WO2021109968A1 - Fusion protein of anti-c3d targeted single-chain antibody and cd59, and application thereof - Google Patents

Abstract

Disclosed is a fusion protein of a single-chain antibody of a human anti-complement C3d molecule and a complement inhibitor CD59. The antibody has excellent antigen binding activity. Biological distribution experiments prove that the fusion protein provided by the present invention can be rapidly and highly aggregated at an arthritis part after entering a rheumatoid arthritis mouse model, and has an excellent anti-adhesion/anti-inflammation targeted inhibition effect. In treatment of MRL/lpr lupus erythematosus mice, the fusion protein provided by the present invention can obviously improve the survival rate of the mice, and symptoms of proteinuria, glomerular score, interstitial inflammation, vasculitis, crescent/necrosis and the like of a treatment group are obviously improved, so that the fusion protein provided by the present invention has an excellent application prospect in preparation of medicaments for treating autoimmune diseases.

Description

Fusion protein of anti-C3d targeting single-chain antibody and CD59 and application Technical field

The invention provides a fusion protein, which belongs to the technical field of polypeptides.

Background technique

The complement system is composed of more than 30 soluble protein molecules and is part of the natural immune system. Its components include more than 30 molecules such as the inherent components of complement, various regulatory factors, and complement receptors. The complement system can be activated through three relatively independent and interconnected pathways, so as to regulate phagocytosis, lyse cells, mediate inflammation, immune regulation and clear immune complexes and other biological effects, including enhancing phagocytosis and enhancing phagocytosis. Chemotaxis of cells; increase the permeability of blood vessels; neutralize viruses; cytolysis; regulation of immune response, etc. Complement activation and its deposition on target structures can also indirectly cause cell or tissue destruction. Complement activation products that mediate tissue damage are produced at various points in the complement pathway. Inappropriate complement activation on host tissues plays an important role in the pathology of many autoimmune and inflammatory diseases. Therefore, the treatment of some autoimmune diseases caused by complement activation based on down-regulation or inhibition of complement activation has become a new attempt in this technical field. Current studies have shown that down-regulation or inhibition of complement activation is suitable for the treatment of some diseases in animal models and in vitro studies. Symptoms are effective, such as rheumatoid arthritis, systemic lupus erythematosus, glomerulonephritis and so on.

There are three pathways for complement activation, namely, the classical pathway, the alternative pathway, and the mannan binding agglutination pathway. The components involved in the classical activation pathway of complement include C1-C9. According to their role in the activation process, they are artificially divided into three groups, namely recognition units (Clq, Clr, Cls), activation units (C4, C2, C3) and membrane attack units (C5-C9). The phases play a role in the recognition phase, the activation phase and the membrane attack phase. The difference between the alternative activation pathway and the classical activation pathway is that activation bypasses the three components of C1, C4, and C2, directly activates C3 and then completes the chain reaction of each component from C5 to C9. Mannan-Binding Lectin (MBL) in the plasma directly recognizes N-galactosamine or mannose on the surface of a variety of pathogenic microorganisms, and then activates MASP-1 and MASP-2 in turn. , C4, C2, C3, forming the same C3 and C5 convertases as the classical pathway, activate the activation pathway of the complement cascade enzymatic reaction. The above three pathways can produce C3 invertase. C3 molecules are cleaved by C3 invertase into anaphylactoxin C3a and C3b with opsonization. C3b molecules can be covalently linked to amine groups and hydroxyl groups on the surface of glycoproteins. This covalent effect It is mediated by the thioester group inside the C3b molecule. Therefore, C3b molecules can be adsorbed on the surface of microorganisms that invade the body, and then bind to type I complement receptors (CR1/CD35), and hydrolyze under the action of serum factors H and I to form iC3b, which is then cleaved into C3d. The C3d fragment is the smallest fragment of complement C3 that can no longer be digested. CD21, CD19, CD81 and CD225 (Leu-13) on the surface of B cells are linked by non-covalent bonds to form the activation co-receptors of B cells. The extracellular region of CD21 binds to the antigen-bound complement component C3d, and the CD19 transmits stimulating signals to the cytoplasm, which can significantly reduce the threshold for antigen activation of B cells. CD21 is also called type II complement receptor (CR2), which is mainly distributed on the surface of follicular dendritic cells (FDC), B cells and some T cells.

In view of the important role of C3d molecule and CR2 as its receptor in the complement activation pathway and the process of humoral and cellular immune activation, researchers began to pay attention to blocking or competitively inhibiting the binding of C3d molecule to CR2 to down-regulate and inhibit complement Activate to block the pathological process of autoimmune diseases. The fusion of complement receptor 2 with specific targeting effect but no complement inhibitory effect with complement inhibitors, thereby exerting a specific inhibitory effect on complement activation, is a technical means for the treatment of autoimmune diseases. Chinese invention patents CN101563363B and CN100594037C respectively reported the complement inhibitory activity of the fusion protein of complement receptor 2 and complement inhibitor F factor, decay accelerating factor or CD59. CD59 is an 18-20 kDa glycosylphosphatidylinositol (GPI)-anchored membrane glycoprotein. It was originally isolated from the surface of human red blood cells as an inhibitor of complement activation. It is known that CD59 inhibits the formation of membrane attack complex (MAC) after complement activation. MAC formation is one of the final events of the complement cascade, forming small pores in the cell membrane, which ultimately leads to cell destruction. CD59 binds to C5b-8 and interferes with the subsequent polymerization of C9 molecules and MAC formation. Other complement inhibitory proteins such as type 1 complement receptor (CR1; CD35), membrane cofactor protein (MCP; CD46) and decay accelerating factor (DAF; CD55) act earlier in the complement cascade. Complement activation leads to the destruction of target cells or cell activation, which recruits leukocytes, shrinks surrounding smooth muscle and increases vascular permeability. Complement activation also plays a role in antibody-dependent cell-mediated cytotoxicity (ADCC) and complement-dependent cell-mediated cytotoxicity (CDCC). Complement activation leads to an inflammatory response, which may damage target tissues if it is not well regulated. CD59 and other complement inhibitory proteins prevent autologous tissue damage caused by activation of the complement cascade. The therapeutic idea of complement receptor 2 and complement inhibitor fusion protein is based on the specific recognition of exogenous protein molecules as receptors and C3d molecules, thereby preventing the binding and activation of C3d molecules and CR2 during pathological processes. In practical applications, this The method still has certain limitations. For example, because the molecular weight of the fusion protein of the targeting molecule and the inhibitor is too large, it is difficult for the fusion protein to reach the lesion, especially in some relatively hidden parts, and it will also cause a decrease in affinity and a prolonged half-life. Disadvantages, and even lead to unnecessary immunogenicity.

Single-chain antibodies are small-molecule antibodies prepared by genetic engineering methods. They are made by connecting the variable region of the heavy chain (VH) of the antibody with the variable region of the light chain (VL) by an elastic linking peptide (usually 12-15 amino acids). The resulting recombinant antibody has a molecular weight equivalent to only one-sixth of the original natural antibody, but the single-chain antibody contains all the antigen-binding sites, so the single-chain antibody retains the antigen-binding activity of the antibody to the greatest extent and is a parent antibody Small fragments of antigen binding activity, which can make it reach the focus tissue that is difficult to reach by conventional antibodies. And because single-chain antibodies do not contain the Fc segment, they will not bind to Fc receptors on unrelated cells, avoiding immune complex reactions caused by the Fc segment. Therefore, inhibiting the binding of C3d and CR2 by anti-C3d antibodies, thereby exerting a specific inhibitory effect on complement activation, is a new treatment idea.

technical problem

Chinese invention patent application CN109575132A discloses an anti-C3d antibody single-chain antibody, showing that the anti-C3d antibody has a certain technical effect in targeting inflammatory lesions and reducing the inflammatory response caused by complement activation. However, based on the requirements of targeted therapy, there is still a need in the art to give full play to the targeting function of anti-C3d antibodies and strengthen the technical solution of the inhibitory effect on the complement activation pathway. That is, anti-C3d antibodies can not only block the binding of C3d and CR2 Blockers, but also can target more potent complement inhibitors to inflammatory lesions to produce a synergistic effect that inhibits complement activation. However, the prior art anti-C3d antibody single-chain antibody is still difficult to meet this technical requirement. The fusion of anti-C3d antibody and different inhibitors will increase the molecular weight of the protein, which will change the spatial structure of the remodeled protein, thereby affecting Targeting effect of anti-C3d antibody.

Therefore, the purpose of the present invention is to provide a new fusion protein of anti-C3d single-chain antibody with excellent targeting performance and complement inhibitor CD59, so that the anti-C3d single-chain antibody not only acts as a blocking agent to block the binding of C3d and CR2 It can also target the complement inhibitor CD59 to inflammatory lesions to produce excellent therapeutic effects.

Technical solutions

Based on the above-mentioned purpose of the invention, the present invention first provides a fusion protein of a human anti-complement C3d molecule single-chain antibody and a complement inhibitor CD59. The amino acid sequences of CDR1, CDR2 and CDR3 of the light chain variable region of the antibody are as The amino acid sequences of positions 25-35, 51-57, and 89-98 of SEQ ID NO. 2 are shown in the amino acid sequences of CDR1, CDR2, and CDR3 of the heavy chain variable region of the antibody, respectively. The amino acid sequences at positions 30-35, 50-66 and 99-107 are shown.

In a preferred embodiment, the amino acid sequence of the variable region of the antibody light chain is shown in SEQ ID NO.2, and the amino acid sequence of the variable region of the antibody heavy chain is shown in SEQ ID NO.4.

In a more preferred embodiment, the variable region of the light chain of the antibody and the variable region of the heavy chain are connected by a flexible polypeptide with an amino acid sequence as shown in SEQ ID NO.6.

More preferably, the single-chain antibody and the CD59 molecule are linked by the flexible polypeptide shown in SEQ ID NO.8.

It is also preferred that the single-chain antibody is located at the amino terminus of the fusion protein.

Particularly preferably, the amino acid sequence of the fusion protein is as described in SEQ ID NO.10.

Secondly, the present invention also provides a polynucleotide encoding the above-mentioned fusion protein, and the sequence of the polynucleotide is as described in SEQ ID NO.9.

Third, the present invention also provides an expression vector for expressing the above-mentioned fusion protein. The expression vector is an expression vector pEE14.1-ScFv-CD59 carrying the above-mentioned polynucleotide.

Finally, the present invention provides the application of the above-mentioned fusion protein in the preparation of drugs for the treatment of autoimmune diseases.

In a preferred embodiment, the disease includes rheumatoid arthritis and systemic lupus erythematosus.

Technical effect

The fusion protein of the anti-C3d targeting single-chain antibody and CD59 provided by the present invention has excellent antigen binding activity, and has a very high inhibitory efficiency for complement-mediated inhibition of CHO cell and red blood cell lysis. Biological distribution experiments have proved that the fusion protein provided by the present invention can quickly accumulate in the arthritis part after entering the rheumatoid arthritis mouse model, and has excellent anti-adhesion/anti-inflammatory targeting inhibition effect. In the treatment of MRL/lpr lupus erythematosus mice, the fusion protein provided by the present invention can significantly improve the survival rate of mice, and the proteinuria, glomerular integral, interstitial inflammation, vasculitis and crescent of the treatment group Symptoms such as necrosis and necrosis are significantly improved, which shows that the fusion protein provided by the present invention has excellent application prospects in the preparation of autoimmune disease therapeutic drugs.

Description of the drawings

Figure 1. The 12% SDS-PAGE identification map of ScFv-CD59;

Figure 2. Western Blot identification map of ScFv-CD59;

Figure 3. Columnar analysis diagram of the biological distribution of ScFv-CD59 in RA mice;

Figure 4. Clinical score control chart after ScFv-CD59 treatment of RA mice;

Figure 5. ScFv-CD59 treatment of the survival rate of MRL/lpr mice;

Figure 6. ScFv-CD59 treatment of proteinuria changes in MRL/lpr mice.

Embodiments of the present invention

The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, these embodiments are only exemplary, and do not constitute any limitation to the protection scope of the present invention.

Example 1. Preparation of anti-C3d single chain antibody

The following methods are used to screen anti-C3d single-chain antibodies. The specific method includes the following steps:

1.1 Preparation of cDNA

Collect 50 parts of peripheral blood of healthy people with 20ml each, and separate mononuclear cells with lymphocyte separation fluid (Tianjin Institute of Blood Research). Trizol reagent (Invitrogen) was used to extract the total RNA of the cells from the isolated human peripheral blood lymphocytes, and then mixed in the same ratio. CDNA was reverse transcribed using cDNA Reverse Transcription Kit (Takara Company). The above steps are carried out in accordance with the instructions provided by the manufacturer.

1.2 Amplification of antibody light chain and heavy chain variable region genes: using PCR method, using reverse transcription synthesized cDNA as a template, add primers to amplify light chain and heavy chain variable region genes in the PCR reaction system, respectively. According to the human antibody gene sequence in GenBank, the primers required for PCR amplification of the variable regions of the antibody heavy chain and light chain were designed (see Table 1).

Table 1. Amplification primers for antibody light chain and heavy chain variable region genes

Primer name	sequence
VHup1	CAGGTGCAGCTGCAGGAGTCSG
VHup2	CAGGTACAGCTGCAGCAGTCA
VHup3	CAGGTGCAGCTACAGCAGTGGG
VHup4	GAGGTGCAGCTGKTGGAGWCY
VHup5	CAGGTCCAGCTKGTRCAGTCTGG
VHup6	CAGRTCACCTTGAAGGAGTCTG
VHup7	CAGGTGCAGC TGGTGSARTCTGG
VHdown1	TGAGGAGACRGTGACCAGGGTG
VHdown2	TGAAGAGACG GTGACCATTGT
VH down3	TGAGGAGACG GTGACCAGGGTT
VH down4	TGAGGAGACG GTGACCGTGGTCC
VLup1	CAGTCTGTSBTGACGCAGCCGCC
VLup2	TCCTATGWGCTGACWCAGCCAC
VLup3	TCCTATGAGCTGAYRCAGCYACC
VLup4	CAGCCTGTGCTGACTCARYC
VLup5	CAGDCTGTGGTGACYCAGGAGCC
VLup6	CAGCCWGKGCTGACTCAGCCMCC
VLup7	TCCTCTGAGCTGASTCAGGASCC
VLup8	CAGTCTGYYCTGAYTCAGCCT
VLup9	AATTTTATGCTGACTCAGCCCC
VL down 1	TAGGACGGTSASCTTGGTCC
VL down 1	GAGGACGGTC AGCTGGGTGC
VKup1	GACATCCRGDTGACCCAGTCTCC

VKup2	GAAATTGTRWTGACRCAGTCTCC
VKup3	GATATTGTGMTGACBCAGWCTCC
VKup4	GAAACGACACTCACGCAGTCTC
VKdown1	TTTGATTTCCACCTTGGTCC
VKdown2	TTTGATCTCCASCTTGGTCC
VKdown3	TTTGATATCCACTTTGGTCC
VKdown4	TTTAA TCTCCAGTCGTGTCC

In Table 1, the degenerate base B=C or G, D=G or A, K=G or T, M=A or C, R=A or G, S=G or C, W=A or T, Y=C or T.

The amplification system consists of 2μl each of the upstream primer and downstream primer, 5μl of 10×PCR buffer, and a final concentration of dNTP of 2.5mM. After mixing, denature at 100°C for 5min, and add 2 units of Taq DNA polymerase. The total reaction volume is 50 μl. After mixing, add mineral oil. Carry out 30 cycles of reaction, each cycle condition is: 94 ℃ denaturation 30s. Anneal at 55°C for 90s, and extend at 72°C for 90s. After the reaction proceeds to the last cycle, it is kept at 72°C for 10 minutes. After the reaction, 3μl of the light chain and heavy chain variable region gene amplification products were taken out and subjected to 1.2% agarose electrophoresis detection. The 327bp light chain variable region gene and the 357bp heavy chain variable region gene were obtained by PCR amplification. The variable region genes were consistent with the expected results, and the rest were ^{recovered and purified with Sephagels TM} Bandprep Kit (Pharmacia).

1.3 Connection of single-chain antibody genes: The recovered heavy chain and light chain variable region genes are connected by a Linker sequence to form the ScFv gene. The nucleotide sequence and amino acid sequence of the Linker sequence are shown in SEQ ID NO. 5 and 6, respectively. Add SfiI and NotI restriction sites and several protective bases to the 5'ends of the amplification primers of the antibody light chain and heavy chain variable region genes, respectively, and add Linker sequences to the 3'ends (see Table 2 for primer sequences) ).

Table 2. Amplification primers used for gene connection of antibody light chain and heavy chain variable region

The PCR amplification system consists of 2μl of upstream primer and 2μl of downstream primer, 2.5mM dNTP and 3 units of Taq DNA polymerase, 5μl of 10×PCR buffer, and a reaction volume of 50μl. Carry out 30 PCR cycles, each cycle conditions are 94 ℃ denaturation 1 min, 55 ℃ annealing 2 min, 72 ℃ extension 2 min, the reaction proceeds to the last cycle and then kept at 72 ℃ 10 min. After the reaction, 3μL 1.2% agarose electrophoresis test was taken from the PCR amplified product. The 750bp single-chain antibody gene was obtained by PCR amplification, which was consistent with the expected result. The rest was recovered and purified with SephagelsTM Bandprep Kit.

1.4 Construction and expression of single-chain antibody library: The expression vector pCANTAB5E (Pharmacia) and the recovered single-chain antibody gene were digested with Sfi 1 and Not 1 respectively, and under the action of T4 ligase, the pCANTAB5E expression vector and single-chain antibody gene The chain antibody gene was ligated overnight at 16°C. The recombinant plasmid was transformed into competent cells of Escherichia coli TG1, and the transformed cells were spread on an LB culture plate containing 100 μg/mL ampicillin and cultured overnight at 37°C. Collect all the transformed bacteria growing on the plate, dilute the cell suspension with 2×YTAG (containing 100μg/mL ampicillin and 2% glucose) to OD ₆₀₀ =0.2, culture at 37°C to the logarithmic growth phase (approximately OD). ₆₀₀ = 0.4), add 2×10 ⁹ pfu M13K07 helper phage, incubate at 37°C for 1 hour, and centrifuge. Resuspend the pelleted cells with 10mL 2×YTAK (2×YT containing 100μg/mL ampicillin and 50μg/mL kanamycin), culture with shaking at 37°C overnight, and collect the supernatant containing the recombinant phage after centrifugation, which is the single-chain antibody Phage expression library.

1.5 Screening of recombinant phage antibodies: A polyethylene petri dish was coated with C3d antigen (Shanghai Shrek Biotechnology Co., Ltd.), and the supernatant containing the recombinant phage was incubated in the petri dish at 37°C for 2 hours. Wash the plate 20 times with PBS, then wash the plate 20 times with PBST (PBS containing 0.05% Tween 20), and discard PBST. Add 10 mL of TG1 cells in the logarithmic growth phase and incubate at 37°C for 1 hour. Centrifuge and collect the supernatant for the next round of screening. Repeat the "adsorption-elution-propagation" screening process twice. After superinfection with M13K07 helper phage, a phage surface display library of enriched clones can be generated.

1.6 Screening and identification of monoclonal recombinant phage: After the third round of screening, use 2×YT to make multiple dilutions of TG1 bacterial solution (stock solution, 1:10, 1:100, 1:1000), and then spread on SOBAG solid culture Incubate at 30°C overnight on the base (molecular cloning, third edition, translated by Huang Peitang, etc.). 100 single colonies were randomly picked from the plate and inoculated into 100 μl 2×YTAG (containing 100 μg/mL ampicillin and 2% glucose) culture medium, and cultured at 30° C. overnight. Take 20μl of culture medium, transfer it to 200μl ^{of 2×YTAG culture medium containing 5×10 8} pfu/mL M13K07, and incubate at 37°C for 2 hours. After centrifugation, the pelleted cells were resuspended in 200 μl 2×YTAK (2×YT containing 100 μg/mL ampicillin and 50 μg/mL kanamycin), and cultured overnight at 30°C. Centrifuge and collect the supernatant to obtain monoclonal recombinant phage.

The enzyme-linked plate was coated with C3d antigen, 0.5% BSA was used as a negative control, and goat anti-M13 phage antibody was used as a positive control. Block with 1% BSA at 37°C for 1 hour. Add 100 μl of an equal volume mixture of recombinant phage antibody supernatant and blocking solution to the enzyme-linked plate, and add M13 phage to the control wells. Incubate at 37°C for 1 hour, wash the plate 3 times with PBST (PBS containing 0.05% Tween 20), and wash the plate 3 times with PBS. Add 100 μl goat anti-M13 phage antibody IgG-HRP (1:2000) to each well, and incubate at 37°C for 1 hour. PBST and PBS wash the plate 3 times each time, add freshly prepared substrate H ₂ O ₂ -OPD, react at room temperature for 20 min, add 50 μl 2M H ₂ SO _{4 to} stop the reaction, and detect the light absorption value of each well _{at A 490.} The positive clones whose light absorption value was 2.1 times higher than that of the negative control were selected, and the positive clones with the strongest C3d binding activity were selected.

1.7 DNA sequence analysis of the positive cloned recombinant plasmid: The DNA sequence of the anti-C3d single-chain antibody on the positive recombinant plasmid was determined with the T7 DNA sequence TAATACGACTCACTATAGGG, and the result was that the sequence consisted of 750 bases. From the 5'end, the light chain variable region coding gene has the DNA sequence of SEQ ID NO: 1 in the sequence list, the flexible polypeptide coding gene as a linker has the DNA sequence of SEQ ID NO: 5 in the sequence list, and the heavy chain can be The gene encoding the variable region has the DNA sequence of SEQ ID NO: 3 in the sequence list, and the DNA sequence of the anti-C3d single-chain antibody encodes the amino acid residues of SEQ ID NO: 2-SEQ ID NO: 6-SEQ ID NO: 4 in the sequence list. The base sequence of the protein, the antibody is named _VL- Linker- _VH (also known as ScFv).

1.8 Construction of eukaryotic expression vector of anti-C3d single-chain antibody ScFv and screening of high-efficiency expression cell lines

In order to get closer to the natural protein molecules in higher organisms molecular structure, physicochemical properties and biological functions, step 1.7 to obtain the single-chain antibody against C3d V _L -Linker-V _H fusion gene was cloned into eukaryotic expression vector pEE14 .1 (Lonza) to give an anti-C3d carrying single chain antibody V _L -Linker-V _H gene fusion recombinant expression vector designated _{pEE14.1 / V L -Linker-V H} . Liposome was used to transfect the recombinant plasmid pEE14.1/V _H -Linker-V _L into Chinese hamster ovary cells CHO. After 24 hours of transfection, the medium was aspirated, and 10 mL of fresh selective medium DMEM+10% FCS+25μm MSX was added. Incubate in a 37°C incubator with 5% CO _{2 mixed gas and 98% humidity.} Two weeks later, clones of approximately 1-2 mm appeared, and the clones were transferred to a 24-well plate with a cloning ring, and 1 mL of selective medium DMEM+10% FCS+25μm MSX was added to each well to continue the culture. After the transformant has grown to 5 days, the supernatant is aspirated. 100 μl of the supernatant was added to the enzyme-linked plate coated with C3d antigen, incubated at 37° C. for 1 hour, and washed with PBS 3 times. Add 100μl of HRP-labeled secondary antibody IgG (1:2000) to each well, and incubate at 37°C for 1 hour. Wash the plate 3 times with PBS, add freshly prepared substrate H ₂ O ₂ -OPD, react at room temperature for 20 min, add 50 μl 2M H ₂ SO _{4 to} stop the reaction, and detect the light absorption value of each well _{at A 490.} The light absorption value is 2.1 times higher than that of the negative control as the positive clone, and the positive clone with the strongest C3d binding activity is selected from the positive clone, which is the CHO cell line expressing the anti-C3d single-chain antibody with high efficiency.

1.9 Purification of anti-C3d single chain antibody

The highly expressed CHO cell line was enlarged and cultured and the supernatant was harvested. The supernatant was slowly added to HiTrap N-hydroxysuccinimide column (Amersham Biosciences) to purify the single-chain antibody. Elute with 0.01mol/L pH 7.4 PBS at a flow rate of 1 mL/min until the eluate OD ₂₈₀ <0.02. Add 0.1 mol/L pH 2.4 glycine-HCl buffer at a flow rate of 1 mL/min, collect the adsorbed components, and immediately neutralize with 1 mol/L sodium carbonate to avoid protein denaturation. After SDS-PAGE and Western Blot identification, the target protein of about 26KD was obtained after expression, and the protein could specifically bind to C3d, which was consistent with the expected results, indicating that a highly pure anti-C3d single-chain antibody was obtained.

Example 2 Preparation of anti-C3d single chain antibody-CD59 (ScFv-CD59) fusion protein

1 Materials The expression vector is pEE14.1 (Lonza biologics); CHO cells are used for protein expression, and the culture medium is DMEM containing 10% fetal bovine serum, purchased from Invitrogen. Mouse anti-CD59 mAb 1H4 and 1A10, mouse anti-human CR2 mAb 171, anti-goat red blood cell IgM and all secondary antibodies were purchased from Sigma.

2 method

2.1 Rabbit anti-CHO cell membrane and human CD59 antiserum were prepared according to the literature Harlow, E., and Lane, D. Antibodies: a laboratory manual. Cold Spring Harbor Laboratory. Cold Spring Harbor, New York, USA.1988:726. Method to obtain.

2.2 Construction of expression recombinants and protein expression The cDNA structural gene is formed by linking the sequence encoding the anti-C3d single-chain antibody with the sequence encoding the extracellular region of CD59. The complement inhibitor sequence is 231 bases encoding the mature CD59 protein sequence (Swissprot accession number is AAA88793).

Then connect the anti-C3d single-chain antibody to the complement inhibitor CD59. When the anti-C3d single-chain antibody is at the N-terminus (ScFv-CD59), the connection sequence is GGGSGGGGS (SEQ ID NO: 8). The gene frame is synthesized by PCR technology (the amino acid sequence of the fusion protein is shown in SEQ ID NO. 10, and the nucleotide sequence is shown in SEQ ID NO. 9). All cloning steps were performed on the pEE14.1 vector (see CN104940953A). The pEE14.1 high-efficiency expression vector contains a special glutamine (GS) gene expression system. GS enzyme is responsible for the synthesis of glutamine using glutamyl and amine as substrates. Some mammalian cell lines do not contain the GS gene, so they cannot survive without glutamine. For these cell lines, the transfected GS gene can be used as a selection marker to select cells grown in glutamine-free medium. Methionine sulphoximine (MSX) can inhibit the activity of GS enzyme, and some cell lines (CHO-K1) can produce endogenous glutamine, which can be used in glutamine-free medium containing MSX For growth, this medium with sufficient amount of MSX that can inhibit GS enzyme activity provides screening pressure to screen out the required cell lines. The ScFv-CD59 fusion gene was synthesized by PCR and ligated with pEE14.1 vector after EcoRI and SmalI double enzyme digestion. The recombinant vector pEE14.1-ScFv-CD59 was transfected with FuGENE 6 into CHO-K1 cells, 24 hours after transfection Change the selective DMEM medium (without glutamine), and add MSX to a final concentration of 50μM, and positive clones will grow in about 2 weeks, but normal CHO cells without transfected plasmids gradually fall off the bottle wall, and the cells are lysed and died . Three cell lines were selected and cultured in serum-containing medium and serum-free medium for 3 days respectively. The cell supernatant was collected, and part of it was concentrated 5 times with PEG20000 for use, and the rest were stored at -80°C. The expression of ScFv-CD59 was detected by ELISA method. The recombinant protein is expressed in CHO cells in a secreted form. The expression level of the stable expression strain of CHO cells cultured in serum-free medium was higher than that of cells cultured in serum-containing medium.

2.3 Purification of recombinant protein Use affinity chromatography to purify the protein in the cell culture supernatant. According to the operation manual, the chromatography column is formed by coupling the anti-CD59 mAb (1H4) with the affinity column activated by HiTrap NHS. The pH value of the culture supernatant containing the recombinant protein was adjusted to 8.0, and the column was passed through the column at a rate of 0.5 mL/min. Then the column was washed with 6 to 8 times the volume of PBS, and the recombinant protein was eluted with 2 to 3 times the column volume of 0.1 mol/L glycine (pH 2.4). The fusion protein was collected in 1 mol/L Tris buffer (pH 8.0) and dialyzed in PBS.

2.4 SDS-PAGE and Western blot identification

The purified protein was carried out in SDS-PAGE gel containing 100g/L. The gel was stained with Coomassie Brilliant Blue.

In Western blot experiments, mouse anti-CD59 mAb 1H4 was used to detect recombinant proteins.

step:

①5% concentrated glue, 10% separating glue;

②SDS-PAGE with 1μl of 1mg/ml antigen, 70V concentrated gel, 130V separation gel;

③Transfer to PVDF film, the transfer time is 24min;

④ 5% skimmed milk powder, 0.1% Tween20 TBS blocked for 2h;

⑤10ml of C3d-ScFV-CD59 with a concentration of 10μg/ml and 20μg/ml of C3d-ScFV-CD59 antibody are used as the primary antibody and added to the 1 and 2 antigen tanks respectively, and the 3 and 4 antigen tanks are added without primary antibody TBST skimmed milk powder, incubate at room temperature for 2h;

⑥ TBST wash 5 times, 5min/time;

⑦ Anti-CD59 (rabbit monoclonal antibody) antibody, diluted according to the ratio of 1:5000, added to No. 1 and 3 antigen tanks respectively, anti-CD59 (mouse monoclonal antibody) antibody, diluted according to the ratio of 1:5000, added decibels to 2 and Incubate in No. 4 antigen tank for 1 hour at room temperature;

⑧TBST wash 5 times, 5min/time;

⑨Goat anti-rabbit antibody and goat anti-mouse antibody, diluted 1:5000, added to No. 1 and No. 3 antigen tanks and No. 2 and No. 4 antigen tanks, and incubated for 1 hour at room temperature;

⑩TBST wash 5 times, 5min/time;

Color rendering.

3. Results

The recombinant protein ScFv-CD59 was isolated from the culture supernatant of stably transfected CHO cells, 100～200μg/L. The results of SDS-PAGE (Figure 1) and Western blot (Figure 2) showed that the target fragment (ScFv- The relative molecular weight of the CD59 fusion protein is approximately 36KDa).

Example 3. Dynamic analysis of the interaction between ScFv-CD59 and C3 ligand

The kinetic analysis of the interaction between ScFv-CD59 and biotin-labeled C3dg (C3dg-biotin) was detected with a surface cytoplasmic genome resonance (SPR) detection system (BIAcore 3000 instrument). According to the average amount of 50mg/L per flow cell, human C3dg-biotin (Guthridge, JM, et al. Structural studies in solution of the recombinant N-terminal pair of short consensus/complement repeat domains of complement receptor type 2( CR2/CD21) and interactions with its ligand C3dg.Biochemistry.2001,40 (20):5931-5941.) was injected into the BIAcore streptavidin sensor chip at a rate of 2μL/min, acting for 20min, buffer It is 0.5×PBS (pH7.4) (containing 0.5g/L Tween20). The SPR signal obtained from the captured C3dg generates BIAcore response units (ranging from 250 to 500). The group without fusion protein was used as a control. After washing with 0.5×PBST (0.5g/L Tween20) at 25°C at a flow rate of 25μL/min, the affinity was evaluated by detecting the concentration of ScFv-CD59 (15.6～500nmol/L).

The kinetic analysis data shows that 1:1 is the most suitable sphere detection parameter for the bonding reaction model. SPR test results show that ScFv-CD59 has a higher binding and dissociation rate than ScFv (Table 3). Moreover, the affinity of ScFv-CD59 is higher than that of ScFv.

Table 3. Kinetic parameters of the binding of recombinant fusion protein to C3dg-biotin

In this study, the kinetic parameters of the single-chain antibody of the anti-C3d antibody disclosed in the Chinese invention patent application CN109575132A were also measured. The results showed that the Ka(1/Ms) of the antibody was 4.58×10 ² , Kd(1/s ) Is 0.023, and K _D (nm) is 764±68. Compared with the antibody, the ScFv provided by the present invention greatly improves the kinetic parameters of C3dg-biotin binding.

Example 4. Complement solubilization experiment

To determine the inhibitory activity of complement, 60% to 80% confluent CHO cells are separated with EDTA, washed twice with DMEM and resuspended in DMEM at a final concentration of 10 ⁶ cells / mL. Add 100mL/L rabbit anti-CHO cell membrane antiserum to the cell suspension and react for 30min at 4°C to sensitize the cells. Then the antiserum was discarded, and the cells were resuspended in NHS diluted with DMEM to a final volume of 50 μL or 100 μL. Incubate at 37°C for 60 minutes, and finally measure the viability of cells with placental blue staining exclusion method (both live and dead cells are counted). The recombinant fusion protein was diluted with DEME and added to the NHS first, and then added to the CHO cell suspension. The final concentration of 100g/L NHS can cause about 90% of the antibody sensitized control CHO cells to be lysed as the standard. The complement-mediated inhibition of red blood cell lysis was tested with antibody-sensitized goat red blood cells (EAs). The hemolysis test was performed in Gelatin Verona buffer (GVB ⁺⁺ ), the final volume was 300 ^{μL, containing 2.5×10 7} EAs, and NHS was diluted 1:300. The reaction mixture was incubated at 37°C for 60 min, and finally 300 μL of 10 mmol/L EDTA-PBS solution was added to terminate the reaction. Centrifuge, take the supernatant, and quantitatively detect the hemoglobin in the supernatant with a spectral imager at a wavelength of 413nm.

Detection of complement inhibitor activity of fusion protein: Complement-mediated lysis of CHO cells and erythrocytes showed that in the CHO cell lysis inhibition experiment, ScFv-CD59 had a more significant inhibitory effect than ScFv, and the inhibitory efficiency was increased by more than 6 times. In the experiment, the protective effect of ScFv-CD59 on red blood cells was more than 3 times higher than that of ScFv (see Table 4 for details).

Table 4. Concentrations of complement inhibitors that can inhibit 50% of cell lysis

Example 5. ScFv-CD59 fusion protein RA in vivo experiment:

1. Biological distribution experiment

Use Iodogen method to label ScFv-CD59 with ¹²⁵ I, and add 150μl of 50mmLo/L PBS (pH7.4), 100μl (100μg) of ScFv dissolved in 1mg BSA, Na ¹²⁵ I solution 15μl (185MBq), shake the labeled tube intermittently for 15min at room temperature. The SEP-PAK C18 column was washed with methanol, double-distilled water and 0.1% trifluoroacetic acid (TFA) each 5mL to activate it; the labeled mixture was applied to the column and washed with 0.1% TFA; 60% acetonitrile solution was eluted before collection. 1.5mL eluent. After freeze-drying, it is diluted with PBS solution containing 1mg/mL BSA, aliquoted, and stored in a refrigerator at -80°C for later use. Male DBA/1J mice were injected subcutaneously with 0.1 mL of collagen II and complete Freund’s adjuvant (both purchased from Sigma in the United States) at the base of the tail. On the 21st day, a mouse model of rheumatoid arthritis (CIA) was established (for model establishment, refer to C57BL). /6 The establishment of mouse CIA model and the preliminary screening of its monitoring system, Chinese Medical Journal of Chinese People's Liberation Army, June 2004, Vol. 29, No. 6, 472-474). The test and grouping methods are as follows: ① The control group was injected with ¹²⁵ I-CD59 (2ug) in the tail vein, and was killed by decapitation after 24h and 48h respectively. Blood was collected, tissues and organs were taken out, weighed and measured for radioactivity (μCi), and the results were converted into ID%/g organization. ②In the arthritis group, ¹²⁵ I-CD59 fusion protein (2ug) was injected into the tail vein. After 24h, 48h, 72h, and 96h, the same treatment and detection were taken. ③In the ScFv-CD59 arthritis treatment group, ¹²⁵ I-ScFv-CD59 fusion protein (0.25ug) was injected into the tail vein once, and the same treatment and detection were taken 24 hours later. The results are shown in Figure 3, indicating that the ScFv-CD59 fusion protein of the present invention can be highly aggregated in arthritic sites (the top-down sequence diagram illustrated in the diagram in Figure 3 and the left-hand column in each grouping bar diagram in Figure 3 The sub-bar graphs in the right order correspond one-to-one).

2. Treatment of Rheumatoid Arthritis (CIA) Mouse Model

Using the rheumatoid arthritis (CIA) mouse model (same as above), the experiment was started from the 21st day, and the groups were as follows: ①Inject 50μl PBS control group (N=22). ②ScFv-CD59 micro-dose treatment group (N=20), scFv-CD59 fusion protein (0.25) mg was injected once a day. ③ScFv-CD59 low-dose treatment group (N=20), scFv-CD59 fusion protein (0.25) mg was injected twice a day. ④ScFv-CD59 middle-dose treatment group (N=22), scFv-CD59 fusion protein (0.25) mg was injected three times a day. ⑤ScFv-CD59 high-dose treatment group (N=18), scFv-CD59 fusion protein (0.25) mg was injected four times a day. Clinical scoring was started on the 23rd day, and the animal’s arthritis degree was scored according to the following criteria: 0 points, no arthritis; 1 point, slight inflammation and paw redness; 2 points, severe erythema and swelling, which affect paw function; 3 Points, the claws or joints are deformed, stiff, and lose function. The maximum total score of each mouse's limbs is 12 points. The results are shown in Figure 4, starting from the 23rd day, the severity of arthritis in the four treatment groups of ScFv-CD59 fusion protein was significantly lower than that of the PBS group. Among them, the score of group ⑤ (4 injections group) is less than 2/3 of group ④ (3 injections), and it is less than 2/5 of group ③ (2 injections group), which is group ② (1 One-third of the injection group) is less than 1/3, which is less than 2/7 of the ① group (PBS control group).

The above experimental results prove that the ScFv-CD59 fusion protein of the present invention has specific targeting to C3d, has a better anti-adhesion/anti-inflammatory targeting inhibitory effect, has a good therapeutic effect on the body's inflammatory response, and has a significant The dose-dependent relationship.

Example 6. Therapeutic effect of ScFv-CD59 fusion protein in MRL/lpr lupus erythematosus mice

1. Improved survival rate

MRL/lpr mice from 16 weeks to 24 weeks ScFv-CD59 high-dose treatment group (n=20), ScFv-CD59 low-dose treatment group (n=20) and PBS control group (n=24) mice survival rate comparison

The MRL/lpr lupus erythematosus mouse model was first established by Murphy and Roths in 1979. It was formed by a complex hybridization process of multiple strains of mice for 12 generations. 75% of the mouse genes of this model are derived from LG/J, 12.6 % Is from AKR/J, 12.1% is from C3H/Di and 0.3% is from C57BL/6 strain mice. MRL/lpr mice contain recessive mutations in the Fas gene related to spontaneous programmed cell death, and the presence of lymphocyte proliferation genes, leading to T cell proliferation, systemic lymph node enlargement, and erosive arthritis, anti-DNA, anti-Sm, anti- Su, anti-nucleoside P antibody, high titer ANA, hypergammaglobulinemia and rheumatoid factor. The mouse first became ill at 8 weeks, at which time autoantibodies could be detected in the serum. Lymphadenitis can be observed at 12 weeks. At 12-16 weeks, MRL/lpr mice began to produce a large number of autoantibodies including anti-double-stranded DNA antibodies. Nearly 16 weeks of age, multiple organ involvement and stable renal function degradation characterized by severe proteinuria appeared. 16-24 weeks old mice develop glomerulonephritis and vasculitis mediated by proliferative immune complexes, and eventually lead to renal failure and death, and the mortality rate can reach 50%.

In this example, 16-week-old MRL/lpr mice that had developed renal failure symptoms were randomly divided into three groups. The first group (n=20) was the high-dose treatment group, and received 0.3 mg/lpr per week from the 16th to 24th weeks. ScFv-CD59 of W, the second group (n=20) is the low-dose treatment group, receiving 0.15mg/W ScFv-CD59 every week from 16-24 weeks, the third group (n=24) is the control group , Receive the same amount of PBS every week from the 16th to the 24th week. The route of administration for the three groups was tail vein injection. The protection rate of ScFv-DA on MRL/lpr lupus erythematosus mice was evaluated according to the survival rate of the administration group and the control group.

The experimental results are shown in Figure 5. In mice treated with ScFv-CD59, because C3d in the complement activation pathway is effectively inhibited by ScFv-CD59 targeting C3d, the survival rate of MRL/lpr lupus erythematosus mice is significantly improved. The ScFv-CD59 high-dose treatment group can completely protect MRL/lpr lupus erythematosus mice during the whole treatment process, and the survival rate is 100%. The ScFv-CD59 low-dose treatment group can maintain a survival rate of more than 80% even in the 24th week. Compared with the control group, the survival rate of mice in the treatment group increased significantly from 18 weeks.

2. Improved kidney function

The mice were placed in a metabolic cage to study the effect of ScFv-CD59 on the secretion of urine albumin in MRL/lpr lupus erythematosus mice. From the 16th week, the mice’s 24-hour urine was collected every two weeks. To prevent bacterial growth, add ampicillin, gentamicin, and chloramphenicol to the collection tube. Use mouse albumin samples of known concentrations to draw a standard curve by ELISA method, and determine the urine albumin secretion of experimental mice, and use a biochemical analyzer to determine the creatinine content in mouse urine. The final evaluation result is expressed as the ratio of urine albumin (mg) to creatinine (mg) of each experimental mouse for 24 hours. A high ratio of urine albumin to creatinine indicates that kidney function is impaired. As shown in Figure 6, the proteinuria of the MRL/lpr mouse ScFv-CD59 treatment group (n=20) and the PBS control group (n=18) were compared. At 18-24 weeks, compared with the control group, the treatment group The level of proteinuria was significantly reduced (P<0.01). It is proved that the ScFv-CD59 provided by the present invention can significantly improve the symptoms of renal damage.

3. Reduced inflammation of the kidneys

After the experiment, the mouse kidney was excised and longitudinally dissected into two halves, half of which was subjected to immunofluorescence analysis, and the other half was fixed with 10% neutral formaldehyde, and the sections were embedded in solid paraffin and stained with hematoxylin-eosin and periodic acid Schiff The staining method was used to stain paraffin-treated kidney tissue sections. The glomerular inflammation, hyperplasia, crescent formation, and necrosis symptoms observed from the self-section were scored by blind method, and the changes in the renal interstitial were also scored. The score is divided into five levels: 0, 1, 2, 3, and 4, with 0 being no damage and 4 being severe damage. The evaluation of perivascular inflammatory exudation adopts a semi-quantitative method. Two independent observers blindly evaluate more than 10 blood vessels in each slice. The score for inflammation is 0-3, 0 means no inflammation, 1 means less than 50% of the blood vessels are surrounded by 3 layers of cells, 2 means more than 50% of the blood vessels are surrounded by 3-6 layers, 3 is the most serious manifestation, more than 6 Surrounded by layers of cells. The evaluation results are shown in Table 5.

Table 5. Comparison of renal damage in the ScFv-CD59 treatment group and the PBS control group in MRL/lpr mice from 16 weeks to 23 weeks after treatment

Grouping	Glomerular score	Interstitial inflammation	Vasculitis	Crescent/Necrosis
Control group (n=22)	14.0±3.5	3.5±0.4	100%	65%
Treatment group (n=20)	5.0±2.5	2.2±0.3	55%	10%

Compared with the control group, the ScFv-CD59 treatment group had significantly lower glomerular scores, interstitial inflammation, vasculitis and crescent/necrosis than the control group (P<0.05).

Industrial applicability

The present invention provides a human-derived anti-complement C3d molecule single-chain antibody and a fusion protein of the single-chain antibody and complement inhibitor CD59, and its application in the preparation of autoimmune disease therapeutic drugs. The single-chain antibody provided by the present invention Antibodies and fusion proteins are easy to industrially produce and have industrial applicability.

Claims (10)

1. A fusion protein of a human-derived anti-complement C3d molecule single-chain antibody and complement inhibitor CD59, characterized in that the amino acid sequences of CDR1, CDR2, and CDR3 of the variable region of the light chain of the antibody are as shown in SEQ ID NO.2. The amino acid sequences of positions 25-35, 51-57, and 89-98 are shown in the amino acid sequences of CDR1, CDR2, and CDR3 of the variable region of the antibody heavy chain, respectively, as shown in SEQ ID NO. 4, 30-35, 50- The amino acid sequences at positions 66 and 99-107 are shown.
2. The fusion protein of claim 1, wherein the amino acid sequence of the variable region of the antibody light chain is shown in SEQ ID NO. 2, and the amino acid sequence of the variable region of the antibody heavy chain is shown in SEQ ID NO. 4 shown.
3. The fusion protein according to claim 2, wherein the variable region of the light chain and the variable region of the heavy chain of the antibody are connected by a flexible polypeptide with an amino acid sequence as shown in SEQ ID NO.6.
4. The fusion protein of claim 3, wherein the single-chain antibody and the CD59 molecule are linked by a flexible polypeptide shown in SEQ ID NO.8.
5. The fusion protein of claim 4, wherein the single-chain antibody is located at the amino terminus of the fusion protein.
6. The fusion protein according to claim 5, wherein the amino acid sequence of the fusion protein is as described in SEQ ID NO.10.
7. A polynucleotide encoding the fusion protein of claim 6, wherein the sequence of the polynucleotide is as described in SEQ ID NO.9.
8. An expression vector for expressing the fusion protein of claim 6, wherein the expression vector is an expression vector pEE14.1-ScFv-CD59 carrying the polynucleotide of claim 7.
9. Use of the fusion protein according to any one of claims 1 to 6 in the preparation of drugs for the treatment of autoimmune diseases.
10. The use according to claim 9, wherein the diseases include rheumatoid arthritis and systemic lupus erythematosus.

Images