rigorous condition of described height for hybridization back with contain 0.1 * SSPE (or 0.1 * SSC), the solution of 0.1%SDS washes film under 65 ℃.
SEQ ID NO:2 in the sequence table is by 969 based compositions, its encoding sequence is from 5 ' end 1-969 bit base, coding has the protein of the amino acid residue sequence of SEQ ID NO:1 in the sequence table, from 5 ' end 751-969 bit base coding complement inhibitor CD59 (1-72aa), from 5 ' end 721-750 bit base coding connection peptides (Gly
4Ser)
2From 5 ' end 1-720 bit base coding anti P selectin single-chain antibody ScFv, wherein, from the variable region of heavy chain of 5 ' end 1-366 bit base coding anti P selectin single-chain antibody ScFv, from the variable region of light chain of 5 ' end 397-720 bit base coding anti P selectin single-chain antibody ScFv.
Contain anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59 expression carrier of the present invention, transgenic cell line and host bacterium and all belong to protection scope of the present invention.
Arbitrary segmental primer is to also within protection scope of the present invention in the amplification anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59 encoding gene.
The present invention also provides the recombinant expression vector that is used to express above-mentioned anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59.
The recombinant expression vector that is used to express above-mentioned anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59 provided by the present invention is the recombinant expression vector that contains anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59 gene.
Described anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59 gene can be inserted in the recombinant expression vector.Make up the carrier that sets out of described recombinant expression vector, can be any one and refer to bacterial plasmid, phage, yeast plasmid, vegetable cell virus, mammalian cell virus (as adenovirus, retrovirus or other carrier) of carrying out exogenous gene expression well known in the art.In a word, as long as can duplicate in host and stably express, any plasmid and carrier can be used.A key character of expression vector is to contain copy-point, promotor, marker gene and translation controlling elements usually.
Described prokaryotic expression carrier can be pET-32a, pET-28a, pET-28b, pET-28c, pET-21a (+) or pET-30a etc.; Described carrier for expression of eukaryon can be pEE14.1, pCMV5, pSilence1.0-U6 (Ambion, Austin, TX, USA), pcDNA, pEGFP-N1, pSV40, pCI-neo (purchasing company), pTEF1, pPICZ α, pAM82 or pAAh5 etc. in Promega.
Wherein, be the carrier that sets out with pEE14.1, the recombinant expression vector that contains described anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59 gene of structure is pEE14.1/ScFv-CD59.
Can adopt method well known to those skilled in the art to make up the recombinant expression vector that contains described anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59 gene, as the extracorporeal recombinant DNA technology, (Sambrook such as the interior recombinant technology of DNA synthetic technology and body, et al Molecular cloing, a Laboratory Manual.Cold springharbor laboratory.New York, 1989).The dna sequence dna of described anti P selectin single-chain antibody gene can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA's.Described promotor can be: colibacillary lac or trp promotor, phage promoter, retrovirus and some other known may command gene expression promoter in protokaryon or eukaryotic cell or its virus.Described expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.
In addition, described expression vector also can comprise one or more selected markers, to be provided for selecting the phenotype shape of transformed host cells, to cultivate dihydrofolate reductase gene, neomycin resistance gene and green fluorescent protein (GFP) gene of usefulness or be used for colibacillary tsiklomitsin or ampicillin resistance gene etc. as eukaryotic cell.
Another object of the present invention provides a kind of method of expressing above-mentioned anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59.
The expression method of anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59 provided by the present invention, be recombinant expression vector conversion or the transduction host cell that is used to express anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59 with described, cultivate host cell, separation and purification albumen from substratum or cell obtains anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59.
Described host cell can be a prokaryotic cell prokaryocyte, as bacterial cell; The low eukaryotic cell that waits is as yeast cell; Higher eucaryotic cells is as mammalian cell.Representative example has: intestinal bacteria, streptomycete; The bacterial cell of Salmonella typhimurium; Eukaryotic cell such as yeast, vegetable cell; Insect cells such as fruit bat S2 or Sf9; Zooblasts such as CHO, COS, 293 cells or Bowes melanoma cell.Described host cell is preferably Chinese hamster ovary celI.
When polynucleotide of the present invention are expressed in higher eucaryotic cells,, will make to transcribe to be enhanced if in carrier, insert enhancer sequence.Enhanser is the cis acting factor of DNA, and length is generally 10-300 base pair, acts on promotor transcribing with enhancing gene.As the length in replication origin side in late period one be about the SV40 enhanser of 100-270 base pair, at the polyoma enhanser of replication origin side in late period one or adenovirus enhanser etc.
Available routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell, is cultivated transformant, the abduction delivering target protein, and recombinant protein advanced separation and purification.
Cultivation contains the substratum and the culture condition of the host cell of anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59 encoding gene of the present invention, all can be substratum and the culture condition of cultivating the host that sets out.
The present invention also provides a kind of medicine for the treatment of the body inflammatory reaction.
The medicine of treatment body provided by the present invention inflammatory reaction, its activeconstituents are above-mentioned anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59 or its encoding gene.
Described anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59 gene can be present in the carrier for expression of eukaryon.
When needing, in said medicine, can also add one or more pharmaceutically acceptable carriers.Described carrier comprises thinner, vehicle, weighting agent, absorption enhancer or the absorption carrier etc. of pharmaceutical field routine.
Medicine of the present invention can be made various ways such as injection liquid, tablet, pulvis, granula, capsule, oral liquid.The medicine of above-mentioned various formulations all can be according to the ordinary method preparation of pharmaceutical field.
The consumption of said medicine is generally 200 μ g anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59/kg body weight, is administered once every 1 day, and be 14 days the course of treatment; The consumption of said medicine is generally 200
μ g anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59 gene/kg body weight was administered once every 1 day, and be 14 days the course of treatment.The dosage and the course of treatment all can be adjusted according to practical situation.
The invention provides a kind of anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59.This fusion rotein is to select element as " target " with P, and anti P selectin single-chain antibody ScFv is as " carrier ", and complement inhibitor CD59 selects plain complement inhibitor as the target P at the treatment inflammatory reaction of " bullet ".ScFv-CD59 not only has targeting to inflammation part, also can two activated pathway (P selects element and complement) with inflammation-related be suppressed, and not only can reach the purpose of treatment inflammation, reduces dosage simultaneously, reduces side effect.Experiment showed, that ScFv-CD59 can significantly improve the lysis that suppresses complement-mediated and imitate, and can assemble at immune damaging part height, obvious developing of inflammation-inhibiting, and significantly reduce the side effect that complement inhibitor causes infection.Thereby can it, activeconstituents select plain complement inhibitor novel gene engineering targeting proteins medicine for being prepared at the target P that treats inflammatory reaction.The present invention will play a significant role in the medicine and pharmacology field, have a extensive future.
Below in conjunction with specific embodiment the present invention is described in further details.
Description of drawings
Fig. 1 is 1.2% an agarose electrophoresis detected result of light chain and heavy chain variable region gene amplified production
Fig. 2 is 1.2% an agarose electrophoresis detected result of anti P selectin single-chain antibody gene amplification product
Fig. 3 is the 12%SDS-PAGE detected result of anti P selectin single-chain antibody
Fig. 4 is the Western Blot qualification result of anti P selectin single-chain antibody
Fig. 5 is 1.2% an agarose electrophoresis detected result of CD59 gene amplification product
Fig. 6 is 1.2% an agarose electrophoresis detected result of ScFv-CD59 gene amplification product
Fig. 7 is the 12%SDS-PAGE detected result of anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59
Fig. 8 is the Western Blot qualification result of anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59
Fig. 9 is the Chinese hamster ovary celI and the erythrolysis experimental result of complement-mediated
Figure 10 is a biosensor avidity analytical results
Figure 11 is the biodistribution experimental result
Figure 12 is the experimentation on animals result
Embodiment
Method therefor is ordinary method if no special instructions among the following embodiment.
Acquisition and the Construction of eukaryotic thereof of embodiment 1, anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59
One, the acquisition of anti P selectin single-chain antibody
With following method screening anti P selectin single-chain antibody, concrete grammar may further comprise the steps:
1, cell cultures and evaluation: will secrete the hybridoma that P selects plain antibody (with reference to hybridoma and monoclonal antibody experimental technique, Xu Tinggui, the method in 1982. makes up) and be incubated in the complete RPMI1640 substratum that contains 15% bovine serum.Incubator contains 5%CO
2Mixed gas, humidity is 98%.With the specificity and the titre of monoclonal antibody in the ELISA method evaluation culture supernatant, antibody titers reaches 1: 3200 as a result, and tangible specific specificity is arranged.。
2, the isolation and purification of mRNA: with preparation, purified mRNA test kit (Promega) and reference reagent box specification sheets fast from about 2 * 10
7Extract total RNA in the individual hybridoma, and purified mRNA, concrete grammar is: collect about 2 * 10
7Individual hybridoma adds 175 μ l lysate lysing cell, 25 ℃ 13, the centrifugal 10min of 000g, collect supernatant, add 200 μ l, 95% ethanol, transfer in the adsorption column, 13, the centrifugal 1min of 000g, absorption RNA adds 600 μ l RNA rinsing liquids, 13, the centrifugal 1min of 000g adds 50 μ l DNaseI, hatches the 15min dna digestion for 25 ℃, add 200 μ l Dnase stop buffers again, 13, the centrifugal 1min of 000g, 600 μ l RNA rinsing liquid rinsings are once, 250 μ lRNA rinsing liquid rinsings once, 100 μ l Nuclease-Free H
2The total RNA. of O wash-out gets the total RNA of 1.0mg, add RNase-Free Water to 150 μ l, hatch 10min for 65 ℃, add 3 μ l Biotinylated-Oligo (dT) Probe and 13 μ l, 20 * SSC, be cooled to room temperature, then RNA is joined among the SA-PMPs, incubated at room 10min adsorbs SA-PMPs with magnet, abandons supernatant, with 300 μ l, 0.1 * SSC rinsing 4 times, collect mRNA with 100 μ l RNase-Free Water wash-outs at last.
3, cDNA preparation: the mRNA with purifying is a template, cDNA is synthesized in reverse transcription, concrete grammar is: 2 μ g mRNA, Random Primers 0.5mg/mL 2 μ l, the water final volume that adds nuclease free is 15 μ l, 70 ℃ were heated 8 minutes, at cooled on ice 5min, of short duration centrifugal to the pipe bottom, add 5 * Buffer, 5 μ l
RibonucleaseInhibitor 40u, 37 ℃ of 5min, add Sodium Pyrophosphate again, 40mM 2.5 μ l, AMV ReverseTranscriptase 30u, the water of adding nuclease free is to cumulative volume 25 μ l, gentle mixing, 37 ℃ of 60min, reaction finishes the back and takes out 20 μ l as template, adds Second Strand 2.5 * Buffer 40 μ l, Acetylated BSA, 1mg/mL 5 μ l, DNA Polymerase I 23u, RNase H 0.8u, the water final volume of nuclease free is 100 μ l, hatched 2 hours for 14 ℃, add 10 μ l 200mM EDTA termination reactions, promptly obtain cDNA.
4, the amplification of antibody variable gene: using PCR method, is template with reverse transcription synthetic cDNA, adds the variable region of light chain (V of a cover anti P selectin single-chain antibody in the PCR reaction system respectively
L) primer (primer sequence is GACATCCAGATGACCCAGTCT and CCGTTTTATTTCCAACTTTGT) or variable region of heavy chain (V
H) primer (primer sequence is GTGCAGCTGCAGGAGTCT and TCCTGAGGAGACGGTGACCGT) (Pharmacia), 10 * PCR damping fluid, 5 μ l, the dNTP final concentration is 2.5mM, mixing is after 100 ℃ of sex change 5min add 2 Taq of unit archaeal dna polymerases.Total reaction volume is 50 μ l.Add mineral oil behind the mixing.Carry out 30 circulating reactions, each cycling condition is: 94 ℃ of sex change 30s.55 ℃ of annealing 90s, 72 ℃ are extended 90s, and reaction proceeds to last circulation back at 72 ℃ of insulation 10min.After reaction finishes, from light chain and heavy chain variable region gene amplified production, take out 3 μ l respectively and carry out 1.2% agarose electrophoresis detection, detected result as shown in Figure 1, the chain variable region gene of 324bp and the heavy chain variable region gene of 366bp have been obtained through pcr amplification, conform to expected results, remaining uses Sephagels
TMBandprep Kit (Pharmacia) reclaims purifying.
5, the connection of single-chain antibody gene: (primer sequence is ACCGTCTCCTCAGGAGGCGGTGGCGGCTCGGGTGGCGGCGGCTCT and GGTCATCTGGATGTCAGAGCCGCCGCCACCCGAGCCGCCTCCGCC, and (Gly encodes with being connected primer with the light chain that reclaims and heavy chain variable region gene
4Ser)
2Dna sequence dna) under the condition that waits volumetric molar concentration, add the dNTP of 2.5mM and the Taq archaeal dna polymerase of 3 units, 10 * PCR damping fluid, 5 μ l, reaction volume are 50 μ l.With carrying out 7 anneal cycles after the Witco 70 sealing, each round-robin reaction conditions is 94 ℃ of sex change 30s, 64 ℃ of annealing 4min.
6, the amplification of single-chain antibody gene: with the single-chain antibody gene is template, in above-mentioned reaction system, add a pair of 5 ' end and contain Sfi 1,3 ' end contains the primer (primer sequence is TCAGGCCATTATGGCCATGGTGCAGCTGCAGGAG and TCAGCGGCCGCTAACCGTTTTATTTCAAC) of Not 1 restriction enzyme site, carry out 30 PCR circulations, each cycling condition is 94 ℃ of sex change 1min, 55 ℃ of annealing 2min, 72 ℃ are extended 2min, and reaction proceeds to last circulation back at 72 ℃ of insulation 10min.The agarose electrophoresis that reaction finishes to take out 3 μ L 1.2% in the back from pcr amplification product detects, detected result as shown in Figure 2, obtained the single-chain antibody gene of 720bp through pcr amplification, conformed to expected results, remaining reclaims purifying with SephagelsTM Bandprep Kit.
7, the structure in single-chain antibody library and expression: with expression vector pCANTAB5E (Pharmacia) and the single-chain antibody gene after reclaiming respectively through Sfi 1 and Not 1 double digestion, under the effect of T4 ligase enzyme, pCANTAB5E expression vector and single-chain antibody gene be connected for 16 ℃ spend the night.With recombinant plasmid transformed e. coli tg1 competent cell, and cell transformed is coated on contains on the 100 μ g/mL penbritin LB culture plates, in 37 ℃ of overnight incubation.The transformed bacteria that is grown on the flat board is all collected, with 2 * YTAG (containing 100 μ g/mL penbritins and 2% glucose) diluting cells suspension to OD
600=0.2,37 ℃ of cultivations are cultured to logarithmic phase (about OD
600=0.4), adds 2 * 10
9The pfuM13K07 helper phage was cultivated 1 hour for 37 ℃, and is centrifugal.(contain 2 * YT) resuspended sedimentation cells of 100 μ g/mL penbritins and 50 μ g/mL kantlex, 37 ℃ of shaking culture are spent the night, and the supernatant that contains recombinant phage is collected in centrifugal back, is single-chain antibody phage expression library with 10mL 2 * YTAK.
8, the screening of recombinant phages antibody: select plain antigen (available from Shanghai history Rake bio tech ltd) bag by the polyethylene culture dish with P, will contain in the supernatant of recombinant phage and this culture dish 37 ℃ and hatch 2 hours.With PBS wash dish 20 times, use PBST (PBS that contains 0.05%Tween 20) wash dish 20 times again, abandon PBST.Add 10mL and be in logarithmic phase TG1 cell, cultivated 1 hour for 37 ℃.Centrifugal, collect supernatant, carry out the next round screening.The screening process of repetition " absorption-wash-out-breeding " 2 times.With the superingection of M13K07 helper phage, the phage surface that just can generate the enrichment clone presents the library.
9, the screening of mono-clonal recombinant phage and evaluation: after the third round screening, with 2 * YT TG1 bacterium liquid is done multiple dilution (stoste, 1: 10,1: 100,1: 1000), be coated on SOBAG solid medium (molecular cloning, the third edition then, Huang Peitang etc. translate) on, 30 ℃ of overnight incubation.94 single bacterium colonies of picking at random from the flat board are inoculated in 100 μ l, 2 * YTAG (containing 100 μ g/mL penbritins and 2% glucose) nutrient solution 30 ℃ of overnight incubation respectively.Get 20 μ l nutrient solutions, transferring contains 5 * 10 in 200 μ l
8In 2 * YTAG nutrient solution of pfu/mL M13K07, cultivated 2 hours for 37 ℃.Centrifugal, with 200 μ l, 2 * YTAK (2 * YT) the resuspended sedimentation cells that contain 100 μ g/mL penbritins and 50 μ g/mL kantlex, 30 ℃ of overnight incubation.Centrifugal, collection supernatant are the mono-clonal recombinant phage.
Select plain antigen coated elisa plate with P, as negative control, use goat-anti M13 phage antibody as positive control with 0.5%BSA.37 ℃ of sealings of 1%BSA 1 hour.The equal-volume mixture of cleer and peaceful confining liquid on the 100 μ l recombinant phages antibodies is joined in the elisa plate, add the M13 phage in the control wells.Hatched 1 hour for 37 ℃, PBST (PBS that contains 0.05%Tween 20) washes plate 3 times, and PBS washes plate 3 times.Every hole adds 100 μ l goat-anti M13 phage antibody IgG-HRP (1: 2000), hatches 1 hour for 37 ℃.PBST and PBS once respectively wash plate 3 times, add freshly prepared substrate H
2O
2-OPD, room temperature reaction 20min adds 50 μ l 2M H
2SO
4Termination reaction is at A
490The absorbance value in every hole is detected at the place.The positive clone more than 2.1 times of the negative contrast of absorbance value selects with P and selects the plain the strongest active positive colony that combines.
10, the dna sequence analysis of positive colony recombinant plasmid: the dna sequence dna of measuring anti P selectin single-chain antibody on this positive recombinant plasmid with T7DNA sequence TAATACGACTCACTATAGGG, this gene has the nucleotide sequence of SEQ ID NO:2 as a result, by 720 based compositions, its variable region of heavy chain encoding gene has the dna sequence dna of SEQ ID NO:5 in the sequence table, the variable region of light chain encoding gene has the dna sequence dna of SEQ ID NO:6 in the sequence table, its encoding sequence is from 5 ' end 1-720 bit base, coding has the protein of the amino acid residue sequence of SEQ ID NO:1 in the sequence table, and ScFv (also claims V with this antibody called after
L-Linker-V
H).
Two, the acquisition of anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59
1, the clone of CD59 gene: extract test kit (Promega) and reference reagent box specification sheets with RNA and extract mouse lymphoma cell (consonance cell centre: CCC0235) Zu Zhi total RNA, and reverse transcription becomes cDNA.Use PCR method, with this cDNA is template, the upstream and downstream primer (primer sequence is CTCACATGCTACCACTGT and ACTTTTGTTACACAAGTT) that in the PCR reaction system, adds CD59 (1-72aa), 10 * PCR damping fluid, 5 μ l, the dNTP final concentration is 2.5mM, 2 Taq of unit archaeal dna polymerases add mineral oil behind the mixing.Carry out 30 circulating reactions, each cycling condition is: 94 ℃ of sex change 30s.55 ℃ of annealing 30s, 72 ℃ are extended 40s, and reaction proceeds to last circulation back at 72 ℃ of insulation 5min.Take out 3 μ l and carry out 1.2% agarose electrophoresis and detect from amplified production, detected result has obtained the CD59 gene of 216bp through pcr amplification as shown in Figure 5, conforms to expected results, and remaining uses Sephagels
TMBandprep Kit (Pharmacia) reclaims purifying.
2, the amplification of ScFv-CD59 gene: (primer sequence is TTGGAAATAAAACGGGGCGGAGGTGGGTCGGGTGGCGGCGGATCT and GTGGTAGCATGTGAGAGATCCGCCGCCACCCGACCCACCTCCGCC, coding (Gly with being connected primer with CD59 (1-72aa) gene of anti P selectin single-chain antibody ScFv gene and recovery
4Ser)
2Dna sequence dna) under the condition that waits volumetric molar concentration, add the dNTP of 2.5mM and the Taq archaeal dna polymerase of 3 units, 10 * PCR damping fluid, 5 μ l, reaction volume are 50 μ l.With carrying out 7 anneal cycles after the Witco 70 sealing, each round-robin reaction conditions is 94 ℃ of sex change 30s, 64 ℃ of annealing 4min.Again in above-mentioned reaction system, add a pair of 5 ' end and contain Hind III, 3 ' end contains the primer (primer sequence is TACAAGCTTGTGCAGCTGCAGGAGTCT and TACCCCGGGACTTTTCTTACACAAGTT) of Sma I restriction enzyme site, carry out 30 PCR circulations, each cycling condition is 94 ℃ of sex change 50s, 55 ℃ of annealing 60s, 72 ℃ are extended 70s, and reaction proceeds to last circulation back at 72 ℃ of insulation 10min.Reaction finishes the back takes out 3 μ l and carries out 1.2% agarose electrophoresis and detect from pcr amplification product, detected result has obtained the dna fragmentation of 969bp through pcr amplification as shown in Figure 6, conforms to expected results, and remaining uses Sephagels
TMBandprep Kit (Pharmacia) reclaims purifying.
3, ScFv-CD59 Construction of eukaryotic: the goal gene of purifying through Hind III and Sma I double digestion, is connected with carrier for expression of eukaryon pEE14.1 through same double digestion, and will connects product transformed into escherichia coli DH5
The α competent cell, screening positive clone, the upgrading grain obtains carrying the recombinant expression vector of anti P selectin single-chain antibody targeted complement inhibitor-ScFv and CD59 fusion gene, called after pEE14.1/ScFv-CD59.The positive colony recombinant plasmid is carried out the dna sequencing analysis, as a result this fusion gene have SEQ ID NO:2 in the sequence table nucleotide sequence, by 969 based compositions, its encoding sequence is from 5 ' end 1-969 bit base, coding has the protein of the amino acid residue sequence of SEQ ID NO:1 in the sequence table, from 5 ' end 751-969 bit base coding complement inhibitor CD59, from 5 ' end 721-750 bit base coding connection peptides (Gly
4Ser)
2From 5 ' end 1-720 bit base coding anti P selectin single-chain antibody ScFv, wherein, from the variable region of heavy chain of 5 ' end 1-336 bit base coding anti P selectin single-chain antibody ScFv, from the variable region of light chain of 5 ' end 397-720 bit base coding anti P selectin single-chain antibody ScFv.ScFv-CD59 (also claims V with this anti P selectin single-chain antibody targeted complement inhibitor called after
L-Linker-V
H-Linker-CD59).
Embodiment 2, anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59 efficiently express the screening of cell strain and the purifying of anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59
One, anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59 efficiently expresses the screening of cell strain
In order to obtain more approaching natural higher organism protein molecule aspect molecular structure, physicochemical property and the biological function, utilize eukaryotic expression recombinant plasmid pEE14.1/ScFv-CD59 transfection that liposome obtains embodiment 1 to Chinese hamster ovary cell CHO.After the transfection 24 hours, inhale and remove substratum, add the fresh selective medium DMEM+10%FCS+25 μ m MSX of 10mL.Containing 5%CO
2Mixed gas, humidity is to cultivate in 37 ℃ of incubators of 98%.After 2 weeks, the clone of about 1-2mm occurs, the clone that will occur with clone's ring is forwarded in 24 orifice plates, and every hole adds 1mL selective medium DMEM+10%FCS+25 μ m MSX and continues to cultivate.After transformant grows to 5 days, draw supernatant.This supernatant 100 μ l are joined with in the plain antigen coated elisa plate of P selection, hatched 1 hour for 37 ℃, PBS washes plate 3 times.Every hole adds two anti-antibody IgG (1: 2000) of 100 μ l HRP marks, hatches 1 hour for 37 ℃.PBS washes plate 3 times, adds freshly prepared substrate H
2O
2-OPD, room temperature reaction 20min adds 50 μ l 2M H
2SO
4Termination reaction is at A
490The absorbance value in every hole is detected at the place.The positive clone more than 2.1 times of the negative contrast of absorbance value selects with P and selects the plain the strongest active positive colony that combines, and is the Chinese hamster ovary celI strain that efficiently expresses anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59.
Two, the purifying of anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59
The Chinese hamster ovary celI strain amplification culture of anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59 will be efficiently expressed, the results supernatant.Supernatant is slowly added among the HiTrap N-hydroxysuccinimide column (AmershamBiosciences) purification of single stranded antibody.With the PBS wash-out of 0.01mol/L pH 7.4, flow velocity is 1mL/min, to elutant OD
280Till＜0.02.Add glycine-HCl damping fluid of 0.1mol/L pH 2.4, flow velocity is 1mL/min, collects the composition that absorbs, immediately with the neutralization of 1mol/L yellow soda ash, in order to avoid protein denaturation.Identify through SDS-PAGE and Western Blot, the result as shown in Figure 7 and Figure 8, obtained the target protein of 35KD through expression, and this albumen can be selected plain specific combination with CD59 and P, conform to expected results, show to have obtained the very high anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59 of purity.
Embodiment 3, inside and outside biologic activity are identified and experimentation on animals
One, the complement cracking suppresses experiment
For measuring the inhibition activity to complement, 60%～80% Chinese hamster ovary celI that merges separates with ethylenediamine tetraacetic acid (EDTA), washes 2 times with DMEM, is resuspended in then among the DMEM, and making its final concentration is 10
9/ L.Add the anti-Chinese hamster ovary celI film of 100mL/L rabbit antiserum(antisera) in cell suspension, 4 ℃ of effect 30min make cell sensitization.Abandon antiserum(antisera) then, cell is resuspended among the NHS that dilutes with DMEM, and final volume is 50 μ l or 100 μ l.37 ℃ of effect 60min measure cell viablity (viable cell and dead cell are all counted) with the blue dyeing of placenta exclusive method at last.Fusion rotein ScFv-CD59 joins earlier among the NHS after diluting with DEME, is added to the Chinese hamster ovary celI suspension again.Final concentration can cause the contrast Chinese hamster ovary celI dissolving of about 90% antibody sensitized to be as the criterion with 100g/L NHS.The erythrolysis of complement-mediated suppresses experiment and measures with the sheep red blood cell (EAs) of antibody sensitized.Hemolytic test is at gelatin veronal buffer (GVB
++) in carry out, final volume is 300 μ L, includes 2.5 * 10
7Eas, NHS was according to dilution in 1: 300.Reaction mixture is hatched 60min at 37 ℃, adds 300 μ L at last and contains 10mmol/L EDTA-PBS solution termination reaction.Centrifugal, get supernatant, under the 413nm wavelength, the protoheme in the supernatant is carried out detection by quantitative with optical spectrum imagers.The Chinese hamster ovary celI of complement-mediated and erythrolysis experimental result as shown in Figure 9, targeted complement inhibitor ScFv-CD59 is more obvious than the inhibition effect of corresponding non-targeted complement inhibitor.
Two, biosensor avidity is analyzed
ScFv-CD59 fusion rotein and biotin labeled P select plain (P selects element-vitamin H) interactional dynamic analysis to detect (BIAcore 3000 instruments) with superficial cell plasmagene group resonance (SPR) detection system.Amount according to the average 50mg/L of each wandering cells, with P select element-vitamin H with the speed injection of 2 μ L/min to BIAcore streptavidin sensor chip, effect 20min, damping fluid is 0.5 * PBS (pH7.4) (containing 0.5g/L Tween20).The spr signal of selecting element to obtain from the P that catches produces BIAcore reacton (scope is 250 to 500).Not add the fusion rotein group in contrast.25 ℃,, after 0.5 * PBST (0.5g/L Tween20) washing, assess its avidity by detecting ScFv-CD59 fusion rotein concentration (500nmol～1 μ m/L) with the flow velocity of 25 μ L/min.SPR detected result such as Figure 10 show that fusion rotein ScFv-CD59 selects element-biology to have higher combining and the speed of dissociating with P, has shown that ScFv-CD59 and P select plain parent to have higher avidity.
Three, biodistribution experiment
Adopt the Iodogen method with ScFv-CD59 fusion rotein mark
125I in the EP pipe that is coated with 200 μ g Iodogen, adds existing 50mmLo/L PBS (pH7.4) the 150 μ l that prepare successively, contains 1mg BSA dissolved ScFv-CD59100 μ l (100 μ g), Na
125I solution 15 μ l (185MBq) are interrupted under the room temperature and slightly shake mark pipe 15min.The SEP-PAKC18 post is used methyl alcohol, distilled water and each 5mL of 0.1% trifluoroacetic acid (TFA) to wash successively respectively and is made its activation; Mark mixture upper prop, 0.1%TFA drip washing; 60% acetonitrile solution wash-out, 1.5mL elutriant before collecting.After lyophilize, with the PBS solution dilution, the packing that contain 1mg/mLBSA ,-80 ℃ of freezer storages are standby.Male DBA/1J mouse tail root subcutaneous injection 0.1mL collagen I I and complete Freund's adjuvant (all purchasing the Sigma company in the U.S.), rheumatoid arthritis (CIA) mouse model is once set up in reinforcement in the 21st day.Test and clustering method are as follows: 1. control group tail vein injection
125I-ScFv-CD59 (2ug), sacrificed by decapitation behind 24h, 48h is respectively collected blood, takes out histoorgan, weighs and measures its radioactivity (Bq), and the result is scaled the ID%/g tissue.2. sacroiliitis group tail vein injection
125I-ScFv-CD59 (2ug) behind 24h, 48h, 72h, 96h, takes the same processing, detection respectively.3. arthritis treatment group, tail vein injection once
125I-ScFv-CD59 (0.25ug) behind the 24h, takes the same processing, detection.4. arthritis treatment group, every day tail vein injection once
125I-ScFv-CD59 (0.25ug) behind continuous 7 days, 24h, takes the same processing, detection.The result shows that ScFv-CD59 can assemble at sacroiliitis position height as shown in figure 11.
Four, experimentation on animals
Utilize rheumatoid arthritis (CIA) mouse model (the same),, be grouped as follows: 1. inject 50 μ l PBS control groups since test in the 21st day.2. ScFv-CD59 treatment group is injected a ScFv-CD59 (0.25) mg every day, injects altogether 7 times.3. ScFv-CD59 treatment group is injected a ScFv-Crry (0.25) mg every day, injects altogether 4 times.4. ScFv-CD59 treatment group is injected a ScFv-CD59 (0.25) mg.The 23rd day beginning clinical score, the standard that clicks is scored to the scorching degree of joint of animal: 0 minute, no sacroiliitis; 1 minute, light inflammation and claw were rubescent; 2 minutes, serious erythema and swelling influenced the claw function; 3 minutes, claw or joint deformity, stiff lost function.Every mouse four limbs highest point total is 12 minutes.The result is starkly lower than the PBS group since the sacroiliitis severity of three treatment groups of the 23rd day ScFv-CD59 as shown in figure 12.
Above experimental result shows that the ScFv-CD59 fusion rotein compares with non-targeted complement inhibitor, and the lysis usefulness that suppresses complement-mediated significantly improves; Targeted complement inhibitor ScFv-CD59 can assemble at immune damaging part height, and obviously inflammation-inhibiting develops.
Sequence table
<160>4
<210>1
<211>323
<212>PRT
＜213〉artificial sequence
<220>
<223>
<400>1
Val?Gln?Leu?Gln?Glu?Ser?Gly?Pro?Gly?Leu?Val?Lys?Pro?Ser?Gln?Ser
1 5 10 15
Leu?Ser?Leu?Thr?Cys?Thr?Val?Thr?Gly?Tyr?Ser?Ile?Thr?Ser?Asp?Tyr
20 25 30
Ala?Trp?Asn?Trp?Ile?Arg?Gln?Phe?Pro?Gly?Asn?Lys?Leu?Glu?Trp?Met
35 40 45
Gly?Tyr?Ile?Ser?Ser?Gly?Arg?Thr?Ser?Tyr?Asn?Pro?Ser?Leu?Lys?Ser
50 55 60
Arg?Ile?Ser?Ile?Thr?Arg?Asp?Thr?Ser?Lys?Asn?Gln?Phe?Phe?Leu?Gln
65 70 75 80
Leu?Asn?Ser?Val?Thr?Thr?Glu?Asp?Thr?Ala?Thr?Tyr?Tyr?Cys?Ala?Arg
85 90 95
His?Tyr?Gly?Asn?Tyr?Glu?Gly?Tyr?Tyr?Tyr?Ala?Met?Asp?Tyr?Trp?Gly
100 105 110
Gln?Gly?Thr?Thr?Val?Thr?Val?Ser?Ser?Gly?Gly?Gly?Gly?Gly?Ser?Gly
115 120 125
Gly?Gly?Gly?Ser?Asp?Ile?Gln?Met?Thr?Gln?Ser?Pro?Ala?Ser?Leu?Ser
130 135 140
Met?Ala?Ile?Gly?Glu?Lys?Val?Thr?Ile?Arg?Cys?Ile?Thr?Ser?Thr?Gly
145 150 155 160
Ile?Asp?Asp?Asp?Met?Asn?Trp?Tyr?Gln?Gln?Lys?Pro?Gly?Glu?Pro?Pro
165 170 175
Glu?Leu?Leu?Ile?Ser?Glu?Gly?Asn?Val?Leu?Arg?Pro?Gly?Val?Pro?Ser
180 185 190
Arg?Phe?Ser?Ser?Ser?Gly?Tyr?Gly?Thr?Asp?Phe?Leu?Phe?Thr?Ile?Glu
195 200 205
Asn?Ile?Leu?Ser?Glu?Asp?Val?Ala?Asp?Tyr?Tyr?Cys?Leu?Gln?Thr?Asp
210 215 220
Asn?Leu?Pro?Leu?Thr?Phe?Gly?Ser?Gly?Thr?Lys?Leu?Glu?Ile?Lys?Arg
225 230 235 240
Gly?Gly?Gly?Gly?Ser?Gly?Gly?Gly?Gly?Ser?Leu?Thr?Cys?Tyr?His?Cys
245 250 255
Phe?Gln?Pro?Val?Val?Ser?Ser?Cys?Asn?Met?Asn?Ser?Thr?Cys?Ser?Pro
260 265 270
Asp?Gln?Asp?Ser?Cys?Leu?Tyr?Ala?Val?Ala?Gly?Met?Gln?Ala?Tyr?Gln
275 280 285
Arg?Cys?Trp?Lys?Gln?Ser?Asp?Cys?His?Gly?Glu?Ile?Ile?Met?Asp?Gln
290 295 300
Leu?Glu?Glu?Thr?Lys?Leu?Lys?Phe?Arg?Cys?Cys?Gln?Phe?Asn?Leu?Cys
305 310 315 320
Asn?Lys?Ser
<210>2
<211>969
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>2
gtgcagctgc?aggagtctgg?acctggcctg?gtgaaacctt?ctcagtctct?gtccctcacc 60
tgcactgtca?ctggctactc?aatcaccagt?gattatgcct?ggaactggat?ccggcaattt 120
ccaggaaaca?aactggagtg?gatgggctac?ataagcagtg?gaagaacaag?ctacaaccca 180
tctctcaaaa?gtcgaatctc?tatcactcga?gacacatcca?agaaccagtt?cttcctgcag 240
ttgaattctg?tgactactga?ggacacagcc?acatattact?gtgcaagaca?ctatggtaac 300
tacgagggct?attactatgc?tatggactac?tggggccaag?ggaccacggt?caccgtctcc 360
tcaggaggcg?gtggcggctc?gggtggcggc?ggctctgaca?tccagatgac?ccagtctcca 420
gcatccctgt?ccatggctat?aggagaaaaa?gtcaccatca?gatgcataac?cagcactggt 480
attgatgatg?atatgaactg?gtaccagcag?aagccggggg?aacctcctga?actccttatt 540
tcagaaggca?atgttcttcg?tcctggagtc?ccatcccgat?tctccagcag?tggctatggt 600
acagattttc?tttttacgat?tgaaaacatt?ctctcagaag?atgttgcaga?ttactactgt 660
ttgcaaactg?ataacttgcc?tctcacgttc?ggctcgggga?caaagttgga?aataaaacgg 720
ggcggaggtg?ggtcgggtgg?cggcggatct?ctcacatgct?accactgttt?ccaaccggtg 780
gtttcttcat?gcaatatgaa?cagcacttgc?tctcctgacc?aggattcctg?tctctatgct 840
gtagccggaa?tgcaagcgta?tcaaaggtgt?tggaaacaat?cagattgtca?tggtgagatc 900
attatggacc?aattagaaga?gacaaaatta?aaattcagat?gctgccagtt?taacttgtgt 960
aacaaaagt
969
<210>3
<211>720
<212>DNA
＜213〉phage
<400>3
gtgcagctgc?aggagtctgg?acctggcctg?gtgaaacctt?ctcagtctct?gtccctcacc 60
tgcactgtca?ctggctactc?aatcaccagt?gattatgcct?ggaactggat?ccggcaattt 120
ccaggaaaca?aactggagtg?gatgggctac?ataagcagtg?gaagaacaag?ctacaaccca 180
tctctcaaaa?gtcgaatctc?tatcactcga?gacacatcca?agaaccagtt?cttcctgcag 240
ttgaattctg?tgactactga?ggacacggcc?acatattact?gtgcaagaca?ctatggtaac 300
tacgagggct?attactatgc?tatggactac?tggggccaag?ggaccacggt?caccgtctcc 360
tcaggaggcg?gtggcggctc?gggtggcggc?ggctctgaca?tccagatgac?ccagtctcca 420
gcatccctgt?ccatggctat?aggagaaaaa?gtcaccatca?gatgcataac?cagcactggt 480
attgatgatg?atatgaactg?gtaccagcag?aagccagggg?aacctcctga?actccttatt 540
tcagaaggca?atgttcttcg?tcctggagtc?ccatcccgat?tctccagcag?tggctatggt 600
acagattttc?tttttacgat?tgaaaacatt?ctctcagaag?atgttgcaga?ttactactgt 660
ttgcaaactg?ataacttgcc?tctcacgttc?ggctcgggga?caaagttgga?aataaaacgg 720
<210>4
<211>240
<212>PRT
＜213〉phage
<400>4
Val?Gln?Leu?Gln?Glu?Ser?Gly?Pro?Gly?Leu?Val?Lys?Pro?Ser?Gln?Ser
1 5 10 15
Leu?Ser?Leu?Thr?Cys?Thr?Val?Thr?Gly?Tyr?Ser?Ile?Thr?Ser?Asp?Tyr
20 25 30
Ala?Trp?Asn?Trp?Ile?Arg?Gln?Phe?Pro?Gly?Asn?Lys?Leu?Glu?Trp?Met
35 40 45
Gly?Tyr?Ile?Ser?Ser?Gly?Arg?Thr?Ser?Tyr?Asn?Pro?Ser?Leu?Lys?Ser
50 55 60
Arg?Ile?Ser?Ile?Thr?Arg?Asp?Thr?Ser?Lys?Asn?Gln?Phe?Phe?Leu?Gln
65 70 75 80
Leu?Asn?Ser?Val?Thr?Thr?Glu?Asp?Thr?Ala?Thr?Tyr?Tyr?Cys?Ala?Arg
85 90 95
His?Tyr?Gly?Asn?Tyr?Glu?Gly?Tyr?Tyr?Tyr?Ala?Met?Asp?Tyr?Trp?Gly
100 105 110
Gln?Gly?Thr?Thr?Val?Thr?Val?Ser?Ser?Gly?Gly?Gly?Gly?Gly?Ser?Gly
115 120 125
Gly?Gly?Gly?Ser?Asp?Ile?Gln?Met?Thr?Gln?Ser?Pro?Ala?Ser?Leu?Ser
130 135 140
Met?Ala?Ile?Gly?Glu?Lys?Val?Thr?Ile?Arg?Cys?Ile?Thr?Ser?Thr?Gly
145 150 155 160
Ile?Asp?Asp?Asp?Met?Asn?Trp?Tyr?Gln?Gln?Lys?Pro?Gly?Glu?Pro?Pro
165 170 175
Glu?Leu?Leu?Ile?Ser?Glu?Gly?Asn?Val?Leu?Arg?Pro?Gly?Val?Pro?Ser
180 185 190
Arg?Phe?Ser?Ser?Ser?Gly?Tyr?Gly?Thr?Asp?Phe?Leu?Phe?Thr?Ile?Glu
195 200 205
Asn?Ile?Leu?Ser?Glu?Asp?Val?Ala?Asp?Tyr?Tyr?Cys?Leu?Gln?Thr?Asp
210 215 220
Asn?Leu?Pro?Leu?Thr?Phe?Gly?Ser?Gly?Thr?Lys?Leu?Glu?Ile?Lys?Arg
225 230 235 240
Claims (9)
1. anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59, be to connect the fusion rotein that complement inhibitor CD59 obtains by connection peptides at the aminoterminal of anti P selectin single-chain antibody ScFv, its amino acid residue sequence is shown in the SEQ ID NO:1 in the sequence table.
2. the gene of coding claim 1 described anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59.
3. according to the gene of the described coding anti P selectin single-chain antibody of claim 2 targeted complement inhibitor ScFv-CD59, it is characterized in that: the Nucleotide of described gene is shown in the dna sequence dna of SEQ ID NO:2 in the sequence table.
4. being used to express the recombinant expression vector of anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59, is the recombinant expression vector that contains claim 2 or 3 described anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59 encoding genes.
5. recombinant expression vector according to claim 4 is characterized in that: described recombinant expression vector is pEE14.1/ScFv-CD59.
6. method of expressing the described anti P selectin single-chain antibody targeted complement inhibitor of claim 1 ScFv-CD59, this method is with claim 4 or 5 described recombinant expression vector conversion or the transduction host cells that are used to express anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59, cultivate host cell, separation and purification albumen from substratum or cell obtains anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59.
7. expression method according to claim 6 is characterized in that: described host cell is a Chinese hamster ovary celI.
8. the application of the described anti P selectin single-chain antibody targeted complement inhibitor of claim 1 ScFv-CD59 in the medicine of preparation treatment body inflammatory reaction.
9. the application of the gene of claim 2 or 3 described coding anti P selectin single-chain antibody targeted complement inhibitor ScFv-CD59 in the medicine of preparation treatment body inflammatory reaction.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008102247681A CN101602809B (en) | 2008-12-29 | 2008-12-29 | Antibody targeted complement inhibitor with anti-inflammatory action |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008102247681A CN101602809B (en) | 2008-12-29 | 2008-12-29 | Antibody targeted complement inhibitor with anti-inflammatory action |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101602809A CN101602809A (en) | 2009-12-16 |
| CN101602809B true CN101602809B (en) | 2011-12-07 |
Family
ID=41468717
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2008102247681A Expired - Fee Related CN101602809B (en) | 2008-12-29 | 2008-12-29 | Antibody targeted complement inhibitor with anti-inflammatory action |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101602809B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021247487A1 (en) * | 2020-06-01 | 2021-12-09 | Medical University Of South Carolina | Recombinant fusion proteins targeting p-selectin, and methods of use thereof for treating diseases and disorders |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110922489B (en) * | 2019-12-01 | 2021-05-04 | 北京康普美特创新医药科技有限责任公司 | anti-C3 d targeting single-chain antibody and CD59 fusion protein and application thereof |
| CN113801244B (en) * | 2021-10-14 | 2022-12-20 | 中国人民解放军疾病预防控制中心 | Targeted immunosuppressant TCAbCD59 for preventing and treating infectious inflammation |
| CN114209813A (en) * | 2021-11-30 | 2022-03-22 | 广西医科大学第一附属医院 | Application of targeted complement inhibitor in preparation of medicine for improving cholestatic liver injury |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1948343A (en) * | 2005-10-14 | 2007-04-18 | 北京安波特基因工程技术有限公司 | Tetravalence single chain antibody of p53 tetra polymerized structure domain |
| WO2007134538A1 (en) * | 2006-05-24 | 2007-11-29 | Institute Of Biophysics Chinese Academy Of Sciences | Rat antihuman macrophage migration inhibitory factor monoclonal antibody and its application |
-
2008
- 2008-12-29 CN CN2008102247681A patent/CN101602809B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1948343A (en) * | 2005-10-14 | 2007-04-18 | 北京安波特基因工程技术有限公司 | Tetravalence single chain antibody of p53 tetra polymerized structure domain |
| WO2007134538A1 (en) * | 2006-05-24 | 2007-11-29 | Institute Of Biophysics Chinese Academy Of Sciences | Rat antihuman macrophage migration inhibitory factor monoclonal antibody and its application |
Non-Patent Citations (3)
| Title |
|---|
| Dirk Spitzer et al..In Vivo Correction of Complement Regulatory Protein Deficiency with an Inhibitor Targeting the Red Blood Cell Membrane.《The Journal of Immunology》.2005,第175卷7763-7770. * |
| Macor P et al..In vivo targeting of human neutralizing antibodies against CD55 and CD59 to lymphoma cells increases the antitumor activity of rituximab.《Cancer Res》.2007,第67卷(第21期),10556-10563. * |
| 谢佩蓉.抗人补体B因子单克隆抗体的杂交瘤细胞系的建立.《细胞与分子免疫学杂志》.1987,(第01期),26. * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021247487A1 (en) * | 2020-06-01 | 2021-12-09 | Medical University Of South Carolina | Recombinant fusion proteins targeting p-selectin, and methods of use thereof for treating diseases and disorders |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101602809A (en) | 2009-12-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105315371B (en) | Anti-human IL-17 monoclonal antibodies | |
| CN108409860B (en) | Human interleukin-4 receptor alpha resisting monoclonal antibody, its preparation method and application | |
| CN101037671B (en) | Hybridoma cell line and anti-human erythrocyte surface H antigen monoclonal antibodies generated thereof | |
| CN109575132B (en) | Single-chain antibody of human anti-complement C3d molecule and application thereof | |
| CN108359011B (en) | Target the antibody, preparation method and application of interleukin-17 A | |
| WO2021109953A1 (en) | Fusion protein of anti-c3d targeting single-chain antibody and daf, and application | |
| CN106336459B (en) | Human interleukin-17A resisting monoclonal antibody, preparation method and application thereof | |
| WO2021109968A1 (en) | Fusion protein of anti-c3d targeted single-chain antibody and cd59, and application thereof | |
| CN101602809B (en) | Antibody targeted complement inhibitor with anti-inflammatory action | |
| CN110256575A (en) | A kind of long-acting recombinant human growth hormone fusion protein and its engineering cell | |
| CN109897107B (en) | Nano antibody and preparation method thereof | |
| CN101434651B (en) | Recombinant thymosin beta 4 two repeat protein and preparation thereof | |
| CN101475644B (en) | Novel targeted fusion protein with anti-inflammatory action and use thereof | |
| CN109897110A (en) | Nano antibody and preparation method thereof | |
| CN103451218B (en) | Preparation method of novel cytokine fusion protein IP10 single-chain antibody | |
| CN105916883B (en) | Bifunctional fusion proteins and its preparation method and application | |
| CN107551265A (en) | A kind of vaccine for pigs trichina disease and its preparation method and application | |
| CN104292341B (en) | A kind of eight factor fusion protein of blood coagulation and its preparation method and application | |
| CN103130894B (en) | Recombinant single-chain antibody G5-4ScFv of anti-human gamma delta T cell receptor (TCR) monoclonal antibody and encoding gene and application thereof | |
| CN101456912B (en) | Anti P selectin single-chain antibody and use thereof | |
| CN109609466A (en) | The anti-aspergillus granulose hybridoma cell strain of mouse, monoclonal antibody and application | |
| CN111840529B (en) | Preparation of recombinant polypeptide vaccine VKVQ of Eimeria tenella and application method of recombinant polypeptide vaccine VKVQ in resisting chicken coccidiosis | |
| CN100441689C (en) | EHEC 0157 shiga-like toxin IIA resisting subunit monoclonal antibody 5F3 light and heavy chain variable region gene and its application | |
| CN100393748C (en) | Human tumour necrosin antibody, its preparation and medicinal composition | |
| KR101482237B1 (en) | A pharmaceutical composition for preventing and treating autoimmune disease comprising minicircle vector expressing bispecific protein comprising anti-IL-6R and TNFR2 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20111207 Termination date: 20151229 |
|
| EXPY | Termination of patent right or utility model |