CN101037671B - Hybridoma cell line and anti-human erythrocyte surface H antigen monoclonal antibodies generated thereof - Google Patents
Hybridoma cell line and anti-human erythrocyte surface H antigen monoclonal antibodies generated thereof Download PDFInfo
- Publication number
- CN101037671B CN101037671B CN 200710063923 CN200710063923A CN101037671B CN 101037671 B CN101037671 B CN 101037671B CN 200710063923 CN200710063923 CN 200710063923 CN 200710063923 A CN200710063923 A CN 200710063923A CN 101037671 B CN101037671 B CN 101037671B
- Authority
- CN
- China
- Prior art keywords
- seq
- variable region
- antigen
- monoclonal antibody
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a hybridization tumor cell stem 2E8Z CGMCC NO.1942 and monoclonal antibody of human red blood cell surface H antigen thereof. The monoclonal antibody 2E8 of human red blood cell surface H antigen genereated by hybridization tumor cell stem has advantages of high effect, strong differentia, extensive distribution of antigen. The flexible peptide is easy to be bended, so mixed albumen of the invnetion is feld correctly and without influence each activity combination area of the mixed albumen. Experiment evidence, the mixed albumen can specially combine with human red blood cell surface H antigen; moreover, the mixed albumen with high expression amount, easy to be purified, short production cycle, large production scale and low cost. Base on these advantages, the invention plans to use gene engineering method to produce double function molecule and establish good base of treating based on red blood cell and testing platform, having more actual sense and wider application foreground in medical testing field.
Description
Technical field
The present invention relates to the monoclonal antibody of the anti-human erythrocyte surface H antigen of hybridoma cell strain and generation thereof.
Background technology
People's erythrocyte surface has many antigen molecules, their structure differences, diverse in function.Wherein, form the surface antigen molecule (as: A, B, O blood group antigen) of blood group system, main and transfusion safety is closely related.Abo blood group antigen gene direct coding specificity glycosyltransferase, and then by the ABO antigen of these enzymic synthesis oligosaccharides character.A type epitope is a N-ethanoyl semi-lactosi, and Type B is a semi-lactosi, and the O type is the H epitope, is Fucose.The H epitope is the precursor of Blood group antigen AB.
Except that the type red corpuscle of rare Bombay (Bombay), H antigen is distributed in all human erythrocyte surfaces, belongs to the red corpuscle common antigen.Directly the common phenotype relevant with H antigen is divided into secretor type and nonsecreting type, 365 amino acid whose α-2-L fucosyl transferases of H (FUT1) locus gene coding, α-fucosyl transferase the activity of control hemopoietic tissue, the expression of decision H antigen on erythrocyte membrane.332 amino acid whose α-2-L fucosyl transferases of SE (FUT2) locus gene coding, the fucosyl transferase activity of control secretory tissue, decision H antigen is in the expression of juice.The H blood group antigen are polysaccharide bodies, and dry and high heat are had stronger resistibility, even 170 ℃ be not destroyed, and highly weather resistance is arranged, and are of many uses aspect legal medical expert's evaluation.H antigen oligosaccharides 2-type precursor sugar chain most importantly on the erythrocyte membrane, L-Fucose are connected in precursor sugar-chain end lactose and constitute the H epitope.
Except blood group antigen, red corpuscle also has many important surface moleculars.Wherein, the CR1 molecule is an I type complement receptor, and the assignment of genes gene mapping is in people's long-armed 32 districts of No. 1 karyomit(e).As the Opsonin acceptor, CR1 can strengthen phagocytic cell to the complement bag by the phagolysis of particle and microorganism.CR1 bind immune complex (IC) transports it into liver with red corpuscle, and immunocomplex is promptly removed by monocyte with after red corpuscle separates.
In the erythrocyte surface antigen system, have the molecule of common antigen character, no matter be blood group antigen (as H antigen etc.) or surface molecular (CR1, glycophorin A etc.), in medical test and treatment research, all day by day come into one's own.
1989, Kemp utilizes the monoclonal antibody of the common antigen one blood group albumin A on anti-erythrocyte surface, and (this monoclonal antibody is non-aggegation type monoclonal antibody, in brine media, can not directly make red corpuscle generation agglutination reaction), set up from the body red cell agglutination and tested, this method is with patient's self the red corpuscle indicator cells as detection system, the bi-functional molecule (specificity is respectively at erythrocyte surface antigen and antigen/antibody to be checked) that forms with special non-aggegation type anti-human erythrocyte antibody (or antibody fragment) and relevant antigen or antibody is as detection reagent (Kemp BE, Rylatt DB, Bundesen PG, Doherty RR, McPhee DA, Stapleton D, Cottis LE, Wilson K, JohnMA.Autologous red cell agglutination assay for HIV-1antibodies:simplifiedtest with wholeblood.[J] Science.1988,241 (4871): 1352-1354.).After in person's to be checked whole blood, adding this detection reagent, if have corresponding antibody or antigen in the blood preparation, one end of bi-functional molecule (anti-human erythrocyte antibody) can combine with the red corpuscle in the blood, free antibody or antigen combine in the other end and the blood, bridge linking effect by this molecule presents macroscopic blood aggegation piece with red cell agglutination together.This method is easy, quick, high specificity, susceptibility height, the external existing report that uses this method that HIV antibody is detected.
Tailor (Craig ML in 1991, Bankovich AJ, Taylor RP.Visualization of thetransfer react ion:tracking immune complexes from erythrocyte complementreceptor tomacrophages[J] .Clin Immunol, 2002,105: 36-47) made up the different aggressiveness of monoclonal antibody based on the common antigen CR1 of erythrocyte surface, the different aggressiveness of this monoclonal antibody can connect together red corpuscle with sick cell; sick cell is engulfed by scavenger cell with erythrocytic normal physiological metabolism process.The application of the different aggressiveness of monoclonal antibody, having started with the red corpuscle is the frontier of the pharmacological agent of carrier.
No matter this shows, be to carry out pharmacological agent as carrier, still carries out the detection of pathogenic agent as indicator cells, and red corpuscle not merely has been the carrier of oxygen and nutrient, already and will bring into play bigger platform action.But, the performance of this effect, the bi-functional molecule that a kind of monoclonal antibody based on anti-erythrocyte surface common antigen of needs is the basis plays a role in the bridging mode as mediators.Therefore, the good anti-erythrocyte monoclonal antibody (abbreviation monoclonal antibody) of obtained performance is the prerequisite of experimental study, and the preparation of bifunctional molecule then is successful key.
At present, the preparation method of bi-functional molecule mainly comprises chemical crosslink technique, hybridoma fusion method and gene engineering research.Chemical crosslink technique promptly connects together the anti-erythrocyte monoclonal antibody by chemical cross-linking agent with an other strain monoclonal antibody.The hybridoma method is by an anti-erythrocyte monoclonal antibody and an other strain monoclonal antibody being merged, filtering out the hybridoma that can secrete the bi-functional molecule.These two kinds of methods are primarily aimed at monoclonal antibody and operate, but the use of chemical cross-linking agent is easy to destroy antibody activity in the chemical crosslink technique, and the difficulty of the hybridoma cell strain of screening secretion bi-functional molecule is bigger in the hybridoma fusion method.Adopt gene engineering research to prepare the bi-functional molecule, the variable region gene that at first needs clonal antibody (anti-erythrocyte monoclonal antibody and other monoclonal antibody), then external by enzyme cut, means such as connection make up the bi-functional molecular gene, perhaps introduce the antigen peptide gene, at last the gene of reconstruct is expressed, the fusion rotein of acquisition is bifunctional molecule.
The acquisition of antibody variable region is the committed step that gene engineering research prepares the bi-functional molecule.The design of primers of clone gene comprises two kinds of methods: RT-PCR method and 5 ' RACE method.The design of primers of RT-PCR method is mainly according to antibody skeleton district or leader peptide sequences design degenerated primer.Because the degeneracy of primer, the N of variable region, C-terminal can not faithful to fully former sequences, the change of some amino-acid residue can influence genetic engineering antibody in conjunction with active, cause the avidity reduction of genetic engineering antibody.5 ' RACE method is a kind of improvement to the RT-PCR method, and by adding one section polyC at 5 ' end, as upstream primer, downstream primer then according to the constant region design, can guarantee to be cloned into and the on all four variable region gene of parental antibody like this.
Summary of the invention
The purpose of this invention is to provide the hybridoma cell strain that a strain can produce the monoclonal antibody of anti-human erythrocyte surface H antigen.
The hybridoma cell strain that produces the monoclonal antibody of anti-human erythrocyte surface H antigen provided by the present invention, name is called 2E8Z, this cell strain was preserved in the China Committee for Culture Collection of Microorganisms common micro-organisms center of BeiJing ZhongGuanCun in 02 month on the 08th in 2007, deposit number is CGMCC No.1942.
The monoclonal antibody of the anti-human erythrocyte surface H antigen that produces by above-mentioned hybridoma cell strain 2E8Z CGMCC No.1942, name is called 2E8, derive from Mus mouse (Mus musculus), its variable region of heavy chain have the amino acid residue sequence of the SEQ ID NO:1 in the sequence table or with the amino acid residue sequence of SEQ ID NO:1 in the sequence table through replacement, disappearance or the interpolation of one to ten amino-acid residue and have in the anti-human erythrocyte surface H antigen and active polypeptide; Variable region of light chain have the amino acid residue sequence of the SEQ ID NO:2 in the sequence table or with the amino acid residue sequence of SEQ ID NO:2 in the sequence table through replacement, disappearance or the interpolation of one to ten amino-acid residue and have in the anti-human erythrocyte surface H antigen and active polypeptide.
SEQ ID NO:1 in the sequence table is made up of 117 amino-acid residues, and the SEQ ID NO:2 in the sequence table is made up of 112 amino-acid residues.
The gene (2E8) of monoclonal antibody 2E8 of coding anti-human erythrocyte surface H antigen, its variable region of heavy chain encoding gene have the dna sequence dna of SEQ ID NO:1 in the dna sequence dna of SEQ ID NO:3 in the sequence table or the code sequence tabulation or the nucleotide sequence of the dna sequence dna hybridization that can limit with SEQ ID NO:3 in the sequence table under the rigorous condition of height; The variable region of light chain encoding gene has the dna sequence dna of SEQID NO:2 in the dna sequence dna of SEQ ID NO:4 in the sequence table or the code sequence tabulation or the nucleotide sequence of the dna sequence dna hybridization that can limit with SEQ ID NO:4 in the sequence table under the rigorous condition of height.
The rigorous condition of described height be 0.1 * SSPE (or 0.1 * SSC), in the solution of 0.1%SDS, hybridization and wash film under 65 ℃ of conditions.
SEQ ID NO:3 in the sequence table is by 351 based compositions, and its encoding sequence is that coding has the protein of the amino acid residue sequence of SEQ ID NO:1 in the sequence table from 5 ' end the 1st to 351 bit base.SEQ ID NO:4 in the sequence table is by 336 based compositions, and its encoding sequence is that coding has the protein of the amino acid residue sequence of SEQ ID NO:2 in the sequence table from 5 ' end the 1st to 336 bit base.
Contain the monoclonal antibody 2E8 heavy chain of anti-human erythrocyte surface H antigen of the present invention and/or the expression vector of variable region of light chain encoding gene, transgenic cell line and host bacterium all belong to protection scope of the present invention.
Arbitrary segmental primer is to also within protection scope of the present invention in the monoclonal antibody 2E8 heavy chain of amplification anti-human erythrocyte surface H antigen and/or the variable region of light chain encoding gene.
The variable region of heavy chain that another object of the present invention provides a kind of monoclonal antibody 2E8 with anti-human erythrocyte surface H antigen is connected the fusion rotein that obtains with variable region of light chain.
The variable region of heavy chain of the monoclonal antibody 2E8 of the anti-human erythrocyte surface H antigen in the described fusion rotein can be connected by flexible peptide with light chain, and described flexible peptide can have the amino acid residue sequence of SEQ ID NO:5, SEQ ID NO:6 in the sequence table or SEQID NO.7.
SEQ ID NO:5 in the sequence table is flexible peptide (Gly4Ser)
3, form by 15 amino-acid residues; SEQ ID NO.6 in the sequence table is flexible peptide (Gly4Ser)
2, form by 10 amino-acid residues; SEQ ID NO:7 in the sequence table is flexible peptide (Gly4Ser), is made up of 5 amino-acid residues.
Specifically, described fusion rotein is one of following amino acid residue sequences:
1) the SEQ ID NO:8 in the sequence table;
2) the SEQ ID NO:9 in the sequence table;
3) the SEQ ID NO:10 in the sequence table;
4) with the amino acid residue sequence of SEQ ID NO:8-10 in the sequence table through replacement, disappearance or the interpolation of one to ten amino-acid residue and have in the anti-human erythrocyte surface H antigen and active protein.
SEQID NO:8 in the sequence table is made up of 244 amino-acid residues, from amino (N) end 1-117 position is the amino acid residue sequence of antibody 2E8 variable region of heavy chain, from aminoterminal 133-244 position is the amino acid residue sequence of antibody 2E8 variable region of light chain, is connection peptides (Gly4Ser) from aminoterminal 118-132 position
3Sequence will have the fusion rotein called after 2E8R3 of the described amino acid residue sequence of SEQ ID NO:8; SEQ ID NO:9 in the sequence table is made up of 239 amino-acid residues, from aminoterminal 1-117 position is the amino acid residue sequence of antibody 2E8 variable region of heavy chain, from aminoterminal 128-239 position is the amino acid residue sequence of antibody 2E8 variable region of light chain, is connection peptides (Gly4Ser) from aminoterminal 118-127 position
2Sequence will have the fusion rotein called after 2E8R2 of the described amino acid residue sequence of SEQ ID NO:9; SEQ ID NO.10 in the sequence table is made up of 234 amino-acid residues, from aminoterminal 1-117 position is the amino acid residue sequence of antibody 2E8 variable region of heavy chain, from aminoterminal 123-234 position is the amino acid residue sequence of antibody 2E8 variable region of light chain, from aminoterminal 118-122 position is connection peptides (Gly4Ser) sequence, will have the fusion rotein called after 2E8R1 of the described amino acid residue sequence of SEQ ID NO:10.
The encode gene of above-mentioned fusion rotein is one of following nucleotide sequence:
1) dna sequence dna of SEQ ID NO:11 in the sequence table;
2) dna sequence dna of SEQ ID NO:12 in the sequence table;
3) dna sequence dna of SEQ ID NO:13 in the sequence table;
4) dna sequence dna of SEQ ID NO:8-10 in the code sequence tabulation:
5) nucleotide sequence of the dna sequence dna hybridization that under the rigorous condition of height, can limit with the SEQ ID NO:11-13 in the sequence table.
The rigorous condition of described height for hybridization back with contain 0.1 * SSPE (or 0.1 * SSC), the solution of 0.1%SDS washes film under 65 ℃.
SEQ ID NO:11 in the sequence table is by 732 based compositions, its encoding sequence is from 5 ' end 1-732 bit base, coding has the protein of the amino acid residue sequence of SEQ ID NO:8 in the sequence table, from 5 ' end 1-351 bit base is the encoding sequence of antibody 2E8 variable region of heavy chain, from 5 ' end 397-732 bit base is the encoding sequence of antibody 2E8 variable region of light chain, is connection peptides (Gly4Ser) from 5 ' end 352-396 bit base
3Encoding sequence, will have the fusion gene called after 2E8R3 of the described nucleotide sequence of SEQ ID NO:11; SEQ ID NO:12 in the sequence table is by 717 based compositions, its encoding sequence is from 5 ' end 1-717 bit base, coding has the protein of the amino acid residue sequence of SEQ ID NO:9 in the sequence table, from 5 ' end 1-351 bit base is the encoding sequence of antibody 2E8 variable region of heavy chain, from 5 ' end 382-717 bit base is the encoding sequence of antibody 2E8 variable region of light chain, is connection peptides (Gly4Ser) from 5 ' end 352-381 bit base
2Encoding sequence, will have the fusion gene called after 2E8R2 of the described nucleotide sequence of SEQID NO:12; SEQID NO:13 in the sequence table is by 702 based compositions, its encoding sequence is from 5 ' end 1-702 bit base, coding has the protein of the amino acid residue sequence of SEQ ID NO:10 in the sequence table, from 5 ' end 1-351 bit base is the encoding sequence of antibody 2E8 variable region of heavy chain, from 5 ' end 367-702 bit base is the encoding sequence of antibody 2E8 variable region of light chain, from 5 ' end 352-366 bit base is the encoding sequence of connection peptides (Gly4Ser), will have the fusion gene called after 2E8R1 of the described nucleotide sequence of SEQ ID NO:13.
The expression vector that contains fusion gene 2E8R3 of the present invention, transgenic cell line and host bacterium also all belong to protection scope of the present invention.
Increase arbitrary segmental primer in the above-mentioned fusion gene to also within protection scope of the present invention.
The present invention also provides a kind of method that makes up above-mentioned fusion gene 2E8R3.
The construction process of above-mentioned fusion gene 2E8R3 provided by the present invention can may further comprise the steps:
1) plasmid with the variable region of heavy chain encoding gene that contains anti-human erythrocyte H antigen monoclonal antibody 2E8 is a template, under the right guiding of the primer that SEQ ID NO:14 and SEQ ID NO:15 form in by sequence table, the variable region of heavy chain encoding gene of pcr amplification anti-human erythrocyte H antigen monoclonal antibody 2E8;
2) plasmid with the variable region of light chain encoding gene that contains anti-human erythrocyte H antigen monoclonal antibody 2E8 is a template, under the right guiding of the primer that SEQ ID NO:16 and SEQ ID NO:17 form in by sequence table, the variable region of light chain encoding gene of pcr amplification anti-human erythrocyte H antigen monoclonal antibody 2E8;
3) with variable region of heavy chain encoding gene and the step 2 of the anti-human erythrocyte H antigen monoclonal antibody 2E8 of step 1) amplification) the variable region of light chain encoding gene of the anti-human erythrocyte H antigen monoclonal antibody 2E8 of amplification is template, under the right guiding of the primer that SEQ ID NO:14 and SEQ ID NO:17 form in by sequence table, carry out overlapping pcr amplification, obtain fusion gene.
In the construction process of above-mentioned fusion gene, SEQ ID NO:14 in the step 1) is by 37 based compositions, SEQ ID NO:15 is by 60 based compositions, and wherein, holding the 1-6 bit base from 5 ' among the SEQ ID NO:14 is restriction enzyme BamHI recognition site; The plasmid that contains the variable region of heavy chain encoding gene of anti-human erythrocyte H antigen monoclonal antibody 2E8 is pMD-18T-2E8Hchain.
Step 2) the SEQ ID NO:16 in is by 60 based compositions, and SEQ ID NO:17 is by 32 based compositions, and wherein, holding the 1-8 bit base from 5 ' among the SEQ ID NO:17 is restriction enzyme NheI recognition site; The plasmid that contains the variable region of light chain encoding gene of anti-human erythrocyte H antigen monoclonal antibody 2E8 is pMD-18T-2E8Lchain.
The present invention also provides a kind of method of expressing above-mentioned fusion rotein.
The above-mentioned fusion rotein method of expression provided by the present invention is that the recombinant expression vector that will contain above-mentioned fusion gene imports host cell, expresses obtaining fusion rotein.
Described host can be yeast, intestinal bacteria, mammalian cell, insect cell or Bacillus subtilus etc., is preferably intestinal bacteria.
Described intestinal bacteria can be E.coli JM109, E.coli HB101, E.coli Top10 or E.coli TG1 etc.Preferred E.coli TG1.
The carrier that sets out that is used to make up described expression of recombinant e. coli carrier can be at expression in escherichia coli expression of exogenous gene carrier, as pET-his or pUC-118 etc. for any one.
With pHenIX is that the set out expression of recombinant e. coli carrier of vector construction is pET-his-2E8ScFv3, pET-his-2E8ScFv2 or pET-his-2E8ScFv1.
Above-mentioned recombinant expression vector all can make up according to ordinary method.
Cultivation contains the substratum and the culture condition of the host cell of fusion gene of the present invention, all can be substratum and the culture condition of cultivating the host that sets out.
When described host is intestinal bacteria, need to use the IPTG abduction delivering, the final concentration of IPTG can be 0.8-1.2mmol/L.
The invention provides the monoclonal antibody of the anti-human erythrocyte surface H antigen of a strain of hybridoma strain CGMCC No.1942 and generation thereof, and by flexible peptide Gly4Ser, (Gly4Ser)
2Or (Gly4Ser)
3As linker, with the variable region of light chain of the monoclonal antibody of anti-human erythrocyte surface H antigen and the fusion rotein that variable region of heavy chain links together and obtains.The monoclonal antibody 2E8 that experiment showed, the anti-human erythrocyte surface H antigen that hybridoma cell strain CGMCC No.1942 produces has the height of tiring, high specificity, the widely distributed advantage of antigen.Flexible peptide Gly4Ser, (Gly4Ser)
2(Gly4Ser)
3Be easy to bending, thereby can make fusion rotein of the present invention correctly folding, and do not influence fusion rotein active calmodulin binding domain CaM separately.Experiment showed, the H antigen of this fusion rotein energy specific combination human erythrocyte surface; In addition, this fusion rotein also has the expression amount height, easy purifying, and with short production cycle, industrial scale is big, the advantage that preparation cost is low.Based on above-mentioned advantage, the present invention prepares the bi-functional molecule for next step with gene engineering research, and set up and lay a good foundation based on erythrocytic treatment and detection platform, will have bigger practical significance and wide application prospect at the medical science detection range.
Below in conjunction with specific embodiment the present invention is described in further detail.
Description of drawings
Fig. 1 is that the 2E8 monoclonal antibody of 5 ' RACE method amplification is light, the agarose gel electrophoresis detected result of heavy chain variable region gene
Fig. 2 is the agarose gel electrophoresis detected result of antigen-4 fusion protein gene 2E8R3
Fig. 3 is the SDS-PAGE electrophoresis detection result of fusion rotein 2E8R3
Fig. 4 is the Western Blot qualification result of fusion rotein 2E8R3
Fig. 5 is the fluoroscopic examination result of fusion rotein 2E8R3
Fig. 6 is that the competition of fusion rotein 2E8R3 suppresses detected result
Embodiment
Method therefor is ordinary method if no special instructions among the following embodiment, and concrete steps can be referring to " Molecular Cloning:A Laboratory Manual " (Sambrook, J., Russell, David W., Molecular Cloning:A Laboratory Manual, 3
RdEdition, 2001, NY, Cold SpringHarbor).All primers are synthetic to be finished by Beijing AudioCodes biotech firm with examining order.
The evaluation of the monoclonal antibody 2E8 of the acquisition of embodiment 1, hybridoma cell strain 2E8Z and the anti-human erythrocyte surface H antigen of generation thereof
The present inventor has prepared can produce the antigenic hybridoma cell strain of anti-human erythrocyte H, name is called 2E8Z, this cell strain was preserved in the China Committee for Culture Collection of Microorganisms common micro-organisms center of BeiJing ZhongGuanCun in 02 month on the 08th in 2007, deposit number is CGMCC No.1942, concrete construction process can be referring to document (Li Hui, Pan Jichun, Liu Zi, Liu Jinghan, Zhang Jingang.Anti-human erythrocyte membrane antigen non-aggegation type Study of Monoclonal Antibodies and CHARACTERISTICS IDENTIFICATION [J].Cell and molecular immunology magazine 2005,21 (4): 473-475).With the monoclonal antibody called after 2E8 that this cell strain produces, the agglutination titer of this monoclonal antibody is 1: 1024, the ascites agglutination titer reaches 1: 64 * and 10
6, subclass is IgGl, K chain.The antiglobulin blood clotting experiment showed, that the 2E8 monoclonal antibody aggegation time is 7s, and grumeleuse is greater than 1mm in the 3min
2Agglutination reaction does not take place in O type red corpuscle and 2E8 monoclonal antibody.2E8 monoclonal antibody and 11 kinds of (mouse, rat, cavy, rabbit, tame pig, miniature pig, ox, sheep, dog, monkey, horse) Mammals blood cells do not have the kind cross reaction.All uncorrelated with 8 (Rhhr, Kidd, MNSs, Duffy, Diego, KellLewis and P blood group antigen) blood group systems of people, 21 kinds of antigens.This monoclonal antibody can effectively combine with monokaryon, scavenger cell, and mediated leucocytes is engulfed, lysed erythrocyte, after complement combines, and activating complement, lysed erythrocyte.Above-mentioned experimental result shows that the monoclonal antibody 2E8 of the anti-human erythrocyte surface H antigen that hybridoma cell strain 2E8Z produces has the height of tiring, high specificity, the widely distributed characteristics of antigen.
The clone of embodiment 2,2E8 variable region of mab gene
With the variable region of heavy chain and the variable region of light chain encoding gene of following method clone 2E8 monoclonal antibody, detailed process may further comprise the steps:
One, extracts total RNA
Extract total RNA of the hybridoma cell strain 2E8Z CGMCC No.1942 of the produced anti-human erythrocyte surface H antigen that embodiment 1 obtains with the TRIzol test kit of Iinvitrogen and reference reagent box specification sheets.
Two, synthetic cDNA
The total RNA that obtains with step 1 is a template, oligo (dT)
15Be primer, with Invitrogen Corporation's Super Script
TM-II ThermoScript II is also carried out reverse transcription to specifications, and 50 μ L reaction systems and reaction conditions are: total RNA 10 μ L, ol igo (dT)
151 μ L, 2.5mmol/L dNTPs 4 μ L, under 65 ℃, hatch 5min, ice bath 5min is little centrifugal then, adds 5 * reverse transcription reaction damping fluid (available from Promega), 5 μ L again, (0.1mol/LDTT available from Invitrogen) 2 μ L, 1 μ L 40U/ μ L RNasin (available from Invitrogen), 42 ℃ of 2min add SuperScript then
TM-II 1 μ L mixing, 25 ℃ of 10min thereupon, 42 ℃ of 50min, 70 ℃ of 15min add 2U/ μ L RnaseH (available from Invitrogen) l μ L, 37 ℃ of 20min at last.
Three, the purifying of reverse transcription product
The 2.5mol/L ammonium acetate of 2 times of volumes of double usefulness and the reverse transcription product of 3 times of volume of ethanol settling steps two, to remove superfluous dNTPs and primer, the product of purifying can be directly used in pcr amplification.
Four, 5 ' RACE method clone variable region gene
With the variable region of heavy chain and the variable region of light chain encoding gene of 5 ' RACE method clone 2E8 monoclonal antibody, concrete grammar may further comprise the steps:
1, at the terminal purifying that adds PloyG tail and reaction product of synthetic cDNA
At the terminal PloyG tail that adds of the cDNA of step 3 purifying, reaction system and reaction conditions are: the cDNA 5 μ L of purifying, 5 * TdT damping fluid (available from Promega), 4 μ L, 100mmol/L dGTP (available from Promega) 2 μ L, TdT enzyme (Promega) 2 μ L, water is supplied reaction system to 20 μ L, reacts 60min down at 37 ℃.Reaction product with ethanol-ammonium acetate method (referring to " Molecular Cloning:A Laboratory Manual ") purifying band PloyG tail is settled to 20 μ L.
2,5 ' RACE amplification
At first, according to the variable region of heavy chain of antibody constant region design 5 ' RACE method amplification 2E8 monoclonal antibody and the primer of variable region of light chain encoding gene, primer sequence is as follows:
PloyC (5 ' end is shared primer): 5 '-CCCCCCCCCCCCCC-3 ';
V
H3 ' end primer (3 ' end primer of amplification variable region of heavy chain) V
RACEFOR: 5 '-ACTAGTACAATCCCCTGGGCACAAT-3 ';
V
L3 ' end primer (3 ' end primer of amplification variable region of light chain) V
RACEkFOR: 5 '-TCATGTCGACGGATCCAAGCTTCAAGAAGCACACACTGAGGCAC-3 '.
Then, be template with the cDNA of the band PloyG tail of step 1 purifying, at primer PloyC and V
RACEFORGuiding under the variable region of heavy chain encoding gene of pcr amplification 2E8 monoclonal antibody, at primer PloyC and V
RACEkFORGuiding under the variable region of light chain encoding gene of pcr amplification 2E8 monoclonal antibody; Reaction conditions is: 95 ℃ of pre-sex change 2min of elder generation; 94 ℃ of sex change 1min then, 57 ℃ of annealing 1min, 72 ℃ are extended 1min, totally 28 circulations; Last 72 ℃ are extended 10min.After reaction finishes, pcr amplification product is carried out 1% agarose gel electrophoresis to be detected, (swimming lane a is Marker to the result as shown in Figure 1, swimming lane b is the variable region of heavy chain encoding gene, swimming lane c is the variable region of light chain encoding gene), obtained the band of about 351bp and 336bp through amplification, reclaim this two dna fragmentations, and use DNA purification kit purifying to reclaim fragment available from Promega, to reclaim fragment again connects into respectively among the carrier pGEM-T (Promega company), to connect product transformed into escherichia coli DH5 α competent cell, with blue hickie method screening positive clone, the recombinant vectors that is contained 2E8 monoclonal antibody variable region of light chain amplified fragments and variable region of heavy chain amplified fragments respectively, the recombinant vectors called after pMD-18T-2E8Hchain that will contain 2E8 monoclonal antibody variable region of heavy chain amplified fragments will contain the recombinant vectors called after pMD-18T-2E8Lchain of 2E8 monoclonal antibody variable region of light chain amplified fragments.Recombinant vectors is checked order, sequencing result shows, the 2E8 monoclonal antibody variable region of heavy chain encoding sequence of amplification has the nucleotide sequence of SEQ ID NO:3 in the sequence table, by 351 based compositions, its encoding sequence is that coding has the protein of the amino acid residue sequence of SEQ ID NO:1 in the sequence table from 5 ' end the 1st to 351 bit base; The 2E8 monoclonal antibody variable region of light chain encoding sequence of amplification has the nucleotide sequence of SEQ ID NO:4 in the sequence table, by 336 based compositions, its encoding sequence is that coding has the protein of the amino acid residue sequence of SEQ ID NO:2 from 5 ' end the 1st to 336 bit base.Carry out sequence alignment through Blast, highest homology reaches 96% and 94% as a result, show the variable region of heavy chain and the variable region of light chain encoding gene of successfully having cloned the 2E8 monoclonal antibody, belong to the I of murine antibody variable region heavy chain gene family (B) subgroup and the I of light chain gene family subgroup.
The clone of embodiment 3, antigen-4 fusion protein gene 2E8R3 and contain the structure of the coli expression carrier of this fusion gene
One, the clone of antigen-4 fusion protein gene 2E8R3
Pass through flexible peptide (Gly4Ser) with following method clone
3The monoclonal antibody 2E8 variable region of heavy chain of the anti-human erythrocyte surface H antigen that the embodiment 2 that (SEQ ID NO:5 in the sequence table) connection obtains obtains and fusion rotein (called after 2E8R3) the gene 2E8R3 of variable region of light chain, detailed process may further comprise the steps:
1, design primer
Variable region of heavy chain and variable region of light chain encoding gene and flexible peptide (Gly4Ser) according to embodiment 2 clone's monoclonal antibody 2E8
3Encoding sequence design primer, primer sequence is as follows:
2E8H
BACKNEW(upstream primer): 5 '-
GgatccCaggtgcagttgaaggagtcagga-3 ' (SEQID NO:14, band underscore base is a restriction enzyme BamHI recognition site);
2E8H
FORNEW(downstream primer): 5 '-gccacccgacccaccaccgcccgagccaccgccacc tgcagagacagtgaccagagtccc-3 ' (SEQ ID NO:15);
2E8L
BACKNEW(upstream primer): 5 '-ggctcgggcggtggtgggtcgggtggcggcggatctgacattgtgatgacacagtc tcca-3 ' (SEQ ID NO:16);
2E8L
FORNEW(downstream primer): 5 '-
GctagcTatttccaactttgtccccgagcc-3 ' (SEQ ID NO:17, band underscore base is a restriction enzyme NheI recognition site).
2, pcr amplification
The recombinant plasmid pMD-18T-2E8Hchain that contains 2E8 monoclonal antibody variable region of heavy chain amplified fragments that makes up with embodiment 2 is a template, at primer 2 E8H
BACKNEWAnd 2E8H
FORNEWGuiding under the heavy chain variable region gene of pcr amplification 2E8, simultaneously, the recombinant plasmid pMD-18T-2E8Lchain that contains 2E8 monoclonal antibody variable region of light chain amplified fragments that makes up with embodiment 2 is a template, at primer 2 E8L
BACKNEWAnd 2E8L
FORNEWGuiding under the chain variable region gene of pcr amplification 2E8, reaction conditions is: 95 ℃ of pre-sex change 2min earlier; 94 ℃ of sex change 1min then, 57 ℃ of annealing 1min, 72 ℃ are extended 1min, totally 28 circulations; Last 72 ℃ are extended 10min.After reaction finishes, pcr amplification product is carried out 1% agarose gel electrophoresis detect, the result has obtained the big or small band that is about 387bp and 372bp respectively, conforms to expected results.Reclaim this two dna fragmentations, and use available from the DNA purification kit purifying of Promega and reclaim fragment, then two segmental recovery products are respectively got 2 μ L, and with separately each other primer carry out pcr amplification, reaction conditions is: 95 ℃ of pre-sex change 2min earlier; 94 ℃ of sex change 1min then, 57 ℃ of annealing 1min, 72 ℃ are extended 1min, totally 7 circulations; In reaction tubes, add 2 μ L primer 2 E8H again
BACKNEWAnd 2E8L
FORNEW, under the same terms (72 ℃ are extended 1min for 94 ℃ of sex change 1min, 57 ℃ of annealing 1min), carry out 28 circulations again, last 72 ℃ are extended 10min.After reaction finishes, pcr amplification product is carried out 1% agarose gel electrophoresis detect, the result is (swimming lane a is Marker, and swimming lane b is a pcr amplification product) as shown in Figure 2, has obtained the big or small dna fragmentation that is about 732bp through pcr amplification, conforms to expected results.Reclaim this dna fragmentation, and use DNA purification kit purifying to reclaim fragment available from Promega, connect in the pGEM-T carrier, to connect product transformed into escherichia coli DH5 α competent cell, with blue hickie method screening positive clone, the upgrading grain obtains containing the recombinant plasmid of antigen-4 fusion protein gene 2E8R3, called after pGEM-T-2E8R3.This plasmid is checked order, sequencing result shows the encoding gene that has obtained the correct fusion rotein 2E8R3 of sequence through aforesaid method amplification, this fusion gene has the nucleotide sequence of SEQ ID NO:11 in the sequence table, by 732 based compositions, its encoding sequence is from 5 ' end 1-732 bit base, coding has the protein of the amino acid residue sequence of SEQ ID NO:8 in the sequence table, from 5 ' end 1-351 bit base is the encoding sequence of antibody 2E8 variable region of heavy chain, from 5 ' end 397-732 bit base is the encoding sequence of antibody 2E8 variable region of light chain, is connection peptides (Gly4Ser) from 5 ' end 352-396 bit base
3Encoding sequence.
Two, the structure of the coli expression carrier of antigen-4 fusion protein gene 2E8R3
After the antigen-4 fusion protein gene 2E8R3 that step 1 is obtained carries out double digestion with restriction enzyme BamHI and NheI, with be connected through the carrier pET-his of same enzyme double digestion (brilliant U.S. biotechnology company limited), obtain the coli expression carrier of antigen-4 fusion protein gene 2E8R3, called after pET-his-2E8ScFv3.
The clone of embodiment 4, antigen-4 fusion protein gene 2E8R2 and contain the structure of the coli expression carrier of this fusion gene
One, the clone of antigen-4 fusion protein gene 2E8R2
Pass through flexible peptide (Gly4Ser) with following method clone
2The monoclonal antibody 2E8 variable region of heavy chain of the anti-human erythrocyte surface H antigen that the embodiment 2 that (SEQ ID NO:6) connection obtains obtains and fusion rotein (called after 2E8R2) the gene 2E8R2 of variable region of light chain, detailed process may further comprise the steps:
1, design primer
Variable region of heavy chain and variable region of light chain encoding gene and flexible peptide (Gly4Ser) according to embodiment 2 clone's monoclonal antibody 2E8
2Encoding sequence design primer, primer sequence is as follows:
2E8H2
BACKNEW(upstream primer): 5 '-
GgatccCaggtgcagttgaaggagtcagga-3 ' (SEQ ID NO:18, band underscore base is a restriction enzyme BamHI recognition site);
2E8H2
FORNEW(downstream primer): 5 '-gccacccgacccaccaccgcctgcagagacagtgaccagagtccc-3 ' (SEQ ID NO:19):
2E8L2
BACKNEW(upstream primer)
5-ggcggtggtgggtcgggtggcggcggatctgacattgtgatgacacagtctcca-3’(SEQ?ID?NO：20)；
2E8L2
FORNEW(downstream primer): 5 '-
GctagcTatttccaactttgtccccgagcc-3 ' (SEQ ID NO:21, band underscore base is a restriction enzyme NheI recognition site).
2, pcr amplification
The recombinant plasmid pMD-18T-2E8Hchain that contains 2E8 monoclonal antibody variable region of heavy chain amplified fragments that makes up with embodiment 2 is a template, at primer 2 E8H2
BACKNEWAnd 2E8H2
FORNEWGuiding under the heavy chain variable region gene of pcr amplification 2E8, simultaneously, the recombinant plasmid pMD-18T-2E8Lchain that contains 2E8 monoclonal antibody variable region of light chain amplified fragments that makes up with embodiment 2 is a template, at primer 2 E8L2
BACKNEWAnd 2E8L2
FORNEWGuiding under the chain variable region gene of pcr amplification 2E8, reaction conditions is identical with embodiment 3 corresponding steps.After reaction finishes, pcr amplification product is carried out 1% agarose gel electrophoresis detect, the result has obtained the big or small band that is about 372bp and 366bp respectively, conforms to expected results.Reclaim this two dna fragmentations, and use available from the DNA purification kit purifying of Promega and reclaim fragment, then two segmental recovery products are respectively got 2 μ L, and with separately each other primer carry out pcr amplification, reaction conditions is identical with embodiment 3 corresponding steps; In reaction tubes, add 2 μ L primer 2 E8H2 again
BACKNEWAnd 2E8L2
FORNEW, under identical cycling condition, carry out 28 circulations again, last 72 ℃ are extended 10min.After reaction finishes, pcr amplification product is carried out 1% agarose gel electrophoresis detect, the result has obtained the big or small dna fragmentation that is about 732bp through pcr amplification, conforms to expected results.Reclaim this dna fragmentation, and use available from the DNA of Promega company purification kit purifying and reclaim fragment, connect in the pGEM-T carrier, to connect product transformed into escherichia coli DH5 α competent cell, with blue hickie method screening positive clone, the upgrading grain obtains containing the recombinant plasmid of antigen-4 fusion protein gene 2E8R2, called after pGEM-T-2E8R2.This plasmid is checked order, sequencing result shows the encoding gene that has obtained the correct fusion rotein 2E8R2 of sequence through aforesaid method amplification, this fusion gene has the nucleotide sequence of SEQ ID NO:12 in the sequence table, by 717 based compositions, its encoding sequence is from 5 ' end 1-717 bit base, coding has the protein of the amino acid residue sequence of SEQ ID NO:9 in the sequence table, from 5 ' end 1-351 bit base is the encoding sequence of antibody 2E8 variable region of heavy chain, from 5 ' end 382-717 bit base is the encoding sequence of antibody 2E8 variable region of light chain, is connection peptides (Gly4Ser) from 5 ' end 352-381 bit base
2Encoding sequence.
Two, the structure of the coli expression carrier of antigen-4 fusion protein gene 2E8R2
After the antigen-4 fusion protein gene 2E8R2 that step 1 is obtained carries out double digestion with restriction enzyme BamHI and NheI, be connected with carrier pET-his through the same enzyme double digestion, obtain the coli expression carrier of antigen-4 fusion protein gene 2E8R2, called after pET-hi s-2E8ScFv2.
The clone of embodiment 5, antigen-4 fusion protein gene 2E8R1 and contain the structure of the coli expression carrier of this fusion gene
One, the clone of antigen-4 fusion protein gene 2E8R1
The monoclonal antibody 2E8 variable region of heavy chain of the anti-human erythrocyte surface H antigen that the embodiment 2 that obtains by flexible peptide (Gly4Ser) (SEQ ID NO:7) connection with following method clone obtains and fusion rotein (called after 2E8R1) the gene 2E8R1 of variable region of light chain, detailed process may further comprise the steps:
1, design primer
According to variable region of heavy chain and variable region of light chain encoding gene and flexible peptide (Gly4Ser) the encoding sequence design primer of embodiment 2 clone's monoclonal antibody 2E8, primer sequence is as follows:
2E8H1
BACKNEW(upstream primer): 5 '-
GgatccCaggtgcagttgaaggagtcagga-3 ' (SEQ ID NO:22, band underscore base is a restriction enzyme BamHI recognition site);
2E8Hl
FORNEW(downstream primer): 5 '-gtcagatccgccgccacctgcagagacagtgaccagagtccc-3 ' (SEQID NO:23:
2E8L1
BACKNEW(upstream primer): 5 '-tctgcaggtggcggcggatctgacattgtgatgacacagtctcca-3 ' (SEQ ID NO:24);
2E8L1
FORNEW(downstream primer): 5 '-
GctagcTatttccaactttgtccccgagcc-3 ' (SEQ ID NO:25, band underscore base is a restriction enzyme NheI recognition site).
2, pcr amplification
The recombinant plasmid pMD-18T-2E8Hchain that contains 2E8 monoclonal antibody variable region of heavy chain amplified fragments that makes up with embodiment 2 is a template, at primer 2 E8H1
BACKNEWAnd 2E8H1
FORNEWGuiding under the heavy chain variable region gene of pcr amplification 2E8, simultaneously, the recombinant plasmid pMD-18T-2E8Lchain that contains 2E8 monoclonal antibody variable region of light chain amplified fragments that makes up with embodiment 2 is a template, at primer 2 E8L1
BACKNEWAnd 2E8L1
FORNEWGuiding under the chain variable region gene of pcr amplification 2E8, reaction conditions is identical with embodiment 3 corresponding steps.After reaction finishes, pcr amplification product is carried out 1% agarose gel electrophoresis detect, the result has obtained the big or small band that is about 369bp and 357bp respectively, conforms to expected results.Reclaim this two dna fragmentations, and use DNA purification kit purifying to reclaim fragment available from Promega biotech firm, then two segmental recovery products are respectively got 2 μ L, and with separately each other primer carry out pcr amplification, reaction conditions is identical with embodiment 3 corresponding steps; In reaction tubes, add 2 μ L primer 2 E8H1 again
BACKNEWAnd 2E8L1
FORNEW, under identical cycling condition, carry out 28 circulations again, last 72 ℃ are extended 10min.After reaction finishes, pcr amplification product is carried out 1% agarose gel electrophoresis detect, the result has obtained the big or small dna fragmentation that is about 732bp through pcr amplification, conforms to expected results.Reclaim this dna fragmentation, and use DNA purification kit purifying to reclaim fragment available from Promega biotech firm, connect in the pGEM-T carrier, to connect product transformed into escherichia coli DH5 α competent cell, with blue hickie method screening positive clone, the upgrading grain obtains containing the recombinant plasmid of antigen-4 fusion protein gene 2E8R1, called after pGEM-T-2E8R1.This plasmid is checked order, sequencing result shows the encoding gene that has obtained the correct fusion rotein 2E8R1 of sequence through aforesaid method amplification, this fusion gene has the nucleotide sequence of SEQ ID NO:13 in the sequence table, by 702 based compositions, its encoding sequence is from 5 ' end 1-702 bit base, coding has the protein of the amino acid residue sequence of SEQ ID NO:10 in the sequence table, from 5 ' end 1-351 bit base is the encoding sequence of antibody 2E8 variable region of heavy chain, from 5 ' end 367-702 bit base is the encoding sequence of antibody 2E8 variable region of light chain, is the encoding sequence of connection peptides (Gly4Ser) from 5 ' end 352-366 bit base.
Two, the structure of the coli expression carrier of antigen-4 fusion protein gene 2E8R1
After the antigen-4 fusion protein gene 2E8R1 that step 1 is obtained carries out double digestion with restriction enzyme BamHI and NheI, be connected with carrier pET-his through the same enzyme double digestion, obtain the coli expression carrier of antigen-4 fusion protein gene 2E8R1, called after pET-his-2E8ScFv1.
Embodiment 6, Expression of Fusion Protein and activity identification thereof
One, Expression of Fusion Protein
Expression vector pET-his-2E8ScFv3 transformed into escherichia coli TG1 competent cell with embodiment 3 structures, with pET-his is contrast, the screening positive monoclonal, again with the single colony inoculation of the positive in 5mL 2YT substratum (peptone20g+yeast extract10g+NaCl 10g+100 μ g/mL ampicillin+1%glucose), in 37 ℃ of following overnight incubation (12-24 hour), then, get 2mL bacterium liquid, inoculate in the fresh 2YT substratum of 200mL, under 37 ℃, 250rpm, be cultured to OD
600, add IPTG (1mol/L) 200 μ L, inducing culture 16 hours under 30 ℃, 250rpm (sampling when being induced to the 8th, 16,20 hour) at=0.6 o'clock.After cultivating end, centrifugal collection thalline, add 5mL damping fluid (50mmol/L pH7.4PBS), ultrasonication is (after 0.5, centrifugal collection supernatant, cross 0.45 μ m filter membrane (newly changing purification device factory), join in batches, under 4 ℃, carry out purifying with reference to specification sheets with 5mL damping fluid pretreated nickel sepharose purification column (Beijing Zhuo Guan biotech company) available from Shanghai City.Albumen behind the purifying is dialysed with PBS liquid, cross 0.22 μ m filter membrane (newly changing purification device factory) available from Shanghai City, packing, frozen.
Then with method same as described above expression vector pET-his-2E8ScFv2 and pET-his-2E8ScFv1 difference transformed into escherichia coli TG1 competent cell with embodiment 4,5 structures, use same procedure abduction delivering and purifying again, and to purified expressing protein packing, frozen.
Two, the SDS-PAGE of expressing protein and Western Blot identify
1、SDS-PAGE
The albumen of step 1 expression and purifying is carried out the 12%SDS-PAGE electrophoresis detection, (swimming lane a is for transforming the expression product of the reorganization bacterium that the pET-his empty carrier is arranged as shown in Figure 3 wherein to transform the detected result of expression product of engineering bacteria of pET-his-2E8ScFv3, swimming lane b is for transforming the expression product of the engineering bacteria that pET-his-2E8ScFv3 is arranged, swimming lane c is Marker, swimming lane d is purified albumen), obtained the albumen that molecular weight is about 32KD through expression, conform to expected results, and the highest through 16 hours expressing quantities of abduction delivering.The engineering bacteria that transforms pET-his-2E8ScFv2 has obtained the albumen of 32KD through abduction delivering, and the engineering bacteria that transforms pET-his-2E8ScFv1 has obtained the albumen of 32KD through abduction delivering, all conforms to expected results.
2, Western Blot identifies
Step 1 expressed and the albumen of purifying carries out changeing behind the 12%SDS-PAGE electrophoresis film and carries out Western Blot and identify, used one anti-ly is anti-His monoclonal antibody (available from Puli's Lay biotech firm), and two anti-ly are sheep anti-mouse antibody (available from magnificent biotech firm).(swimming lane a is for transforming the expression product of the reorganization bacterium that the pET-his empty carrier is arranged as shown in Figure 4 wherein to transform the Western Blot detected result of expression product of engineering bacteria of pET-his-2E8ScFv3, swimming lane b is for transforming the expression product of the engineering bacteria that pET-his-2E8ScFv3 is arranged), show expressing protein can with anti-His monoclonal antibody specific combination, proof antigen-4 fusion protein gene 2E8R3 obtains correct the expression, has obtained by flexible peptide (Gly4Ser)
3The 2E8 monoclonal antibody variable region of heavy chain that connects and the fusion rotein 2E8R3 of variable region of light chain.
Transform pET-his-2E8ScFv2 and pET-his-2E8ScFv1 engineering bacteria expression product also can with anti-His monoclonal antibody specific combination, prove that antigen-4 fusion protein gene 2E8R2 and 2E8R1 also all obtain correct the expression, have obtained passing through respectively flexible peptide (Gly4Ser)
2(Gly4Ser) the fusion rotein 2E8R2 and the 2E8R1 of 2E8 monoclonal antibody variable region of heavy chain of Lian Jieing and variable region of light chain.
Three, the fluoroscopic examination of fusion rotein
Get 4 EP pipes, detector tube on the mark (3) and positive control pipe, add 4% red corpuscle 300 μ L respectively, each the 100 μ L (0.85mg/mL) of three kinds of fusion roteins with different connection peptides that in 3 detector tubes, add step 1 expression and purifying then respectively, add 2E8 monoclonal antibody (3.84mg/mL) in the positive control pipe, 4 pipes were hatched under 37 ℃ 1 hour, physiological saline washing with 0.9% 3 times, use the resuspended precipitation of 300 μ L physiological saline again, in detector tube, add an anti-(anti-His monoclonal antibody, available from Puli's Lay biotech firm), hatched 1 hour for 37 ℃ behind the mixing, the resuspended precipitation of 300 μ L physiological saline is used in physiological saline washing with 0.9% 3 times again, adds two anti-(FITC mark sheep anti-mouse antibodies in two pipes, available from magnificent biotech firm), hatched 1 hour for 37 ℃ behind the mixing, the physiological saline washing with 0.9% 3 times is observed under the fluorescence Electronic Speculum at last.Identical with positive controls, test set is visible green fluorescence also, wherein, the detected result of fusion rotein 2E8R3 as shown in Figure 5, above-mentioned experimental result shows the H epitope specific combination that three kinds of fusion roteins with different connection peptides of the present invention all can show with red corpuscle, has the biological activity identical with the 2E8 monoclonal antibody.
Four, the competition inhibition test of fusion rotein
Get the test tube of 4 10mL, detector tube (3) and control tube on the difference mark, add 5% red corpuscle 100 μ L respectively, the three kinds of fusion roteins (0.85mg/mL) that in 3 detector tubes, add step 1 expression and purifying then respectively with different connection peptides, hatched 1 hour for 37 ℃, in 4 pipes, add 2E8 monoclonal antibody (3.84mg/mL) more respectively, hatched 1 hour for 37 ℃; Take out test tube, add low ionic liquid (LIM, Dongyao Biologic Sci. ﹠ Tech. Co., Ltd.) 700 μ L respectively, mixing; In 4 pipes, add 2 polybrenes (available from Dongyao Biologic Sci. ﹠ Tech. Co., Ltd.) more respectively, mixing, the centrifugal 30s of 3400rpm, in every pipe, add 500 μ L dissociation solution (Resuspending again, Dongyao Biologic Sci. ﹠ Tech. Co., Ltd.), vibration 15s respectively gets 10 μ L and is laid on the slide, and opticmicroscope is observed down.The result has added the red corpuscle of three kinds of detection of fusion proteins groups of expression of the present invention and purifying under the effect of polybrene, agglutination phenomenon no longer appears, wherein, the detected result of fusion rotein 2E8R3 is (right figure is contrast) as shown in Figure 6, and agglutination phenomenon appears in the red corpuscle of control group, show the H epitope specific combination that three kinds of fusion roteins with different connection peptides of the present invention all can show with red corpuscle, have the biological activity identical with the 2E8 monoclonal antibody.
Sequence table
<160> 25
<210> 1
<211> 117
<212> PRT
＜213〉Mus mouse (Mus musculus)
<400> 1
Gln?Val?Gln?Leu?Lys?Glu?Set?Gly?Pro?Gly?Leu?Val?Ala?Pro?Ser?Gln
1 5 10 15
Ser?Leu?Ser?Ile?Thr?Cys?Thr?Val?Ser?Gly?Phe?Ser?Leu?Ser?Gly?Tyr
20 25 30
Ser?Val?His?Trp?Val?Arg?Gln?Pro?Pro?Gly?Lys?Gly?Leu?Glu?Trp?Leu
35 40 45
Gly?Met?Ile?Trp?Gly?Gly?Gly?Asn?Thr?Asp?Tyr?Lys?Ser?Ala?Leu?Lys
50 55 60
Ser?Arg?Leu?Thr?Ile?Ser?Lys?Asp?Asn?Ser?Arg?Ser?Gln?Val?Leu?Leu
65 70 75 80
Lys?Met?Asn?Ser?Leu?Gln?Ile?Asp?Asp?Thr?Ala?Ile?Tyr?Tyr?Cys?Ala
85 90 95
Arg?Asn?Tyr?Gly?Tyr?Ser?Pro?Phe?Val?His?Trp?Gly?Gln?Gly?Thr?Leu
100 105 110
Val?Thr?Val?Ser?Ala
115
<210> 2
<211> 112
<212> PRT
＜213〉Mus mouse (Mus musculus)
<400> 2
Asp?Ile?Val?Met?Thr?Gin?Ser?Pro?Ser?Ser?Leu?Ala?Met?Ser?Val?Gly
1 5 10 15
Gln?Lys?Val?Thr?Met?Ser?Cys?Lys?Ser?Ser?Gln?Ser?Leu?Leu?Asn?Ser
20 25 30
Asp?Asn?Gln?Lys?Asn?Tyr?Leu?Ala?Trp?Tyr?Gln?Gln?Lys?Pro?Gly?Gln
35 40 45
Ser?Pro?Lys?Leu?Leu?Val?Tyr?Phe?Ala?Ser?Ser?Arg?Glu?Ser?Gly?Val
50 55 60
Set?Asp?Arg?Phe?Ile?Gly?Ser?Gly?Set?Gly?Thr?Asp?Phe?Thr?Leu?Thr
65 70 75 80
Ile?Gly?Ser?Val?Gln?Ser?Glu?Asp?Leu?Ala?Tyr?Tyr?Phe?Cys?Gln?Gln
85 90 95
Leu?Tyr?Arg?Thr?Pro?Phe?Thr?Phe?Gly?Ser?Gly?Thr?Lys?Leu?Glu?Ile
100 105 110
<210> 3
<211> 351
<212> DNA
＜213〉Mus mouse (Mus musculus)
<400> 3
caggtgcagt?tgaaggagtc?aggacctggc?ctggtggctc?cctcacagag?cctgtccatc 60
acatgcactg?tctctggatt?ctcattatca?ggatatagtg?tacactgggt?tcgccagcct 120
ccaggaaagg?gtctggagtg?gctgggaatg?atatggggtg?gtggaaacac?agactataaa 180
tcagctctca?aatccagact?gaccattagt?aaggacaact?ccaggagcca?agttctctta 240
aaaatgaaca?gtctgcaaat?tgatgacaca?gccatttact?actgtgccag?aaattacgga 300
tatagtccgt?ttgttcactg?gggccaaggg?actctggtca?ctgtctctgc?a 351
<210> 4
<211> 336
<212> DNA
＜213〉Mus mouse (Mus musculus)
<400> 4
gacattgtga?tgacacagtc?tccatcctct?ctggctatgt?cagtaggaca?gaaggtcact 60
atgagctgca?agtccagtca?gagcctttta?aatagtgaca?atcaaaagaa?ctatttggcc 120
tggtaccagc?agaaaccagg?acagtctcct?aaacttctgg?tgtactttgc?atccagtagg 180
gaatcggggg?tgtctgatcg?gttcataggc?agtggctctg?ggacagattt?cactcttacc 240
atcggcagtg?tgcagtctga?agacctggca?tattacttct?gtcagcaact?ttatagaact 300
ccattcacgt?tcggctcggg?gacaaagttg?gaaata 336
<210> 5
<211> 15
<212> PRT
＜213〉artificial sequence
<220>
<223>
<400> 5
Gly?Gly?Gly?Gly?Ser?Gly?Gly?Gly?Gly?Ser?Gly?Gly?Gly?Gly?Ser
1 5 10 15
<210> 6
<211> 10
<212> PRT
＜213〉artificial sequence
<220>
<223>
<400> 6
Gly?Gly?Gly?Gly?Ser?Gly?Gly?Gly?Gly?Ser
1 5 10
<210> 7
<211> 5
<212> PRT
＜213〉artificial sequence
<220>
<223>
<400> 7
Gly?Gly?Gly?Gly?Ser
l 5
<210> 8
<211> 244
<212> PRT
＜213〉artificial sequence
<220>
<223>
<400> 8
Gln?Val?Gln?Leu?Lys?Glu?Ser?Gly?Pro?Gly?Leu?Val?Ala?Pro?Ser?Gln
1 5 10 15
Ser?Leu?Ser?Ile?Thr?Cys?Thr?Val?Ser?Gly?Phe?Ser?Leu?Ser?Gly?Tyr
20 25 30
Ser?Val?His?Trp?Val?Arg?Gln?Pro?Pro?Gly?Lys?Gly?Leu?Glu?Trp?Leu
35 40 45
Gly?Met?Ile?Trp?Gly?Gly?Gly?Asn?Thr?Asp?Tyr?Lys?Ser?Ala?Leu?Lys
50 55 60
Ser?Arg?Leu?Thr?Ile?Ser?Lys?Asp?Asn?Ser?Arg?Ser?Gln?Val?Leu?Leu
65 70 75 80
Lys?Met?Asn?Ser?Leu?Gln?Ile?Asp?Asp?Thr?Ala?Ile?Tyr?Tyr?Cys?Ala
85 90 95
Arg?Asn?Tyr?Gly?Tyr?Ser?Pro?Phe?Val?His?Trp?Gly?Gln?Gly?Thr?Leu
100 105 110
Val?Thr?Val?Ser?Ala?Gly?Gly?Gly?Gly?Ser?Gly?Gly?Gly?Gly?Ser?Gly
115 120 125
Gly?Gly?Gly?Ser?Asp?Ile?Val?Met?Thr?Gln?Ser?Pro?Ser?Ser?Leu?Ala
130 135 140
Met?Ser?Val?Gly?Gln?Lys?Val?Thr?Met?Ser?Cys?Lys?Ser?Ser?Gln?Ser
145 150 155 160
Leu?Leu?Asn?Ser?Asp?Asn?Gln?Lys?Asn?Tyr?Leu?Ala?Trp?Tyr?Gln?Gln
165 170 175
Lys?Pro?Gly?Gln?Ser?Pro?Lys?Leu?Leu?Val?Tyr?Phe?Ala?Ser?Ser?Arg
180 185 190
Glu?Ser?Gly?Val?Ser?Asp?Arg?Phe?Ile?Gly?Ser?Gly?Ser?Gly?Thr?Asp
195 200 205
Phe?Thr?Leu?Thr?Ile?Gly?Ser?Val?Gln?Ser?Glu?Asp?Leu?Ala?Tyr?Tyr
210 215 220
Phe?Cys?Gln?Gln?Leu?Tyr?Arg?Thr?Pro?Phe?Thr?Phe?Gly?Ser?Gly?Thr
225 230 235 240
Lys?Leu?Glu?Ile
<210> 9
<211> 239
<212> PRT
＜213〉artificial sequence
<220>
<223>
<400> 9
Gln?Val?Gln?Leu?Lys?Glu?Ser?Gly?Pro?Gly?Leu?Val?Ala?Pro?Ser?Gln
1 5 10 15
Ser?Leu?Ser?Ile?Thr?Cys?Thr?Val?Ser?Gly?Phe?Ser?Leu?Ser?Gly?Tyr
20 25 30
Ser?Val?His?Trp?Val?Arg?Gln?Pro?Pro?Gly?Lys?Gly?Leu?Glu?Trp?Leu
35 40 45
Gly?Met?Ile?Trp?Gly?Gly?Gly?Asn?Thr?Asp?Tyr?Lys?Ser?Ala?Leu?Lys
50 55 60
Ser?Arg?Leu?Thr?Ile?Ser?Lys?Asp?Asn?Ser?Arg?Ser?Gln?Val?Leu?Leu
65 70 75 80
Lys?Met?Asn?Ser?Leu?Gln?Ile?Asp?Asp?Thr?Ala?Ile?Tyr?Tyr?Cys?Ala
85 90 95
Arg?Asn?Tyr?Gly?Tyr?Ser?Pro?Phe?Val?His?Trp?Gly?Gln?Gly?Thr?Leu
100 105 llO
Val?Thr?Val?Ser?Ala?Gly?Gly?Gly?Gly?Ser?Gly?Gly?Gly?Gly?Ser?Asp
115 120 125
Ile?Val?Met?Thr?Gln?Ser?Pro?Ser?Ser?Leu?Ala?Met?Ser?Val?Gly?Gln
130 135 140
Lys?Val?Thr?Met?Ser?Cys?Lys?Ser?Ser?Gln?Ser?Leu?Leu?Asn?Ser?Asp
145 150 155 160
Asn?Gln?Lys?Asn?Tyr?Leu?Ala?Trp?Tyr?Gln?Gln?Lys?Pro?Gly?Gln?Ser
165 170 175
Pro?Lys?Leu?Leu?Val?Tyr?Phe?A1a?Ser?Ser?Arg?Glu?Ser?Gly?Val?Ser
180 185 190
Asp?Arg?Phe?Ile?Gly?Ser?Gly?Ser?Gly?Thr?Asp?Phe?Thr?Leu?Thr?Ile
195 200 205
Gly?Ser?Val?G1n?Ser?Glu?Asp?Leu?Ala?Tyr?Tyr?Phe?Cys?Gln?Gln?Leu
210 215 220
Tyr?Arg?Thr?Pro?Phe?Thr?Phe?G1y?Ser?Gly?Thr?Lys?Leu?Glu?Ile
225 230 235
<210> 10
<211> 234
<212> PRT
＜213〉artificial sequence
<220>
<223>
<400> 10
Gln?Val?Gln?Leu?Lys?Glu?Ser?Gly?Pro?G1y?Leu?Val?Ala?Pro?Ser?Gln
1 5 10 15
Ser?Leu?Ser?Ile?Thr?Cys?Thr?Val?Ser?Gly?Phe?Ser?Leu?Ser?Gly?Tyr
20 25 30
Ser?Val?His?Trp?Val?Arg?Gln?Pro?Pro?Gly?Lys?Gly?Leu?Glu?Trp?Leu
35 40 45
Gly?Met?Ile?Trp?Gly?Gly?Gly?Asn?Thr?Asp?Tyr?Lys?Ser?Ala?Leu?Lys
50 55 60
Ser?Arg?Leu?Thr?Ile?Ser?Lys?Asp?Asn?Ser?Arg?Ser?Gln?Val?Leu?Leu
65 70 75 80
Lys?Met?Asn?Ser?Leu?Gln?Ile?Asp?Asp?Thr?Ala?Ile?Tyr?Tyr?Cys?Ala
85 90 95
Arg?Asn?Tyr?Gly?Tyr?Ser?Pro?Phe?Val?His?Trp?Gly?Gln?Gly?Thr?Leu
100 105 110
Val?Thr?Val?Ser?Ala?Gly?Gly?Gly?Gly?Ser?Asp?Ile?Val?Met?Thr?Gln
115 120 125
Ser?Pro?Ser?Ser?Leu?Ala?Met?Ser?Val?Gly?Gln?Lys?Val?Thr?Met?Ser
130 135 140
Cys?Lys?Ser?Ser?Gln?Ser?Leu?Leu?Asn?Ser?Asp?Asn?Gln?Lys?Asn?Tyr
145 150 155 160
Leu?Ala?Trp?Tyr?Gln?Gln?Lys?Pro?Gly?Gln?Ser?Pro?Lys?Leu?Leu?Val
165 170 175
Tyr?Phe?Ala?Ser?Ser?Arg?Glu?Ser?Gly?Val?Ser?Asp?Arg?Phe?Ile?Gly
180 185 190
Ser?Gly?Ser?Gly?Thr?Asp?Phe?Thr?Leu?Thr?Ile?Gly?Ser?Val?Gln?Ser
195 200 205
Glu?Asp?Leu?Ala?Tyr?Tyr?Phe?Cys?Gln?Gln?Leu?Tyr?Arg?Thr?Pro?Phe
210 215 220
Thr?Phe?Gly?Ser?Gly?Thr?Lys?Leu?Glu?Ile
225 230
<210> 11
<211> 732
<212> DNA
＜213〉artificial sequence
<220>
<223>
<400> 11
caggtgcagt?tgaaggagtc?aggacctggc?ctggtggctc?cctcacagag?cctgtccatc 60
acatgcactg?tctctggatt?ctcattatca?ggatatagtg?tacactgggt?tcgccagcct 120
ccaggaaagg?gtctggagtg?gctgggaatg?atatggggtg?gtggaaacac?agactataaa 180
tcagctctca?aatccagact?gaccattagt?aaggacaact?ccaggagcca?agttctctta 240
aaaatgaaca?gtctgcaaat?tgatgacaca?gccatttact?actgtgccag?aaattacgga 300
tatagtccgt?ttgttcactg?gggccaaggg?actctggtca?ctgtctctgc?aggtggcggt 360
ggctcgggcg?gtggtgggtc?gggtggcggc?ggatctgaca?ttgtgatgac?acagtctcca 420
tcctctctgg?ctatgtcagt?aggacagaag?gtcactatga?gctgcaagtc?cagtcagagc 480
cttttaaata?gtgacaatca?aaagaactat?ttggcctggt?accagcagaa?accaggacag 540
tctcctaaac?ttctggtgta?ctttgcatcc?agtagggaat?cgggggtgtc?tgatcggttc 600
ataggcagtg?gctctgggac?agatttcact?cttaccatcg?gcagtgtgca?gtctgaagac 660
ctggcatatt?acttctgtca?gcaactttat?agaactccat?tcacgttcgg?ctcggggaca 720
aagttggaaa?ta 732
<210> 12
<211> 717
<212> DNA
＜213〉artificial sequence
<220>
<223>
<400> 12
caggtgcagt?tgaaggagtc?aggacctggc?ctggtggctc?cctcacagag?cctgtccatc 60
acatgcactg?tctctggatt?ctcattatca?ggatatagtg?tacactgggt?tcgccagcct 120
ccaggaaagg?gtctggagtg?gctgggaatg?atatggggtg?gtggaaacac?agactataaa 180
tcagctctca?aatccagact?gaccattagt?aaggacaact?ccaggagcca?agttctctta 240
aaaatgaaca?gtctgcaaat?tgatgacaca?gccatttact?actgtgccag?aaattacgga 300
tatagtccgt?ttgttcactg?gggccaaggg?actctggtca?ctgtctctgc?aggcggtggt 360
gggtcgggtg?gcggcggatc?tgacattgtg?atgacacagt?ctccatcctc?tctggctatg 420
tcagtaggac?agaaggtcac?tatgagctgc?aagtccagtc?agagcctttt?aaatagtgac 480
aatcaaaaga?actatttggc?ctggtaccag?cagaaaccag?gacagtctcc?taaacttctg 540
gtgtactttg?catccagtag?ggaatcgggg?gtgtctgatc?ggttcatagg?cagtggctct 600
gggacagatt?tcactcttac?catcggcagt?gtgcagtctg?aagacctggc?atattacttc 660
tgtcagcaac?tttatagaac?tccattcacg?ttcggctcgg?ggacaaagtt?ggaaata 717
<210> 13
<211> 702
<212> DNA
＜213〉artificial sequence
<220>
<223>
<400> 13
caggtgcagt?tgaaggagtc?aggacctggc?ctggtggctc?cctcacagag?cctgtccatc 60
acatgcactg?tctctggatt?ctcattatca?ggatatagtg?tacactgggt?tcgccagcct 120
ccaggaaagg?gtctggagtg?gctgggaatg?atatggggtg?gtggaaacac?agactataaa 180
tcagctctca?aatccagact?gaccattagt?aaggacaact?ccaggagcca?agttctctta 240
aaaatgaaca?gtctgcaaat?tgatgacaca?gccatttact?actgtgccag?aaattacgga 300
tatagtccgt?ttgttcactg?gggccaaggg?actctggtca?ctgtctctgc?aggtggcggc 360
ggatctgaca?ttgtgatgac?acagtctcca?tcctctctgg?ctatgtcagt?aggacagaag 420
gtcactatga?gctgcaagtc?cagtcagagc?cttttaaata?gtgacaatca?aaagaactat 480
ttggcctggt?accagcagaa?accaggacag?tctcctaaac?ttctggtgta?ctttgcatcc 540
agtagggaat?cgggggtgtc?tgatcggttc?ataggcagtg?gctctgggac?agatttcact 600
cttaccatcg?gcagtgtgca?gtctgaagac?ctggcatatt?acttctgtca?gcaactttat 660
agaactccat?tcacgttcgg?ctcggggaca?aagttggaaa?ta 702
<210> 14
<211> 37
<212> DNA
＜213〉artificial sequence
<220>
<223>
<400> 14
ggatcccagg?tgcagttgaa?ggagtcagga 30
<210> 15
<211> 60
<212> DNA
＜213〉artificial sequence
<220>
<223>
<400> 15
gccacccgac?ccaccaccgc?ccgagccacc?gccacctgca?gagacagtga?ccagagtccc 60
<210> 16
<211> 60
<212> DNA
＜213〉artificial sequence
<220>
<223>
<400> 16
ggctcgggcg?gtggtgggtc?gggtggcggc?ggatctgaca?ttgtgatgac?acagtctcca 60
<210> 17
<211> 32
<212> DNA
＜213〉artificial sequence
<220>
<223>
<400> 17
gctagcta?tttccaactt tgtccccgag?cc 30
<2lO> 18
<2ll> 37
<212> DNA
＜213〉artificial sequence
<220>
<223>
<400> 18
ggatcccagg?tgcagttgaa?ggagtcagga 30
<210> 19
<211> 45
<212> DNA
＜213〉artificial sequence
<220>
<223>
<400> 19
gccacccgac ccaccaccgc ctgcagagac?agtgaccaga?gtccc 45
<210> 20
<211> 54
<212> DNA
＜213〉artificial sequence
<220>
<223>
<400> 20
ggcggtggtg?ggtcgggtgg?cggcggatct?gacattgtga?tgacacagtc?tcca 54
<210> 21
<211> 32
<212> DNA
＜213〉artificial sequence
<220>
<223>
<400> 21
gctagcta?tttccaactt?tgtccccgag?cc 30
<210> 22
<211> 37
<212> DNA
＜213〉artificial sequence
<220>
<223>
<400> 22
ggatccgccc?aggtgcagtt?gaaggagtca?gga 33
<210> 23
<211> 42
<212> DNA
＜213〉artificial sequence
<220>
<223>
<400> 23
gtcagatccg?ccgccacctg?cagagacagt?gaccagagtc?cc 42
<210> 24
<211> 45
<212> DNA
＜213〉artificial sequence
<220>
<223>
<400> 24
tctgcaggtg?gcggcggatc?tgacattgtg?atgacacagt?ctcca 45
<2lO> 25
<211> 32
<212> DNA
＜213〉artificial sequence
<220>
<223>
<400> 25
gctagcta?tttccaactt?tgtccccgag?cc 32
Claims (10)
1. hybridoma cell strain 2E8Z CGMCC No.1942.
2. the monoclonal antibody of the anti-human erythrocyte surface H antigen that produces of the described hybridoma cell strain 2E8Z of claim 1 CGMCC No.1942; The variable region of heavy chain of described monoclonal antibody is the amino acid residue sequence that the SEQID NO:1 in the sequence table represents; Variable region of light chain is the amino acid residue sequence that the SEQ ID NO:2 in the sequence table represents.
3. the light chain and the heavy chain variable region gene of the monoclonal antibody of the anti-human erythrocyte surface H antigen that the described hybridoma cell strain 2E8Z of the claim 2 CGMCC No.1942 that encodes produces; The variable region of heavy chain encoding gene of described monoclonal antibody is the dna sequence dna that SEQ ID NO:3 represents in the sequence table; The variable region of light chain encoding gene is the dna sequence dna that SEQ ID NO:4 represents in the sequence table.
4. contain the monoclonal antibody heavy chain of the described anti-human erythrocyte surface H antigen of claim 3 and/or the expression vector of variable region of light chain encoding gene, transgenic cell line and host bacterium.
5. the variable region of heavy chain with the monoclonal antibody of the described anti-human erythrocyte surface H antigen of claim 2 is connected the fusion rotein that obtains with variable region of light chain; The variable region of heavy chain of the monoclonal antibody 2E8 of the anti-human erythrocyte surface H antigen in the described fusion rotein and variable region of light chain are by being that the flexible peptide of the amino acid residue sequence that SEQ ID NO:5, SEQ ID NO:6 or SEQ ID NO:7 represent in the sequence table is connected.
6. fusion rotein according to claim 5 is characterized in that: described fusion rotein is one of following amino acid residue sequences:
1) the SEQ ID NO:8 in the sequence table;
2) the SEQ ID NO:9 in the sequence table;
3) the SEQ ID NO:10 in the sequence table.
7. the gene of coding claim 6 described fusion rotein is one of following nucleotide sequence:
1) dna sequence dna of SEQ ID NO:11 in the sequence table;
2) dna sequence dna of SEQ ID NO:12 in the sequence table;
3) dna sequence dna of SEQ ID NO:13 in the sequence table.
8. the expression vector that contains the described fusion gene of claim 7, transgenic cell line and host bacterium.
9. method that makes up the described fusion gene of claim 7 may further comprise the steps:
1) plasmid with the variable region of heavy chain encoding gene that contains the described anti-human erythrocyte H of claim 3 antigen monoclonal antibody is a template, under the right guiding of the primer that SEQ ID NO:14 and SEQ ID NO:15 form in by sequence table, the variable region of heavy chain encoding gene of pcr amplification anti-human erythrocyte H antigen monoclonal antibody;
2) plasmid with the variable region of light chain encoding gene that contains the described anti-human erythrocyte H of claim 3 antigen monoclonal antibody is a template, under the right guiding of the primer that SEQ ID NO:16 and SEQ ID NO:17 form in by sequence table, the variable region of light chain encoding gene of pcr amplification anti-human erythrocyte H antigen monoclonal antibody;
3) with the variable region of heavy chain encoding gene and the step 2 of the anti-human erythrocyte H antigen monoclonal antibody of step 1) amplification) the variable region of light chain encoding gene of the anti-human erythrocyte H antigen monoclonal antibody of amplification is template, under the right guiding of the primer that SEQ ID NO:14 and SEQ ID NO:17 form in by sequence table, carry out overlapping pcr amplification, obtain fusion gene.
10. a method of expressing claim 5 or 6 described fusion roteins is that the recombinant expression vector that will contain the described fusion gene of claim 7 imports host cell, expresses obtaining fusion rotein.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200710063923 CN101037671B (en) | 2007-02-14 | 2007-02-14 | Hybridoma cell line and anti-human erythrocyte surface H antigen monoclonal antibodies generated thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200710063923 CN101037671B (en) | 2007-02-14 | 2007-02-14 | Hybridoma cell line and anti-human erythrocyte surface H antigen monoclonal antibodies generated thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101037671A CN101037671A (en) | 2007-09-19 |
| CN101037671B true CN101037671B (en) | 2010-07-07 |
Family
ID=38888845
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200710063923 Expired - Fee Related CN101037671B (en) | 2007-02-14 | 2007-02-14 | Hybridoma cell line and anti-human erythrocyte surface H antigen monoclonal antibodies generated thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101037671B (en) |
Families Citing this family (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP5501439B2 (en) | 2009-04-02 | 2014-05-21 | ロシュ グリクアート アクチェンゲゼルシャフト | Multispecific antibody comprising a full-length antibody and a single chain Fab fragment |
| WO2011034605A2 (en) * | 2009-09-16 | 2011-03-24 | Genentech, Inc. | Coiled coil and/or tether containing protein complexes and uses thereof |
| CN102146137B (en) * | 2010-02-05 | 2013-08-14 | 中国医学科学院基础医学研究所 | Antibody to beta-amyloid peptide and application thereof |
| TW201138821A (en) | 2010-03-26 | 2011-11-16 | Roche Glycart Ag | Bispecific antibodies |
| WO2012025530A1 (en) | 2010-08-24 | 2012-03-01 | F. Hoffmann-La Roche Ag | Bispecific antibodies comprising a disulfide stabilized - fv fragment |
| JP5766296B2 (en) | 2010-12-23 | 2015-08-19 | エフ．ホフマン−ラ ロシュ アーゲーＦ． Ｈｏｆｆｍａｎｎ−Ｌａ Ｒｏｃｈｅ Ａｋｔｉｅｎｇｅｓｅｌｌｓｃｈａｆｔ | Polypeptide-polynucleotide complexes and their use in targeted delivery of effector components |
| CN102492042B (en) * | 2011-12-22 | 2014-09-10 | 广西壮族自治区兽医研究所 | 3F3Rmg recombinant fusion protein and preparation method thereof and application thereof to detection of dog rabies antibody |
| ES2597228T3 (en) | 2012-06-27 | 2017-01-17 | F. Hoffmann-La Roche Ag | Procedure for the selection and production of objectification entities, such as targets, highly selective and multi-specific, customized, which contain at least two different binding entities, and use of these |
| WO2014001325A1 (en) | 2012-06-27 | 2014-01-03 | F. Hoffmann-La Roche Ag | Method for making antibody fc-region conjugates comprising at least one binding entity that specifically binds to a target and uses thereof |
| CN103724434B (en) * | 2013-12-27 | 2016-01-27 | 广西壮族自治区兽医研究所 | For recombinant protein that porcine reproductive and respiratory syndrome virus detects and its preparation method and application |
| PL3227332T3 (en) | 2014-12-03 | 2020-06-15 | F. Hoffmann-La Roche Ag | Multispecific antibodies |
| CN104788572B (en) * | 2015-04-23 | 2018-03-27 | 江苏省农业科学院 | For detecting PCV2 fusion protein, preparation method and application |
-
2007
- 2007-02-14 CN CN 200710063923 patent/CN101037671B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN101037671A (en) | 2007-09-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101037671B (en) | Hybridoma cell line and anti-human erythrocyte surface H antigen monoclonal antibodies generated thereof | |
| AU776464B2 (en) | Monoclonal antibodies, antigens and diagnosis and therapy of malignant diseases | |
| CN111378043B (en) | Human-mouse chimeric anti-Siglec-15 whole-molecule IgG with neutralization function and preparation method and application thereof | |
| CN109306005A (en) | A kind of Epstein-Barr virus specific T-cells antigen receptor and its application | |
| CN112480258B (en) | anti-CD 123 nano antibody and application thereof | |
| CN108359011B (en) | Target the antibody, preparation method and application of interleukin-17 A | |
| CN106519019A (en) | TCR for identifying PRAME antigen | |
| CN112048018B (en) | Chimeric T cell growth factor and application thereof | |
| CN110862457A (en) | Camel source nano antibody capable of being specifically combined with carbonic anhydrase IX and application thereof | |
| CN109609466A (en) | The anti-aspergillus granulose hybridoma cell strain of mouse, monoclonal antibody and application | |
| CN113527500B (en) | Fully human monoclonal antibody of glypican 3, chimeric antigen receptor and application thereof | |
| CN113461810B (en) | Fully human monoclonal antibody for resisting novel coronavirus spike protein and application thereof | |
| CN107964045B (en) | Human-mouse chimeric anti-CXCR 2 full-molecular IgG and application thereof | |
| CN112111013A (en) | Universal chimeric antigen receptor T cell targeting claudin18.2, construction method and application thereof | |
| WO2024056098A1 (en) | Nkg2d-nkp46 cell adapter molecule and use thereof | |
| CN108250293B (en) | anti-Ebola virus VP40 protein monoclonal antibody G7A6 and application thereof | |
| CN115947854A (en) | Anti-human CD40 protein monoclonal antibody, preparation method and application thereof | |
| CN100441689C (en) | EHEC 0157 shiga-like toxin IIA resisting subunit monoclonal antibody 5F3 light and heavy chain variable region gene and its application | |
| CN101475644B (en) | Novel targeted fusion protein with anti-inflammatory action and use thereof | |
| TW202241955A (en) | Garp protein antibody and application thereof | |
| CN113667015A (en) | Antibodies targeting PSGL-1 protein and uses thereof | |
| CN108424448B (en) | anti-Ebola virus VP40 protein monoclonal antibody F1B4 and application thereof | |
| CN107286238B (en) | Preparation, detection and the application of HCV-Ab IgG wide spectrum neutralizing antibody | |
| CN114957477B (en) | Pig RIG-I like receptor RIG-I specific monoclonal antibody and application | |
| CN110759975B (en) | Polypeptide, antibody with strong ADCC effect and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20100707 Termination date: 20170214 |