CN110922480B

CN110922480B - anti-C3 d targeting single-chain antibody and DAF fusion protein and application thereof

Info

Publication number: CN110922480B
Application number: CN201911209446.4A
Authority: CN
Inventors: 唐晓敏; 杜兰英
Original assignee: Beijing Kangpu Meite Innovation Pharmaceutical Technology Co ltd
Current assignee: Beijing Kangpu Meite Innovation Pharmaceutical Technology Co ltd
Priority date: 2019-12-01
Filing date: 2019-12-01
Publication date: 2021-06-11
Anticipated expiration: 2039-12-01
Also published as: WO2021109953A1; CN110922480A

Abstract

The invention discloses a single-chain antibody of a human anti-complement C3d molecule and a fusion protein of the single-chain antibody and a complement inhibitor DAF, wherein the antibody has excellent antigen binding activity, and biological distribution experiments prove that the fusion protein provided by the invention can be rapidly highly aggregated at an arthritis part after entering a rheumatoid arthritis mouse model, and has excellent anti-adhesion/anti-inflammatory targeted inhibition effect. In the treatment of MRL/lpr lupus erythematosus mice, the fusion protein provided by the invention can obviously improve the survival rate of the mice, and the symptoms of proteinuria, glomerular score, interstitial inflammation, vasculitis, crescent/necrosis and the like in a treatment group are obviously improved, thereby showing that the fusion protein provided by the invention has excellent application prospect in the preparation of autoimmune disease treatment medicines.

Description

anti-C3 d targeting single-chain antibody and DAF fusion protein and application thereof

Technical Field

The invention relates to an antibody and a fusion protein, belonging to the technical field of polypeptides.

Background

The complement system is composed of more than 30 soluble protein molecules, is a part of the natural immune system, and comprises more than 30 molecules such as complement inherent components, various regulatory factors, complement receptors and the like. The complement system can be activated through 3 relatively independent and interconnected pathways, thereby exerting various biological effects such as opsonophagocytosis, cell lysis, mediated inflammation, immunoregulation and immune complex removal, including phagocytosis enhancement and phagocyte chemotaxis enhancement; increase the permeability of blood vessels; neutralizing the virus; cell lysis; regulation of immune response, etc. Complement activation and its deposition on target structures can also indirectly cause cell or tissue destruction. Complement activation products that mediate tissue damage are produced at various points in the complement pathway. Inappropriate complement activation on host tissues plays an important role in the pathology of many autoimmune and inflammatory diseases. Therefore, based on the new attempt of reducing or inhibiting complement activation to treat some autoimmune diseases caused by complement activation, studies have shown that reducing or inhibiting complement activation is effective for treating some disease indications, such as rheumatoid arthritis, systemic lupus erythematosus, glomerulonephritis, in animal models and in vitro studies.

There are 3 pathways for complement activation, namely the classical pathway, the alternative pathway and the mannan-binding agglutination pathway. Components involved in the classical complement activation pathway include C1-C9. According to their role in the activation process, they are artificially divided into three groups, namely recognition units (Clq, Clr, Cls), activation units (C4, C2, C3) and membrane attack units (C5-C9), which play roles in different stages of activation, namely, recognition stage, activation stage and membrane attack stage, respectively. The alternative activation pathway differs from the classical activation pathway in that activation crosses three components, C1, C4 and C2, directly activates C3 and then completes the chain reaction of the components C5 to C9. Mannan-Binding agglutination pathway Mannan-Binding Lectin (MBL) in plasma directly recognizes N-galactosamine or mannose on the surface of various pathogenic microorganisms, and then sequentially activates MASP-1, MASP-2, C4, C2 and C3 to form C3 and C5 convertases which are the same as those of the classical pathway, and activates the activation pathway of complement cascade enzymatic reaction. The three pathways can produce C3 convertase, C3 molecule is cleaved into anaphylatoxin C3a by C3 convertase, and C3b with opsonization, C3b molecule can be linked with amine and hydroxyl on glycoprotein surface covalently, and the covalent is mediated by thioester group in C3b molecule. Thus, the molecule C3b can be adsorbed on the surface of a microorganism invaded in vivo, then combined with a type I complement receptor (CR1/CD35), hydrolyzed under the action of serum H factor and I factor to form iC3b, and iC3b is subsequently cleaved to form C3 d. The C3d fragment is the smallest fragment of complement C3 that is no longer enzymatically cleaved. CD21, CD19, CD81 and CD225(Leu-13) on the surface of the B cell are connected in a non-covalent bond to form an activated co-receptor of the B cell. The extracellular domain of CD21 binds to the complement component C3d bound to antigen, and the CD19 transmits a stimulation signal to cytoplasm, which can obviously reduce the threshold of antigen activation of B cells. CD21, also known as complement receptor type ii (CR2), is distributed predominantly on the surface of Follicular Dendritic Cells (FDCs), B cells, and some T cells.

In view of the important role played by the C3d molecule and CR2 as its receptor in the complement activation pathway and the processes of humoral and cellular immune activation, researchers have begun to focus on blocking or competitively inhibiting the binding of the C3d molecule to CR2 and thereby down-regulating and inhibiting complement activation to block the pathological processes of autoimmune diseases. The fusion of complement receptor 2 with specific targeting but no complement inhibition with complement inhibitors, thereby exerting specific inhibition of complement activation, is a technical approach for the treatment of autoimmune diseases. Chinese invention patents CN101563363B and CN100594037C report the complement inhibitory activity exhibited by fusion proteins of complement receptor 2 and complement inhibitor factor F, decay accelerating factor or CD59, respectively. Decay accelerating factor (DAF, CD55) is composed of 4 SCRs plus a Ser/Thr rich region, and therefore is capable of extensive O-linked glycosylation. DAF can be anchored to the cell membrane by a glycosyl phosphatidyl alcohol (GPI) and through its SCR binding to C4b/C3b, accelerate the decay of the classical and alternative pathways C3/C5 convertases. The therapeutic thought is based on the specific recognition of exogenous protein molecules as receptors and C3d molecules, so as to prevent the combination and activation of C3d molecules and CR2 in pathological processes, and the method still has certain limitations in practical application, for example, the difficulty of the fusion protein reaching focuses is increased due to the overlarge molecular weight of the fusion protein of targeting molecules and inhibitors, especially some hidden positions are involved, and the defects of reduced affinity and prolonged half-life period are also caused, and even unnecessary immunogenicity is caused.

The single-chain antibody is a small molecular antibody prepared by a genetic engineering method, is a recombinant antibody formed by connecting a heavy chain variable region (VH) and a light chain variable region (VL) of the antibody by an elastic connecting peptide (generally 12-15 amino acids), has the molecular weight which is only one sixth of that of the original natural antibody, but contains all antigen binding sites, so the single-chain antibody furthest retains the antigen binding activity of the antibody and is a small fragment with the antigen binding activity of a parent antibody, and can reach the focus tissues which are difficult to reach by the conventional antibody. Moreover, the single-chain antibody does not contain an Fc segment, so that the single-chain antibody cannot be combined with an Fc receptor on an unrelated cell, and immune complex reaction caused by the Fc segment is avoided. Therefore, it is a new therapeutic approach to inhibit the binding of C3d to CR2 by an anti-C3 d antibody, thereby exerting a specific inhibitory effect on complement activation. The Chinese patent application CN109575132A discloses a single-chain antibody of an anti-C3 d antibody, and shows that the anti-C3 d antibody has certain technical effects of targeting inflammatory lesions and reducing inflammatory reaction caused by complement activation. However, based on the requirement of targeted therapy, there is still a need in the art for a technical solution that fully exerts the targeting function of the anti-C3 d antibody and enhances the inhibitory effect on the complement activation pathway, i.e., the anti-C3 d antibody not only can be used as a blocking agent for blocking the binding between C3d and CR2, but also can target a more potent complement inhibitor to the inflammatory foci to generate a synergistic effect of inhibiting complement activation. However, the single-chain antibody of the anti-C3 d antibody in the prior art is difficult to meet the technical requirement, and the fusion of the anti-C3 d antibody and different inhibitors increases the molecular weight of the protein, so that the spatial structure of the reconstructed protein is changed, and the targeting effect of the anti-C3 d antibody is influenced.

Therefore, the present invention aims to provide a novel anti-C3 d single-chain antibody and a fusion protein of an anti-C3 d single-chain antibody and a complement inhibitor DAF with excellent targeting performance, so that the anti-C3 d single-chain antibody not only serves as a blocking agent to block the combination of C3d and CR2, but also can target the complement inhibitor DAF to an inflammatory lesion to generate an excellent therapeutic effect.

Disclosure of Invention

Based on the above objects, the present invention provides a single-chain antibody of human anti-complement C3d molecule, wherein the amino acid sequences of CDR1, CDR2 and CDR3 in the light chain variable region of the antibody are shown as the amino acid sequences at positions 25-35, 51-57 and 89-98 of SEQ ID NO.2, respectively, and the amino acid sequences of CDR1, CDR2 and CDR3 in the heavy chain variable region of the antibody are shown as the amino acid sequences at positions 30-35, 50-66 and 99-107 of SEQ ID NO.4, respectively.

In a preferred embodiment, the amino acid sequence of the antibody light chain variable region is shown in SEQ ID NO.2, and the amino acid sequence of the antibody heavy chain variable region is shown in SEQ ID NO. 4.

In a more preferred embodiment, the antibody light chain variable region is linked to the heavy chain variable region by a flexible polypeptide having the amino acid sequence shown in SEQ ID No. 6.

The invention also provides a fusion protein containing the single-chain antibody, and the fusion protein also contains a complement activity regulator.

In a preferred embodiment, the complement activity modulator is a DAF molecule.

In a more preferred embodiment, the single chain antibody is linked to a DAF molecule as a flexible polypeptide as shown in SEQ ID No. 8.

More preferably, the amino acid sequence of the fusion protein is as shown in SEQ ID NO. 10.

Thirdly, the invention also provides a polynucleotide for coding the fusion protein, and the sequence of the polynucleotide is shown in SEQ ID NO. 9.

Finally, the invention provides the application of the fusion protein in preparing the medicine for treating the autoimmune disease.

In a preferred embodiment, the disease comprises rheumatoid arthritis and systemic lupus erythematosus.

The fusion protein of the anti-C3 d targeting single-chain antibody and the DAF provided by the invention has excellent antigen binding activity, and has very high inhibition efficiency on complement-mediated CHO cell and erythrocyte lysis inhibition. Biological distribution experiments prove that the fusion protein provided by the invention can be rapidly highly aggregated at the arthritis part after entering a mouse model with rheumatoid arthritis, and has excellent anti-adhesion/anti-inflammatory targeted inhibition effect. In the treatment of MRL/lpr lupus erythematosus mice, the fusion protein provided by the invention can obviously improve the survival rate of the mice, and the symptoms of proteinuria, glomerular score, interstitial inflammation, vasculitis, crescent/necrosis and the like in a treatment group are obviously improved, thereby showing that the fusion protein provided by the invention has excellent application prospect in the preparation of autoimmune disease treatment medicines.

Drawings

FIG. 1 is a 12% SDS-PAGE identification of ScFv-DAF;

FIG. 2 is a Western Blot identification of ScFv-DAF;

FIG. 3 histogram of the biological distribution of ScFv-DAF in RA mice;

FIG. 4 is a graph of the clinical scores of ScFv-DAF-treated RA mice;

FIG. 5 is a graph showing survival rates for ScFv-DAF treated MRL/lpr mice;

FIG. 6 is a graph showing the change in proteinuria in ScFv-DAF-treated MRL/lpr mice.

Detailed Description

The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. These examples are only illustrative and do not limit the scope of the present invention.

Example 1 preparation of anti-C3 d Single chain antibody

The anti-C3 d single-chain antibody is screened by the following method, which comprises the following steps:

1.1 preparation of cDNA

Peripheral blood of 50 healthy persons was collected in an amount of 20ml each, and mononuclear cells were separated from each other by using a lymphocyte separation medium (Tianjin blood research institute). Total RNA of the cells was extracted from the isolated human peripheral blood lymphocytes using Trizol reagent (Invitrogen corporation), and then mixed in the same ratio. The cDNA was reverse-transcribed using a cDNA reverse transcription kit (Takara Co.). The above steps were carried out according to the instructions provided by the manufacturer.

1.2 amplification of antibody light and heavy chain variable region genes: by PCR method, cDNA synthesized by reverse transcription is used as template, and primers for amplifying light chain and heavy chain variable region genes are added into a PCR reaction system respectively. Primers required for PCR amplification of the variable regions of the heavy chain and the light chain of the antibody are respectively designed according to the gene sequence of the human antibody in GenBank (see Table 1).

TABLE 1 amplification primers for antibody light and heavy chain variable region genes

The degenerate bases in table 1, B ═ C or G, D ═ G or a, K ═ G or T, M ═ a or C, R ═ a or G, S ═ G or C, W ═ a or T, Y ═ C or T.

The amplification system comprises 2 μ l of each of the upstream primer and the downstream primer, 5 μ l of 10 XPCR buffer solution, and 2.5mM of dNTP final concentration, and the amplification system is uniformly mixed, denatured for 5min at 100 ℃, and added with 2 units of Taq DNA polymerase. The total reaction volume was 50. mu.l. Mixing, and adding mineral oil. 30 cycles of reaction were carried out, each cycle having the conditions: denaturation at 94 ℃ for 30 s. Annealing at 55 deg.C for 90s, extending at 72 deg.C for 90s, and holding at 72 deg.C for 10min after the reaction is carried out to the last cycle. After the reaction, 3. mu.l of each of the amplified products was subjected to 1.2% agarose electrophoresis, 327bp of light chain variable region gene and 357bp of heavy chain variable region gene were obtained by PCR amplification, and the remainder were Sephagels^TMBandprep Kit (Pharmacia) was recovered and purified.

1.3 linking of Single chain antibody genes: the recovered heavy chain and light chain variable region genes are connected through a Linker sequence to form ScFv genes. The nucleotide sequence and the amino acid sequence of the Linker sequence are respectively shown as SEQ ID NO.5 and 6. The 5 'ends of amplification primers of the light chain and heavy chain variable region genes of the antibody are respectively added with the restriction enzyme cutting sites of SfiI and NotI and a plurality of protective bases, and the 3' ends are respectively added with Linker sequences (the primer sequences are shown in a table 2).

TABLE 2 amplification primers for antibody light and heavy chain variable region Gene ligation

The PCR amplification system was 2. mu.l each of the upstream and downstream primers, 2.5mM dNTP and 3 units Taq DNA polymerase were added, 5. mu.l of 10 XPCR buffer, and the reaction volume was 50. mu.l. Performing 30 PCR cycles, wherein each cycle is denaturation at 94 deg.C for 1min, annealing at 55 deg.C for 2min, extension at 72 deg.C for 2min, and keeping the temperature at 72 deg.C for 10min after the reaction is performed to the last cycle. After the reaction, 3. mu.L of 1.2% agarose gel electrophoresis detection was taken out from the PCR amplification product, and 750bp of single-chain antibody gene was obtained by PCR amplification, which was consistent with the expected result, and the remainder was recovered and purified by Sephagels band prep Kit.

1.4 construction and expression of Single chain antibody library: the expression vector pCANTAB5E (Pharmacia) and the recovered single-chain antibody gene were digested with Sfi 1 and Not 1, respectively, and the pCANTAB5E expression vector and the single-chain antibody gene were ligated at 16 ℃ overnight under the action of T4 ligase. Coli TG1 competent cells were transformed with the recombinant plasmid, and the transformed cells were plated on LB plates containing 100. mu.g/mL of ampicillin and cultured overnight at 37 ℃. The transformants grown on the plate were collected in their entirety, and the cell suspension was diluted to OD with 2 XYTAG (containing 100. mu.g/mL ampicillin and 2% glucose)₆₀₀Culture at 37 ℃ to logarithmic growth phase (about OD) of 0.2₆₀₀0.4), 2 × 10 was added⁹pfu M13K07 helper phage, cultured at 37 ℃ for 1 hour, centrifuged. The precipitated cells were resuspended in 10mL of 2 XYTAK (2 XYT containing 100. mu.g/mL ampicillin and 50. mu.g/mL kanamycin), cultured overnight with shaking at 37 ℃ and centrifuged, and the supernatant containing the recombinant phage was collected, to obtain a single-chain antibody phage expression library.

1.5 screening of recombinant phage antibodies: a polyethylene dish was coated with C3d antigen (Shanghai Shireli Biotech Co., Ltd.), and the supernatant containing the recombinant phage was incubated with the dish at 37 ℃ for 2 hours. The plate was washed 20 times with PBS, followed by 20 times with PBST (0.05% Tween20 in PBS), and the PBST was discarded. 10mL of TG1 cells in logarithmic growth phase were added and cultured at 37 ℃ for 1 hour. Centrifuging, collecting the supernatant, and performing the next round of screening. The screening process of "adsorption-elution-propagation" was repeated 2 times. Phage surface display libraries of enriched clones can be generated upon superinfection with M13K07 helper phage.

1.6 screening and identification of monoclonal recombinant phages: after the third round of selection, TG1 was diluted by 2 XYT to multiple degrees (stock solution, 1:10, 1:100, 1:1000) and spread on SOBAG solid medium (molecular cloning, third edition, translation of Huang Petang, etc.) and cultured overnight at 30 ℃. 100 single colonies were randomly picked from the plate, inoculated into 100. mu.l of 2 XYTAG (containing 100. mu.g/mL ampicillin and 2% glucose) culture medium, and cultured overnight at 30 ℃.20 μ l of the culture medium was transferred to 200 μ l of a medium containing 5X 10⁸pfu/mL M13K07 in 2 XYTAG medium, cultured at 37 ℃ for 2 hours. Centrifugation was performed, and 200. mu.l of 2 XYTAK (2 XYT containing 100. mu.g/mL ampicillin and 50. mu.g/mL kanamycin) was used to resuspend the precipitated cells, and the cells were cultured overnight at 30 ℃. Centrifuging and collecting the supernatant to obtain the monoclonal recombinant phage.

The enzyme-linked plates were coated with C3d antigen, 0.5% BSA as a negative control, and goat anti-M13 phage antibody as a positive control. Blocking with 1% BSA at 37 ℃ for 1 hour. 100 μ l of an equal volume of the mixture of recombinant phage antibody supernatant and blocking solution was added to the enzyme-linked plate, and M13 phage was added to the control wells. After incubation at 37 ℃ for 1 hour, the plates were washed 3 times with PBST (PBS containing 0.05% Tween20) and 3 times with PBS. Mu.l of goat anti-M13 phage antibody IgG-HRP (1:2000) was added to each well and incubated at 37 ℃ for 1 hour. PBST and PBS were washed 3 times each, and freshly prepared substrate H was added₂O₂OPD, reacted at room temperature for 20min, 50. mu.l of 2M H was added₂SO₄Terminating the reaction at A₄₉₀The light absorption value of each well was measured. Among the positive clones, those with the highest binding activity to C3d were selected, which had a light absorption value of 2.1 times or more that of the negative control.

1.7 DNA sequence analysis of the recombinant plasmid of the positive clone: the DNA sequence of the anti-C3 d single-chain antibody on the positive recombinant plasmid was determined using the T7 DNA sequence TAATACGACTCACTATAGGG, and as a result, the sequence consisted of 750 bases. From the 5' end, the light chain variable region coding gene has the sequence shown in SEQ ID NO: 1, the flexible polypeptide coding gene as a linker has the sequence shown in SEQ ID NO: 5, the heavy chain variable region coding gene has the sequence shown in SEQ ID NO: 3, the DNA sequence of the anti-C3 d single-chain antibody codes a DNA sequence with the sequence table SEQ ID NO: 2-SEQ ID NO: 6-SEQ ID NO: 4, and the antibody was named V_L-Linker-V_H(also known as ScFv).

1.8 construction of anti-C3 d Single chain antibody ScFv eukaryotic expression vector and screening of high-efficiency expression cell line

In order to obtain higher biological protein molecules which are closer to natural in terms of molecular structure, physicochemical properties and biological functions, the anti-C3 d single-chain antibody V obtained in step 1.7_L-Linker-V_HCloning the fusion gene into a high-efficiency eukaryotic expression vector pEE14.1(Lonza) to obtain the single-chain antibody V carrying the anti-C3 d_L-Linker-V_HThe recombinant expression vector of the fusion gene is named as pEE14.1/V_L-Linker-V_H. Then the recombinant plasmid pEE14.1/V is prepared by utilizing liposome_L-Linker-V_HTransfection into Chinese hamster ovary cells CHO. 24 hours after transfection, the medium was aspirated and 10mL of fresh selective medium DMEM + 10% FCS +25 μm MSX was added. In the presence of 5% CO₂The mixed gas of (2) was cultured in a 37 ℃ incubator with a humidity of 98%. After 2 weeks, about 1-2mm clones appeared, and the appeared clones were transferred to 24-well plates using cloning rings, and the culture was continued by adding 1mL of selective medium DMEM + 10% FCS +25 μm MSX per well. After the transformants had grown for 5 days, the supernatant was aspirated. Mu.l of the supernatant was added to an enzyme-linked plate coated with C3d antigen, incubated at 37 ℃ for 1 hour, and the plate was washed 3 times with PBS. Mu.l of HRP-labeled IgG secondary antibody (1:2000) was added to each well, and the mixture was incubated at 37 ℃ for 1 hour. The plate was washed 3 times with PBS and freshly prepared substrate H was added₂O₂OPD, reacted at room temperature for 20min, 50. mu.l of 2M H was added₂SO₄Terminating the reaction at A₄₉₀The light absorption value of each well was measured. The positive clones with the light absorption value more than 2.1 times of that of the negative control are selected, and the positive clones with the strongest binding activity with C3d are selected, namely the CHO cell strain for efficiently expressing the anti-C3 d single-chain antibody.

1.9 purification of anti-C3 d Single chain antibodies

The CHO cell strain with high expression efficiency is amplified and cultured, and the supernatant is harvested. The supernatant was slowly added to HiTrap N-hydroxysuccinimide column (Amersham Biosciences) to purify the single-chain antibody. Eluting with 0.01mol/L PBS (pH7.4) at a flow rate of 1mL/min to OD of eluate₂₈₀<Up to 0.02. 0.1mol/L glycine-HCl buffer solution of pH2.4 was added at a flow rate of 1mL/min, and the adsorbed fraction was collected and immediately neutralized with 1mol/L sodium carbonate to prevent protein denaturation. Through SDS-PAGE and Western Blot identification, the target protein with about 26KD is obtained through expression, and the protein can be specifically combined with C3d, which is consistent with the expected result, and shows that the anti-C3 d single-chain antibody with high purity is obtained.

Example 2 preparation of anti-C3 d Single chain antibody-DAF (ScFv-DAF) fusion protein

1, selecting pEE14.1(Lonza biologics) as a material expression vector; CHO cells were used for protein expression, and the culture medium was DMEM containing 10% fetal bovine serum, purchased from Invitrogen. Murine anti-DAF mAbs 1H4 and 1A10, murine anti-human CR2 mAb 171, anti-sheep red blood cell IgM and all secondary antibodies were purchased from Sigma.

2 method

2.1 preparation of antisera against CHO cell membranes and human DAF from rabbits the antisera were obtained according to the method described in Harlow, E., and Lane, D.antibodies: a laboratory manual, Cold Spring Harbor laboratory, Cold Spring Harbor, New York, USA, 1988:726.

2.2 construction of expression recombinants and protein expression cDNA structural genes are formed by connecting the sequence of the coded anti-C3 d single-chain antibody with the sequence of the coded DAF coding extracellular region. The complement inhibitor sequence is a nucleotide sequence encoding 1-250 amino acid residues of the mature DAF protein sequence (Swissprot accession number P08174).

Then, the anti-C3 d single-chain antibody was linked to the complement inhibitor DAF, and the anti-C3 d single-chain antibody had a sequence of GGGSGGGGS (SEQ ID NO: 8) at the N-terminus (ScFv-DAF). The gene frame is synthesized by PCR technology (the amino acid sequence of the fusion protein is shown as SEQ ID NO.10, and the nucleotide sequence is shown as SEQ ID NO. 9). All cloning steps were performed on the pee14.1 vector (see CN 104940953A). The pEE14.1 high-efficiency expression vector contains a special Glutamine (GS) gene expression system. The GS enzyme is responsible for the synthesis of glutamine using glutamyl and amine as substrates. Some mammalian cell lines do not contain the GS gene and therefore cannot survive in the absence of glutamine. For these cell lines, the transfected GS gene can be used as a selection marker to select for cells grown in glutamine-free medium. Methionine imine (MSX) inhibits the activity of GS enzyme, certain cell lines (CHO-K1) produce endogenous glutamine and can grow in glutamine-free medium containing MSX, and the medium added with sufficient MSX to inhibit GS enzyme activity provides screening pressure to screen out the desired cell lines. After being synthesized by a PCR method, the ScFv-DAF fusion gene is connected with a pEE14.1 vector after being cut by EcoRI and SmalI, the recombinant vector pEE14.1-ScFv-DAF is used for transfecting CHO-K1 cells by FuGENE 6, after 24 hours of transfection, a selective DMEM medium (without glutamine) is replaced, MSX is added until the final concentration is 50 mu M, positive clones are grown in about 2 weeks, and normal CHO cells without transfection plasmids gradually fall off from the bottle wall, and the cells are cracked and killed. Selecting 3 cells, culturing with serum-containing medium and serum-free medium for 3 days, collecting cell supernatant, partially concentrating with PEG20000 for 5 times, and storing at-80 deg.C. Expression of ScFv-DAF was examined by ELISA. The recombinant protein was expressed in a secreted form in CHO cells. The expression level of the CHO cell stable expression strain cultured in the serum-free medium is higher than that of the CHO cell stable expression strain cultured in the serum-containing medium.

2.3 purification of recombinant proteins from cell culture supernatants were purified by affinity chromatography. The column was prepared by coupling anti-DAF mAb (1H4) to HiTrap NHS activated affinity column according to the manual. The pH of the recombinant protein-containing culture supernatant was adjusted to 8.0, and the supernatant was passed through the column at a rate of 0.5 mL/min. The column was then washed with 6-8 times the volume of PBS and the recombinant protein was eluted with 2-3 times the column volume of 0.1mol/L glycine (pH 2.4). The fusion protein was collected in 1mol/L Tris buffer (pH8.0), and dialyzed against PBS.

2.4 SDS-PAGE and Western blot identification

The purified protein was carried out on SDS-PAGE gels containing 100 g/L. The gel was stained with Coomassie Brilliant blue.

Recombinant proteins were detected in Western blot experiments using murine anti-DAF mAb 1H 4.

The method comprises the following steps:

firstly, 5% of concentrated glue and 10% of separation glue;

1 mul of 1mg/ml antigen is subjected to SDS-PAGE, 70V concentrated gel and 130V separation gel;

transferring to the PVDF film for 24 min;

5 percent of skimmed milk powder and 0.1 percent of Tween20 are sealed with TBS for 2 hours;

fifthly, 10ml of C3d-ScFV-CD59 with the concentration of 10 mug/ml and 20 mug/ml of C3d-ScFV-DAF antibody as primary antibody are respectively added into 1 and 2 antigen tanks, TBST skimmed milk powder without primary antibody is added into 3 and 4 antigen tanks, and the mixture is incubated for 2 hours at room temperature;

sixthly, washing the mixture for 5 times and 5 min/time by TBST;

seventhly, diluting antibodies resisting CD59 (rabbit monoclonal antibodies) according to the ratio of 1:5000, respectively adding the diluted antibodies into

antigen grooves

1 and 3, diluting antibodies resisting DAF (mouse monoclonal antibodies) according to the ratio of 1:5000, respectively adding the diluted antibodies into

antigen grooves

2 and 4, and incubating for 1h at room temperature;

washing the eighty TBST for 5 times and 5 min/time;

ninthly, adding the goat anti-rabbit antibody and the goat anti-mouse antibody into the

antigen grooves

1 and 3 and the

antigen grooves

2 and 4 respectively according to the dilution ratio of 1:5000, and incubating for 1h at room temperature;

TBST in the middle of the car is washed for 5 times, 5 min/time;

and (4) developing color.

3. Results

The recombinant protein ScFv-DAF, which is separated from the culture supernatant of the stably transfected CHO cells, is 100-200. mu.g/L, and the results of SDS-PAGE (figure 1) and Western blot (figure 2) show that the target fragment with the expected size (the relative molecular weight of the ScFv-DAF fusion protein is about 55KDa) appears.

Example 3 analysis of the kinetics of the interaction of ScFv-DAF with the C3 ligand

Kinetic analysis of the interaction of ScFv-DAF with biotin-labeled C3dg (C3 dg-biotin) was detected using a Surface Plasmon Resonance (SPR) detection system (BIAcore 3000 instrument). Human C3 dg-biotin (Guthridge, J.M., et al. structural students in solution of the recombinant N-terminal pair of short consensus/complementary domains of complementary receptors type 2(CR2/CD21) and interactions with its ligand and 3dg. biochemistry.2001,40(20): 5931. 5941.) was injected at a rate of 2. mu.L/min onto a BIAcore streptavidin sensor chip for 20min, the buffer being 0.5 XPBS (pH7.4) (containing 0.5g/L Tween20) at an average amount of 50mg/L per flow cell. The BIAcore reaction units (ranging from 250 to 500) were generated from SPR signals acquired on captured C3dg. The group without the fusion protein was used as a control. After washing at 25 ℃ with 0.5 XPBST (0.5g/L Tween20) at a flow rate of 25. mu.L/min, the affinity was assessed by measuring the ScFv-DAF concentration (15.6-500 nmol/L).

Kinetic analysis data showed that 1:1 was best suited to fit the spherical detection parameters for the reaction model. The results of SPR measurements showed that the ScFv-DAF showed higher binding and dissociation rates than the ScFv (Table 3). Furthermore, the affinity of ScFv-DAF was higher than that of ScFv.

TABLE 3 kinetic parameters for binding of recombinant fusion proteins to C3 dg-Biotin

In this study, the kinetic parameters of the single-chain antibody against the C3d antibody disclosed in the Chinese patent application CN109575132A were also measured, and the results showed that the Ka (1/Ms) of the antibody was 4.58X 10²Kd (1/s) is 0.023, K_D(nm) is 764 +/-68, and compared with the antibody, the ScFv provided by the invention greatly improves the kinetic energy of C3 dg-biotin combinationAnd (4) counting.

Example 4 complement lysis assay

To determine complement inhibitory activity, 60% -80% of the fused CHO cells were separated with EDTA, washed 2 times with DMEM, and then resuspended in DMEM to a final concentration of 10⁶Individual cells/mL. Adding 100mL/L rabbit anti-CHO cell membrane antiserum into the cell suspension, and acting at 4 deg.C for 30min to sensitize the cells. The antiserum was then discarded and the cells resuspended in NHS diluted in DMEM to a final volume of 50. mu.L or 100. mu.L. The cells were incubated at 37 ℃ for 60min and finally cell viability was measured by the placental blue staining exclusion method (both live and dead cells were counted). The recombinant fusion protein was diluted with DEME, added to NHS, and then added to the CHO cell suspension. The final concentration was based on the control CHO cell lysis at which 100g/L NHS resulted in approximately 90% antibody sensitization. Complement-mediated inhibition of erythrolysis experiments sheep erythrocytes sensitized with antibody (EAs) were tested. Hemolysis assay was performed in gelatin phorona buffer (GVB)⁺⁺) In a final volume of 300. mu.L, containing 2.5X 10⁷EAs, NHS were diluted 1: 300. The reaction mixture was incubated at 37 ℃ for 60min and finally stopped by adding 300. mu.L of a solution containing 10mmol/L EDTA-PBS. Centrifuging, collecting supernatant, and quantitatively detecting heme in the supernatant with a spectral imager at 413nm wavelength.

Detection of the activity of the fusion protein complement inhibitor: the results of complement-mediated CHO cell and erythrocyte lysis experiments show that in CHO cell lysis inhibition experiments, ScFv-DAF has an obvious inhibition effect and an inhibition efficiency improved by more than 6 times than ScFv, and in cell lysis inhibition experiments, ScFv-DAF has a protection effect on erythrocytes improved by more than 3 times than ScFv (detailed in Table 4).

TABLE 4 concentration of complement inhibitor that inhibits lysis of 50% of cells

Example 5 ScFv-DAF fusion protein RA in vivo experiments:

1. biological profiling experiment

ScFv-DAF labeling by Iodogen method¹²⁵I, 150. mu.l of 50mmLo/L PBS (pH7.4), 100. mu.l (100. mu.g) of ScFv containing 1mg of BSA dissolved therein, and Na were sequentially added to an EP tube coated with 200. mu.g of Iodogen¹²⁵Solution I15. mu.l (185MBq) and the labeling tube gently shaken intermittently at room temperature for 15 min. The SEP-PAK C18 column was activated by washing with methanol, double distilled water and 5mL each of 0.1% trifluoroacetic acid (TFA) in this order; the labeling mixture was loaded onto a column, rinsed with 0.1% TFA; eluting with 60% acetonitrile solution, and collecting the first 1.5mL eluate. After freeze-drying, diluted with PBS containing 1mg/mL BSA, and dispensed, and stored in a refrigerator at-80 ℃ for further use. The male DBA/1J mouse is injected with 0.1mL of collagen II and complete Freund's adjuvant (purchased from Sigma company in USA) subcutaneously at the tail root, and a rheumatoid arthritis (CIA) mouse model is established by reinforcement once on day 21 (the model establishment refers to the establishment of a C57BL/6 mouse CIA model and the preliminary screening of a monitoring system thereof, volume 6, 472-474 of the Jiefang Jun Med. 2004, volume 6). The test and grouping methods were as follows: tail vein injection of control group¹²⁵I-DAF (2ug), killed by decapitation after 24h, 48h respectively, blood was collected, tissue organs were removed, weighed and measured for radioactivity (. mu. Ci), and the results were converted to ID%/g tissue. ② arthritis group tail vein injection¹²⁵The I-DAF fusion protein (2ug) is processed and detected as above after 24h, 48h, 72h and 96h respectively. ③ ScFv-DAF arthritis treatment group, tail vein injection once¹²⁵I-ScFv-DAF fusion protein (0.25ug) is processed and detected as above after 24 h. The results are shown in FIG. 3, which indicates that the ScFv-DAF fusion protein of the present invention can be highly aggregated at the arthritis site (the top-down sequence of the legend in FIG. 3 corresponds to the left-to-right sequence of the sublolumns in each of the component histograms in FIG. 3).

2. Treatment of rheumatoid arthritis (CIA) mouse model

The test was started from day 21 using the rheumatoid arthritis (CIA) mouse model (supra) and grouped as follows: injection of 50 μ l PBS control (N ═ 18). (iv) ScFv-DAF microdose treatment group (N ═ 16), ScFv-DAF fusion protein (0.25) mg was injected once a day. (iii) ScFv-DAF low dose treatment group (N ═ 18), ScFv-DAF fusion protein (0.25) mg was injected twice daily. (iv) ScFv-DAF medium dose treatment group (N ═ 16), three daily injections of ScFv-DAF fusion protein (0.25) mg. (iv) ScFv-DAF high dose treatment group (N16) with four daily injections of ScFv-DAF fusion protein (0.25) mg. Clinical scoring started on day 23 and animals were scored for arthritis according to the following criteria: 0 point, no arthritis; score 1, mild inflammation and redness of the paw; 2 points, severe erythema and swelling, affecting the function of the paw; in 3 minutes, the claws or joints become deformed, stiff and lose their functions. The maximum total limb score of each mouse is 12. As shown in FIG. 4, the severity of arthritis was significantly lower in the four treatment groups of ScFv-DAF fusion protein than in the PBS group from day 23. Wherein the score of the fifth group (4 injections) is 1/2 or less of the fourth group (3 injections), 1/4 or less of the third group (ScFv-DAF2 injections), 1/5 or less of the fourth group (ScFv-DAF 1 injections), and 1/7 or less of the fourth group (PBS control).

The experimental results prove that the ScFv-DAF fusion protein has specific targeting property on C3d, has better anti-adhesion/anti-inflammatory targeting inhibition effect, has good treatment effect on the inflammatory response of an organism, and is obviously higher than the treatment effect of ScFv-DAF.

Example 6 therapeutic Effect of ScFv-DAF fusion proteins in MRL/lpr lupus erythematosus mice

1. Improvement of survival rate

Comparison of survival rates of ScFv-DAF high dose treatment group (n-24), ScFv-DAF low dose treatment group (n-24) and PBS control group (n-26) in MRL/lpr mice from 16 weeks to 24 weeks

The MRL/lpr lupus erythematosus mouse model, which was first established in 1979 by Murphy and Roths, was made by 12 generations of complex crossing processes of multiple strains of mice, and 75% of the mouse genes of the model were derived from LG/J, 12.6% from AKR/J, 12.1% from C3H/Di, and 0.3% from C57BL/6 strain of mice. MRL/lpr mice contain recessive mutations in the Fas gene associated with spontaneous apoptosis of cells, the appearance of lymphoproliferative genes, resulting in T cell proliferation, generalized lymphadenectasis, and erosive arthritis, anti-DNA, anti-Sm, anti-Su, anti-nucleoside P antibodies, high titer ANA, hypergammaglobulinemia, and rheumatoid factor. The mouse was first developed at 8 weeks when autoantibodies were detectable in the serum. Lymphadenitis was observed at 12 weeks. At 12-16 weeks, MRL/lpr mice began to develop large amounts of autoantibodies, including anti-double stranded DNA antibodies. Multiple organs were involved at the age of approximately 16 weeks and stable deterioration of renal function characterized by severe proteinuria occurred. 16-24 weeks old mice develop proliferative immune complex mediated glomerulonephritis, vasculitis, and eventually death due to renal failure, with a mortality rate of 50%.

In this example, 16-week-old MRL/lpr mice that had developed renal failure symptoms were randomized into three groups, the first group (n-24) was a high dose treatment group and received 0.3mg/W of ScFv-DAF weekly from week 16 to 24, the second group (n-24) was a low dose treatment group and received 0.15mg/W of ScFv-DAF weekly from week 16 to 24, the third group (n-26) was a control group and received an equal amount of PBS weekly from week 16 to 24. The administration routes of the three groups are tail vein injection. The protection rate of ScFv-DA on MRL/lpr lupus erythematosus mice was evaluated based on the survival rate of the administration group and the control group.

As shown in FIG. 5, the survival rate of the mice treated with ScFv-DAF is significantly improved because C3d in the complement activation pathway is effectively inhibited by ScFv-DAF targeting C3d, the survival rate of the MRL/lpr lupus erythematosus mice is significantly improved, the MRL/lpr lupus erythematosus mice can be completely protected by the whole treatment process of the ScFv-DAF high dose treatment group, the survival rate is 100%, the survival rate of the ScFv-DAF low dose treatment group can be maintained at 70% or more even at week 24, and the survival rate of the mice in the treatment group is significantly improved from week 18 compared with the control group.

2. Improvement of renal function

Mice were placed in metabolic cages to study the effect of ScFv-DAF on urinary albumin secretion in MRL/lpr lupus erythematosus mice. 24 hour urine from mice was collected every two weeks starting at 16 weeks. To prevent bacterial growth ampicillin, gentamicin and chloramphenicol were added to the collection tubes. A standard curve is drawn by an ELISA method by using mouse albumin samples with known concentrations, urine albumin secretion of experimental mice is determined, and creatinine content in mouse urine is determined by using a biochemical analyzer. The final evaluation results are expressed as urinary albumin (mg) to creatinine (mg) ratio for 24 hours per experimental mouse. A higher urinary albumin creatinine ratio indicates impaired kidney function. As shown in fig. 6, in the MRL/lpr mouse ScFv-DAF treated group (n-22) and PBS control group (n-24), the level of proteinuria in the treated group was significantly reduced (P <0.01) compared to the control group at week 18-24. The ScFv-DAF provided by the invention is proved to be capable of remarkably improving the symptom of renal function injury.

3. Reduction of inflammatory response in kidney

After the experiment is finished, the kidney of the excised mouse is longitudinally dissected into two halves, wherein one half is subjected to immunofluorescence analysis, the other half is fixed by 10% neutral formaldehyde, the other half is subjected to solid paraffin embedding and sectioning, the sectioning of the kidney tissue processed by paraffin is dyed by a hematoxylin-eosin dyeing method and a periodic acid snowflake dyeing method, glomerulonephritis, hyperplasia, crescent moon formation and necrosis symptoms observed by the sectioning are respectively graded by a blind method, and meanwhile, the change of renal interstitium is also graded. The scores were divided into five grades of 0, 1, 2, 3 and 4, with 0 being no damage and 4 being severe damage. Perivascular inflammatory exudation was evaluated in a semi-quantitative manner by blinding two independent observers on more than 10 vessels per section. Inflammation was scored as 0-3, 0 as no inflammation, 1 as less than 50% of the vessels surrounded by 3 layers of cells, 2 as more than 50% of the vessels surrounded by 3-6 layers, 3 as most severely represented, more than 6 layers surrounded by cells. The evaluation results are shown in Table 5.

TABLE 5 comparison of Kidney Damage in MRL/lpr mice between ScFv-DAF treated and PBS control groups at week 24 after 16-23 weeks treatment

Compared with the control group, the ScFv-DAF treatment group has more obvious reduction in glomerular score, interstitial inflammation, vasculitis, crescent/necrosis and the like than the control group (P < 0.05).

Sequence listing

<110> Beijing Congpumet Innovation medicine science and technology, Limited liability company

<120> fusion protein of targeting single-chain antibody and DAF for resisting C3d and application

<160> 10

<170> PatentIn version 3.3

<210> 1

<211> 327

<212> DNA

<213> Homo sapiens

<400> 1

atggccagct acgaactgac ccagccgccg agcgtgtcgg tggcgccggg tcagaccgcg 60

cgtatcacct gctcgggcga tgcgctgggc gataaatacg cgagctggta tcagcagaaa 120

ccgggtcagg caccggtgct ggtgatttac gaagattcta aacgcccgtc tggcatcccg 180

gaacgcttta gcggctcgaa ttcgggcaac accgcgaccc tgaccattag cggcacccag 240

gcggaggatg aggcggacta ttactgccag tcgcaggctg gcgccgttgt tggggtgttt 300

ggcggtggca ccaaactgac cgtgctg 327

<210> 2

<211> 109

<212> PRT

<213> Homo sapiens

<400> 2

Met Ala Ser Tyr Glu Leu Thr Gln Pro Pro Ser Val Ser Val Ala Pro

1 5 10 15

Gly Gln Thr Ala Arg Ile Thr Cys Ser Gly Asp Ala Leu Gly Asp Lys

20 25 30

Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val

35 40 45

Ile Tyr Glu Asp Ser Lys Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser

50 55 60

Gly Ser Asn Ser Gly Asn Thr Ala Thr Leu Thr Ile Ser Gly Thr Gln

65 70 75 80

Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Gln Ser Gln Ala Gly Ala Val

85 90 95

Val Gly Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu

100 105

<210> 3

<211> 357

<212> DNA

<213> Homo sapiens

<400> 3

gaagtgcaat tggtggaaag cggtggcggt ctggtgcagc cgggtggcag cctgcgtctg 60

agctgcgcag cgagcggctt cacctttagc agctacgcga tgagctgggt gcgccaggca 120

ccgggtaaag gtctggaatg ggtgagcgcg attagcggta gcggcggcag cacctactat 180

gcggatagcg tgaaaggccg ttttaccatc tcgcgtgata actcgaaaaa caccctgtac 240

ctgcagatga acagcctgcg tgcggaagat accgcggtgt attattgcgc acgtggttcg 300

gttaatcatg gtgtggattt ctggggtcag ggcactctgg tgaccgtgtc gagcgcg 357

<210> 4

<211> 119

<212> PRT

<213> Homo sapiens

<400> 4

Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr

20 25 30

Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

35 40 45

Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr

65 70 75 80

Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Gly Ser Val Asn His Gly Val Asp Phe Trp Gly Gln Gly Thr

100 105 110

Leu Val Thr Val Ser Ser Ala

115

<210> 5

<211> 66

<212> DNA

<213> Artificial

<400> 5

ggcagcggcg gctcgaccat aacttcgtat aatgtatact atacgaagtt atcgagctcg 60

ggcagc 66

<210> 6

<211> 22

<212> PRT

<213> Artificial

<400> 6

Gly Ser Gly Gly Ser Thr Ile Thr Ser Tyr Asn Val Tyr Tyr Thr Lys

1 5 10 15

Leu Ser Ser Ser Gly Ser

20

<210> 7

<211> 27

<212> DNA

<213> Artificial

<400> 7

ggaggtgggt cgggtggcgg cggatct 27

<210> 8

<211> 9

<212> PRT

<213> Artificial

<400> 8

Gly Gly Gly Ser Gly Gly Gly Gly Ser

1 5

<210> 9

<211> 1527

<212> DNA

<213> Artificial

<400> 9

atggccagct acgaactgac ccagccgccg agcgtgtcgg tggcgccggg tcagaccgcg 60

cgtatcacct gctcgggcga tgcgctgggc gataaatacg cgagctggta tcagcagaaa 120

ccgggtcagg caccggtgct ggtgatttac gaagattcta aacgcccgtc tggcatcccg 180

gaacgcttta gcggctcgaa ttcgggcaac accgcgaccc tgaccattag cggcacccag 240

gcggaggatg aggcggacta ttactgccag tcgcaggctg gcgccgttgt tggggtgttt 300

ggcggtggca ccaaactgac cgtgctgggc agcggcggct cgaccataac ttcgtataat 360

gtatactata cgaagttatc gagctcgggc agcgaagtgc aattggtgga aagcggtggc 420

ggtctggtgc agccgggtgg cagcctgcgt ctgagctgcg cagcgagcgg cttcaccttt 480

agcagctacg cgatgagctg ggtgcgccag gcaccgggta aaggtctgga atgggtgagc 540

gcgattagcg gtagcggcgg cagcacctac tatgcggata gcgtgaaagg ccgttttacc 600

atctcgcgtg ataactcgaa aaacaccctg tacctgcaga tgaacagcct gcgtgcggaa 660

gataccgcgg tgtattattg cgcacgtggt tcggttaatc atggtgtgga tttctggggt 720

cagggcactc tggtgaccgt gtcgagcgcg ggaggtgggt cgggtggcgg cggatctgac 780

tgtggccttc ccccagatgt acctaatgcc cagccagctt tggaaggccg tacaagtttt 840

cccgaggata ctgtaataac gtacaaatgt gaagaaagct ttgtgaaaat tcctggcgag 900

aaggactcag tgatctgcct taagggcagt caatggtcag atattgaaga gttctgcaat 960

cgtagctgcg aggtgccaac aaggctaaat tctgcatccc tcaaacagcc ttatatcact 1020

cagaattatt ttccagtcgg tactgttgtg gaatatgagt gccgtccagg ttacagaaga 1080

gaaccttctc tatcaccaaa actaacttgc cttcagaatt taaaatggtc cacagcagtc 1140

gaattttgta aaaagaaatc atgccctaat ccgggagaaa tacgaaatgg tcagattgat 1200

gtaccaggtg gcatattatt tggtgcaacc atctccttct catgtaacac agggtacaaa 1260

ttatttggct cgacttctag tttttgtctt atttcaggca gctctgtcca gtggagtgac 1320

ccgttgccag agtgcagaga aatttattgt ccagcaccac cacaaattga caatggaata 1380

attcaagggg aacgtgacca ttatggatat agacagtctg taacgtatgc atgtaataaa 1440

ggattcacca tgattggaga gcactctatt tattgtactg tgaataatga tgaaggagag 1500

tggagtggcc caccacctga atgcaga 1527

<210> 10

<211> 509

<212> PRT

<213> Artificial

<400> 10

Met Ala Ser Tyr Glu Leu Thr Gln Pro Pro Ser Val Ser Val Ala Pro

1 5 10 15

Gly Gln Thr Ala Arg Ile Thr Cys Ser Gly Asp Ala Leu Gly Asp Lys

20 25 30

Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val

35 40 45

Ile Tyr Glu Asp Ser Lys Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser

50 55 60

Gly Ser Asn Ser Gly Asn Thr Ala Thr Leu Thr Ile Ser Gly Thr Gln

65 70 75 80

Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Gln Ser Gln Ala Gly Ala Val

85 90 95

Val Gly Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly Ser Gly

100 105 110

Gly Ser Thr Ile Thr Ser Tyr Asn Val Tyr Tyr Thr Lys Leu Ser Ser

115 120 125

Ser Gly Ser Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln

130 135 140

Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe

145 150 155 160

Ser Ser Tyr Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu

165 170 175

Glu Trp Val Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala

180 185 190

Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn

195 200 205

Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val

210 215 220

Tyr Tyr Cys Ala Arg Gly Ser Val Asn His Gly Val Asp Phe Trp Gly

225 230 235 240

Gln Gly Thr Leu Val Thr Val Ser Ser Ala Gly Gly Gly Ser Gly Gly

245 250 255

Gly Gly Ser Asp Cys Gly Leu Pro Pro Asp Val Pro Asn Ala Gln Pro

260 265 270

Ala Leu Glu Gly Arg Thr Ser Phe Pro Glu Asp Thr Val Ile Thr Tyr

275 280 285

Lys Cys Glu Glu Ser Phe Val Lys Ile Pro Gly Glu Lys Asp Ser Val

290 295 300

Ile Cys Leu Lys Gly Ser Gln Trp Ser Asp Ile Glu Glu Phe Cys Asn

305 310 315 320

Arg Ser Cys Glu Val Pro Thr Arg Leu Asn Ser Ala Ser Leu Lys Gln

325 330 335

Pro Tyr Ile Thr Gln Asn Tyr Phe Pro Val Gly Thr Val Val Glu Tyr

340 345 350

Glu Cys Arg Pro Gly Tyr Arg Arg Glu Pro Ser Leu Ser Pro Lys Leu

355 360 365

Thr Cys Leu Gln Asn Leu Lys Trp Ser Thr Ala Val Glu Phe Cys Lys

370 375 380

Lys Lys Ser Cys Pro Asn Pro Gly Glu Ile Arg Asn Gly Gln Ile Asp

385 390 395 400

Val Pro Gly Gly Ile Leu Phe Gly Ala Thr Ile Ser Phe Ser Cys Asn

405 410 415

Thr Gly Tyr Lys Leu Phe Gly Ser Thr Ser Ser Phe Cys Leu Ile Ser

420 425 430

Gly Ser Ser Val Gln Trp Ser Asp Pro Leu Pro Glu Cys Arg Glu Ile

435 440 445

Tyr Cys Pro Ala Pro Pro Gln Ile Asp Asn Gly Ile Ile Gln Gly Glu

450 455 460

Arg Asp His Tyr Gly Tyr Arg Gln Ser Val Thr Tyr Ala Cys Asn Lys

465 470 475 480

Gly Phe Thr Met Ile Gly Glu His Ser Ile Tyr Cys Thr Val Asn Asn

485 490 495

Asp Glu Gly Glu Trp Ser Gly Pro Pro Pro Glu Cys Arg

500 505

Claims

1. A single-chain antibody of human anti-complement C3d molecule, wherein the amino acid sequences of CDR1, CDR2 and CDR3 in the variable region of the antibody light chain are shown as the amino acid sequences at positions 25-35, 51-57 and 89-98 of SEQ ID NO.2, respectively, and the amino acid sequences of CDR1, CDR2 and CDR3 in the variable region of the antibody heavy chain are shown as the amino acid sequences at positions 30-35, 50-66 and 99-107 of SEQ ID NO.4, respectively.

2. The single-chain antibody of claim 1, wherein the amino acid sequence of the variable region of the antibody light chain is shown as SEQ ID No.2, and the amino acid sequence of the variable region of the antibody heavy chain is shown as SEQ ID No. 4.

3. The single chain antibody of claim 2, wherein the antibody light chain variable region is linked to the heavy chain variable region by a flexible polypeptide having the amino acid sequence shown in SEQ ID No. 6.

4. A fusion protein comprising the single chain antibody of claim 3, wherein the fusion protein further comprises a complement activity modulator, wherein the complement activity modulator is a DAF molecule, wherein the single chain antibody is linked to the DAF molecule by a flexible polypeptide as shown in SEQ ID No.8, and wherein the fusion protein has the amino acid sequence as shown in SEQ ID No. 10.

5. A polynucleotide encoding the fusion protein of claim 4, wherein the polynucleotide has the sequence set forth in SEQ ID No. 9.

6. Use of the fusion protein of claim 4 for the preparation of a medicament for the treatment of an autoimmune disease.

7. Use according to claim 6, wherein the diseases include rheumatoid arthritis and systemic lupus erythematosus.