CH675728A5 - - Google Patents

Description

5

10th

15

20th

25th

30th

35

40

45

50

55

60

65

CH 675 728 A5

description

The present invention relates to compositions useful for the diagnosis, treatment and prevention of viral infections. The compositions contain monoclonal antibodies and peptides which are useful for the diagnosis, neutralization and vaccination against human immunodeficiency virus (HIV) infections.

The infectious agent responsible for the acquired immunodeficiency syndrome (AIDS) and its prodromal phases, the AIDS-related complex (ARC) and the lymphadenopathic syndrome (LAS) is a new lymphotropic retrovirus different from LAV, HTLV-III, ARV, and recently labeled HIV.

Since the prevalence of HIV has reached pandemic proportions, the treatment of infected individuals and the prevention of transmission to uninfected individuals who are at risk are of the utmost importance. A variety of therapeutic strategies have targeted various stages in the virus life cycle and are described in Mitsuya and Broder, 1987, Nature. 325: 773. One attempt involves the use of antibodies that bind the virus and inhibit viral replication either by preventing viral entry into host cells or by some other mechanism. Once the viral components that are sensitive to the antibody intervention are identified, it is hoped that antibody titres sufficient to neutralize the infectivity of the virus could be produced by vaccination or, alternatively, by passive administration of immunoglobulins or monoclonal antibodies of the desired specificity.

The envelope glycoproteins of most retroviruses are believed to react with receptor molecules on the surface of sensitive cells, whereby virus infectivity is determined for certain hosts. Antibodies bound to the glycoproteins can block the interaction of the virus with the cell receptors and neutralize the infectivity of the virus. Compare in general "The Molecular Biology of Tumor Viruses" 534 (J. Tooze, editor, 1973) and "RNA Tumor Vi-ruses", 226, 236 (R. Weiss et al., Editor, 1982), to which express reference is made becomes. See also, Gonzales-Scarano et al., 1982 "Virology" 120:42 (La Crosse Virus); Matsuno and Inouye, 1983, Infect. Imun. 39: 155 (neonatal calf diarrhea virus); and Mathews et ao., 1982, J. Im-munol., 129: 2763 (encephalomyelitis virus).

The general structure of HIV is that a ribonucleoprotein nucleus is surrounded by a lipid-containing envelope, which is created during growth by the membrane of the infected host cell. The virally encoded glycoproteins are embedded between the shell and the protruding external shape. The envelope glycoproteins of HIV are originally synthesized in the infected cell as a precursor molecule of 150,000 to 160,000 daltons (gp150 or gp160), which is then converted into an N-terminal fragment of 110,000 to 120,000 daltons in the cell (gpl 10 or gp120) is converted to form the external glycoprotein and a C-terminal fragment of 41,000 to 46,000 daltons (gp41), which is a membrane-penetrating envelope glycoprotein.

For the reasons discussed above, the gp110 glycoprotein of HIV has been the subject of much research as a potential target for disrupting the virus life cycle. Sera from HIV-infected individuals were able to "neutralize the HIV in vitro and antibodies that bind to the purified gp110 are present in the serum. Robert-Guroff et al., 1985, Nature 316: 72, Weiss et al., 1985, Nature 316: 69; and Mathews et al., 1986, Proc. Nati. Acad. Sci. USA. 83: 9709. Purified and recombinant gp110 stimulated the production of neutralizing serum antibodies when used to immunize animals, Robey et al., 1986, Proc. Nati. Acad. Sci. USA. 83: 7023; Lasky et al., 1986, Science 233: 209; and a human individual, Zagury et al., 1986, Nature 326: 249. Die Binding of the gp110 molecule to the CD4 (T4) receptor has also been detected and the monoclonal antibodies which recognize certain epitopes of the CD4 receptor block HIV binding, syncytia formation and infectivity. McDougal et al, 1986, Science 231: 382. Putney et al., (1986, Science 234: 1392) produced neutralizing serum antibodies after immunization with a recombinant fusion protein containing the carboxy-terminus half of the gp110 molecule, and it was further shown that the glycosylation of the coat protein is unnecessary for a neutralizing antibody reaction.

Accordingly, a subunit vaccine for AIDS using the HIV gp110 molecule or portions thereof may be desirable. Subunit vaccines are an alternative to vaccines made from inactivated or weakened viruses. Inactivated vaccines are troublesome because it is possible that not all viral particles are killed, and weakened viruses can have the ability to mutate and, in turn, acquire their disease-causing ability. With subunit vaccines only those parts of the virus that contain antigens or epitopes that can cause immune responses, i.e. Antibodies that can neutralize ADCC and cytotoxic T cell responses can be used to immunize hosts. A major advantage of subunit vaccines is that the irrelevant viral material is excluded.

Viral subunits for use in vaccines can be formed in a number of ways. For example, the envelope glycoprotein can be expressed and purified from a bacterial host, although this molecule lacks most of the post-translational changes (such as glycosylation or other methods). Such changes can be made using eukaryotic

2nd

CH 675 728 A5

Expression systems can be achieved, such as by yeast or cultured mammalian cells. Viral genes were introduced into mammalian cells using a vaccinia virus as a vector. See, for example, Mackett, M. et al., 1982, Proc. Nat. Acad. Be. USA 79: 7415; Panicali, D. and Paoletti, E., 1982, Proc. Nat. Acad. Be. USA 79: 4927. The recombinant vaccinia virus can be constructed according to the methods described in the following 5 publications: Hu et al., Nature 320: 537 (1986) or Chakrabarti et al., Nature 320: 535 (1986) which is expressly referred to. In these systems, viral glycoproteins which are produced by cells which are infected with recombinant vaccinia are expediently glycosylated and can be transported to the cell surface for squeezing and final isolation.

10 An important step in the manufacture of a subunit vaccine is the appropriate purification of the desired glycoprotein from the complex mixture of the expression system. Various methods of cleaning can be used. These include, for example, polyacrylamide gel electrophoresis, gel permeation chromatography and various chromatography methods (e.g. ion exchange, reverse phase, immunoaffinity, hydrophobic interaction) and others. Most of these methods are used in various combinations to obtain essentially pure preparations (Kleid, DG, et al., 1981, Science 214: 1125; Cabra-dilla, CD, et al., 1986, Biotechnoloav 4: 128; Dowbenko, DJ., 1985, Proc. Nat. Acad. Sci. USA 82: 7748), to which express reference is made.

There is a need for methods that reduce the number of steps required to maximize purification of a particular viral antigen from a complex expression mixture to produce subunit vaccines. The effective separation of the antigens from foreign components could be carried out using immunoaffinity chromatography. This technique, which is also known as immunoadsorption, consists in principle of the selective adsorption of an antigen on a solid support on which a specific antibody 25 is covalently bound. The selectively adsorbed antigens are then eluted from such an antibody affinity adsorbent by changing, for example the pH value and / or the ionic strength of the buffer.

Polyclonal antibodies which are obtained from animals immunized with the desired antigen or from naturally infected individuals (see for example Lasky et al., Supraì have often been used as Immu-30 noadsorbents, in general these reagents have significant disadvantages, like (I)) all of the antibodies bound to the insoluble carrier are specific for the molecule of interest and additional purifications are required; (II) the yields of the desired antigen are often low and (III) the antibody affinities often vary from one preparation to another, modifications in The use of 35 monoclonal antibodies specific for the desired viral antigen in the subunit drug formulations, in contrast to the polyclonal antibodies, could circumvent these difficulties.

Monoclonal mouse antibodies that bind HIV antigens have been described. Various research groups have described monoclonal antibodies which are specific for the p25 core protein (see, for example, Marzo Veronese, et al., 1985, Proc. Nat. Acad. Sci. USA 82: 5199 and Chas-sagne, J., et al., 1986, J. Immunol. 136: 1442). The monoclonal antibodies specific for the membrane glycoprotein gp41 have also been described (see e.g. di Marzo Veronese, et al., 1985, Science 229: 1402).

Accordingly, there remains a need in the art for monoclonal antibodies that are 45 specific to epitopes in well-defined regions of the major envelope glycoprotein gp110. Monoclonal antibodies that bind these regions and reduce or eliminate the replication and transmission capacity of HIV would have significant therapeutic and prophylactic utility. In addition, the monoclonal antibodies could also be used to purify the desired region of gp110 from smashed viruses or recombinant expression systems, for example for use in vaccines. In addition, the region containing one or more epitopes recognized by the monoclonal antibody could be chemically synthesized, avoiding the difficulties encountered in cleaning and administering larger fragments of gp110 molecules. The present invention fulfills these or similar needs.

55 Peptides are available which are capable of immunologically mimicking neutralized epitopes of HIV proteins, nucleic acid samples which encode such peptides and monoclonal antibodies which are reactive with such peptides and also other peptides which are associated with HIV infection. interact with each other. These new materials find e.g. in diagnostic tests for the detection of HIV infections and in therapeutic preparations for the treatment or vaccines 60 against such infections.

The present invention relates to novel compositions as defined in claim 1 for the neutralization of HIV infections, i.e. for the prevention or substantial inhibition of the formation or cellular transmission of infectious HIV in a host. It also relates to the peptides according to claim 19 which mimic a neutralizing region of HIV and monoclonal antibodies-65 per which are reactive with such a region and for the diagnosis, treatment and vaccination against

3rd

5

10th

15

20th

25th

30th

35

40

45

50

55

60

65

CH 675 728 A5

HIV infections can be used. In this regard, the term "neutralizing region" means those parts of HIV, in particular HIV proteins, which contain amino acid segments which define one or more epitopes which react with antibodies which are capable of HIV, either individually or in combination with other antibodies according to the invention Neutralize infections. Appropriate neutralization tests are well known and include, for example, the reduction of HIV infection in T cell lines, the reduction of plaque-forming units in VSV (HIV) pseudotypes that have the envelope glycoprotein of HIV, syncytial inhibition tests and virion receptor binding tests. As desired, the neutralizing activity can be compared to the antibody activity in immunochemical tests such as immunofluorescence, immunoblotting and radio-dioimmunoprecipitation test. In one aspect, the new peptides, which typically have less than about 50 amino acids, contain five or more contiguous amino acids that form epitopes that are substantially similar to epitopes in the neutralizing regions of HIV-gp110 or p25 that are present by the env or gaq areas of the HIV genome are encoded. Of particular interest are the regions that extend approximately from amino acid residue 301 to approximately 336 of gp110 and from approximately 278 to approximately 319 and from approximately 315 to approximately 363 of p25, all of which originate from the HIV strain called LAVbru. The amino acid residue designations come from the Los Alamos Data Bank (AIDS Virus sequence database, Los Alamos National Laboratory, Theoretical Division, Los Alamaos, NM 87545, USA).

Those skilled in the art will note that additional analog domains (homologs) of other HIV isolates can be identified based on their location in related proteins from different isolates. In practice, such homologues can be identified based on the LAVßRU sequence data as follows:

a) the amino acid sequences of HIV isolates and LAVbru can be arranged in order to obtain maximum homology between the two sequences;

b) the peptides which contain amino acid sequences of HIV isolates which correspond to the position of LAVßRU peptides that immunologically imitated LAVßRU proteins can be identified. The peptides identified in this way, which contain HIV isolate amino acid sequences, are typically immunologically clinical to corresponding HIV isolate proteins.

This method can be applied to strains of HIV that have not yet been discovered. For example, when new strains of HIV are discovered, the amino acid sequences of their shell and core can be arranged with that of LAVbru in order to obtain maximum homology. The methods for the sequence of the sequences are known to the person skilled in the art. When arranging the sequences, it is desirable to maintain as much homology as possible between the cysteine residues. The amino acid sequence of new HIV strains or species that correspond to the sites of the peptides specifically disclosed herein can be synthesized and used in accordance with the present invention.

Another method for determining sequences of a homologous region in other HIV strains is described by Scharf et al., Science (1986) 233: 1076. It uses two oligonucleotide primers that bind to two conserved sequences outside the region of interest and contains different restrictive sites in each primer. The DNA from HIV strains can then subsequently be amplified in vitro, wherein the oligonucleotides obtained can be cloned into vectors for sequence analysis and can be incorporated into a vaccine as a cassette which represents a special epitope of the HIV strain.

It is not necessary in the present invention that the epitopes contained in such sequences be cross-reactive with antibodies from all HIV strains or species. Peptides that include immunological epitopes that can distinguish one species or serogroup are used in the identification of particular species or serogroups and can be used to help identify individuals who are infected with one or more HIV species or serogroups. They can also be useful for combination with other peptides, either from a homologous region or from another neutralizing region, for the preparation of therapeutic compositions.

The peptides of interest can also be derived from the gp110 region of the virus. Of particular interest in this region are peptides which are encoded within the reading frame env, which extends from base pair (bp) 6667 to about 6774 on the LAVbru iso-lat. Accordingly, different homologous regions from other HIV isolates include the homologous sequences obtained from the Los Alamos database (exception LAV2) as listed in Table I.

Other useful peptides for the formation or screening of monoclonal antibodies include those encoded in the reading frame env from about bp 7246 to about 7317 by LAVbru. Such antibodies and reactive peptides are particularly useful for immunoassays.

4th

CH 675 728 A5

10th

15

Table I

HXB2 TGTACAAGACCCAACAACAATACAAGAAAAAGA ATCCGTATC

CysThrArgProAsnAsnAsnThrArgLysArg IleArglle 309

BH8 Lys 309

BRU —— - • ———— Ser— ~ ——— «- 314

MAL Gly ArgGly HisPhe 314

ELI —Aia -—— TyrGln— Gin— - ThrPro 310

WMJ2 Tyr —Val ArgSer— LeuSer 306

Z6 -—-— TyrLyB —GlnSer ThrPro 311

Z3 GlySerAspLysLyslle ——— GlnSer— 306

CDC42 His ValThrLeu 320

LAV2 Gly Lys Val Gin Met Leu 302

25 HXB2 CAGAGA GGACCAGGGAGAGCATTTGTTACAATAGGAAAAATAGGAAATATG

GlnArg ...: GlyProGlyArgAlaPheValThrlleGlyLysIleGlyAsnHet 326

HXB3 326

K9M 326

BRU ■: 331

MAL - ——Gin LeuTyr Thr IleVal Aspi le 329

ELI GlyLeu ... GlnSerLeuTyrThr Arg 'IleValSerArgSer 323

ARV2; His Thr Arg IleGlyAsp 327

WMJ2 —— Arg ArgUlu ... IleGlylle 320

RFENV: VallleTyrAlaThr Gin IleGlyAsp 337

Z6 GlyLeu ———— .. .GlnAlaLeuTyrThr Arg ArgThrLysIlelle 327

40 Z3 Argile ———— LysVal TyrAlaLys Gly 319

NY5 GlyPro ———..— ThrLeuTyrAlaArgGlu Asplle 320

CDC42 ValTrpTyr Thr Glu LeuGlyAsn 335

LAV2 MetSer—— —— HisVal — HisSerHisTyrGlnProIle — Lys 323

45

11XB2 ... AGA ... CAAGCACATTGT

... Arg ... GlnAlaHîsCys 331 BH102 331

HXB3 331

H9M 331

BRU 335

MAL Arg Tyr 334

55 tLI IlelleGly 330

ARV2 Ile Lys ... 333

WMJ2 Ile 326

RFENV Ile Lys ... 343

60 Z6 Gly ... 334

Z3 IleThrUly 326

CDC42 Ile 341

65 LAV2 ArgProArg —Met— 330

30th

35

50

5

5

10th

15

20th

25th

30th

35

40

45

50

55

60

65

CH 675 728 A5

In the qaa response of the LAVßRU isolate, the p15 amino acid sequences are from about 278 to 319 and 315 to 363 additional neutralizing regions of HIV. The person skilled in the art recognizes that additional neutralizing regions of HIV can be identified on the basis of the present teachings - in particular combinations of monoclonal antibodies which are reactive with different different HIV epitopes show a neutralizing activity.

Peptide I, also referred to as peptide 29, is encoded in the open reading frame env from approximately amino acid residue No. 308 to approximately 328 and has the following amino acid sequence, with oligopeptides which are included in the following sequence also including linear epitopes within such a sequence:

I (29)

Y-Thr-Arg-Ly s-Ser-Ile-Arg-1le-GIn-Arg-Gly-

Pro-Gly-Arg-Ala-Phe-Val-Thr-Ile-Gly-Lys-

Ile-y wherein Y and Y ', if present, each represent sequences of about 20 amino acids. If Y and / or Y 'are present, they may contain, for example, one or more amino acids from the sequences flanking amino acid residues 308 to 328 of the HIV envelope sequence or any part of these flanking sequences. For example, Y may contain all or part of the LAVbru shell amino acid sequence from about residues No. 301 to 307 and Y 'may contain all or parts of the LAVBRU envelope amino acid sequence from about residue No. 329 to 336, which is shown below:

II (29a)

Cys-Thr-Arg-pro-Asn-Asn-Asn-Thr-Arg-Lys-Ser-Ile-Arg-Ile-Gln-Arg-Gly-Pro-Gly-Arg-Ala-Phe-Val-Thr-Ile- Gly-Lys-Ile-Gly-Asn-Met-Arg-Gln-Ala-His-Cys.

Alternatively, garbled sequences of peptides of the present invention can be made. The following sequences from peptide 29 can be particularly useful in this regard:

III (29b)

Y-Thr-Arg-Lys-Ser-Ile-Arg-Ile-Gln-Arg-Gly-Pro-Gly-Y '

where Y and / or Y't, if present, each represent up to 20 amino acid residues.

IV (29c)

Y-Ile-Gln-Arg-Gly-Pro-Gly-Arg-Ala-Phe-Val-Thr-Ile-Gly-Lys-Ile-Y '

where Y and Y ', if present, each represent up to 20 amino acid residues.

In a further embodiment, homologous regions of the ARV-2 isolate of particular interest are encoded and possessed in the open reading frame from approximately amino acid residues 306 to approximately 323.

6

CH 675 728 A5

10th

25th

35

45

50

zen typically the following amino acid sequence, where oligopeptides included in the following amino acid sequence include linear epitopes of such a sequence:

V (177)

Y-Thr-Arg-Lys-Ser-Ile-Tyr-Ile-Gly-Pro-Gly-Arg-Ala-Phe-His-Thr-Thr-Gly-Arg-Ile-Y '

wherein Y and Y ', if present, each represent up to about 20 or more amino acid residues. If Y and / or Y 'are present, these may represent one or more amino acid residues from sequences ■ 15 which flank amino acid residues 306 to 323 of the ARV-2 shell sequence or any part of these flanking sequences. In particular, Y may include all or part of the HIV envelope amino sequence of the residual numbers from about 299 to 306; Y 'may contain all or part of the HIV envelope amino acid sequence from about residues No. 324 to 333.

Alternatively, mutilated sequences of peptide V can be made. In this regard, the following sequences can be particularly useful:

VI (177a)

Y-Thr-Arg-Lys-Ser-Ile-Tyr-Ile-Gly-Pro-Gly-Y1; and

30, VII

Y-Asp-Cys-Lys-Thr-Ile-Leu-Lys-Ala-Leu-Gly-Pro-Ala-Ala-Thr-Leu-Glu-Glu-Norleu-Norleu-Thr-Ala-

Cys-Yf

40 wherein Y and / or Y ', if present, each represent up to 20 or more amino acid residues.

Another example includes homologous regions of the LAV2 isolate, as is encoded in the open env reading frame by approximately the amino acid residues of the numbers 311 to 330 and typically has the following sequence:

VIII (110-2-2)

Y-Lys-Thr-Val-Lys-Ile-Nor-Leu-Nor-Ser-Gly-His-Val-Phe-His-Ser-His-Tyr-Gln-Pro-Y1

wherein Y and / or Y ', if present, each represent sequences of 20 or more amino acids (see Nature 326: 662 (1987), to which express reference is made).

55 In accordance with another aspect of the present invention, new cell lines capable of recognizing monoclonal antibodies and compositions containing such antibodies are provided, which antibodies are capable of selectively extremely high titers (from 102 to 104 to about 107 or more) neutralizing regions contained within a predetermined sequence of the envelope glycoprotein gp110 or p25, their protein precursors, biologically expressed, recombinant fusion proteins and synthetic peptides containing in or more epitopes within the predetermined sequence region of gp110 or p25 to determine. The major hybrid cells have an identifiable chromosome in which the germline DNA is rearranged to encode an antibody that has a binding center for an epitope on gp110 or p25 that is common to some or all of the clinical HIV isolates. These monoclonal antibodies can be used in a wide variety of procedures including diagnosis and therapy and also for

7

5

10th

15

20th

25th

30th

35

40

45

50

55

60

65

CH 675 728 A5

Identification of other cross-reactive antibodies, such as blocking antibodies. Peptides or polypeptides containing one or more epitopes with which they react can be used separately as immunogens for vaccines or as therapeutic agents.

Blocking Aspects

Primarily for use in conjugation with the above-described peptides or neutralizing monoclonal antibodies, the present invention embodies, as an embodiment, additional peptides or antibodies which interact with HIV binding to receptors to further mitigate HIV infectivity. Preferably, so-called "blocking peptides" which are capable of inhibiting virus proliferation, as well as monoclonal antibodies which are used on epitopes present in such blocking peptides, can be used to increase the effectiveness of treatments against HIV infections. HIV blocking peptides typically correspond to amino acid sequences of HIV, which are believed to be essential for virus binding to the host cell, such as the env-encoded amino acid residues of numbers from about 190 to about 197 of LAVbru and about 185 to about 192 of ARV2 and HTLVIII (BH-10). These include the peptide T-octapeptide (Ala-Ser-Thr-Thr-Thr-Asn-Tyr-Thr) and its numerous derivatives (e.g. IX below) and analogs (e.g. XI below) described by Pert et al., ( 1986, Proc. Nati. Acad. Sci. USA: 83: 9254-9258, to which express reference is made) which are present in the envelope glycoprotein (gp110 or 120).

For example, blocking peptides which have the following sequences are of particular interest, preferably with an acetylated NH2 terminus and an amidated COOH terminus:

IX (173D)

Y- ^ Ala-Ser-Thr-Thr-Thr-Asn-Tyr-Thr-Y ';

X (186)

Y-Thr-Thr-Asn-Tyr-Thr-Y1;

XI (187)

Y-Thr-Thr-Ser-Tyr-Thr-Y ';

XII (188)

Y-Thr-Asp-Asn-Tyr-Thr-Y ';

XIII (189) Y-Asn-Thr-Ser-Tyr-Gly-Y ';

XIV (190)

Y-Asp-Thr-Asn-Tyr-Ser-Y ';

XV (191)

Y-Ala-Val-Phe-Thr-Asp-Asn-Tyr-Thr-Y ';

wherein for each peptide Y and Y ', if present, each comprises an amino acid sequence up to about 20 amino acids. Epitopes or antigenic determinants within these peptides are typically defined by at least about five consecutive amino acids and are used, for example, in the mimicking of naturally occurring antigenic HIV sites, for the production of HIV-reactive antibodies and vaccines.

Formation of monoclonal antibodies

Monoclonal antibody production can be accomplished by immortalizing the expression of nucleic acid sequences encoding antibodies specific for HIV by introducing such sequences, typically cDNA encoding the antibody, into a host capable of in a Culture to be cultivated. The immortalized cell line can be a mammalian cell line that has been reshaped by oncogenesis, transvection, mutation, or the like. Such cells include myeloma lines, lymphoma lines, or other cell lines capable of ex-

8th

5

10th

15

20th

25th

30th

35

40

45

50

55

60

65

CH 675 728 A5

to support expression and secretion of the antibody in vitro. The antibody can be a naturally occurring immunoglobulin of a mammal which can be obtained by transforming a lymphocyte, in particular a splenocyte by means of a virus or by fusing the lymphocyte with a neoplastic cell, e.g. a myeloma, has been produced to obtain a hybrid cell line. Typically, the splenocyte is obtained from an animal that has been immunized against the HIV virus or a fragment thereof that contains an epitopic site.

The immunization protocols are well known and can be varied widely and still remain effective. Compare Goding, Monoclonal Antibodies: Principles and Practice. Academic Press, 2nd édition (1986), to which express reference is made. Smashed viruses, synthetic peptides and bacterial fusion proteins containing antigenic fragments of gp110 or p25 molecules can be used as immunogens. Preferably, the immunogen of the smashed virus, peptide or recombinant protein is enriched for proteins or fragments thereof which enrich the epitopes against which the antibody-producing B cells or splenocytes are desired. In particular, solutions containing smashed virus lysates or extracts or supernatants of biologically expressed recombinant proteins or smashed expression vectors can be enriched with glycoproteins, using purification methods such as polyacrylamide gel electrophoresis if desired. Lectin affinity purification is a preferred and common method for purifying gp110 and other glycoproteins, e.g. affinity purification using lens lectin. The extent to which the glycoproteins are purified from the solutions for use as an immunogen can vary in a wide range, e.g. less than 50% as usual or as desired at least 75 to 95% and preferably 95 to 99% to absolute homogeneity.

Once the proteins have been purified to the desired extent, they can be suspended or diluted in an appropriate physiological vehicle for immunization or they can be coupled to an ad juvans. A preferred technique includes, for example, adsorbing the protein and its fragments onto lentil lectin agarose or other macromolecular carriers for injection. The immunogens of antigenic preparations that are enriched in HIV proteins including gp110-glyco-protein and p25 core protein or antigenic portions thereof are generally injected in a concentration ranging from 1 ng to 20 mg / kg of the host. Administration can be by injection, e.g. intramuscularly, peritoneally, subcutaneously, intravenously etc. Administration can be carried out one or more times, usually at 1 to 4 week intervals. The immunized animals are tested for the production of the antibody against the desired antigen, then the spleen is removed and the B lymphocytes of the spleen are isolated and fused or transformed with a myeloma cell line. The transformation or fusion can be carried out in the usual way, the fusion technique is described in a large number of patents, e.g. in U.S. Patent Nos. 4,272,124, 4,350,683, 4,363,799, 4,381,292 and 4,423,147. Also compare Kennett et al., Monoclonal Antibodies (1980) and the references given therein, to which express reference is made here and Goding, supra.

The immortalized cell lines can be cloned and screened according to conventional techniques and the antibodies detected in the cell supernatants are capable of binding the desired gp110 or p25 HIV viral proteins, recombinant fusion proteins or synthetic peptides containing the desired epitopic region. The appropriate immortalized cell lines can then be grown in vitro or injected into the abdominal cavity of an appropriate host for the production of ascites fluid. By possessing some antibodies of the invention which are known to be specific for epitopes contained, for example in the regions encoded by the lavbru genomic region from bp6688 to bp6750 (encoding peptide 29) or from bp7246 to bp7317 (coding peptide 36) (bp numbering according to Wain-Hobson et al., Cell 44: 9, 1985, to which express reference is made), the supernatants can be screened in competition with the monoclonal antibodies according to the invention in a competition test . Accordingly, additional immortalized hybrid dom cell lines with the desired binding characteristics can easily be produced from a variety of sources based on the accessibility of the present antibodies which are specific for a particular antigen. Alternatively, these cell lines can be fused with other neoplastic B cells if other such B cells can serve as precipients for genomic DNA which encode the antibody.

While neopiastic B cells from rodents, especially mice, are preferred, other species of mammals can be used, such as rabbits, cattle, horses, pigs or birds. The immunization of these animals can be carried out easily and their lymphocytes, in particular splenocytes, can be obtained for fusions.

The monoclonal antibodies secreted by the transformed or hybridized cell lines can be of any class or subclass of immunoglobulins, such as IgM, IgD, IgA, IgG-i-4, or IgE. Because IgG is the most common isotype used in diagnostic tests, this is often preferred. The monoclonal antibodies can be used intact or as fragments such as Fv, Fab, F (ab ') 2, but usually intact.

9

5

10th

15

20th

25th

30th

35

40

45

50

55

60

65

CH 675 728 A5

To circumvent a possible antigenicity of a monoclonal antibody derived from an animal other than human in a human host, chimeric antibodies can be constructed in which the antigen binding fragment of an immunoglobulin molecule (variable region) with a peptide bond to at least part of another Protein is bound, which is not recognized by humans as a foreign protein, such as the ejected part of a human immunoglobulin molecule. This can be accomplished by fusing the variable region of an animal's exon with the kappa or gamma constant region of a human's exon. Various techniques are known to those skilled in the art, such as those described in PCT 86/01 533, EP 17 1496 and EP 173 494, to which express reference is made.

Pharmaceutical formulations and use

The monoclonal antibodies according to the invention which have a neutralizing activity, such as those which react with an epitopic site to gp11Q or p25, can also be used as components of pharmaceutical compositions for the attenuation of HIV infections. The compositions should contain a therapeutic or prophylactic amount of at least one of the monoclonal antibodies according to the invention with a pharmaceutically active carrier. A pharmaceutical carrier should be any compatible, nontoxic substance useful to deliver the monoclonal antibody to the patient. Sterile water, alcohol, fats, waxes and inert solids can be used as carriers. Pharmaceutically acceptable adjuvants (buffering agents, dispersing agents) can also be added to the pharmaceutical composition. Such compositions may contain a single monoclonal antibody, such as one that is specific for strains of HIV with envelope glycoproteins that contain an epitopic site within a region encoded by bp6688 to bp6750. Alternatively, a pharmaceutical composition may contain one or more monoclonal antibodies to form a cocktail. For example, a cocktail that would contain monoclonal antibodies to various strains of HIV would be a universal product with therapeutic or prophylactic activity against the vast majority of clinical HIV isolates. The cocktail may contain monoclonal antibodies that bind HIV proteins or glycoproteins other than gp110 or p25, such as to the gp41 glycoprotein or the p34 nucleus ease / integrase. The molar ratio of the various monoclonal antibody components normally does not differ by more than a factor of 10, usually by not more than a factor of 5, and they are usually present in a molar ratio of 1: 1-2 with respect to the other antibody components.

The antibodies according to the invention can be used as separately administered compositions which are administered in interaction with other anti-retroviral agents, for example blocking peptides. The current state of development of the anti-retroviral agents and anti-HIV agents in particular is described in Mitsuya et al., Nature 325: 773-778, 1987, to which express reference is made.

The monoclonal antibodies, peptides and pharmaceutical compositions according to the invention are particularly useful for oral or parenteral administration. Preferably the pharmaceutical compositions are administered parenterally, i.e. subcutaneously, intramuscularly or intravenously.

Accordingly, the present invention provides compositions for parenteral administration which comprise a solution of the monoclonal antibody, a peptide or a cocktail thereof, dissolved in a suitable carrier, preferably in an aqueous carrier. A variety of aqueous carriers can be used, e.g. Water, buffered water, 0.4% saline, 0.3% glycine and the like. These solutions are sterile and generally free of particulate matter. These compositions can be sterilized by conventional, well known sterilization techniques. The compositions may contain pharmaceutically acceptable auxiliary substances necessary to achieve approximately physiological conditions, such as pH adjusters and buffering agents, toxicity adjusting agents and the like, such as sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate, etc. The antibody concentration of these formulations can be in vary over a wide range. For example less than about 0.5%, usually at or at least about 1% up to 15 or 20% by weight and can be selected primarily based on the volume of the liquid, the viscosities, etc., which is preferably for the particular type of administration is selected.

Accordingly, a typical pharmaceutical composition for intramuscular injection could contain up to 1 ml of sterile buffered water and 50 mg of monoclonal antibodies. A typical composition for intravenous infusion may contain 250 ml of sterile Ringer's solution and 150 mg of monoclonal antibodies. Current methods for the preparation of parenterally administrable compositions are known or obvious to those skilled in the art and are detailed in, for example, Reminaton's Pharmaceutical Science. 15th edition, Mack Publishing Company, Easton, Pennsylvania (1980), to which express reference is made.

The monoclonal antibodies and peptides according to the invention can be used for

10th

CH 675 728 A5

Storage should be lyophilized and reconstituted in a suitable carrier before use. This technique has been found to be effective with conventional immunoglobulins and the lyophilization and reconstitution techniques known in the art can be used. It is generally known that lyophilization and reconstitution can lead to various degrees of loss of anti-body activity (e.g. with conventional immunoglobulins, IgM antibodies tend to lose more activity than IgG antibodies) and that the amounts used must be compensated accordingly.

The compositions which contain monoclonal antibodies, peptides or cocktails thereof according to the invention can be used for prophylactic and / or therapeutic treatments of HIV-10 infections. When used in therapy, the compositions are administered in sufficient quantity to a patient already infected with HIV in order to cure the infection and its complications or at least to bring it to a standstill. An appropriate amount to achieve this goal is defined as a "therapeutically effective dose". Amounts that are effective for this purpose depend on the severity of the infection and the general condition of the patient's immune system, but generally vary from 1 to 200 mg of antibody per kg of body weight at doses of 5 to 25 mg / kg Doses of 5 to 25 mg / kg are usually to be used. It must be remembered that materials according to the invention are generally to be used in serious conditions, i.e. in life-threatening or potentially life-threatening situations. In such cases it is possible and can be considered desirable by the attending physician to administer a substantial excess of these antibodies.

In prophylactic applications, compositions containing the subject peptides, antibodies, or a cocktail thereof can be administered to a patient who has not yet been infected with HIV, but who has recently been at risk or must be suspected of being at risk of viral infection. Suspension existed. This increases the patient's resistance to such a potential infection or he is vaccinated against the virus. Such an amount is called a "prophylactically effective dose". With this use, the exact amounts again depend on the patient's state of health and the general level of immunity, but generally vary from 0.1 to 25 mg / kg, in particular 0.5 to 2.5 mg / kg.

Single and multiple administrations of the compositions can be carried out with dose amounts and according to the pattern according to the choice of the treating doctor. In any case, the pharmaceutical formulations should provide a sufficient amount of antibodies according to the invention to enable an effective treatment of the patient.

In addition, the monoclonal antibodies according to the invention can also be used as target-specific carrier molecules. An antibody can be linked to a toxin to form an immunotoxin 35 or radioactive material or medicament, which are radiopharmaceutical or pharmaceutical agents. Methods for the production of immunotoxins and radiopharmaceutical agents are known (cf. for example Cancer Treatment Reports 68: 317 (1984)).

It is also possible that heteroaggregates of monoclonal antibodies according to the invention and human T cell activators, such as monoclonal antibodies against the CD3 antigen or against the 40 Fc gamma receptor of T cells, can be human T cells or Fc gamma-carrying cells (such as K cells or neutrophils) confer the ability to kill HIV-infected cells via antibody-dependent cell-mediated cytolysis (ADCC). Such heteroaggregates can be assembled, for example, by covalently crosslinking the anti-HIV antibodies with anti-CD3 antibodies, using the heterobifunctional reagent N-succinimidyi-3- (2-pyridyldithiol) propionate, as by 45 Karpowsky et al., in J Exo. Med. 160: 1686 (1984), to which express reference is made.

The peptide compositions according to the invention themselves can also find therapeutic use if their administration leads to a reduction or elimination of HIV in an infected host. These compositions, such as peptide 29, blocking peptides and pep-50 tid 126, can be administered intravenously, subcutaneously, intramuscularly, intraperitoneally, etc. in a convenient physiological vehicle. Peptide 126 is disclosed in US application SN 930 785. Various carriers include phosphate buffered saline, saline, water, potassium chloride, sodium lactate, or the like. The concentration of the peptides can vary widely, depending on their target use, activity and route of administration. Preferably, the 55 peptides have an amidated COH terminus, a formated NH2 terminus, or other pharmaceutically acceptable modifications. The addition of blocking peptides to the peptides which mimic a neutralizing HIV region or to the specifically reactive antibodies according to the invention leads to a considerably increased therapeutic effectiveness. Other anti-HIV agents can also be incorporated into the formulations (other than monoclonal antibodies that bind the 60 peptides), such as 3'-azido-3'-deoxythymidine, 2 ', 3'-dideoxycytidine, 2', 3 ' -Dideoxy-2 ', 3'-didehy-drocytidine etc.

65

11

5

10th

15

20th

25th

30th

35

40

45

50

55

60

65

CH 675 728 A5

Use of monoclonal antibodies in immunoaffinity reiniauna

Monoclonal antibodies which are specific for polypeptides containing gp119 or antigenic determinants, especially those antigenic determinants which are obtained from biologically ex-primed, recombinant fusion proteins, lysates or extracts from cultured HIV, are particularly advantageous for use in purification processes. In general, the antibodies have affinity association constants on the order of 108-1012 M. Such antibodies can be used to purify recombinant fusion proteins from the culture medium of the recombinant expression system if the expressed protein has been excreted, or of components of disrupted biological expression systems if that expressed protein was not secreted. In general, the monoclonal antibodies that are capable of reacting with gp110 or other antigenic determinants are bound or immobilized on substrates or supports. The solution containing the HIV antigenic determinants is then contacted with the immobilized antibody under conditions which are appropriate for the formation of the immune complex between the antibody and the polypeptides containing the antigenic determinants of gp110. Unbound material is separated from the bound immunocomplexes, with complexes or antigenic gp110 fragments being separated from the support.

Typically, the monoclonal antibodies are subjected to a coarse cleaning of ascites fluid or culture supernatants before they are bound to the support. Such methods are well known to those skilled in the art and can include fractionation with neutral salts at high concentration. Other methods, such as DEAE chromatography, gel filtration chromatography, preparative gel electrophoresis or affinity chromatography with protein A affinity chromatography, can also be used to purify the monoclonal antibodies prior to their use as an immunoadsorbent.

The carriers with which the monoclonal antibodies are immobilized should have the following general characteristics: a) weak interactions with proteins, generally in order to minimize non-specific binding, b) good flow characteristics which allow the flow through a material of high molecular weight , c) the support should have chemical groups which can be activated or modified to enable chemical bonds with the monoclonal antibody, d) physical and chemical stability under the conditions for binding the monoclonal antibody and e) stability against the conditions and Components of the buffer, which is required for the adsorption and elution of the antigen. Some commonly used carriers are agarose, derived polystyrenes, polysaccharides, polyacrylamide beads, activated cellulose, glass and the like. There are various chemical methods for binding antibodies to substrates. See in general, Cuatrecasas, P., Advances in Enzvmoloov 36: 29 (1972). The antibodies according to the invention can be connected directly to the support or alternatively via a “linker” or spacer arm.

The general conditions required for the immobilization of monoclonal antibodies as chromatography supports are known in the art. See, for example, Tijssen, P., 1985, Practice and Theorv of Enzvme Immunoassav. express reference is made to soft publication. Modern coupling methods are slightly dependent on the characteristics and the type of antibody to be coupled. Monoclonal antibodies have characteristics that are generally constant from batch to batch, and it is possible to optimize the conditions. The binding is typically done by covalent bonds.

A suspension of extracts or lysates of the HIV virus from the supernatant of a cultured biological expression system or a suspension of smashed cells is then added to the separation matrix. The mixture is incubated under conditions and sufficient time for the immune complex to form, which usually takes at least 30 minutes and usually 2 to 24 hours. The immune complexes which the polypeptides have with the antigenic parts of gp110 are then separated from the mixture. Typically the mixture is removed e.g. adsorption buffers are washed thoroughly by elution and the bound immune complexes. The immune complexes can then be washed out of the separation matrix using an eluent which is compatible with the supports used; the eluents are well known to those skilled in the art. The polypeptides containing the gp110 or other antigenic parts can also be selectively removed. For example, peptides containing an epitope recognized by the antibodies can be used in competition with the antibody binding center, which is an alternative elution technique that can be performed under mild elution conditions. The selectively adsorbed polypeptides containing the gp110 antigen can be eluted from anti-body affinity adsorbent by changing the pH and / or the ionic strength of the buffer. Chaotropic agents can also be used to remove the bound antigens. The selection of the chaotropic agent, its concentration, and other elution conditions depend on the characteristics of the antibody-antigen interaction, but once determined, they do not need to undergo any changes that are commonly required in polyclonal affinity separation systems.

12

5

10th

15

20th

25th

30th

35

40

45

50

55

60

65

CH 675 728 A5

The eluted material may require adjustment to a physiological pH if buffers of low or high pH or ionic strength are used to separate the bound gp110 antigen from the separation matrix. Dialysis or gel filtration chromatography may be required to remove excess salts in the eluent to allow the gp110 or the polypeptide-containing antigenic fragments of gp110 to be reconstituted into their natural structure.

Antigenic fragments thereof containing gp110 or polypeptide can be produced in a substantially pure form either naturally by infected cell cultures or by recombinant expression systems of bacteria, yeast or cultured insect or mammalian cells. gp110 and fragments or other purified proteins can typically have a purity of more than 50%, mostly at least 75% and most often between 95 and 99%. These molecules are then used in a wide range.

The HIV gp110 proteins, polypeptides containing antigenic fragments thereof or other proteins, can find wide use, including in AiDS subunit vaccine formulations, wherein the immunogen has an effective dose of an antigenic determinant such as gp110 or a neutralizing region thereof. Other components for formulations may include these antigenic portions of HIV proteins or glycoproteins that cause the production of antibodies (preferably neutralizing antibodies) in an immunized host, which antibodies are able to protect against subsequent HIV infection.

Diagnostic uses of monoclonal antibodies

The monoclonal antibodies according to the invention are useful for diagnostic purposes. For these purposes, they can either be marked or unmarked. Typically, diagnostic tests result in the detection of the formation of a complex by binding the monoclonal antibody to the HIV antigen. In the unlabelled state, the antibodies are used, for example, in agglutination tests. In addition, the unlabeled antibodies can be used in combination with other labeled antibodies (second antibodies) that are used with the monoclonal antibodies, such as antibodies that are specific for immunoglobulin. Alternatively, the monoclonal antibodies can be labeled directly. A variety of labels can be used, such as radionuclides, fluorescers, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, ligands (especially haptens), etc. Numerous types of immunoassays are available, and for example, some are described in U.S. Patent No. 3 817 827; 3,850,752; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; and 4,098,876, which patents are expressly incorporated by reference.

The monoclonal antibodies and peptides according to the invention are usually used in enzyme immunoassays, in which, for example, the main antibodies or the second antibodies of various types are conjugated to an enzyme. If a biological sample which contains HIV antigens, such as human blood serum, saliva, semen, vaginal secretions or virally infected cell culture suspensions, is combined with the antibodies according to the invention, a binding takes place between the antibodies and those molecules which have the desired epitope. Such proteins or viral particles can then be separated from the unbound reagents and a second antibody (enzyme labeled) can be added. The presence of the antibody-enzyme conjugate, which is specifically bound to the antigen, is then determined. Other conventional techniques known to those skilled in the art can also be used.

Equipment can also be provided for the use of the antibodies according to the invention for the detection of HIV infections or the presence of HIV antigens. Accordingly, antibody compositions of the invention are provided, usually in lyophilized form, either alone or in conjugation with antibodies specific for other HIV epitopes. The antibodies, which can be conjugated or unconjugated with a label, are present in the equipment together with buffers such as tris, phosphate or carbonate, stabilizers, biocides, inert proteins such as bovine serum albumin or the like. Generally, these materials are present in an amount less than 5% by weight based on the active antibody and usually in a total amount of at least about 0.001% by weight based on the antibody concentration. It is often desirable to add an inert excipient or an excipient to dilute the active ingredients, it being possible for the excipient to be present in a proportion of 1-99% by weight of the total composition. If a second antibody is used which is capable of binding the monoclonal antibody, this is usually present in a separate ampoule. The second antibody is typically conjugated to a label and formulated in an analogous manner to the antibody formulations described above. The detection of gp110 or p25 antigens or of the entire virus in various biological samples can be used in the diagnosis of an ongoing infection by the HIV virus. Biological samples can include, for example, blood serum, saliva, semen, tissue biopsy samples (brain, skin, lymph nodes, spleen, etc.), cell culture supernatants, smashed, eukaryotic and bacterial expression systems and the like. The presence of the virus is tested by the mo-

13

5

10th

15

20th

25th

30th

35

40

45

50

55

60

65

CH 675 728 A5

noclonal antibodies are incubated with the biological sample under conditions for immune complex formation and the complex formation is subsequently detected. In one embodiment, complex formation is detected using a second antibody that is capable of binding the monoclonal antibody, which is typically conjugated to a label and is formulated in a manner analogous to the antibody formulations described above. In a further embodiment, the monoclonal antibody is bound to a solid phase support, which is then brought into contact with the biological sample. Following the incubation step, a labeled, monoclonal antibody is added to detect the bound antigen.

Production and use of synthetic peptides

The present invention provides new peptides which are, inter alia, immunological mimic protein epitopes which are encoded by the HIV retrovirus, in particular epitopes which are encoded within the env or oaq regions of the viral genome which encode the gp110 or p25 coded. For strain-to-strain variant accommodation among different isolates, settings for conservative substitutions and selections from the alternatives in which non-conservative substitutions are involved can be made. These peptides can be used as immunogens to inhibit or eliminate HIV antigen production in vitro or in vivo, for the detection of the virus or from the antibody to the virus in a physiological sample. Depending on the nature of the experimental set-up, the peptides can be conjugated to a carrier or to other compounds, labeled or unlabeled or bound to a solid surface.

In one embodiment, the peptides of interest can be derived from the gp110 region of the virus. Of particular interest is the region in which the open env reading frame extends from about base pair (bp) 6688 to about bp 6750 and from about bp7247 to about 7317.

The peptides of interest, including the blocking peptides, include at least five, sometimes six, sometimes eight, sometimes twelve, sometimes 21, and usually less than 50, and most usually less than 35, and preferably less than 25, amino acids within a sequence which is characterized by an HIV retrovirus is encoded. It is desirable that the peptide be as small as possible and still have all of the immunoreactivity or anti-viral activity of the larger peptide. In some cases, it is desirable to add two or more oligopeptides that are not overlapping to form a single peptide structure or to use them simultaneously as individual peptides, separately or together, providing equivalent sensitivity to that of the original peptide.

The peptides can be modified by introducing conservative or non-conservative substitutions in the peptide, usually less than 20 number percent and usually less than 10 number percent of the amino acids are unchanged. In these situations where regions have been found to be polymorphic, it is desirable to vary one or more particular amino acids in order to achieve a more effective mimicking of the different epitopes of the different retro-viral strains. In many cases, norleucine (Nor) can be replaced to achieve chemical stability of methionine. '

It is pointed out that the peptide which is the subject of the present invention need not be identical to a special HIV polypeptide sequence as long as the compound according to the invention is able to compete immunologically with proteins, at least one of which is from the strain of HIV Is retrovirus. Accordingly, numerous changes can be made in the peptide according to the invention, such as insertions, deletions and substitutions, either conservative or non-conservative, in which such changes can bring certain advantages when used. Conservative substitutions mean substitutions within, for example, the following groups: gly, ala; val, ile, leu; asp, glu; asn, gin; ser, thr; lys, arg; phe, tyr; and nor, met. Usually the sequence differs by no more than 20% from the sequence of at least one HIV retrovirus strain, with the exception of where additional amino acids are attached to one of the termini to provide an "arm" through which the peptide according to the invention is can be immobilized in a conventional manner. The arms usually consist of at least one amino acid and can contain up to 50 or more amino acids, but most of the time they are 1 to 10 amino acids in length.

The peptides in which the amino acid sequence is modified by substitution, addition or deletion of amino acid residues should have substantially all of the immunoreactivity or antiviral activity of the unmodified peptide, which can be conventionally measured by the various assay techniques disclosed herein. The d-isomer form of one or more amino acids can, if desired, be used to modify biological properties, such as activity or degree of degradation.

In addition, one, two, or three amino acids can be added to the termini of an oligopeptide or peptide so that the peptides can be more easily linked together for coupling to a carrier or a larger peptide, for reasons discussed below for changing physical or chemical properties of the peptide or oligopeptide or the like.

14

5

10th

15

20th

25th

30th

35

40

45

50

55

60

65

CH 675 728 A5

Amino acids such as tyrosine, cysteine, lysine, glutamic or aspartic acid or the like can be coupled at the C or N terminus of the peptide or oligopeptide to provide useful functionality for a compound. Cysteine is particularly preferred to facilitate covalent coupling with other peptides or to form polymers by oxidation.

In addition, the peptide or oligopeptide sequences can be different from the natural sequence, in that the sequence by terminal NH2 acylation, for example by acetylation or thio-glycolic acid amidation, terminal carboxyamidation, e.g. with ammonia or methylamine, for imparting stability, increased hydrophobicity for the connection or the binding to a support or to another molecule or for the polymerization.

For example, when Y or Y 'is present in the peptides I-VIII and IX-XV disclosed above, a preferred embodiment is present when Y or Y' contains one or more cysteine residues or a combination of one or more cysteine residues with spacer amino acids. Glycine is a particularly preferred spacer. Preferred peptides for use in oxidative polymerization are those wherein Y or Y 'are at least two cysteine residues. If there are two cysteine residues at the same end of the peptide, a preferred embodiment exists if the cysteine residues are separated from one another by one to three spacer amino acid residues, preferably glycine. The presence of cysteine residues can allow the formation of dimers of the peptide and / or increase the hydrophobicity of the resulting peptide, which enables immobilization of the peptide in solid phase or immobilized assay systems.

Of particular interest is the use of the mercaptan group of cysteines or thioglycolic acids which are used for the acylation of terminal amino groups or the like, for the connection of two peptides, oligopeptides or combinations thereof, by a disulfide bond or a longer bond for formation of polymers containing a number of epitopes. Such polymers have the advantage of an improved immunological response. If different peptides are used for the composition of the polymer, they have the additional ability to induce antibodies that immunoreact with different antigenic determinants from different HIV isolates.

Compounds which have bis-haloacetyl groups, nitroaryl halides or the like can be used to prepare antigenic polymers (synthetic multimers) if the reagents react specifically with thio groups. The bond between the two mercapto groups of different peptides or oligopeptides can thus be a simple bond or a bond group of at least two, usually at least four and not more than sixteen, usually not more than fourteen carbon atoms.

The peptides according to the invention can be bound to a soluble macro-molecular (e.g. not more than 5 kDal) carrier. Typically, the carrier can be a poly (amino acid), natural or synthetic, to which antibodies in human serum are unlikely to be exposed. Examples of such carriers are poly-L-lysine, keyhole burdock hemocyanin, thyroglobulin, albumins such as bovine serum albumin, tetanus toxoid, etc. The choice of carrier depends primarily on the intended use of the antigen and also on convenience and availability.

In such conjugates, at least one molecule of at least one peptide according to the invention is present per macromolecule and not more than about 1 per 0.5 kDal, normally not more than 1 per 2 kDal, of the macromolecule. One or more different peptides can be linked to the same macromolecule.

The type of binding is conventional; reagents such as p-maleimidobenzoic acid, p-methyldithiobenzoic acid, malic anhydride, succinic anhydride, glutaric anhydride, etc. are used. The connection can take place at the N-, at the C-terminus or at a point within the molecule. The peptides of the present invention can be derived by connection, can be connected while bound to a support, or the like.

The person skilled in the art is familiar with various test arrangements which can be used to detect the presence of antibodies against retroviral proteins or for retroviral proteins themselves. Of particular interest is the use of the peptide as a labeled reagent, the labeling agent serving as a detectable signal, or the direct or indirect binding of the peptide to a surface, the antibody to the peptide in the sample being bound to the surface by the peptide. The presence of human antibodies bound to the peptide can be determined using a xenogeneic antibody specific for human immunoglobulins, usually IgM and IgG, or by a labeled protein specific for immunocomplexes, e.g. the Rf factor of S. aureus protein A can be detected.

Illustrative of an assay technique is the use of a sample container, e.g. the holes of micro-perforated plates, in which the polypeptide according to the invention or conjugates thereof are either covalently or non-covalently bound to the container bottom and / or to the walls. The sample, usually human blood or serum, diluted by appropriately buffered medium, is placed in the container and allowed to complex between the polypeptides and any related antibodies in the sample for sufficient time. The supernatant is removed and the container washed to remove non-specifically bound proteins. A marked speci15

5

10th

15

20th

25th

30th

35

40

45

50

55

60

65

CH675728 A5

The binding protein which is specifically bound to the complex, such as a xenogenic antiserum against human immunoglobulin, is used for the detection. The peptide can be prepared in a number of ways. Because of its relatively short size, the peptide can be synthesized in a solution or on a solid support by conventional manufacturing methods. Various automatic synthesizers are commercially available today and can be used according to known experimental arrangements. Compare e.g. Stewart and Young, Solid Phase Peptide Synthesis, 2nd Edition, Pierce Chemical Co., 1984; and Tarn et al., J. Am. Chem. Soc. (1983) 105: 6442.

Alternatively, hybrid DNA technology can be used when a synthetic gene is used using single strands that synthesize the polypeptide or substantially complementary strands if the individual strands overlap and are combined in a tempered medium for hybridization can. The hybridized strands can then be combined to form the complete gene and, by choosing appropriate terms, the gene can be inserted into expression vectors which are readily available today. For example, see Maniatis et all, Molecular Cloning, A Laboratory Manual, CSH, Cold Spring Harbor Laboratory, 1982. Or the region of the viral genome encoding the peptide can be cloned and expressed by conventional recombinant DNA techniques (cf. Maniatis, supra).

DNA coding sequences of LAVbru and ARV2 from HIV isolates which can be used for the expression of the peptides include the following:

LAVbru

TGT

ACA

AGA

CCC

AAC

AAC

AAT

ACA

AGA

AAA

AGT

ATC

CGT

ATC

CAG

AGG

GGA

CCA

GGG

AGA

GCA

TTT

GTT

ACA

ATA

GGA

AAA

ATA

GGA

AAT

ATG

AGA

CAA

GCA

CAT

TGT

ARV-2

TGT

ACA

AGA

CCC

AAC

AAC

AAT

ACA

AGA

AAA

AGT

ATC

DID

ATA

GGA

CCA

GGG

AGA

GLA

TTT

CAT

ACA

ACA

GGA

AGA

ATA

ATA

GGA

GAT

ATA

AGA

AAA

GCA

CAT

TGT

Sequence fragments can be used for the expression of peptide fragments, whereby conservative base changes can be carried out if the modified codons encode the same amino acids or non-conservative changes can also be made in the coding sequence if the resulting amino acid is a conservative or non- represents conservative change in amino acid sequence as previously discussed. The coding sequence can either be extended at the 5 'or 3' terminus, or the peptide can be extended at both ends while maintaining its epitopic centers. The extension can serve as an arm for a compound, for example for a label, such as an enzyme for connecting two or all peptides together in the same chain to confer antigenic activity, conventional restriction sites for cloning or the like. The DNA sequence itself, fragments thereof or larger sequences with usually at least 15 bases, preferably at least 18 bases, can be used as nucleotide probes for the detection of retroviral RNA or proviral DNA or for the identification of homologous regions for cloning or sequencing. Numerous techniques have been described, such as the Grunstein-Hogness technique, the Southern technique, the Northern technique, dot blot and enhancement thereof, as well as other methods as described in US-A 4,358,535 , to which express reference is made.

The peptides according to the invention, including the blocking peptides and their analogs, are used in vaccines themselves or in combination. Similarly, anti-idio-type antibodies, i.e. reactive antibodies that are reactive with the idiotypes of the antibody of the present invention and contain epitopes that mimic the neutralizing regions of HIV are used in vaccines. The peptides or anti-idiotype antibodies can also be formulated in a conventional manner, generally in concentrations ranging from 1 g to 20 mg / kg of the host. Physiologically acceptable media such as sterile water, saline, phosphate buffered saline and the like can be used as carriers. Adjuvants can be used, such as aluminum hydroxygel, surface-active substances, such as Lysolecithin, pluron polyols, polyanions, peptides, proteins (e.g. diptheria or cholerate oxides) and oil emulsions. The peptides can also be incorporated into liposomes or conjugated to polysaccharides, polypeptides, or polymers for use in vaccine formulations. You can by injection, e.g. administered by intramuscular, peritoneal, subcutaneous, intravenous, etc. An immunogenically effective dose can be administered all at once or several times, usually at intervals of 1 to 4 weeks. An "immunogenically" effective dose is that amount of a vaccine which is useful for eliciting an immune response in one word, with the host showing increasing infection.

16

CH 675 728 A5

Other features and advantages of the present invention will become apparent from the following experimental examples, which describe the invention by way of examples. The examples serve to illustrate and not to limit the invention.

5 Example I

Formation and characterization of monoclonal antibodies

Example I describes the formation of hybrid cell lines that produce monoclonal antibodies that are specific for HIV envelope glycoproteins. This procedure involves the use of lectin-purified extracts from LAVbru, which are bound to the lens lectin agarose as an immunogen. The monoclonal antibodies, which are subsequently formed by hybrid cell lines, are formed by their ability of gp110 from purified LAV and as biologically expressed recombinant fusion protein to form immunoblots and radioimmunoprecipitates. The monoclonal antibodies which are bound to epitope 15 at gp110 are also reactive in ELISAs with all of the smashed viruses, fusion proteins and synthetic peptides and react with the whole virus in indirect fluorescence assays.

The working procedures for the formation of hybrid cell lines which produce monoclonal antibodies and the characterization of the antibodies are as follows:

20 purified LAV virus from infected CEM cells (ATCC No. CRL8904) were in 50 mM Tris, pH 7.4, 0.15 M NaCl, 1.0% aprotinin, 2.0% Nonidet p-40® ( NP-40) (octylphenoxypolyethoxyethanol) smashed. The extract was clarified twice by centrifugation and to 0.5 NP-40 by adding 3 volumes of crushing buffer without NP-40. Lentil lectin sepharose (Pharmacia, Piscataway, NJ) was prewashed in smash buffer without NP-40 and then in adsorption buffer 25 (50mM Tris, pH 7.4, 0.15M NaCl, 1.0% aprotinin, 0.5% NP-40 ) equilibrated. The clarified, viral extract was adsorbed with lentil lectin sepharose for 42 hours at 4 ° C. The unadsorbed material was removed by washing with an excess of adsorption buffer. Elution of the adsorbed material was carried out in 0.2 M alpha methyl mannoside in adsorption buffer. The eluate was dialyzed against PBS to remove the sugar and the material was readsorbed onto the lens-30 lectinsepharose.

The glycoprotein-lens lectin sepharose complex was used to immunize BALB / c mice by administering three intraperitoneal injections without adjuvants two to three weeks apart. The spleen cells were removed from the immunized mice, the circulating antibody against the glycoproteins of HIV being detected by immunoblot, RIP and / or ELISA.

The procedures used to form the cell lines were essentially those of Koehler and Milstein (Nature 256: 495 (1985) with the modifications of Goldstein, LC, et al. (Infect. Immun. 38: 273 (1982)). Spleen -B-lymphocytes from immunized mice were fused with NS-1 myeloma cells using 40% (w / v) polyethylene glycol. The cell mixture was then immersed in HAT medium (RPMI-1640 medium with addition) resuspended from 15% fetal calf serum, 1 x 10 "4 M hypoxanthine, 4 x 10 ~ 7 M aminopterin and 1.6 x 10-5 M thymidine), to choose from for the growth of hybrid cells and then on 96-well microculture dishes at a concentration of 1 to 3 x 106 cells / ml and humidified in a humidified atmosphere containing 6% CO2 at 37 ° C. The cultures were fed by replacing half of the supernatant 45 with fresh HAT medium Holes for signs of cell proliferation using an inverse observed on a microscope, • and if the cells were of sufficient density, the supernatants were tested for anti-LAV antibodies.

Holes containing hybrid cells that produced antibodies against LAV were identified by ELISAS, and the binding was measured on the whole, purified, broken virus or on the bio-50 logically expressed fusion proteins. ELISAs using smashed viruses were performed on LAV-EIA plates (Genetic Systems, Seattle, Washington). The plates were run with cell culture fluids at 37 ° C for 45 min and then washed three times with 0.05% Tween 10 in phosphate buffered saline (PBS-Tween).

Peroxidase-goat anti-mouse IgG (1: 2000, diluted in PBS-Tween; Zymed Laboratories, Inc., 55 South San Francisco, California) was added (100 ml per well) and the plates were kept at 37 ° for 45 min C incubated and washed as above. The substrate (0.025 M citric acid, 0.05 M dibasic sodium phosphate, pH 5.0, which contains 14 mg o-phenylenediamine and 10 jo.l 30% hydrogen peroxide per 50 ml) was added and the plates were immersed in the room temperature for 30 min Incubated in the dark. The reaction was stopped with 3 N sulfuric acid and the colorimetric reactions were quantified with an automatic microplate reader. Holes that gave positive results were subcloned by limited dilution, tested again for specificity, and then expanded.

The monoclonal antibodies, which are secreted by the resulting hybrid cell lines, were further characterized in terms of specificity and reactivity with immunoblotting, immunoprecipitation and ELISA, whereby broken down LAV virus recombinant LAV fusion proteins and synthetic LAV-

65

17th

5

10th

15

20th

25th

30th

35

40

45

50

55

60

65

CH 675 728 A5

Peptides were used. All antibodies were determined as IgGH types. The cell lines HIV-gp110-1, HIV-gp110-2 and HIV-gp110-3 were deposited with the American Type Culture Collection prior to submission of the priority application and were given the deposit numbers ATCC HB 9175, HB 9176 and HB 9177, respectively.

The recombinant fusion proteins, which were tested for reactivity, were previously

ENV2, ENV3, ENV4 and ENV 5. The protein ENV2 is ex-primed from pENV2 (ATCC No. 53071), which represents a region of the LAV from base pair (bp) 6598 to bp 7178 (the numbering was carried out according to Wain-Hobson et al., Cell 44: 9 ( 1985)), ENV3 is expressed by pENV3 (ATCC No. 53072) and contains the LAV region from bp 7178 to bp 7698; ENV4 is expressed by pENV4 (ATCC No. 53073) and contains bp 7698 to bp8572; and ENV5 is expressed by pENV5 (ATCC No. 53074) and contains the LAV region from bp5889 to bp 7698. The production of the recombinant fusion proteins is detailed in U.S. Pat. Patent application Serial No. 721 237, to which express reference is made.

Merging synthetic peptides

Peptides I (29) and VIII (110-2-2) were on a benzhydrylamine (polystyrene / divinylbenzene)

Resin (Applied Biosystems, Inc., Foster City, California). Peptide V (177) was assembled on a t-butyloxycarbonyl (Boc) -ethylbenzylcysteine-phenylacetamidomethyl (PAM) -polystyrene / divinyl n-kenzen resin. The symmetrical anhydride couplings were carried out on an Applied Biosystems 430A synthesizer. The cysteine was added as the first residue in both peptides.

Dicyclohexylcarbodiimide couplings in the presence of hydroxybenzotriazole were used for asparagine and glutamine. The side chain protection based on benzyl and the Al-phaamin protection with Boc were also used. Other side chains were routinely used using Boc (formyl) tryptophan, Boc methionine sulfoxide, Boc (tosyl) arginine, Boc (methylbenzyl) cysteine, Boc (to-syl) histidine, Boc (chlorobenzyloxycarbonyl) lysine and Boc (bromobenzyloxycarbonyl) used.

If the peptides were radiolabeled, this was done by acetylating the amino terminus with 3H-acetic acid and an excess of dicyclohexylcarbodiimide.

The deblocking and cleavage of the peptides from the resin was carried out according to the Tarn “low-high” HF working instructions (Tarn et al., Supra). The extraction from the resin was done with 5% acetic acid and the extract was subjected to gel filtration chromatography in 5% acetic acid.

The synthetic HIV peptides were tested for reactivity with monoclonal antibodies containing peptides 29, 36 and 39. Peptide 29 is encoded by the LABßRU genomic region from about bp 6688 to bp 6750; peptide 36 is encoded by the region from about bp 7246 to bp 7317; and peptide 39 is encoded by the region from about bp 7516 to bp 7593. Peptides 36 and 39 are described in detail in U.S. Patent 4,629,783, which is incorporated by reference.

The blocking peptides IX-XV were assembled essentially as described above on a methyl benzhydrylamine (polystyrene / divinylbenzene) resin (Applied Biosystems, Inc., Foster City, California). The symmetrical anhydride couplings were carried out on an Applied Biosystem 430A synthesizer. The dicyclohexylcarbodiimide couplings in the presence of hydroxybenzotriazole were used for asparagine. For protection, side chains based on benzyl and Boc alpha-amine protection were used, while Boc (bromobenzyloxycarbonyl) was used specifically for tyrosine side chains.

If necessary, acetylation was carried out using acetic anhydride or glacial acetic acid and dicyclohexylcarbodiimide. Deblocking and cleavage of the peptide from the resin was carried out according to the standard “high” HF working procedure (Stewart et al., Supra). The extraction from the resin was carried out with 50% acetic acid and the extract was then subjected to gel filtration chromatography in 20% acetic acid. As desired, liquid chromatography was performed on a Vydac C18 column (Rainin Instrument Co., Emeryville, CA)

using a 0.1% trifluoroacetic acid-acetonitrile gradient.

Immunoblottina

Characterization by immunoblotting was carried out on clone supernatants or ascites fluid using purified LAV virus and recombinant fusion proteins as antigens. The antigens were first separated by polyacrylamide gradient gel electrophoresis (7.0-15.0%) and then transformed onto a nitrocellulose membrane (NCM) by electrophoresis, for 4 hours at 25 V in 25 mM sodium phosphate (pH 7.0). After the transfer, the NCM was blocked to avoid non-specific interactions by incubation in PBS-Tween or Biotto (5% non-fat dry milk in PBS) for 1 hour at room temperature. The NCM was incubated with cell culture supernatant or ascites fluid diluted with PBS-Tween for 1 hour at room temperature and was rinsed three times with PBS-Tween. In the second step, the NCM was treated with goat anti-mouse IgG horseradish peroxidase, diluted in PBS-Tween, for 1 hour at room temperature.

18th

5

10th

15

20th

25th

30th

35

40

45

50

55

60

65

CH 675 728 A5

incubated temperature. This incubation was followed by a wash with PBS-Tween and then immersed in horseradish peroxidase color development solution (Bio-Rad Laboratories, Richmond, California) for 20 minutes. The reaction was stopped by immersion in deionized water. The reactivity of the monoclonal antibody was compared to a positive control serum which was reactive with purified, smashed virus or expressed fusion protein. The results showed that all antibodies were bound to gp110 and its precursor gp150 when smashed virus preparations were used. Antibodies 110-1 and 110-2 also recognized fusion protein ENV3, while antibodies 110-3, 110-4, 110-5 and 110-6 formed an immunocomplex with ENV2.

Immunoprecipitation

Viral extracts for radioimmunoprecipitation were made from CEM cells, which were treated with the LAVßRU isolate of HIV, which was adapted to the lytic growth by continuous passage. If early cytophatic effects were evident, the cells were transferred to a labeling medium containing 35 (S) -methionine (0.05 mCi / ml) or 3 (H) -glucosamine (0.025 mCi / ml) and then for 24 hours. incubated until most of the cells were lysed and released the virus in the culture supernatant. The virus was tabletted from the cell-free supernatant (1 hour at 100,000 g) and detergent extracts were made in P-RIPA buffer (phosphate-buffered saline containing 1.0% Triton X-100, 1.0% deoxycholate , 0.1% SDS and 1% aprotinin). Similar extracts were made from the supernatants of uninfected CEM cells. • The immunoprecipitation assays were carried out with 100 nl virus extract, which was incubated with 100 ml culture supernatant from the hybrid cell line for 1 hour on ice. 4 nl of rabbit anti-mouse Ig (Zymed Laboratories, So. San Francisco, California) was added to each sample and incubated for 30 min. Immunoprecipitin (100 µl, Bethesda Research Laboratory, Bethesda, Maryland), which was resuspended in P-RIPA buffer containing 1.0% ovalbumin, was added to each sample and incubated for an additional 30 min. The bound complexes were washed and separated by SDS polyacrylic gel electrophoresis (15.0% acrylamide: DATD gel). After electrophoresis, the gels were fixed, rinsed in enhancement (New England Nuclear, Boston, MA), dried and exposed to Kodak XR-5 film. A positive reference serum in which all HIV viral proteins were immunoprecipitated was reacted with virally infected CEM cell supernatants as positive and negative controls.

The results showed that all six monoclonal antibodies gp110 and gp150 specifically immunoprecipitated.

Enzvm-linked immunoadsorbent test (ELISAÌ

To map the gp110 epitopes that are recognized by the monoclonal antibodies according to the invention, culture supernatants of hybrid cell lines or ascites fluids are further characterized by their reactivity in ELISA with biologically expressed fusion proteins and synthetic peptides. The procedures were the same as those described above, except that as the antigen adsorbed to the surface of the microtiter wells, fusion proteins or synthetic peptides replaced the purified virus.

When using peptides as antigen, the protocol for the application was as follows: lyophilized peptide was dissolved in 6M guanidine HCl. Immediately before application to the 96-well plates, the guanidine solution was diluted in 0.05 M carbonate / bicarbonate buffer (pH 9.6) to a final peptide concentration of up to 100 g / ml. a 50 µl volume of diluted peptides was applied to each microtiter plate and the plates were incubated overnight at 4 ° C. The excess peptide solution was "shaken out", the plates were blocked with Biotto and the procedure described above followed for the rest of the ELISA. In some way, recombinant protein was diluted to a final concentration of about 2 jig / ml in 0.05 M carbonate / bicarbonate buffer (pH 9.6) before the same procedure followed.

The results are shown in Table II. The monoclonal antibodies produced by the HIV gp110-1 and HIV gp110-2 cell lines reacted with ENV3, ENV5, peptide 36 and smashed virus. The antibodies from the HIV gp110-3, HIV gp110-4, HIV gp110-5 and HIV gp110-6 cell lines reacted with ENV2 and peptide 29, as well as with the smashed virus.

19th

5

10th

15

20th

25th

30th

35

40

45

50

55

60

65

CH 675 728 A5

Table II

ELISA, which shows the reactivity of the monoclonal antibodies with recombinant proteins and synthetic peptides

Recombinant fusion protein Synthetic peptide LAV CEM

ENV2

ENV3

ENV4

ENV5

29

36

39

Contr

110-1

0.077

3,000

0.113

3,000

ND

2,421

0.054

0.908

0.125

110-2

-0.003

3,000

0,000

3,000

ND

2,305

-0.005

1,214

0.009

110-5

3,000

0.011

"ND

ND

3.0p0

ND

0.017

0.363

0.046

110-4

3,000

0.020

ND

ND

3,000

ND

0.016

0.383

0.067

110-5

3,000

0.014

ND

ND

3,000

ND

0.016

0.368

0.025

110-6

3,000

0.033

ND

ND

1,937

ND

0.017

0.486

0.032

The results in Table II demonstrated that monoclonal antibodies 110-1 and 110-2, which recognized an antigenic determinant encoded by a DNA sequence within the pENV3 region, particularly the region of the HIV genome encoded by the Amino acid sequence of peptide 36 is defined, ie that the monoclonal antibodies gp110-1 and 110-2 bind to a peptide region of gp110 which is encoded within bp 7246 to bp 7317, as evidenced by the formation of an immunocomplex with peptide 36 and ENV3. This region of the HIV genome was previously identified as conserved, i.e. small changes in the DNA sequence in the region encoded by peptide 36 within different viral isolates from different geographic areas. See Starcich et al., Cell 46: 637 (1986). In contrast, the monoclonal antibodies gp110-3, -4, -5 and -6 bind HIV peptides which are encoded by region of peptide 29 from bp 6688 to about bp 6750. The region in gp110 defined by peptide 29 has been demonstrated to have different nucleotide substitutions in different viral isolates. Monoclonal antibodies that selectively bind gp110 polypeptides that contain conserved epitopes, such as antibodies 110-1 and 110-2, may have improved utility in a variety of circumstances, such as in affinity chromatography, etc. Also responded to ELISA assays peptide 110-2-2 with sera from individuals from which LAV-2 was isolated.

Indirect Immunofluorescence Assav

Indirect immunofluorescence assays using monoclonal antibodies directed against HIV's gp110 antigen were performed on acetone-fixed and living lines. Acetone-fixed slides, which were produced with LAV-infected CEM cells, were incubated with diluted culture supernatants or ascites liquids for 1 hour at 37 ° C., while the living cells with culture supernatants or ascites liquids for 1 hour 4 ° C before the cells were placed on the slides and acetone fixed. Fluorescein isothiocyanate-labeled anti-mouse IgG was used in both methods to detect cells carrying the reactive gp110 antigen. The monoclonal antibody HIV-gp110-1 gave positive results using either living or acetone-fixed LAV-infected cells.

Example II

Neutralization of HIV infectivity by anti-gp110 monoclonal antibodies

This example describes and characterizes the neutralization of HIV infectivity using monoclonal antibodies that bind gp110 and peptides that contain gp110. The results indicate that the monoclonal antibodies gp110-3, -4, -5 and -6 have a neutralizing activity and that gp110-3 and gp110-4 in particular have high levels of neutralizing activity.

Neutralization test

A sensitive neutralization test was developed to quantitatively measure the effect of the monoclonal antibodies on HIV infectivity. An A CD4 + cell line of high susceptibility to HIV infection, CEM was used as the target cell for infectivity comparisons. Ascites fluid, which was prepared according to Example I, or the IgG fraction thereof, which was purified using the ammonium sulfate precipitation, was heated at 56 ° C. for 30 minutes

20th

5

10th

15

20th

25th

30th

35

40

45

50

55

60

65

CH 675 728 A5

inactivated and then diluted as required in RPMI medium containing 10% fetal calf serum. A suspension of the HIV strain LAVbru was harvested from about 4 day cultures with CEM in the logarithmic growth phase, filtered through 0.2 or 0.45 micron filters, divided into aliquots and frozen at -70 ° C. An aliquot was thawed, titrated to determine the TCID50, and then the tests were performed with freshly thawed aliquots diluted 1: 500 with culture medium to a concentration which was about ten times the amount required by 50% of the CEM cells infect in the culture (10 TCID50). The virus suspension was mixed with an equal volume (250 nI) of the monoclonal antibody preparation in five-fold dilutions 1: 5 to 1: 9 765 625. The virus / antibody mixture was incubated at 37 ° C. for 45 minutes and then duplicate 200 I samples were used to inoculate wells containing 1.0 ml of approximately 2 x 105 CEM cells per well. The cultures were incubated at 37 ° C in a humid atmosphere containing 5% CO2 for 14 days. The cells were harvested, tabletated and lysed with 1% Triton X-100 in PBS for approx. 10 min. The level of virus (or viral antigen) present in the lysed cells was quantitated using a sensitive HIV anti-gene capture sandwich enzyme immunoassay as described above. The titer of neutralizing activity, if any, was determined as the reciprocal of the dilution of the monoclonal antibody that inhibited antigen production by more than 50% of the control virus cultures incubated without antibody or with a monoclonal antibody of the same isotype that was previously detected that it shows no neutralizing activity.

The HIV antigenic capture test refers to the two monoclonal antibodies used above, which are directed against the p25 antigens as capture agents. These hybridoma cell lines were generated by the methods described above with minor changes, including using a recombinant gag fusion protein as an immunogen and characterizing the resulting monoclonal antibodies for specificity and reactivity using recombinant fusion proteins, which are tentatively called GAG-1, GAG-2 and GAG-3 and the synthetic peptide 141. The protein GAG-1 is expressed by pGAG-1 (ATCC No. 53 379), GAG-2 is expressed by pGAG-2 (ATCC No. 53 111) and GAG- 3 is expressed by pGAG-3 (ATCC No. 53 112). The production of the recombinant fusion proteins is described in detail in the pending US patent applications of serial numbers 764 460 and 828 828, to which express reference is made. Synthetic peptide 141 is encoded by the LAVbru genomic region in accordance with amino acid residues 198 to 242. The monoclonal antibodies produced by the hybridoma p25-2 and p25-3 have been shown to be reactive with the recombinant fusion proteins GAG-1, GAG-2 and GAG-3 and the monoclonal of p25-3 is also with the synthetic peptide 141 reactive.

To carry out the antibody capture test, the capture reagents were first adsorbed onto a solid support. The ascites fluid derived from the hybridoma cell lines p25-2 and p25-3 was diluted 1: 5000 with 25 mM Tris buffer, pH 8.5, and 200 nl were added to the wells of micro well plates. The holes were closed and incubated at 4 ° C for about 16 hours. The solution was removed from the holes by suction before adding a blocking solution of 0.3% Biotto in PBS. The blocking was carried out for 15 minutes at room temperature. The blocking solution was aspirated and the samples were added. 200 microliters of lysed cell suspension and 5.0 ni of the detection conjugate, prepared as described above, were added to each well. The perforated strips or plates were incubated for 2 hours at 37 ° C., the suspension was then suctioned off and the holes were washed four times with buffer (0.05% Tween in 20% PBS). The detection conjugate was prepared as follows: The monoclonal antibodies p25-6 and p25-7 were conjugated with horseradish peroxidase (HRP) in a molar ratio of 3: 1 (Ab: HRP) for 3 hours using a periodate oxidation method (Nakane, et al., J. Histochem. Cvtochem 22: 1084 (1974)). The conjugates were diluted 1: 1500 in 2.5% (w / v) in defatted dry milk, 0.02% thimerosal and 0.005% anti-foam A in 20 mM sodium citrate. The rest of the ELISA procedure was carried out as described in Example I.

The results of the neutralization activity test with the antibodies gp110-3, -4, -5 and -6 are as follows. The highest titers in which residual neutralization activity was detected were: gp110-3 = 15,625; gp110-4 = 9 765 625; gp110-5 = 125 and gp110-6 = 625.

Because of the predicted genetic variability of the region defined by peptide 29, the ability of the monoclonal antibody gp110-4 to recognize other isolates of HIV was tested. The immunofluorescence tests were carried out as described above. The antibody gp110-4 Hess antigen was found in cultures of at least three of the sixteen HIV isolates tested.

The antibody gp110-4 was able to neutralize viruses isolated from a chimpanzee 15 weeks after it was inoculated in an animal control experiment with an AIDS vaccine test with LAVbru. The monoclonal antibody was able to neutralize the isolates, although the animal had serum antibodies that neutralized HIV in vitro and developed a networkable, mediated immune response to HIV infection. This shows a deficiency of the antigenic drive in vivo for the epitope which is recognized by the gp110-4 antibody.

21st

5

10th

15

20th

25th

30th

35

40

45

50

55

60

65

CH 675 728 A5

Example III

Neutralization of HIV infectivity by means of a cocktail of the monoclonal antibodies Anti-ap110 and Anti-p25

This example describes the neutralization of HIV infectivity using monoclonal antibodies that bind to gp110 and peptides within gp110 in combination with monoclonal antibodies that bind to p25 and peptide within p25, which only little or no neutralizing Have effect. The results indicate that the monoclonal »

Antibodies gp110-2 in combination of either p25-6 or p25-7 have particularly high levels of neutralizing activity. Hybridoma cell lines p25-6 and p25-7 were formed by the methods described above, but with changes that require the use of inactivated, smashed virus or a purified recombinant gaa fusion orotein. which was expressed in E. coli as an immunogen and the resulting monoclonal antibodies for specificity and reactivity using the recombinant fusion proteins, which are tentatively as GAG-1, GAG-2 and GAG-3 and synthetic peptides 15, 88, 150, 137 and 148 were characterized. The synthetic peptides are encoded by the LAVbru, which corresponds to the amino acid residues as follows. Peptide 15, amino acid residues 329 to 350; Peptide 88, amino acid residues 325 to 350; Peptide 150,

Amino acid residues 318 to 363; Peptide 147, amino acid residues 278 to 319; and peptide 148, amino acid residues 290 to 319. The monoclonal antibodies produced by the hybridoma cell lines p25-6 and p25-7 are reactive with the recombinant fusion protein GAG-3, p25-6 is reactive with the synthetic peptides 147 and 148 and p25-7 reactive with synthetic peptides 15, 88 and 150.

The neutralization tests were carried out as described above, except that when cocktails were used, the individual monoclonal antibodies were first diluted 1: 5 with culture medium and then mixed in the same ratio to obtain a final concentration of 1:10. The rest of the test was carried out as described above.

The monoclonal antibodies gp110-2, p25-6 and p25-7 show less than 50% neutralizing activity when used alone. When used in a cocktail containing the monoclonal antibodies gp110-2 with p25-6 and gp110-2 with p25-7 in a 1:10 dilution, total neutralization was found. A cocktail comprising the monoclonal antibodies p25-6 in combination with p25-7 resulted in a neutralizing activity of 60 to 90%.

Example IV

Immunopotency of peptide 29 and homologues

The ability of peptide 29 and the homologous peptides, including peptide 177, to stimulate an immune response against HIV was tested on two strains of mice. The procedures for the preparation of the peptide immunogens of the immunization protocol and for the characterization of the immune response formed are detailed below.

Peptide 29 was prepared for immunization by conjugation with a purified thyroglobulin. The thyroglobulin can be derived with N-succidinimidyl-4- (N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) for conjugation, according to the method described in US Pat. No. 4,629,783.

Column 10, lines 28-51. As a second immunogen, thyroglobulin was derived with glutaraldehyde as follows. Pig thyroglobulin, 27 mg, was dissolved in 1 ml of 0.1 M sodium bicarbonate to which 8.3 I of 25% glutaraldehyde solution was added dropwise and the mixture was stirred overnight at room temperature. 1 ml of the sodium carbonate bicarbonate buffer (pH 9.3) was added to the solution and then dialyzed against 2 l of the same buffer at 4 ° C. for 8 hours, the dialysate being completely replaced after 4 hours. Peptide 29 was then added to the derived thyroglobulin in about 100 molar excess and the mixture was stirred at room temperature overnight. Unreacted glutaraldehyde was blocked with 200 ml of 0.2 M lysine solution and the mixture was stirred at room temperature for several hours (or overnight). The peptide-thyroglobulin conjugate was then exhaustively dialyzed against PBS at 4 ° C.

Two strains of mice (C57 black and BALB / c) were inoculated with peptides that were produced by all conjugate methods. All animals were about 2-4 weeks old at the time of inoculation. The inoculation routes included the paws, the tail scarification or were subcutaneous, intranasal or intraperitoneal. The inoculum consisted of 25ng conjugated peptide, which consisted of 0.5 ml 'Freund's complete adjuvant, with the amplification inoculations repeated after weeks 2, 3 and 5 by the same immunogen dissolved in incomplete Freund's adjuvant. Serum samples were taken from individual mice, before immunization, 4 * days after the boost immunization, after 3 weeks and 4 days after the final boost after 5 weeks. The serum samples were analyzed for antibodies against homologous peptides or the entire virus by screening in ELISAs. The sera which showed antibody activity against LAV were subjected to further screening for neutralizing activity, followed by analysis.

22

5

10th

15

20th

25th

30th

35

40

45

50

55

60

65

CH 675 728 A5

the gene by immunoblots against smashed LAV antigen and radioimmunoprecipitation test with radiolabelled gp110.

The results of the immunizations showed that mice immunized with peptide 29 developed antibodies which were reactive with peptide 29 and the smashed LAV-1 virus according to ELISA. The conjugation of peptide 29 with glutaraldehyde generally elicited higher antibody titers against peptide 29 in BALB / c mice, although conjugation with maleinimide successfully raised anti-peptide 29 antibody in some BALB / c mice. Mice immunized with peptide 177 developed antibodies to the peptide and conjugation of peptide 177 with glutaraldehyde was better for eliciting an immune response. The C57 mice showed a greater response to immunostimulation with the peptide 177 than the BALB / c mice. Mice immunized with the LAV-2 peptide 110-2-2 developed antibodies to 110-2-2 and LAV-2 virus as shown by ELISA. The 110-2-2 peptides conjugated to glutaraldehyde showed immunogenicity in both the C57 and BALB / c mice, although the titers against the 110-2-2 peptides in BALB / c were generally higher than that of the C57 mice, whereas the titers against the LAV-2 virus were higher in the C57 mice than in the BALB / c mice.

In general, serum samples from immunized mice which (i) showed antibodies to the whole virus, (ii) are able to neutralize the HIV as described in the tests in Example II and (iii) are reactive with the peptide in ELISAs 29, which cumulatively indicates the effectiveness of using peptide 29 in a vaccine formulation.

Example V

Immunoaffinity separation of oo110 using monoclonal antibodies

Monoclonal antibodies to HIV gp110 antigen can be used in immunoaffinity separation procedures to substantially purify bacterially expressed recombinant fusion proteins. If the expressed protein is excreted by the bacterium, the protein can be isolated from the culture supernatant; if the protein is not excreted, bacterial cells may need to be disrupted.

The construction of the plasmid pENV-5 (ATCC No. 53 074) is described in the parallel US patent application serial number 721 237, to which express reference is made here. The plasmid pENV-S encodes the major part of the carboxy terminus of gp110 and a part of the amino terminus of gp41 from LAV, which is inserted into the trp expression vector. E. coli C600, which is transformed by this vector, expresses but does not secrete the gp110 fusion protein.

The E. coli C600, which contains the plasmid pENV-5, is grown in a medium which contains tryptophan (20 (ig / ml) and ampicillin (100 (xg / ml) overnight with air supply at 37 ° C. Overnight Cultures are then inoculated 1: 100 in fresh minimal medium containing ampicillin (100 ng / ml) but no tryptophan, and these cultures are grown for aeration for 2 to 3 hours (up to an early log phase) at 37 ° C. The inducer 3-B-indole-acrylic acid (Sigma Chemical Co., St. Louis, MO) is added to a final concentration of 20 ng / ml from freshly made stocks of 20 mg / ml in 95% ethanol. The induced cultures are then grown at 37 ° C. with aeration for 4 to 5 hours and then deleted and, if necessary, frozen in. The protein yields of pENV-5 are typically less than 1 mg / l.

The pelleted bacterial cells are lysed using P-RIPA buffer (PBS containing 1% Triton X-100.1% deoxycholate, 0.1% sodium dodecyl sulfate and 1% aprotinin), lysing the E. co-ji cells . The suspension can be sonicated to separate the DNA and the RNA and then the particulate material can be removed by centrifugation. A dilution or concentration step may be required to standardize protein concentration.

The monoclonal antibody HIV-gp110-1 is first exposed to ascites fluid or cell culture supernatants at room temperature or in the cold with (NH4) 2S04 or Na2S04 solutions, which at pH 7.3 to a final saturation of 33 or 18%. are saturated, failed. The precipitated proteins are removed by centrifugation and again dissolved in PBS and precipitated a second time with 33% (NH4hS04 or 12 to 15% Na2SÜ4. This step can be repeated if necessary. The lozenge obtained by centrifugation is again dissolved in PBS and the excess salts are removed by gel filtration, by a desalination matrix or by exhaustive dialysis against PBS.

The purified monoclonal antibody 110-1 can then be coupled to cyanogen-activated Sepharose. The required amount of gel is swollen in 10 -3 M HCl solution on a glass filter (1 g freeze-dried material gives a final gel volume of approximately 3.5 ml) and washed with the same solution for 15 minutes and the antibody is added immediately afterwards . In general, the coupling reaction is most effective in a pH range of 8-10, but a lower pH can be used if antibody stability requires it. The antibody should be dissolved in PBS or in a carbonate / bicarbonate or borate buffer with 150 mM NaCl of high ionic strength. The activated Sepharose and the antibody suspension is then stirred moderately for 2 to 4 hours at room temperature or overnight at 4 ° C and then on a sample glass frit filter

23

5

10th

15

20th

25th

30th

35

40

45

50

55

60

65

CH 675 728 A5

washed with the coupling buffer. All remaining active groups are blocked by treatment with 1.0 M ethanolamine at pH 8 for 2 hours. The final antibody-Sepharose product is then washed alternately four to five times with a buffer solution with a high and low pH (borate buffer, 0.1 M, pH 8.5, 1M NaCl and acetate buffer 0.1 M, pH 4.0, 1 M NaCI). This washing removes traces of non-covalently adsorbed materials. The completed immunoaffinity separation matrix is stored below 8 ° C in the presence of an appropriate bacteriostatic, such as 0.01% azide.

The addition of the suspension of the expressed protein to the immunoaffinity separation matrix leads to the selective removal of the gp110 antigen. The mixture can react with each other for 2 to 24 hours, preferably 12 to 18 hours, with gentle stirring or rocking. A column format can also be used in which the immunoaffinity matrix is poured into the column, equilibrated and the solution of the expressed protein is slowly added to the column. After the protein suspension has been added, the flow should be stopped to allow maximum immune complex formation.

Unbound material is washed out or separated by exhaustive washing with adsorption buffer. A coarse glass frit filter with vacuum or the column flow can be used. The bound material is then eluted using low and high pH buffer solutions (acetate buffer, pH 4.0 or borate buffer, pH 8.56) or a chaotropic agent.

Example VI

Immunoaffinity purity of recombinant od110 from a mammalian expression system

The monoclonal antibodies according to the invention are used in the immunoaffinity purification of recombinant fusion gp110, which is expressed by mammalian cells. The mammalian cells are infected with a recombinant vaccinia (Mackett et al. J. Virol. 49: 857 (1984)) which contains sequences which encode at least a part of gp110 which is antigenic and which produces neutralizing antibodies.

The recombinant vaccinia has been constructed according to the method described in US Patent Application Serial Number 842,984. Briefly, sequences encoding the envelope glycoprotein of HIV are inserted into a plasmid vector (pGS20) downstream from the vacciniatrans transcription control element. This chimeric gene is flanked by sequences encoding the viral thymidine kinase (TK) gene.

Chimeric plasmid vectors that have the vaccinia virus promoter bound to the LAV-Hüilgen are used to transform the E. coli strain MC1000. The insertion of the chimeric LAV-env sequences into the vaccinia virus genome was achieved in vivo by recombination, which was made possible by the fact that the chimeric genes in the plasmids pv-env5 are flanked by vaccinia virus sequences which are the TK gene encode. This plasmid is then introduced into the cells previously infected with the wild-type vaccinia virus and the recombination could occur between the TK sequences on the plasmid and the homologous sequences in the viral vaccinia genome, with the chimeric gene being inserted. African green monkey liver cells (strain BSC-40, a line derived from BSC-1 cells, ATCC No. CCL26) were used as hosts in the expression system.

Confluent BSC-40 cells are infected by a variety of infections from 10 recombinant vaccinia viruses. Infections were allowed to proceed for 12 hours after which the cells were harvested, washed once with PES and collected by centrifugation. The cell pastilles were again suspended in lysis buffer (1.0% NP 40, 2.5% sodium deoxycholate, 0.1 M NaCl, 0.01 MM Tris-HCl, pH 7.4, 1 mM EDTA) and the lysate was then passed through Centrifugation clarified. The immunoaffinity purification of the expressed recombinant fusion protein is carried out as described above for the bacterial expression system, using the monoclonal antibody gp110-1. The proteins produced by this expression system are more like the naturally produced HIV-gp110, since the process and glycosylation were carried out by mammalian cells.

Example VII

Inhibition of HIV infection by blocking peptides

The efficacy of blocking peptides in inhibiting tissue culture cells by the LAVßRU strain of HIV was studied using a modified protocol for the selection of peptide T as published by Pert et al., Supra. The preferred HIV inhibition tests include the combination of equal volumes of blocking peptides and CEM cells (2.5 x 10s) in the medium (RPMI, 10% FCS and 2 mg / ml polybrene) and incubation for 45 min at 37 ° C. The virus is then added in various doses (10, 50, 500 TCID 50) and the mi

24th

CH 675 728 A5

10th

15

20th

incubated for 14 days at 37 ° C, after which the supernatant was tested for virus antigen production (e.g. the number p25).

The re-incubation of the CEM cells with the peptides before the virus was added to the cultures increased the inhibitory effect in the tests. The inhibition turned out to be dependent on the virus dose, which shows the strong activity at low and medium doses, but the lower activity at the highest virus doses.

About 60 to 90% inhibition of virus antigen production was achieved with the peptide T in low virus dose experiments. Additional experiments with the peptides X-XV, typically with an amidated COOH terminus and an acetylated NH2 terminus, showed similar results, while peptide XI was particularly effective over a wide dose range. The neutralizing antibodies can be added either during the preincubation period or at the time of virus addition to achieve additional or synergistic inhibition of viral antigen production.

It can be seen from the foregoing that the monoclonal antibodies and peptides according to the invention, including the blocking peptides, enable improved methods for the neutralization and / or inhibition of HIV infections. This allows more easily prophylactic and therapeutic compositions to be developed which can be used effectively against infections caused by most, if not all, strains of HIV. In addition, the new materials are used in diagnostic tests and other well-known procedures.

While the present invention has been described in detail by way of illustration and example for purposes of clear understanding, it is apparent that certain changes and modifications can be made within the scope of the appended claims.

25th

Hinterleaunasdaten for the microorganisms

The following microorganisms, which form part of the present invention, have been deposited with the American Type Culture Collection, 12 301 Parklawn Drive, Rockville, Maryland 20 852, USA. The data regarding the deposits are the following:

30th

35

40

45

Scientific description

Ref. Of the deposit

Ref.ATCC

Filing date

Mouse hybridoma (balbc / NS-1)

HIV gp 110-1

HB 9175

August 15, 1986

Mouse hybridoma (balbc / NS-1)

HIV gp 110-2

HB 9176

August 15, 1986

Mouse hybridoma (balbc / NS-1)

HIV gp 110-3

HB 9177

August 15, 1986

Mouse hybridoma (balb c / NS-1)

HIV gp 110-6

HB 9404

April 30, 1987

Mouse hybridoma (balb c / NS-1)

HIV gp 110-4

HB 9405

April 30, 1987

Mouse hybridoma (balbc / NS-1)

HIV gp 110-5

HB 9406

April 30, 1987

Mouse hybridoma (balb c / NS-1) -

H! V-p 25-2

HB 9407

April 30, 1987

Mouse hybridoma (balb c / NS-1)

HlV-p 25-3

HB 9408

April 30, 1987

Mouse hybridoma (balb c / NS-1)

HIV-p 25-6

HB 9409

April 30, 1987

Mouse hybridoma (balbc / NS-1)

HIV-p 25-7

HB 9410

April 30, 1987

The HB 9175, HB 9176 and HB 9177 hybrodomes were tested and found viable on August 26, 1986. The remaining hybridomas were tested and found viable on May 4, 1987.

Claims (39)

50 claims 1. Composition for use in the treatment of HIV infections, characterized in that it contains a therapeutically effective dose of at least one monoclonal antibody which is capable of reacting specifically with one or more epitopes of HIV and a pharmaceutically Contains 55 table acceptable carriers. 2. Composition according to claim 1, characterized in that the epitopes are encoded in the env or oao regions of the HIV genome. 3. Composition according to claim 1, characterized in that the epitopes are localized in the HIV proteins gp110 or p25. 60 4. Composition according to one of claims 1-3, characterized in that it additionally contains one or more blocking peptides which are capable of reducing HIV infectivity and / or monoclonal antibodies which are reactive with the epitopes of the said peptides . 5. Composition according to claim 4, characterized in that it additionally contains a mixture of monoclonal antibodies, which with different homologues of said Se- 65 sequence of blocking peptides are reactive. 25th 5 10th 15 20th 25th 30th 35 40 45 50 55 60 65 CH 675 728 A5 6. The composition according to claim 1, characterized in that the monoclonal antibody is reactive with at least one epitope of LAVbru p25 amino acid sequence 278 to 319 and / or homologues thereof and a second antibody with at least one epitope in the LAVbru p25 amino acid sequence 315 to 363 and / or homologues thereof, is reactive. 7. The composition according to claim 1, characterized in that the monoclonal antibody is reactive with at least one epitope of HIV and a second antibody is reactive with at least one epitope of HIV gp110. 8. Composition according to claim 7, characterized in that the p25 epitope is located in the LAVeRU amino acid sequence 278 to 319 or 315 to 363 or in homologues of the said sequences. 9. The composition according to claim 7, characterized in that the gp110 epitope is located in the LAVeRU amino acid sequence 308 to 328 or homologues thereof. 10. The composition according to claim 1, characterized in that it further contains a monoclonal antibody which is capable of reacting with a blocking peptide of HIV. 11. The composition according to claim 1, characterized in that it contains the following components a) and b): a) at least one monoclonal antibody which is reactive with an epitope of HIV and b) blocking peptide which has at least five adjacent amino acids of the following HIV gp110 amino acid sequences or homologues thereof contains: IX C173) Y-Ala-Ser-Thr-Thr-Thr-Asn-Tyr-Thr-Y '; or XV C191) Y-Ala-Val-Phe-Thr-Asp-As n-Tyr-Thr-Y ', where Y and Y ', if present, each represent an amino acid sequence of up to 20 amino acids. 12. The composition according to claim 1, characterized in that it contains the following components a) and b): a) a monoclonal antibody which is specific for an epitope of HIV and b) a peptide containing at least one of the following amino acid sequences or homologues thereof: XI Y-Thr-Thr-Ser-Tyr-Thr-Y '; or XII Y-Thr-Asp-Asn-Tyr-Thr-Y; or XIII Y-Asn-Thr-Ser-Tyr-Gly-Y '; or XIV Y-Asp-Thr-Asn-Tyr-Ser-Y ';, (187) (188) (189) (190) where Y and Y ', if present, each represent an amino acid sequence of up to 20 amino acids. 13. The composition of claim 10, wherein said blocking peptide defines at least one antigenic determinant capable of eliciting antibodies in a host, said elicited antibodies being protective against HIV infection. 14. Monoclonal antibodies corresponding to the monoclonal antibodies in compositions according to claim 1, characterized in that they are able to react specifically with an epitope of HIV. 15. Monoclonal antibody according to claim 14, characterized in that the epitope is localized in the envelope glycoprotein gp110 of HIV. 16. Monoclonal antibodies according to claim 15, characterized in that said epitope comprises the HIV gp110 amino acid sequence from 301 to 336 or 308 to 328 or homologs of said sequences. 26 5 10th 15 20th 25th 30th 35 40 45 50 55 60 65 CH 675 728 A5 17. Monoclonal antibodies according to claim 14, characterized in that the epitope is localized in HIV p25. 18. A monoclonal antibody according to claim 14 which is capable of reacting specifically with an antigenic determinant of HIV, the monoclonal antibody blocking the binding of an antibody which passes through the cell lines with the ATCC numbers. HB 9175, HB 9176, HB 9177, HB 9405, HB 9406, HB 9404, HB 9409 or HB 9410 is produced. 19. peptide of epitopes of HIV which reacts specifically with monoclonal antibodies according to claim 14, characterized in that it contains at least five contiguous amino acids of the following HIV gp110 amino acid sequences or homologues thereof: II C29a) Cys-Thr-Arg-Pro-Asn-Asn-Asn-Thr-Arg-Lys-Ser-Ile-Arg-Ile-Gln-Arg-Gly-Pro-Gly-Arg-Ala-Phe-Val-Thr-Ile- Gly-Lys-Ile-Gly-Asn-Met-Arg-Gln-Ala-His-Cys. 20. Peptide according to claim 19, characterized in that the contiguous amino acids form at least one antigenic determinant which is able to produce antibodies after the immunization of a host, the said antibodies being protective against HIV infections. 21. Peptide according to claim 19, characterized in that it contains one of the following HIV gp110 amino acids or homologues thereof: I (29) Y-Thr-Arg-Lys-Ser-Ile-Arg-Ile-Gln-Arg-Gly-Pro Gly-Arg-Ala-Phe-Val-Thr-Ile-Gly-Lys-Ile-Y ', V (177) Y-Thr-Arg-Lys-Ser-Ile-Tyr-Ile-Gly-Pro-Gly-Arg- Ala-Phe-His-Thr-Thr-Gly-Arg-Ile-Gly-A ', or VIII (110-2-2) Y-Lys-Thr-Val-Lys-Ile-Nor-Leu-Nor-Ser-Gly-His-Val-Phe-His-Ser-His-Tyr-Gln-Pro-Y ', wherein Y and Y ', if present, each comprise an amino acid sequence of up to 20 amino acids. 22. Peptide according to claim 21, characterized in that Y and / or Y 'is an amino acid residue of glycine, tyrosine, cysteine, lysine, glutamic acid or asparagine. 23. A nucleic acid sequence, characterized in that it contains a nucleic acid segment of approximately 150 nucleotides or less, which encodes a peptide of HIV epitopes with which a monoclonal antibody according to claim 14 specifically reacts. 24. Nucleic acid sequence according to claim 23, which encodes the peptides of claims 19 or 22. 25. Nucleic acid sequence according to claim 23, which additionally encodes a blocking peptide of HIV. 26. Nucleic acid sequence according to claim 25, characterized in that the peptide contains at least five amino acids of the LAVBRU-gp110 amino acids 301 to 336 or LAVBRu-p25 amino acid sequences 278 to 319 or 315 to 363 and the homologues of the sequences. 27. Sample plate for use in diagnostic hybridization experiments, characterized in that it contains at least two nucleic acid sequences according to claim 23, which encode the peptides according to the following Table I: 27th TABLE I 5 co S 12 co O HXB2 TGTACAAGACCCAACAACAATACAAGAAAAAGA ATCCGTATC CysThrArgProAsnAsnAsnThrArgLysArg IleArglle BH102 Ser BH8 HXB3 H9M BRU TIMES ELI ARV2 WMJ2 RFENV Z6 Z3 NY5 -Lys - Lys - Ser - Ser- Gly-ArgGly HisPhe Ala TyrGln Gin ThrPro Ser Tyr Tyr Val ArgSer LeuSer • ser; • ThrLys TyrLys GlnSer ThrPro GlySerAspLysLysIle GlnSer -Lys Gly- -Ala CDC42 His- -ValThrLeu .. LAV2 -Gly Lys Val Gln- -MetLeu 309 309 309 309 309 314 314 310 312 306 322 311 306 304 320 302 03 cvj O CVJ m CM o co io co o -si- io tj * o LO IO IO O (O OK co CONTINUE. TABLE I HXB2 C AG AGA GGACCAGGGAGAGCATTTGTTACAATAGGAAAAATAGGAAATATG GlnArg GlyProGlyArgAlaPheValThrlleGlyLysIleGlyAsnMet 32 6 BH102 326 BH8 326 ^ HXB3 32 6 S H9M 326 I * "» S BRU: 331 g> (O ™ g MAL Gin LeuTyr Thr IleVal Asplle 329 ELI GlyLeu. . .GlnSerLeuTyrThr Arg IleValSerArgSer 323 ARV2 His Thr Arg IleGlyAsp 327 WMJ2 Arg ArgGlu. . . IleGlylle 32 0 RFENV ValIleTyrAlaThr Gin IleGlyAsp 337 Z6 GlyLeu. . .GlnAlaLeuTyrThr Arg ArgThrLysIlelle 327 Z3 Argile LysVal TyrAlaLys Gly 319 NY5 GlyPro ... ThrLeuTyrAl aArgGlu Asplle 32 0 CDC42 ValTrpTyr Thr Glu LeuGlyAsn 3 35 LAV2 MetSer HisVal HisSerHisTyrGlnProIle Lys 323 5 10th 15 20th 25th 30th 35 40 45 50 55 60 65 CH 675 728 A5 HXB2 ... AGA ... CAAGCACATTGT ... Arg ... GlnAlaHisCys 331 BH102 331 BH8 331 HXB3 331 H9M 331 BRÜ 336 MAL Arg Tyr 334 ELI IlelleGly 330 ÂRV2 Ile Lys ... 333 WMJ2 Ile 326 RFENV Ile Lys ... 343 Z6 Gly ... 334 Z3 IleThrGly 32 6 NY5 325 CDC42 Ile '341 LAV 2 ArgProArg Met 330 28. Vaccine against an HIV infection, characterized in that it contains an immunologically effective dose of one or more peptides with less than 50 amino acids, which comprise the epitopes of gp110 and / or P25, with which monoclonal antibodies according to claim 14 react specifically , said peptides being present in a mixture with a physiologically acceptable carrier. 29. Vaccine according to claim 28, characterized in that it additionally contains a sequence of five amino acids of a blocking peptide. 30. Immortalized cell lines for the production of a monoclonal antibody according to claim 14, which is capable of reacting with an antigenic determinant of an envelope glycoprotein, which is contained in an epitope of HIV. 31. The cell lines HIV-gp110-1 with the ATCC no. HB 9175, HIV-gp110-2 with the ATCC no. HB 9176, HIV-gp110-3 with the ATCC no. HB 9177, HIV-gp110-4 with the ATCC no. HB 9405, HIV-gp110-5 with the ATCC no. HB 9406, HIV-gp110-6 with the ATCC no. HB 9404, HIV-p25-6 with the ATCC no. HB 9409 and HIV-p25-7 with the ATCC no. HB 9410 as immortalized cell lines according to claim 30. 32. Monoclonal antibody according to claim 14, produced by a cell line according to claim 31. 33. A method for the formation of cell lines according to claim 30, which produce antibodies which are reactive with antigenic determinants of HIV-gp110, characterized in that a host is administered an immunogenic amount of an antigen preparation which is enriched in HIV proteins, the immunized host is tested for the production of antibodies reactive with gp110 antigen-determinants, the antibody-producing cells of the host are recovered and the recovered cells are immortalized, from the immortalized cells those which are HIV-gp110 produce are selected and the immortalized cells are cloned to produce the cell lines. 34. The method according to claim 33, characterized in that the HIV proteins are recombinant fusion proteins which are expressed by a eukaryotic or bacterial host or that the HIV proteins are extracted from an extract or lysate of HIV. 35. A method for diagnosing the presence of HIV in a biological sample, characterized in that a monoclonal antibody according to claim 14 which is capable of reacting with HIV-gp110 is incubated with a biological sample and the presence of the immune complex which with the monoclonal antibody and the antigenic determinant of the biological sample 30th CH 675 728 A5 is detected and from this the presence or absence of HIV in the sample is determined. 36. The method according to claim 35, characterized in that the monoclonal antibody is capable of reacting with an epitope or a blocking peptide of gp110. 5 37. A method for the diagnosis of the presence of antibodies against HIV in a biological sample, characterized in that a peptide according to claim 19 of an epitope of HIV-gp110 or p25 is incubated with the biological sample and the presence of the immune complex which between the Peptide and the antibodies is formed, in which the peptide reactive sample is detected and from this the presence or absence of HIV in the sample is determined. 10th 38. A method for diagnosing the presence of HIV in a biological sample, characterized in that a nucleic acid sequence according to claim 23, which encodes at least part of an epitope of HIV, is incubated with nucleic acid in the biological sample under hybridizing conditions and the presence of the Hybrid complex, which is formed between the nucleic acid segment and the nucleic acid in the sample, is detected and from this the presence or absence 15 essence of HIV in the sample is determined. 39. A method for determining an HIV strain in a biological sample, characterized in that the biological sample is incubated with a peptide according to claim 19 of an epitope of HIV and the presence of the immune complex between the peptide and the antibody is detected in the sample and from this the strain of HIV is determined. 20th 25th 30th 35 40 45 50 55 60 65 31