DD284089A5 - METHOD FOR DETERMINING THE PRESENCE OF HIV IN A BIOLOGICAL SAMPLE - Google Patents

Abstract

The invention relates to a method for determining the presence of HIV in a biological sample by means of monoclonal antibodies that specifically react with one or more neutralizing HIV regions, peptides that immunologically mimic the neutralizing HIV regions, and nucleic acid sequences that comprise at least a portion of the neutralizing region. {Procedure; Diagnosis; manufacture; monoclonal antibodies; peptides; peptide sequence; neutralizing area; Immune complexes; immunoaffinity; Medicine; To HIV; HIV detection}

Description

METHOD FOR DETERMINING THE PRESENCE OF HIV IN A BIOLOGICAL SAMPLE

Field of application of the invention

The invention relates to a method for determining the presence of human immunodeficiency virus (HIV) in a biological sample.

Characteristic of the known state of the art

_1B The infectious agent responsible for Acquired Immunodeficiency Syndrome (AIDS) and its prodromal phases, AIDS-related Complex (ARC) and Lymphadenopathy Syndrome (LAS); Agent is a novel lymphotropic retrovirus. This virus has been referred to in various ways, namely as

LAV, HTLV-III, ARV and more recently as HIV.

Since the pandemic spread of HIV, the treatment of infected persons and the prevention of transmission to uninfected risk groups is of paramount importance. A variety of treatment strategies address different phases in the life cycle of the virus. They are described in Mitsuya and Broder, 1987, Nature 325: 773. One possibility involves the use of antibodies that bind to the virus and inhibit viral replication, either because they interfere with virus entry into the host sites or because of other mechanisms. Once the viral component (s) undergoing intervention by the antibody is (are) identified, it is hoped that antibody

Be sufficient to neutralize the infectivity of the virus by vaccination or alternatively by passive administration of immunoglobulins or monoclonal antibodies of the desired

Specificity.

It is believed that the envelope glycoproteins of most retroviruses react with receptor molecules on the surface of cells susceptible to the virus, thus determining viral infectivity to particular hosts. Antibodies "that bind to the glycoproteins" can block the interaction of the virus with the cell receptors and thus neutralize the infectivity of the virus. See "The Molecular Biology of Tumor Viruses" 534 (J. Tooze, ed.).

1973) and RNA Tumor Viruses "226" 236 (R. Weiss et al. Ed., 1982) to both publications are hereby incorporated by reference. Compare also

Gonzalez-Scarano et al. "1982" Virology 120: 42 (La Crosse Virus); Matsuno and Inouye «1983« Infect. Immune. 39: 155 (Neonatal Calf Diarrhea Virus); and Mathews et al., 1982, J. Immunol. 129: 2763 (encephalomyelitis virus).

The general structure of HIV is a ribonucleoprotein core "surrounded by a lipid-containing shell" which, in the course of its development, forms the virus from the membrane of the infected host cell. The virally encoded glycoproteins are embedded in the envelope and protrude outward. The envelope glycoproteins of HIV are originally produced in the infected cell as precursor

3Q molecule of 150,000 to 160,000 daltons (gpl50 or gpl60) and then synthesized in the cell into an N-terminal fragment of 110,000 to 120,000 daltons (gp 110 or gp 120) to generate the external glycoprotein and into a C-terminal fragment of 41,000 to 46,000 daltons (gp41) "representing the transmembrane envelope glycoprotein."

For the reasons given above, the gpl10 HIV glycoprotein has been the subject of much research into a potential target to disrupt the life cycle of the virus. It has been demonstrated that sera from HIV-infected individuals neutralize HIV in vitro and that antibodies that bind to purified gPL10 are present in the sera / Robert-Guroff et al / 1985 / Nature 316: 72 / Weiss et al / 1985 / Nature 316: 69 and Mathews et al / 1986 / Proc. Natl. Acad. Be. USA / 83: 9709. Purified and recombinant gplOO stimulated the production of neutralizing serum antibodies / when administered to animals for immunization / Robey et al / 1986 / Proc. Natl. Acad. Be. USA / 83: 7023; Lasky et al / 1986 / Science 233: 209; and Zagury et al / 1986 / Nature 326: 249. Further, it has been shown that the gpl10 molecule binds to the CD4 (T4) receptor and that monoclonal antibodies / recognize the specific epitopes of the CD4 receptor / block HIV binding / syncytium formation and infectivity / HcDougal et al / 1986 / Science 231: 382. Putney et al. (1986 / Science 234: 1392) demonstrated neutralizing serum antibodies in animals after immunization with a recombinant fusion protein containing the carboxyl-terminal half of the gpl10 molecule. They further demonstrated that glycosylation of the envelope protein is unnecessary for response to the neutralizing antibody.

It would therefore be desirable to have a subunit vaccine against AIDS using the HIV gpl10 molecule or parts thereof. Subunit vaccines are one

Alternative to vaccines / those from inactivated or in

their effects weakened viruses are produced. Inactivated vaccines are problematic / because not all virus particles have been killed and their weakened viruses have the ability to mutate and regain their disease-causing effects. Subunit vaccines use only those

Parts of the virus for immunizing the host "which contain the antigens or epitopes capable of triggering the immune response" i. a response to neutralizing antibodies, ADCC and a cytotoxic T cell response. The main advantage of subunit vaccines is that irrelevant viral material is excluded.

Viral subunits for use in a vaccine can be produced by various methods. For example, the envelope glycoprotein can be expressed and purified by a bacterial host, although this molecule lacks most post-translational modifications (such as glycosylation) or other processing. Such a modification can be achieved by using a eukaryotic expression system, for example, yeast or cultured mammalian cells. Viral genes have been introduced into mammalian cells using vaccinia viruses as vectors, cfshe, for example, Mackett, M. et al, 1982, Proc. Nat. Acad .. Be. USA 79: 7415; D. Panicali and

E. Paoletti, 1982, Proc. Nat. Acad. Be. USA 79: 4927.

Recombinant vaccinia viruses can be constructed according to the methods of Hu et al., Nature 320: 537 (1986) or Chakrabarti et al., Nature 320: 535 (1986), which are incorporated herein by reference. In these systems, the viral glycoproteins produced by ropes infected with recombinant vaccinia are suitably glycosylated. They can be transported to the cell surface for extrusion and final isolation.

An important step in the production of a subunit vaccine is adequate purification of the desired glycoprotein from the complex mixture of the expression system. For this purpose, several methods are suitable. These include, but are not limited to, preparative polyacrylamide gel electrophoresis, gel permeation chromatography,

various chromatographic methods (i.e., ion exchange, reverse phase, immunoaffinity, and hydrophobic insert chromatography) and others. Most of these methods are used in various combinations to obtain substantially pure preparations »see D.G. Dress et al., 1981, Science 214: 1125, CD. Cabradilla et al., 1986, Biotechnology 4: 128, D.J. Dovbenko, 1985, Proc. Nat. Acad. Be. USA 82: 7748, which is hereby incorporated by reference.

To produce subunit vaccines, methods are needed which reduce the number of steps required to obtain the best purification of a particular viral antigen from a complex expression mixture.

_C target. Efficient separation of antigens from foreign

components can be made using immunoaffinity chromatography. This method, also known as immunoadsorption, consists in principle in the selective adsorption of an antigen to a solid support, to the. a specific antibody was covalently linked. The selectively adsorbed antigen is then eluted from such an adsorbent with antibody affinity by, for example, changing the pH and / or ionic strength of the buffer.

Polyclonal antibodies obtained from animals immunized with the desired antigen or from naturally infected individuals (see, for example, Laksy et al., Supra) were frequently used as immunoadsorbents. However, these reagents generally have

outgoing disadvantages, for example that (i) not all of

Antibodies which bind to the insoluble carrier are specific to the molecule of interest, so that further purification is required; (ii) the yields of the desired antigen are often low; and (iii) the 35th

Antibody affinities often vary from one preparation to another, requiring modification of the elution method. With the use of monoclonal antibodies * δ specific for the desired viral antigen in subunit vaccine preparations rather than polyclonal antibodies, one could circumvent these difficulties.

Monoclonal mouse antibodies that bind HIV antigens have already been described. Several groups have reported monoclonal antibodies specific for the core protein p25 (see, for example, Marzo Veronese et al., 1985, Proc. Nat. Acad., Sei. USA 82: 5199, and J. Chassagne et al., 1986). J. Immunol., 136: 1442). Monoclonal antibodies / specific for the membrane glycoprotein gp41 have also been described (see, for example, Marzo Veronese et al / 1985 / Science 229: 1402).

₇ Μρ1 the invention is to enable a better diagnosis of HIV infection.

Explanation of the essence of the invention

25

The invention is based on the object, a method

to provide for the determination of the presence of HIV in biological samples. These are peptides which are capable of immunologically mimicking the neutralizing epitopes of HIV proteins / nucleic acid probes, 30

which code for such peptides and monoclonal antibodies which react with such peptides used.

Therefore, there is a need for monoclonal

OO

Antibodies specific for epitopes in well-defined regions of the major envelope glycoprotein gPL10. Monoclonal antibodies attached to these areas

binding and reducing or eliminating the replication and transmissibility of HIV would be of great therapeutic and prophylactic benefit. In addition, one could also use the monoclonal antibodies to purify the desired region of gpl10 for example for use in vaccines from disrupted viruses or recombinant expression systems. Further, the region containing (s) the epitope (s) recognized by the monoclonal antibodies could be chemically synthesized, thereby resulting in those associated with the purification and administration of larger fragments of the gpl10 molecule Difficulties could be avoided. The present invention fulfills these and other needs.

The invention relates to new means and methods for neutralizing HIV infection / i. for preventing or substantially inhibiting the formation or cellular transmission of infectious HIV in a host. In particular, peptides that mimic a neutralizing region of HIV as well as monoclonal antibodies that react with such a region are used for the diagnosis and treatment and vaccination against HIV infections. The term "neutralizing region" in this context refers to those parts of HIV, particularly HIV proteins, which contain amino acid segments "that define one or more epitopes that react with antibodies" that are capable of either one or in combination with other antibodies of the invention «To neutralize HIV infections. Suitable assays for neutralization are known, including, for example, the reduction of HIV infections in T cell lines, the reduction of pseudopathies of VSV (bIV) pseudotypes

Envelope glycoproteins of HIV carry "Syncytium inhibition tests

β 2 64 08 9

and virion receptor binding assays. As desired, the neutralizing activity is comparable to antibody reactivity in immunochemical assays / immunofluorescence, immunoblot and radioimmunoprecipitation assay. 6

The new peptides, typically less than about 50 amino acids, contain 5 or more contiguous amino acids that form epitopes substantially similar to those epitopes found in neutralizing regions of HIV gpl10 or p25 through the env and gag regions Of particular interest are those regions ranging from amino acid residue 301 to about 336 from gPL10 and from about 278 to about 319 and from about 315 to about 363 of p25 (all from the HIV strain designated LAV _00n ). The name of the amino acid residues comes from the Los Alamos database (AIDS virus sequence database, Los Alamos National Laboratory, Theoretical Division, Los Alamos NM 87545).

It will be apparent to those skilled in the art that other analogous regions ("homologues") of other HIV isolates can be identified based on their location in related proteins from different isolates. In practice, such homologs may be identified by reference to LAV _n "sequence data as follows:

a) the amino acid sequences of HIV isolates and LAV ₀₀₁₁ can be aligned so that there is maximum homology between the two sequences.

b) one can identify peptides comprising those amino acid sequences of HIV isolates corresponding to the location of the LAV _nnM peptides which immunologically mimic the LAV _nnI1 proteins. Peptides, which

DNU

the amino acid sequences of HIV isolates identified in this way typically mimic the

immunohistochemically speaking proteins of the HIV isolate.

This method can also be applied to HIV strains "that are yet to be found. For example, if new HIV strains * to identify the envelope and core amino acid sequences may be brought into line with those of LAV_ _RU for maximum homology, never Methods / with which the sequences are matched / are known to the expert. When the sequences are matched, it is desirable to keep the homology between the cysteine residues as large as possible. The amino acid sequence of the new HIV strain or HIV species / location of the peptides disclosed herein / can be synthesized and used in the present invention.

Another method for determining sequences of a homologous region in other HIV strains has been described by Scharf et al. Science (1986) 233: 1076. In this case, two oligonucleotide primers are used which bind to conserved sequences outside the sequence region of interest here, wherein different restrictive sites are present in each primer. The DNA of HTV strains can then be multiplied in vitro and the resulting oligonucleotides can be cloned into vectors for sequence analysis and incorporated into a vaccine as a cassette / representing a particular epitope of the HIV strain.

It is not required in the present invention that the epitopes present within such sequences cross-react with antibodies of all HIV strains or species. Peptides / immunological epitopes comprising / distinguishing one species or serogroup from another

specific individuals or serogroups and may be used to identify individuals / individuals infected with one or more HIV species or serogroups. They are also useful in therapeutic agents in combination with other peptides / derived either from a homologous region or other neutralizing region.

The peptides of interest here are preferably derived from the gPL10 region of the virus. Of particular interest in this area are peptides encoded in the open env reading frame extending from about base pair (bp) 6667 to about the base pair 6774 of the LAV _BRU isolate. Different homologous regions of other HIV isolates thus comprise, as listed in Table I,

the homologous sequences used by the Los Alamos data-ίο '

bank (except LAV2).

Other peptides useful for generating and screening for monoclonal antibodies are those in the open env reading frame, such as from bp 7246 to about

7317 encoded by LAV _BRU . Such antibodies and reactive peptides are particularly useful in immunoassay.

In the gag region of the LAV_ _DM -Isolats provide the p25 amino acid sequences of about 278-319 and 315-363 further neutralizing regions of the HIV

It will be apparent to those skilled in the art that the additional neutralizing regions of HIV can be identified based on the teachings of the present invention. In particular, combinations of monoclonal antibodies that interact with

react to various HIV epitopes «·

a neutralizing activity.

TABLE 1 HXB2 TCTACAAGACCCAACAACAATACAACAAAAAGA ATCCCTATC CyaThrArg ProAanAenAhrThrArgLyeArg IlcArgllt 309

BH102 Str 309

If w. »Ww_wwww ~ ww..www.www.wwww.ww_V - -

ΟΠΟ WWWWW WWW - - ·. WWW "-" WWWWWWW.WW ^ y0W

ΠλΟ «Ι W ········································································································································································

Il QM η Γ-τι «τη τ ι τι- -» - »-» »

Π7Π ww w-www- - - w wwwwwww

BRU Str 314

Times. CIy ArgCly HlePh «31« ELi-Ala TyrCln Gin- ThrPro-310 ARV2 Ser Tyr-312 WMJ2 --- -Tyr --- 'VaI - ^ - Ar gSer ------- LeuSer- 306 RFENV Str ThrLye 322 Ib TyrLya ClnStr - Thr Pro-311

23 .- .... -ClySerAspLyaLyelle ------- GlnSer- 306

NY5 Lye-GIy Ala-304 CDC4 2 Ria ValThrLeu 320 LAV2 GIy-Lye-VaI Gin MetLeu 302

, , HXB 2 CAGAGA GGACCA6GGAGAGCATTTGTTACAATAGGAAAATAGGAAATATG

° ClnArg GlyProGlyArgAlaPhcValThrllcClyLyellcGlyAanMet 326

BH102 · 326

BH8 326

HXB3 326

HyH w www ww WMWWW ^ WWWWM- *. wta w WW-WWWW.WWW ww wv-wwwwwwwwwwwww www www ·· w ww ww J2w

BRU 331

MAL GIn-L «uTyr - Thr-IleVal-Aeplle 329 ELI CIyLeu .. .GlnSerLeuTyrThr-Arg-IleValSerArgSer 323 ARV2 HIs-Thr-Arg-lleGlyAsp 327 WMJ2 Arg-Argtflu ...- IleClylle 320 RFENV VallleTyrAlaThr-CIn-lleClyAep 337

26 ClyLeu- "... GInAlaLeuTyrThr - Arg - ArgThrLyallelle 327

Z3 Arglle LyaVal-TyrAlaLya-CIy , 319 NY5 GlyPro ... ThrLeuTyrAlaArgGlu Aeplle 320

, , CDCA2, ValTrpTyr-Thr-Glu-UuClyAen 335

"UV2 MetSer HisVal-HlaSerHleTyrClnProIl" -Lye 323

11XB2 ... AGA ... CAAGCACATTGT

... Arg ... ClnAl «Hi« Cyi 331

BH102 331

BH8 331

H9M 331

BRU 336

MAL Arg-Tyr-334

fcLl UeIIeGIy 330

ARV2 lets Lye ... 333

WMJ2 left 326

RFK.MV lie-Lye ... 343

, e Z6 GIy .., 334

^J3 23 IleThrGly 326

NY5 J25

CDC42, Ue 341

LAV2 ArgProArg Met- 330

12th

Peptide I, also referred to as peptide 29, is encoded in the open env reading frame approximately from amino acid residues 308 to 328 and has the following amino acid sequence in which the oligopeptides within this sequence comprise linear epitopes of this sequence:

I (29)

Y-Thr-Arg-Lys-Ser-Ue-Arg-Ile-Gln-Arg-Gly-Pro-Gly-Arg-Ala-Phe ^u Val-Thr-Ile-Gly-Lys-Ile-Y ·

in the Y and Y ¹ , if present "each have sequences of up to about 20 amino acids. For example, when Y and / or Y ¹ are present, they may include one or more amino acids from sequences flanking amino acid residues 308 to 328 of the HIV envelope sequence or any portion of these flanking sequences. For example, and without being limited to this, Y can use the LAV _nDM -

Shell amino acid sequence approximately from residues 301 to 307 in whole or in part, and Y 'may be the LAV _DDI1 envelope

DKU

amino acid sequence approximately from residues 329 to 336 in whole or in part, as follows:

II (29a)

Cys-Thr-Arg-Pro-Asn-Asn-Asn-Thr-Arg-Lys-Ser-Ile-Arg-Ile-Gln-Arg-Gly-Pro-Gly-Arg-Ala-Phe-Val-Thr-I le -Gly-Lys-Ile-Gly-Asn-Met-Arg-Gln-Ala-His-Cy s.

30

Alternatively, one can prepare truncated sequences of the peptides of the invention. In this regard, the following sequences of peptide 29 are particularly useful:

III (29b)

35

Y-Thr-Arg-Ser-L yi-Ile-Arg-Ile-Gln-Arg-Gly-Pro-Gly

Y "

where Y and / or Y '/ if present »each have sequences of up to about 20 amino acid residues ^

XV (29c)

Y Ije-Cln-Arg-Gly-Pro-Gly-Arg-Ala-Phe-Val-Thr

Xle-Gly-Lys-Ile-Y · ...

wherein Y and Y ¹ / if present "each of sequences up to about 20 amino acid residues.

In another embodiment, particularly interesting homologous regions of the ARV-2 isolate are encoded in the open env reading frame of about amino acid residues Nos. 306 to about 323. They typically have the following amino acid sequence, in which oligopeptides within this amino acid sequence comprise linear epitopes: within such a sequence.

V (177)

Y-Thr-Arg-Lys-Ser-Ile-Tyr-Ile-Gly-Pro-Gly-Arg- "Ala-Phe-His-Thr-Thr-Gly-Arg-Ile-Y

wherein Y and Y%, if present, each comprise from 1 to about 20 or more amino acid residues. If Y and / or Y ¹ are present, they may comprise one or more amino acid residues of sequences "flanking amino acid residues 306 to 323 of the ARV-2 envelope sequence" or a portion of these flanking sequences. In particular, Y may comprise all or part of the HIV envelope amino acid sequence from residues 299; Y ¹ may partially or completely encompass the HIV envelope sequence approximately from residues 324 to 333, respectively .

Alternatively, shortened sequences of the 3 g peptides V can be prepared. In this regard, the following are

Sequences especially useful:

VI (177a)

Y-Thr-Arg-Lye-Ser-Ile-Tyr-Ile-Gly-Pro-Gly-Y ¹ ; and VII

Y-Asp-Cye-Lys-Thr-Ile-Leu-Lys-Ala-Leu-Gly-Pro-

Ala-Ala-Thr-Leu-Glu-Glu-norLeu-norLeu-Thr-Ala-Cys-Y ·

wherein Y and / or Y ¹ , if present, each represent sequences of up to 20 or more amino acid residues.

Another example includes homologous regions of the LAV-2 isolate, such as encoded by amino acid residues 311 to 330 in the open env reading frame.

They typically have the following sequence:

VIII (110-2-2)

Y-Lys-Thr-Val-Lys-Ile-Leu-Nor-Nor-Ser-Gly-His-Val-Phe-His-Ser-His-Tyr-Gln-Pro-Y '

wherein Y and / or Y ¹ "if present" each represent sequences of up to 20 or more amino acid residues (see Nature 326: 662 (1987), which is hereby incorporated by reference).

The invention further relates to novel cell lines capable of producing monoclonal antibodies and agents containing these antibodies. The antibodies are

2 4 capable of extremely high titers (from 10 to 10 to

about 10 ⁷ or more) neutralizing regions contained in a predetermined sequence of the envelope glycoprotein gp110 or p25, their protein precursors, biologically expressed recombinant fusion proteins, and syn-

to selectively recognize thetic peptides containing one or more epitopes within the predetermined sequence region of gp110 or p25. The hybrid cells have an identifiable chromosome in which the germline DNA has rearranged to encode an antibody that has a binding site for an epitope on gp110 or p25 that has some or all clinical HIV isolates. These monoclonal antibodies can be used in a variety of ways. These include the applications in diagnosis and therapy as well as the application to identify other cross-reactive antibodies, such as blocking antibodies. Peptides or polypeptides containing the epitope (s) with which they react find separate application as immunogens for vaccines or as therapeutic agents.

15

Blocking peptides

Another embodiment of the invention is primarily for use with the above peptides or neutralizing monoclonal antibodies / other peptides or antibodies that interfere with HIV binding to receptors to further reduce HIV infectivity. Preferably, the so-called "blocking peptides" / capable of inhibiting viral proliferation, as well as monoclonal antibodies specific for epitopes contained in such blocking peptides may be used / the efficacy of treating HIV infections to increase. HIV-blocking peptides are typically / corresponding to the HIV amino acid sequence / thought to be essential for attachment of the virus to a host cell, for example, the env-encoded amino acid residues from about 190 to about 197 of _LAVβRU and from about 185 to about 192 of ARV-2 and HTLV-III (BH-IO). These include the peptide T-octapeptide (Ala-Ser-Thr-Thr-Thr-Asn-Tyr-Thr) and its various derivatives (eg, IX below) and analogs (eg, XI, below) described by Pert et al (1986). Proc. Natl. Acad. Ser. USA 83: 9254-9258, hereby incorporated by reference).

16

which is located on the hull glycoprotein (gpl10 or 120).

Of particular interest are, for example, blocking peptides having the following sequences: wherein preferably the NH ^ -terminus is acetylated and the COO.H-terminus is amidated:

IX (173D) Y-Ala-Ser-Thr-Thr-Thr-Asn-Tyr-Thr-Y ¹ ι

X (186) Y-Thr-Thr-Asn-Tyr-Thr -Y ';

XI (187) Y-Thr-Thr-Ser-Tyr-Thr-Y · t

XII (188) Y-Thr-Asp-Asn-Tyr-Thr-Y ¹ t

XIII (189) Y-Asn-Thr-Ser-Tyr-Gly-Y ·;

XIV (190) Y-Asp-Thr-Asn-Tyr-Ser-Y ¹ ;

²⁰ XV (191)

Y-Ala-Val-Phe-Thr-Asp-Asn-Tyr-Thr-Y ' }

wherein for each peptide Y and Y '# if present «each 25

an amino acid sequence of up to about 20 amino acids. Epitopes or antigenic determinants within these peptides are typically defined by at least 5 contiguous amino acids, and are used, for example, to mimic naturally occurring HIV antigen sites in the production of HIV-reactive antibodies and vaccines.

Obtaining monoclonal antibodies

The production of monoclonal antibodies can be carried out by "immortalizing" the expression of nucleic acid sequences

Encode antibodies specific for HIV by introducing such sequences, typically cDNA encoding the antibody, into a culturable host. The inunortalized cell line can produce such a mammalian

animal cell line caused by oncogenesis,

Transfection / mutation or the like was transformed. Such cells include myeloma lines, lymphoma lines or other cell lines capable of inducing expression and secretion of the antibody in vitro. The antibody may be a naturally occurring immunoglobulin of a mammal produced by transformation of a lymphocyte, particularly a splenocyte / by means of a virus, or by fusion of the lymphocyte with a neoplastic cell / myeloma, for example, to form a hybrid cell line. Typically, the splenocyte is obtained from an animal immunized against the HIV virus or a fragment having an epitopic site thereof.

Immunization methods are known / they can be considerable

vary and yet remain effective / see Goding / Monoclonal Antibodies: Principles and Practice / Academic Press / 2nd ed. (1986) / which is incorporated herein by reference. Destroyed viruses / synthetic peptides and bacterial fusion proteins / which contain the antigenic fragments of the gpl10 or p25 molecule can be used as immunogens. Preferably, the immunogen of disrupted viruses / peptides or recombinant proteins is enriched by proteins or fragments thereof / which contain the epitopes / for which antibody producing B cells or splenocytes are desired. In particular, one may include solutions / lysates or extracts of disrupted viruses, or accumulate supernatants of biologically expressed recombinant proteins or destroyed expression vectors by glycoproteins as desired, using purification methods such as polyacrylamide gel electrophoresis.

Lectin affinity purification is a preferred convenient method for purifying gPL10 and other glycoproteins / for example, affinity purification using lentil lectin. The extent to which the glycoproteins are purified from the solutions for use as immunogen / can vary widely / i. from less than 50% to usually at least 75 to 95% / desirably 95 to 99%, and most desirably to absolute homogeneity.

Having purified the proteins to the desired extent, they can be suspended or dissolved in a physiological carrier suitable for immunization, or they can be coupled to an adjuvant. For example, one preferred technique involves adsorption of the proteins and fragments thereof to lectin lectin agarose or another macromolecular carrier for injection. Immunogenic amounts of antigenic preparations / enriched in HIV proteins / including the gPL10 glycoprotein and the p25 core protein (s) are / are generally injected in concentrations ranging from 1 μg to 20 mg / kg of the host. The administration can _; for example, by intramuscular / peritoneal / subcutaneous / intravenous, etc., injection. Administration may be 1 χ or more times and usually at 1 to 4 week intervals. The immunized animals are controlled for the production of antibodies against the desired antigens / subsequently the spleen is removed / the B-lymphocytes of the spleen are isolated and fused with a myeloma cell line or transformed. The transformation or fusion can be carried out in a conventional manner / the fusion method is described in numerous patents / for example in US Pat. Nos. 4,172,124 / 4,350,683 / 4,363,799 / 4,381,292 and 4,423,147; compare also Kennett et al / Monoclonal Antibodies (1980) and those cited therein, and Godin as mentioned above; All of these publications are hereby incorporated by reference.

The immortalized cell lines were cloned and screened according to standard procedures. In the cell supernatants, one may detect the antibodies capable of binding to the desired gpl10 or p25 HIV proteins, the recombinant fusion proteins or the synthetic peptides containing the desired epitope region. Suitable immortalized cell lines may then be grown in vitro or injected into the peritoneal cavity of a suitable host for obtaining Mscites fluid. Because antibodies of interest are present / known to be specific for epitopes / which are present, for example, within the regions / regions defined by the LAV_ _OII genomic region from about bp6688 to about bp 6750 (coding for peptide 29) or from about bp7246 to about 7317 ( coding for peptide 30) (bp numbering according to Wain-Hobson et al., Cell 44: 9 1985 / incorporated herein by reference) / can one / the supernatants can be subjected to a competitive assay with the monoclonal antibodies. Thus, other immortalized hybridoma cell lines with the desired binding properties can readily produce from a variety of sources due to the availability of the antibody of the invention / specific for a particular antigen. Alternatively, one may fuse these cell lines with other neoplastic B cells, these other B cells being able to serve as the recipient for the genomic DNA (s).

Neoplastic rodent B cells, particularly mice or rats, are preferred. However, they may also be derived from other mammalian species / for example from Lagomorpha / cattle / sheep / horses / pigs / birds (Avian) or the like. It is easy to immunize these animals and obtain their lymphocytes, especially the splenocytes, for fusion.

The monoclonal antibodies secreted by the transformed or hybrid cell lines may be from one of the classes or subclasses of the immunoglobulins / such as IgN _f IgD, IgA / IgG, ₄ or IgE. IgG is preferred / because it is about

δ is the most common isotype; used in diagnostic assays. The monoclonal antibodies can be used intact or as fragments / as Fv / Fab / F (ab ') ₂ '. However, they are usually used intact.

In order to circumvent a possible antigenicity of a non-human monoclonal antibody (s), it is possible to construct chimeric antibodies, in which the antigen binding fragment of an immunoglobulin molecule (variable region) is linked by means of a peptide linkage of at least part of another protein is not recognized as foreign in humans / such as the "cast out portion" of a human immunoglobulin molecule. This can be accomplished by fusing the animal's variable region exons to human constant range kappa or gamma exons. For this purpose, the skilled person several methods are known / for example, those / which are described in PCT 86/01533 / EP-A-171496 and EP-A-173494 / to which reference is hereby made.

25

Pharmaceutical Formulations and Applications

The neutralizing activity monoclonal antibodies of the present invention / for example those which react with an epitopic site on gPl10 or p25 or with a blocking peptide can be incorporated as a component of pharmaceutical agents / to weaken HIV infections. The agent should contain a therapeutic or prophylactic amount of at least one of the monoclonal antibodies of the invention together with a pharmaceutically active carrier. The pharmaceutical

₂₁ 2 84 Ü8

Carrier should be a compatible non-toxic substance

be suitable / to mediate the monoclonal antibodies to the patient. One can use sterile water * alcohol »fats / waxes and inert pesticides as a carrier. Pharmaceutical. compatible adjuvants (buffers, dispersants) may also be incorporated in the compositions according to the invention. These agents may contain a single monoclonal antibody /, for example, to be specific for HIV strains with envelope glycoproteins / containing an epitopic site within a region encoded by bp6688 to bp6750. Alternatively, a pharmaceutical agent may contain one or more monoclonal antibodies and form a "cocktail." For example, a cocktail / monoclonal antibody to various HIV strains contains / is a universally applicable product with therapeutic or prophylactic activity against most clinical HIV isolates. The cocktail may contain monoclonal antibodies / bind to HIV proteins or glycoproteins. which differ from gPl10 or p25 / such as gp41 glycoprotein or p34 nuclease / integrase. The molar ratio of the various monoclonal antibody components generally does not differ by more than a factor of 10 / more particularly by not more than a factor of 5, and is generally about 1: 1-2 per each other antibody component.

The monoclonal antibodies of the present invention can be used as a separate agent to be co-administered with other anti-retroviral agents, including blocking peptides. The current state of development of anti-retroviral agents and anti-HIV agents is described in detail in Mitiuya et al., Nature 325: 773-778 / 1987, which is incorporated herein by reference.

The monoclonal antibodies, peptides and pharmaceutical agents of the invention are particularly useful for oral and parenteral administration. Preferably, the pharmaceutical agents are administered parenterally, i. δ subcutaneously, intramuscularly or intravenously. The present invention therefore also provides means for parenteral administration comprising a solution of monoclonal antibodies, peptides or a cocktail thereof in an acceptable carrier, preferably an aqueous carrier. One can use a variety of aqueous carriers, for example, water, buffered water, 0.4% saline, 0.3% glycine, and the like. These solutions are sterile and generally free of particles. The agents can be sterilized by conventional and known methods. The compositions may contain pharmaceutically acceptable excipients as required to adjust approximately physiological conditions, such as pH adjusters and buffers, toxicity adjusting agents, and the like, for example, sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate, and the like , The amount of antibody in these formulations can vary widely, i. less than about 0.5 weight percent, usually about or at least about 1 weight percent, up to 15 or 20 weight percent. This amount is chosen mainly with regard to liquid volumes, viscosities and the like, and preferably with regard to the mode of administration.

A typical pharmaceutical agent for intramuscular injection may thus contain 1 ml of sterile buffered water and 50 mg monoclonal antibodies. A typical intravenous infusion may contain 250 ml of sterile Ringer's solution and 150 mg of monoclonal antibody. Methods for the preparation of parenterally administrable agents are known or are familiar to the person skilled in the art and are described in detail, by way of example.

in Remington's Pharmaceutical Science / 15th Edition / Mack Publishing Company / Easton, Pennsylvania (1980) / which is incorporated herein by reference.

The monoclonal antibodies according to the invention peptides can be lyophilized for storage and reconstituted before use in a suitable carrier. This method has been shown to be effective with common immunoglobulins. One can apply known Lyophilisiorungs- and reconstitution techniques. It will be apparent to those skilled in the art that lyophilization and constitution can lead to a different degree of antibody activity loss (in conventional immunoglobulins, IgM antibodies are prone to more loss of activity than IgG antibodies) and therefore the amount applied must be adjusted. to compensate for the loss.

The agents / monoclonal antibodies / peptides or cocktails thereof of the invention may be administered for prophylactic and / or therapeutic treatment of HIV infection. In therapeutic administration, the agents are a patient / to cure sufficient / to the infection and its associated complications or to bring at least partly to a halt administered in an amount / the already mi ¹ HIV infected /. The dose needed / achieved to achieve this is defined as "therapeutically effective.""Osis". The effective amounts for this application depend on the severity of the infection and the general condition of the immune system.

oQ systems of the patient / are generally in the range of about 1 to 200 mg of antibody per kg of body weight / with dosages of 5 to 25 rag per kg are usually used. Since the products of the invention are generally associated with serious illnesses / i. in life-threatening

_g5 or potentially life-threatening situations, it is possible and may be

would like to · administer a significantly greater amount of these antibodies.

In prophylactic use, the agents are administered with the peptides / antibodies of the invention or a cocktail thereof "a patient" who has not yet been infected with HIV "but who may have recently been exposed to or have suspected such infection" that he has been exposed was or is at risk of being exposed to the virus. Prophylactic administration serves to "strengthen the patient's resistance to a potential infection or vaccinate the patient against the virus. An appropriate amount is defined as a "prophylactically effective dose".

Also with this application the exact ones are to be repaired

Sufficient quantities according to the state of health and the general state of the immune system of the patient »they are generally in the range of 0» l mg to 25 mg per kg »in particular 0/5 mg to 2» 5 mg per kg.

One can single or multiple administrations of funds

The dosage and administration regimen are selected by the attending physician. The pharmaceutical formulations should in any case provide a quantity of antibodies according to the invention

sufficient »to treat the patient effectively.

In addition, the monoclonal antibodies according to the invention are used as target-specific carrier molecule.

An antibody can bind to a toxin to form an immuno-30

toxins, or to a radioactive material or drug agent for the formation: of a radiopharmaceutical or drug. Methods for producing immunotoxins and radiopharmaceuticals are known (see, for example, Cancer Treatment

Reports 68: 317 (1984))

 35

It is also possible that heteroaggregates of monoclonal antibodies according to the invention and human T-cell activators, such as monoclonal antibodies to the CD3 antigen or to the F -J ^ receptor on T cells, human T cells or F-Jf * enable cells (such as K cells or neutrophils) to kill HIV-infected cells via antibody-dependent cell-mediated cytolysis (ADCC). Such heteroaggregates may be formed, for example, by covalently cross-linking the anti-HIV antibodies with the anti-CD3 antibodies using the heterobifunctional reagent N-succinimidyl-3- (2-pyridyldithiol * propionate as described by Karpowsky et al. , J. Exp. Med. 160: 1686 (1984), which is hereby incorporated by reference.

The peptides-based compositions of the invention alone may also find therapeutic use, the administration resulting in a reduction or elimination of HIV from an infected host. These means, like

Peptide 29, the blocking peptides and peptide 126,

which is described in USSN 930785, which is hereby incorporated, can be administered in suitable physiological carriers intravenously, subcutaneously, intramuscularly, intraperitoneally, etc. Various carriers are suitable, including phosphate buffered saline, saline, water, potassium chloride, sodium lactate, or the like. The peptide concentration may vary widely depending on the final application, activity and mode of administration. Preferably, the peptides have an amidation of the COOH-terminus, a forrylation of the NH 2 -terminus or another pharmaceutically acceptable derivatization. The addition of blocking peptides to the peptides that mimic a neutralizing HIV region and / or the specifically reactive inventive

Antibodies lead to a significantly increased therapeutic efficacy. The formulations may also contain other anti-HIV agents (other than the monoclonal antibodies binding the peptides), such as 3'-azido-3'-deoxythymidine, 2'-3'-dideoxycytidine, 2'/ 3'- Dideoxy-2 · # 3'-didehydrocytidine etc.

Application of monoclonal antibodies to the immune system

affinity cleaning _,

The monoclonal antibodies specific for polypeptides / containing gPL10 or other antigenic determinants / particularly those antigenic determinants / derived from biologically expressed recombinant fusion proteins or lysates or extracts of cultured HIV * are particularly useful in purification procedures. In general, the

Antibody affinity constants (affinity association

8-12 constants) in the range of 10 to 10 M. Such antibodies can be used to purify recombinant fusion proteins from the culture medium of the recombinant expression system / when the expressed protein is secreted / from the components of the disrupted biological expression system / if the protein is not is secreted. The monoclonal antibodies / capable of reacting with gPL10 or other antigenic determinants are generally bound or immobilized to a substrate or support. The solution / containing the HIV antigenic determinants is then contacted with the immobilized antibody under conditions appropriate for the formation of immune complexes between the antibody and the polypeptides containing the gpl10 antigen determinants. Unbound material is separated from the bound immune complexes

Complexes or the gPL10 antigen fragments are then separated from the carrier.

The monoclonal antibodies are typically purified before being bound to the carrier / survived from ascites fluid or cell culture. Such purification processes are known to the person skilled in the art / this includes fractionation with neutral salts at high concentration. Other methods such as DEAE chromatography / gel filtration chromatography, preparative gel electrophoresis or protein A affinity chromatography / can also be used / to purify the monoclonal antibodies before they are used as immunoadsorbent.

The carrier / on which the monoclonal antibodies are immobilized should have the following general properties:

(a) generally weak interactions with

Proteins / to minimize non-specific binding /

(b) good flow properties / permitting high molecular weight material flow

^ b ( _c ) presence of chemical groups / which can be activated or modified / to facilitate chemical binding of the monoclonal antibody

(d) physical and chemical stability under conditions / conditions applicable to monoclonal antibody binding and

(e) stability against the conditions and constituents of the buffers / for the adsorption and elution of the buffers

Antigens are required. Some usually ver-35

used carriers are agarose, derivatized polystyrenes / polysaccharides, polyacrylamide beads / activated cellulose / glass and the like. There are various chemical methods used to attach the antibodies to the substrate carriers / see generally Cuatrecasas P. Advances in Enzymology 36:29 (1972). The antibodies of the invention can be attached directly or alternatively via a link or spacer (linker / spacer) to the support.

The general conditions required for the immobilization of monoclonal antibodies to chromatographic supports are known. See, for example, P. Tijissen / 19851 Practice and Theory of Enzyme Immunoassay / which is incorporated herein by reference. The actual coupling method used depends to a small extent on the property and the type of antibody to be coupled. Monoclonal antibodies have properties / are usually consistent from lot to lot / so that the mentioned conditions can be optimized. The linkage is typically via covalent bonds.

To the separation matrix is then added a suspension of extracts or lysates of HIV virus / the supernatant from a cultured biological expression system or a suspension of the disrupted cells. The mixture is incubated under conditions and for a time sufficient to form the immune complex / usually at least 30 minutes / more conveniently 2 to 24 hours. The immune complexes / polypeptides with antigenic parts of gPL10 contain / separate from the reaction mixture. For example, the mixture is removed by elution and the bound immune complexes extensively washed with adsorption buffer. The immune complexes can then be detected by the

Eluting separation matrix using an eluant / compatible with the carrier used. Such eluents are known in the art. Also, the polypeptides / gPL10 or other antigenic parts can be selectively removed. For example, peptides / containing an epitope / recognized by the antibodies / can be used to compete for antibody binding sites. This represents an alternative elution process / which can be carried out under mild elution conditions. The selectively adsorbed polypeptide / containing the gPL10 antigen can be eluted from an antibody affinity adsorbent / by changing the pH and / or ionic strength of the buffer. Chaotropic agents are also used to remove the bound antigen. The choice of a chaotropic agent / its concentration and the elution conditions depend on the characteristics of the antibody-antigen interaction , but once established they should / should not be subject to change / are commonly required in polyclonal affinity separation systems.

It may be necessary to adjust the pH of the eluted material to the physiological pH / if a high or low pH or ionic strength buffer was used / to separate the bound gPL10 antigens from the separation matrix. Also, dialysis or gel filtration chromatography may be required to remove excess / eluent-used salts / to allow reconstitution of gpl10 or polypeptides / antigen fragments of gpl10 / to native conformations.

For example, the methods of the present invention yield substantially pure gPl10 or substantially pure polypeptides / containing antigenic fragments thereof

either naturally by infected cell cultures or recombinant expression systems of bacteria / yeasts or cultured insects or mammalian cells. gPL10 / the fragments thereof or other purified proteins typically have a purity greater than 50% / usually at least 75%, and often greater than 95 to 99%. These products have many uses.

The HIV-gpl10 proteins that contain polypeptides / antigen fragments thereof or other proteins that have been substantially purified by the method of the present invention have many uses. These include AIDS subunit vaccine formulations / in which the immunogen comprises an effective dose of antigenic determinants of, for example, gPL10 or a neutralizing region thereof. Other components of the formulation may include those antigenic portions of HIV proteins or glycoproteins which stimulate the production of antibodies (preferably neutralizing antibodies) in an immunized host / which antibodies are capable of / / a protective against subsequent HIV infection exercise.

Application of monoclonal antibodies in the diagnosis

The monoclonal antibodies of the invention are also useful for diagnostic purposes. They can be marked or unmarked for this purpose. Typically, a diagnostic assay involves the detection of complex formation by the binding of a monoclonal antibody to an HIV antigen.

Unlabeled antibodies are used, for example, in agglutination assays. In addition, unlabelled antibodies may be used in combination with other labeled antibodies (Breiten antibodies) / reactive with the monoclonal antibodies, such as antibodies / specific antibodies

QQ for immunoglobulin are / are used. Alternatively, the monoclonal antibodies can be labeled directly

become. It is possible to use a variety of labels, for example, radionuclides, fluorescent substances, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, ligands (especially haptens), etc. Numerous types of immunoassays are available, including those described in US Pat 817 827 «

3,850,752, 3,901,654, 3,935,074, 3,984,533, 3,996,345,

4 034 074 and 4 098 876 are hereby incorporated by reference.

10

The monoclonal antibodies and peptides according to the invention are usually used in enzyme immunoassays, for example where the antibodies according to the invention or the second antibodies of another species are conjugated to an enzyme. When a biological sample containing HIV antigens, such as human blood serum, saliva, semen is used Vaginal secretions or a virus-infected cell culture suspension "combined with the antibodies, a bond between the antibodies and those molecules" is the desired

Epitope. One can then such proteins or

Separate virus particles from the unbound reagents and add a second antibody (labeled with an enzyme). Subsequently, the presence of the antibody-enzyme conjugate "which is specifically bound to the antigen is determined. It is also possible to use other conventional methods known to the person skilled in the art.

To detect HIV infection or the presence of HIV antigens, one can also provide kits using the antibodies of the invention. The monoclonal antibody compositions of the present invention may be provided, usually in lyophilized form either alone or in conjunction with other antibodies specific for other HIV epitopes. The antibodies "which may be conjugated to a label or may be unconjugated" are included in the kits along with buffers such as

Tris # phosphate / carbonate buffers, etc. # Stabilizers, biocides / inert proteins such as bovine serum albumin or the like. Generally, these materials will be present in an amount of less than about 5 weight percent based on the amount of active antibody and usually in a total amount of at least about 0/001 weight percent based on antibody concentration. It is often desirable to have an inert extender or excipient to dilute the active ingredients, and the excipient may be present in an amount of about 1 to 99 weight percent of the total composition. If a second antibody capable of binding to the monoclonal antibodies is used, it is usually in a separate vial. The second antibody is typically conjugated to a label and formulated in an analogous manner as the antibody formulations described above.

The detection of gPl10 or p25 antigens or the

Whole virus in biological samples is used in the diagnosis of HIV virus infection. Biological samples include, but are not limited to / blood serum / saliva / semen / tissue biopsy samples (brain / skin / spleen, etc.) / cell culture supernatants / disrupted eukaryotic and bacterial expression systems and the like. The presence of the virus is tested by incubating the monoclonal antibodies with the biological sample under conditions which lead to immune complex formation and subsequent detection of complex formation. In one embodiment, complex formation is detected by the use of a second antibody capable of binding to a monoclonal antibody / which is typically conjugated to a labeling agent and formulated in a manner analogous to the antibody formulations described above. According to another embodiment, the monoclonal antibody is bound to a solid

phasepträger bound «which is then brought into contact with the biological sample. After incubation, the labeled monoclonal antibody is added / to detect the bound antigen.

Production and application of synthetic peptides The invention also provides new peptide *? available / the

inter alia immunologically mimicking the protein epitopes / encoded by the HIV retrovirus / in particular the epitopes / encoded within the env or gag regions of the viral genome / which encode the gpl10 or p25. In order to adapt to the different ratios of strain to strain in the respective isolates, one can make an adjustment for conservative substitutions and a choice among alternatives with non-conservative substitutions. These peptides can be used to inhibit or eliminate HIV antigen production in vitro or in vivo, as immunogens for the detection of the virus or. Antibodies used to insert the virus in a physiological sample. Depending on the nature of the scheme, one may conjugate the peptides to a carrier or to other compounds which are labeled or unlabeled / attached to a solid

Surface bound etc. are present.

In one embodiment, the peptides of the invention are derived from the gPL10 region of the virus. Of particular interest is the region within the open env reading frame extending from about base pair (bp) 6698 to about bp6750 and from about bp7246 to about 7317, respectively. The peptides of interest, including blocking peptides, comprise at least 5, sometimes 6, sometimes 8, sometimes 12, sometimes 21, often less; as about 50, more preferably less than about 35, and more preferably less than about 25 amino acids in a sequence encoded by an HIV retrovirus.

Desirably, the peptides are as small as possible / yet contain substantially all of the immunoreactivity or artiviral activity of a larger peptide. In some cases, it may be desirable to "join two or more non-overlapping oligopeptides / to form a single peptide structure" or to use them as single peptides simultaneously / these peptides have, separately or together, equivalent sensitivity of the starting material.

The peptides can be modified by introducing conservative or non-conservative substitutions, generally with less than 20% points, especially less than 10% points, of the amino acids being exchanged. When polymorphic regions are present, it may be desirable to change one or more particular amino acids to more efficiently mimic the different epitopes of the various retrovirus strains. Frequently, methionine will be replaced by norleucine (Nor) to achieve chemical stability.

It should be pointed out that the peptide to be used according to the invention need not be identical to a particular HIV polypeptide sequence / as long as the compound in question is capable of immunological coordination with the proteins of at least one strain of HIV Retrovirus. The subject peptides can therefore be altered in a variety of ways, for example, by insertions / deletions and substitutions in a conservative or non-conservative manner, if such changes entail application preferences. By conservative substitution is meant substitutions / within the groups / as gly / ala; val / ile leu; asp / glu; asn / gin; sor / thr; lys / arg; phe / tyr; and nor / met. Usually, the sequence will not differ by more than 20% from the sequence of at least one strain of HIV retrovirus / unless further amino acids are present on the two

Termini can be added / to provide an "arm" / by means of which the peptide according to the invention can be immobilized in a simple manner. The arms are usually at least one amino acid in length and may be 50 or more amino acids / more usually 1 to 10 amino acids / long.

The peptide / amino acid sequence modified by substitution / addition or deletion of amino acid residues is / should retain substantially all of the immunoreactivity or antiviral activity of the unmodified peptides. This can be readily determined by various assays described herein. If desired, one may use the d-isomer of one or more amino acids / to modify the biological properties / such as the activity / degradation rate and the like /.

In addition, one or two or more amino acids may be added to the termini of an oligopeptide or peptide to facilitate coupling of the peptides together for coupling to a carrier or larger peptide / for the reasons explained below / for modifying the physical or chemical properties of the peptide Peptides or oligopept. Ds or the like.

Amino acids / such as tyrosine / cysteine / lysine / glutamic acid or aspartic acid or the like / can be introduced at the C- or N-terminus of the peptide or oligopeptide / to provide suitable functionality for linking, cysteine is particularly preferred for facilitating covalent attachment to others Peptides or to form polymers by oxidation.

In addition, the peptide or oligopeptide 3g sequences can be separated from the natural sequence by a sequence

distinguished by terminal NH ₂ acylation, for example, acetylation or amidation with thioglycolic acid, terminal Carbo> .yamidierung, for example, with ammonia or methylamine are "modified" for better stability, increased hydrophobicity for connection with or binding to a carrier or a other molecule or to achieve a polymerization.

A preferred embodiment of the above-described

Peptides I to VIII and IX to XV, when Y or Y ¹ are present, are present, for example, when Y or Y ¹ comprises one or more cysteine residues or a combination of one or more cysteine residues with spacer amino acids. Glycine is a particularly preferred spacer. Preferred peptides for use in oxidative polymerization are those in which Y or Y ^{1 represent} at least two cysteine residues. When two cysteine residues are present at the same end of the peptide, a preferred embodiment is "when the cysteine residues are separated by 1 to 3 spacer amino acid residues", preferably glycine. The presence of cysteine residues may allow the formation of peptide dimers and / or increase the hydrophobicity of the resulting peptide, which facilitates immobilization of the peptide on solid phase or immobilized assay systems.

Of particular interest is the use of mercaptan groups of cysteines or thioglycolic acids or the like used to acylate the terminal amino groups to link two peptides or oligopeptides, or combinations thereof, through a disulfide bridge or bridge to form polymers containing a series of epitopes. Such polymers have the advantage of an enhanced immunological reaction. When different peptides are used to make the polymer, they also have the ability to produce antibodies

which are immuno-responsive to some antigenic determinants of various HIV isolates.

The formation of antigenic polymers (synthetic multimers) may involve compounds having bis-haloacetyl groups * nitroaryl halides or the like / wherein the reagents are specific for thio groups. The linkage between two mercapto groups of different peptides or oligopeptides may thus be a single bond or a link of at least 2, usually at least 4 "and not more than about 16", usually not more than about 14 carbon atoms.

The peptides in question may be used bound to a soluble macromolecular tracer (for example not less than 5 kDal). Conveniently, the carrier is a naturally occurring or synthetic poly (aminoacid) against which antibodies in human serum are unlikely. Examples of such carriers are poly-L-lysine / keyhole limpet-hemocyanin / thyroglobulin / albumins / such as bovine serum albumin / tetanus toxoid, etc. The choice of carrier will depend primarily on the intended use for the antigen and will depend on the convenience and availability of the carrier carrier. In such conjugates there is at least 1 molecule of at least one peptide per macromolecule and not more than 1 per 0/5 kDal / usually not more than about 1 per 2 kDal of the macromolecule /. One or more different peptides can bind to the same macromolecule.

The compound is conventionally using

of reagents / such as p-maleimidobenzoic acid, p-methyldithiobenzoic acid / maleic anhydride / succinic anhydride / glutaraldehyde, etc. Binding may occur at the N-terminus / C-terminus or between the ends of the molecule.

The peptide can be derivatized by linking /

while bound to a carrier or the like.

To detect the presence of antibodies to retroviral proteins

or of retroviral proteins themselves / one can proceed according to different / familiar to those skilled in the assay method. Of particular interest is to use the peptide as the labeled reagent / wherein the labeling agent provides a detectable signal / or bind the peptide directly or indirectly to a surface / wherein the antibody against the peptide in the sample to the peptide on the surface bound becomes. The presence of a human antibody / bound to the peptide (s) may then be by use of a xenogeneic antibody specific for human immunoglobulin / normally both human IgM and IgG / or a labeled protein specific for immune complexes / for example the Rf factor of S. aureus protein A.

An example of an assay method is the use of a sample container / wells of microwell plates, for example, wherein the polypeptide or conjugates thereof are covalently or non-covalently adsorbed to the bottom and / or walls of the container. The sample / usually human blood or serum / diluted with a suitable buffer medium / is added to the container and allowed sufficient time to pass until complex formation between the polypeptide (s) and a corresponding antibody in the

Sample is done. Remove the supernatant and wash

the container for removal of non-specifically bound proteins. For detection, use is made of a labeled specific binding protein * that specifically binds to the complex / such as xenogenic antiserum to human immunoglobulin.

The peptide can be prepared in a variety of ways. The peptide can be synthesized due to its relatively short length in solution or to a solid support according to conventional methods. Various automatic synthesizers are commercially available and can be used in a known manner. See, for example, Stewart and Young / Solid Phase Peptide Synthesis / 2nd Edition / Pierce Chemical Co./1984; and Tarn et al. J. Am. Chem. Soc. (1983) 105: 6442.

Alternatively, one may use hybrid DNA technology, where a synthetic gene is generated using single strands / which encode the polypeptide, or from substantially complementary strands thereof, where the single strands overlap and in an annealing medium can be brought together / to hybridize. The hybridized strands can then be ligated to a complete gene and the gene inserted by selecting appropriate termini in readily available expression vectors today. See, for example, Maniatis et al., Molecular Cloning, A Laboratory Manual, CSH, Cold Spring Harbor Laboratory, 1982. Or man may clone and express the region of the viral genome (s) encoded by the peptide by conventional recombinant DNA techniques (see above Maniatis et al.).

DNA code sequences of LAV _DDM and ARV 2 isolates of HIV /

BKU

which can be used to express the peptides include the following: 30

40 2 B 4089

LAV _pRU TGT ACA AGA CCC AAC AAC AAT ACA AGA AAA AGT ATC CGT ATC CAG AGG GGA CCA GGG AGA GCA TTT GTT ACA ATA GGA AAA ATA GGA AAT ATG AGA CAA GCA CAT TGT

ARV-2 TGT ACA AGA CCC AAC AAC AAT ACA AGA AAA AGT ATC TAT ATA GGA CCA GGG AGA GLA TTT CAT ACA ACA GGA AGA ATA ATA GGA GAT ΑΤΑ AGA AAA GCA CAT TGT

For expression of peptide fragments one can use fragments of a sequence. Conservative base changes may be coded (where the modified codon (s) encode (s) for the same amino acid (s); or non-conservative base changes in the coding sequence / wherein the amino acid obtained may be a conservative or non-conservative change in amino acid sequence / as described above.

* The code sequence may be extended at the 5 'or 3' terminus or both / to extend the peptide / while retaining the epitope site (s). The extension may serve to create an arm for attachment to, for example, a label product / enzyme such as two or three

*** to link all peptides together in the same chain / provide antigenic activity and appropriate restriction sites for cloning or the like.

The DNA sequence itself / fragments thereof or larger sequences / usually at least 15 bases / preferably at least 18 bases can be used as nucleotide probes for the detection of retroviral RNA or proviral DNA or for the identification of homologous regions for cloning or sequencing methods described / _w ith the Grunstein-Hogness method / Southern method /

Northern method, dot blot, improvements thereof as well

other methods such as those described in U.S. Patent 4,358,535, which is incorporated herein by reference.

The peptides of the invention, including the

blocking peptides and their analogs find application alone or in combination in vaccines. Similarly, vaccines can also use anti-idiotype antibodies, i. Antibodies that react with the idiotype of the antibodies of the invention and thereby contain epitopes that mimic the neutralizing HIV regions. The peptides or anti-idiotypic antibodies may be formulated in a conventional manner, generally in concentrations ranging from 1 pg to 20 mg / kg of the host.

Physiologically acceptable media may be used as the carrier, for example, sterile water, saline, phosphate buffered saline, and the like. Adjuvants such as aluminum hydroxide gel, surfactants such as lysolecithin, pluronic polyols, polyanions, peptides, proteins (e.g., diphtheria and cholera toxin) and oil emulsions may be employed. The peptides can also be incorporated into vaccine formulations and liposomes or conjugated to polysaccharides, polypeptides or polymers. Administration may be by injection, for example intramuscularly, peritoneally, subcutaneously, intravenously, etc. Administration of an immunogenically effective dose may be one or more times, usually at intervals of 1 to 4 weeks. An "immunogenically effective dose" is that amount of a vaccine that is capable of eliciting an immune response in a host, the host exhibiting an increased infection.

The following examples illustrate the invention without limiting it.

42 2 64 08

Example I

Generation and Characterization of Monoclonal Antibodies 5

Example I describes the generation of hybrid cell lines / which produce monoclonal antibodies / which are specific for HIV whole glycoproteins. This method comprises the

Application of lectin-purified extracts of LAV _n -,. /

'

which is bound to lentile lectin agarose as an immunogen.

The monoclonal antibodies subsequently produced by the hybrid cell lines are characterized by their ability to immunoblot gpl10 from purified LAV and to precipitate in a radioimmunoassay and as a biologically expressed recombinant fusion protein. The monoclonal antibodies / binding to the epitopes on gpl10 also react and react in ELISA's with disrupted whole virus / fusion proteins and synthetic peptides

with whole viruses in indirect fluorescence assays. 20

Generation of the monoclonal antibody-producing hybrid cell lines and characterization of the antibodies are as follows:

LAV viruses / infected CEM cells (ATCC No. CRL 8904)

were purified / destroyed in 50mM Tris / pH 7/4/0 / 15M NaCl / IfJO% aprotinin / 2/0% Nonidet P-40 ^v '(NP-40) (octylphehoxypolyethoxyethanol). The extract was clarified 2 χ by centrifugation and passed through to 0/5% NP-40

QQ Added 3 volumes of disruption buffer without NP-40. Lentil lectin-pharose (Pharmacia / Piscataway / N.J.) was prewashed in disruption buffer without NP-40 and then in adsorption buffer (50 mMTtLs ₁ pH 7/4 / 0.15 M NaCl., 1.0% aprotinin, 0.5% NP-40).

o _he clarified virus extract was treated with lentil lectin

sepharose adsorbed at 4 ⁰ C for 42 h. Unadsorbed material was removed by washing with excess adsorption buffer. The elution of the adsorbed material was performed with Ο »2 M 6 ^ -methylmannoside in adsorption buffer. The eluate was dialyzed against PBS to remove the sugar and the material was re-adsorbed on lentil lectin-pharose.

The glycoprotein-lentil lectin-pharose complex was used to immunize BALB / c mice with three adjuvanted intraperitoneal injections given at intervals of 2 to 3 weeks. The spleen of immunized mice was removed. Immunoblot RIP and / or ELISA reveals circulating antibodies to glycoproteins.

Generally, Kohler and Milstein (Nature 256: 495 (1985)) used the modifications of LC GoIdstein et al., (Infect. Immun., 38: 273 (1982)) to generate cell lines. The spleen B lymphocytes from the immunized mice were fused with NS-1 myeloma cells using 40% (w / v) polyethylene glycol. Following fusion, the cell mixture was resuspended in HAT medium (RPMI-1640 supplemented with 15% fetal calf serum / 1χ10-M hypoxanthine / 4χ 10 M aminopterin and 1/6 χ 10 M thymidine) for the Growth of the hybrid cells to be selected and then placed on 96-well microculture plates at a concentration of 1 to 3 χ ΙΟ "* cells / ml and incubated at 37 ⁰ C in a humid atmosphere / 6% CO _2. The cultures were half of the supernatant was replaced with fresh HAT medium, and the wells were examined for signs of cell proliferation using a plankton microscope.

3 g proliferation is observed and once the cells have an

The supernatants were / were tested for anti-LAV antibodies.

Those wells "that contain antibodies to LAV-producing hybridoma cells" were identified by ELISA ¹ S, whereby the binding to purified "destroyed whole viruses" or biologically expressed fusion proteins was determined. The ELISA assays using disrupted viruses were performed on LAV EIA plates (Genetic Systems "Seattle" Washington). The plates were incubated with cell culture liquid at 37 ⁰ C for 45 min. And then washed with 3 χ 0/05% Tween 20 in phosphate buffered saline (PBS-Tween).

Ϊ6 peroxidase goat anti-mouse IgG (1: 2,000 dilution in PBS-Tween; Zymed Laboratories "Inc." South San Francisco, "California) was added (100 μΐ per well) and the plates 45 min at 37 ^0th C and washed as above. Substrate was added (0/025 M citric acid "0/05 M dibasic sodium phosphate" pH 5 "containing 14 mg o-phenylenediamine and 10 μΐ 30% hydrogen peroxide per 50 ml) and the plates were left in the dark at room temperature for 30 min incubated. The reaction was quenched with 3N sulfuric acid and the colorimetric reactions were quantitated with an automatic microplate reader. Those wells "that gave positive results" were subcloned by limiting dilution "were again tested for specificity and then expanded.

The monoclonal antibodies secreted by the resulting hybrid cell lines were further evaluated for specificity and reactivity by immunoblotting "immunoprecipitation and ELISA using destroyed LAV viruses" of recombinant LAV fusion proteins and synthetic LAV

3g peptides characterized. It turned out that other antibodies were of the IgG isotype. Cell lines HIV-gpllO-1 «

Si5 Si__

HIV gpl10-2 and HIV gpl103 were in the Amercian Type

Culture Collection deposited before filing this application and have the deposit nos. ATCC HB 9175 / HB9176 and HB9177

 5

The recombinant fusion proteins tested for their reactivity were designated ENV2, ENV3, ENV4 and ENV5. The protein ENV2 is expressed from pENV2 (ATCC No. 53071) and comprises the LAV region from base pair (bp) 6598 to bp 7178 (numbering according to Wain-Hobson et al., Cell 44: 9 (1985). EI / V3) from pENV3 (ATCC No. 53072) and comprises the LAV region from bp 7178 to bp 7698. ENV4 is expressed from pENV4 (ATCC No. 53073) and comprises bp7698 to bp 8572. ENV5 is derived from pENV5 (ATCC No. 53074). and covers the LAV region from bp 5889 to bp 7698. The production of the recombinant fusion proteins is described in detail in UPS No. 721,237, incorporated herein by reference.

Assembly of synthetic peptides

Peptides I (29) and VIII (110-2-2) were assembled on a benzhydrylamine resin (polystyrene / divinylbenzene (Applied Biosystems / Inc. / Foster City / California).

Peptide V (177) was isolated on a t-butyloxycarbonyl (Boc) -

ethylbenzylcysteine-phenylacetarnidomethv] / pam) -polystyrene / divinylbenzene resin. Symmetric anhydride couplings were performed in an Applied Biosystems 430A Synthesizer. Cysteine was the first

Rest added to the two peptides.

Couplings with dicyclohexylcarbodiimide in the presence of hydroxylbenzotriazole were used for asparagine and glutamine. The protecting groups used were side chains based on benzyl groups and Boc-oO aminguppsn. Further

Side chain protecting groups routinely used were Boc (formyl) -tryptophan / Boc-methionine sulfoxide / Boc (tosyl) arginine, Boc (methylbenzyl) cysteine, Boc (tosyl) -histidine / Bocfchlorbenzyloxycarbonyl) lysine and Boc (bromobenzyloxycarbonyl) tyrosine.

The radiolabeling of the peptides was carried out by acetylation of the amino terminus with Η-acetic acid and an excess of dicyclohexylcarbodiimide.

Removal of the protecting groups and cleavage of the peptide from the resin was done according to the Tarn "low-high" HF method (Tarn et al / supra). The extraction of the resin was carried out with 5% acetic acid and the extract was subjected to gel filtration chromatography in 5% acetic acid.

Synthetic HIV peptides / tested for reactivity with the monoclonal antibodies included peptides 29/36 and 39. Peptide 29 is encoded by the LA \ _.. genome region from about bp 66Θ8 to bp 6750; peptide 36 is encoded by the range from about bp 7246 to bp 7317; and peptide 39 is encoded by the range of about bp 7516 to bp7593. Peptides 36 and 39 are described in detail in U.S. Patent 4,629,783, incorporated herein by reference.

The blocking peptides IX-XV were assembled essentially as described above on a methylbenzhydrylamine resin (polystyrene / divinylbenzene) (Applied Biosystems / Inc. Foster City, California). Symmetric anhydride couplings were performed on an Applied Biosystems 430A synthesizer. For asparagine, couplings with dicyclohexylcarbodiimide in the presence of

Hydroxybenzotriazole used. As protective groups, side effects

benzyl group-based chains and boc-i ^ amine protecting groups were used, whereas Boc (bromobenzyloxycarbonyl) was used specifically for tyrosine side chains. Acetylation was carried out / if present / using acetic anhydride or glacial acetic acid and dicyclohexylcarbodiimide. Deprotection and cleavage of the peptide from the resin was done according to the "high" standard HF procedure (Stewart et al., Supra). Extraction from the resin was done with 50% acetic acid and the extract was then subjected to gel filtration chromatography in 20% acetic acid. If desired, high pressure liquid chromatography was performed on a Vydac Cl8 column (Rainin Instrument Co., Emeryville, CA) using a 0/1% trifluoroacetic acid-acetonitrile gradient.

immunoblotting

Immunoblotting characterization was performed on clone supernatants or ascites fluid using purified LAV viruses and recombinant fusion proteins as antigens. The antigens were first separated by polyacrylamide gradient gel electrophoresis (7/0 - 15/0%) and transferred to a nitrocellulose membrane (NCM) by 4-hour electrophoresis at 25 V in 25 mM sodium phosphate (pH 7/0). After transfer, the NCM was blocked by incubation for 1 h at room temperature in PBS-Tween or Blotto (5% low-fat dry milk in PBS) / to prevent nonspecific interactions. The NCM was incubated with cell culture supernatant or ascites fluid / diluted in PBS-Tween / 1h at room temperature and rinsed 3χ with PBS-Tween. In the second step, the NCM was incubated with goat anti-mouse IgG horseradish peroxidase / diluted in PBS-Tween / 1 h at room temperature. Following incubation, wiu-de washed with PBS-Tween / followed by 20 minutes immersion in horseradish peroxidase color developing solution (Bio-Rad Laboratories / Richmond, California).

The reaction was made by immersion in deionized water. The monoclonal antibody activity was compared to a positive control serum reacted with purified disrupted virus or expressed fusion protein. It turned out that with the use of destroyed virus preparations all antibodies bound to gpl10 or its precursor molecule gpl5O. Antibodies 110-1 and 110-2 also recognized the ENV3 fusion protein whereas antibodies 110-3 # 110-4, 110-5 and 110-6 convert ENV2 to an immunocomplex.

immunoprecipitation

Virus extracts for radioimmunoprecipitation were prepared from CEM cells / which were immunized with LAV__ _M HIV isolate.

Oku

were fused by continuous passage to the lytic growth. Once early cytopathic effects were demonstrated, the cells were transferred to labeling media / the S-methionine

(0/05 mCL / ml) or [h] -glucosamine (0/025 mCi / ml) / then incubated for 24 h / until most of the cells had lysed and released the virus into the culture supernatant. Viruses were pelleted from the cell-free supernatant (1 h at 100,000 xg) and detergent extracts were added to P-RIPA buffer (phosphate buffered saline, I / O% Triton X-100, 0% deoxycholate, 0/1% SDS and 1% aprotinin). Similar extracts were prepared from the supernatants of uninfected CEM cells.

Immunoprecipitation assays were performed with 100 μM virus extract which was incubated on ice with 100 μM culture supernatant from the hybrid cell lines for 1 h. 4 μM rabbit anti-mouse Ig (Zymed Laboratories, San. San Pransisco, California) were added to each sample and incubated for 30 min. To each sample was added immunoprecipitin (100 μΐ;

Bethesda Research Laboratory "Bethesda, Maryland) resuspended in P-RIPA buffer / containing 1% ovalbumin and incubated for an additional 30 min. The bound complexes were washed and separated by SDS-polyacrylamide gel electrophoresis (15/0% acrylamide: DATD-GeI). Following electrophoresis, the gels were fixed / soaked in Enhance (New England Nuclear, Boston, Mass.) And contacted with a Kodak XR-5 film. A positive reference serum / immunoprecipitate with all HIV virus proteins / was reacted as positive and negative control with virus-infected and mock-infected CEM cell supernatants.

The results show that all six monoclonal antibodies specifically immunoprecipitated gpl10 and gpl50.

Enzyme-linked assay Immunoadsorbant

In order to map the gpl10 epitopes recognized by the monoclonal antibodies of the present invention, the culture supernatants from hybrid cell lines or ascites fluid were further characterized by reactivity in ELISA assays with biologically expressed pusion proteins and synthetic peptides. The procedures used were the same as those described above / except that the fusion proteins or synthetic peptides replaced the purified viruses as antigens / adsorbed to the surface of the microtiter wells.

When using peptides as antigen one worked

according to the following procedure. The lyophilized peptides were dissolved in 6 M guanidine-HCl. Immediately before plating into the 96-well plates, the guanidine solution in 0/05 M carbonate / bicarbonate buffer (pH 9/6) was assayed for peptide

diluted final concentration of up to 100 μς / ιηΐ. 50 μΐ of the diluted peptide was added to each microtiter well. The plates were then incubated overnight at 4 ^e C, excess peptide solution was "shaken out" / the plates were blocked with blotto and the further ELISA assay was performed according to the procedure described above. Similarly, recombinant protein was diluted to a final concentration of about 2 pg / ml in 0.05 M carbonate / bicarbonate buffer (pH 9.6) and the same procedure repeated.

The results are shown in Table II. The monoclonal antibodies produced by the cell lines HIV-gpl10-1 and HIV-gpl10-2 reacted with ENV3, ENV5, peptide 36 and destroyed viruses. The antibodies from the HIV-gPL10-3, HIV-gpl10-4, HIV-gpl10-5 and HIV-gpl10-6 cell lines reacted with ENV2 and peptide 29 as well as with destroyed viruses.

TABLE II

ELISA assays showing the reactivity of the monoclonal antibodies with recombinant proteins and synthetic peptides

Recombinant fusion protein Synthetic peptides LAV CEM EHV2 ENV3 ENV4 ENV5 29 36 39 Control Control

110-1 0.077 3.000 0.113 3.000

110-2 -0.003 3.000 0.000 3.000

110-3 3.000 0.011 ND ND

110-4 3.000 0.020 ND ND

110-5 3,000. 0.014 ND ND

110-6 3,000 0.033 ND ND

ND 2 .421 0054 0908 0125 ND 2 .305 -0,005 1214 0009 3000 ND 0017 0363 0046 3000 ND 0016 0383 0067 3000 ND 0016 0368 0025 1937 ND 0017 0486 0032

The results summarized in Table II show /

that the monoclonal antibodies 110-1 and 110-2 recognize an antigenic determinant / encoded by the DNA sequence in the pENV3 region / in particular by the region of the HIV genome / defined by a sequence of amino acids in peptide 36 , That is, the monoclonal antibodies gpl10-1 and 110-2 bind to a peptide region of gpl10, which is encoded in bp 7246-7317 / as shown by the formation of immune complexes with peptide 36 and ENV3. This area of the HIV genome has been identified as conserved / e. with only minor changes in the DNA sequence in the region encoded by peptide 36 on different viral isolates of different geographical origin / see Starcich et al., Cell 46: 637 (1986). in the

In contrast, the monoclonal antibodies bind

gpllO-3 / -4 / -5 and -6 to HIV peptides / defined by region / encoded by peptide 29 from bp6688 to about bp 6750. The region in gPL10 / defined by peptide 29 was identified as containing several nucleotide substitutions in different virus isolates. The monoclonal antibodies / the selectively bind gPL10 polypeptides / which contain conserved epitopes / as the antibodies 110-1 and 110-2 / may often be particularly useful / for example in the affinity

Chromatography, etc. Also reacts in an ELISA assay

the peptide HO-- 2-2 was isolated with sera from the subject / LAV-2.

Indirect immunofluorescence assay

Indirect immunofluorescence assays using monoclonal antibodies against HIV gpl10 antigen were performed on acetone-fixed and live cells. Acetone-fixed slides / the au3 LAV-infected CEM

Cells were prepared * were diluted with diluted culture.

or ascites fluid was incubated for 1 h at 37 ° C / whereas live cells were incubated with culture supernatant or ascites fluid for 1 h at 4 ⁰ C before the cells were placed on the slides and fixed with acetone.

δ Both methods used fluorescein isothiocyanate labeled anti-mouse IgG to detect those cells which have the reactive gpl10 antigen. The monoclonal antibodies HIV-gpl10-1 gave positive results both when using live or acetone-fixed LAV-infected cells.

Example II

Neutralization of HIV infectivity by anti-gPL10 monoclonal antibodies

This example describes and characterizes the neutralization of HIV infectivity using monoclonal antibodies that bind to gpl10 and peptides within gpl10. The results show that the antibodies have gpl10-4 and neutralizing activity and that gpl103 and -4 have particularly high neutralizing activity.

Neutralization assay

A sensitive neutralization assay was developed to "evaluate the effect of monoclonal antibodies on HIV

To detect infectivity quantitatively. A CD4 + cell

The "CEM" line, which is particularly sensitive to HIV infection, was chosen as the target cell for infectivity comparisons. Ascites fluid "prepared as described in Example I" or the IgG fraction thereof "purified using ammonium sulfate precipitation"

30 min. At 56 ⁰ C inactivated / then / containing 10% fetal calf serum in the required amount in RPMI medium / diluted. A suspension of HIV strain LAV _SSRU was harvested from about 4 days old CEM cultures in log phase of growth / by a 0/2 or 0/45 microfilter filtered / divided into aliquots and frozen at -70 ⁰ C. An aliquot was thawed, titrated to determine TCID ₀ and then assays were performed with freshly thawed aliquots / diluted to a ratio of 1: 500 in culture medium to about 10-fold concentration / required / by 50% of CEM cells in the culture (10 TCID ₅₀ ) to infect. The virus suspension was mixed with the same volume (250 μΐ) of a monoclonal antibody preparation in 5-fold dilutions of 1: 5 to 1: 9,765,625. The virus / antibody mixture was incubated at 37 ^° C. for 45 min and then duplicated from 1: 5 to 1: 9 765 625. The virus / antibody mixture was then incubated at 37 ^° C. for 45 min. Subsequently, duplicate samples of 200 μΐ were used to inoculate / wells containing 1 ml of approximately 2 χ 10 CEM cells per well. The cultures were incubated at 37 ^° C. in a humidified atmosphere with 5% CO 2 for 14 days. Cells were harvested / pelleted and incubated with 1% Triton-X-100 in PBS for about 10 min.

lysed. The amount of virus (or viral antigen) / present in the lysed cells was quantitated using a sensitive HIV antigen capture "sandwich" enzyme immunoassay as described below. The titer of neutralizing activity / if present / was determined to be the reciprocal of the dilution of the monoclonal antibodies / which inhibited by more than 50% the antigen production of the virus control cultures / which were incubated without antibody or monoclonal antibody of the same isotype / previously shown was / that he has no neutralizing activity.

In the above-mentioned HIV antigen capture assay, two monoclonal antibodies to p25 antigens were used as the capture reagent. These hybridoma cell lines were generated by the methods described above with minor modification / including application of a purified gag recombinant fusion protein as immunogen and characterization of the resulting monoclonal antibodies for specificity and reactivity using as GAG-I / GAG-2 and GAG-3 The protein GAG-I is expressed from PGAG-I (ATCC No. 53379), GAG-2 is expressed from pGAG-2 (ATCC No. 53111) and GAG-3 is isolated from pGAG-1. 3 (ATCC No. 53112). The production of the recombinant fusion proteins is described in detail in USSN 764,460 and Θ2Θ 828 / which is hereby incorporated by reference "The synthetic peptide 141 is encoded by the _M LAV__ -Genombereich / corresponding to amino acid residues 198-242. The monoclonal antibodies produced by the hybridoma cell lines p25-2 and p25-3 / react with the recombinant fusion proteins GAG-I / GAG-2 and GAG-3. The monoclonal antibodies obtained from p25-3 also react with the synthetic peptide 141.

To perform the antigen capture assay, the

Capture reagents are first adsorbed to a solid support. Ascites fluid / derived from hybridoma cell lines p25-2 and p25-3 was diluted 1: 5000 in 25mM Tris buffer pH 8/5. 200 μΐ were placed in the wells of microwell plates. The wells were sealed and incubated for approximately 16 hours at 4 ⁰ C. The solution was aspirated from the plates / before a blocking solution of 0/3% Blotto in PBS was added. The blocking was carried out at room temperature for 15 min. The blocking solution was

3g and the sample was added. 200 μΐ of the lysed

Cell suspension and 5 μΐ detection conjugate / prepared as described below were added to each well. The corrugated strips Odei: plates were incubated for 2 h at 37 ^e C, then the suspension was aspirated and the wells washed 4 wuden χ with buffer (0.05% Tween 20 in PBS)..

The detection conjugate was prepared as follows. Monoclonal antibodies p25-6 and p26-7 were assayed for horseradish peroxidase (HRP) in a molar ratio of 3: 1 (AbtHRP) for 3 hours using the periodate oxidation method (Nakane et al., J. Histochem Cytochem *. 22: 1084 (1974). ) conjugated. The conjugates were diluted 1: 1500 in 2.5% (w / v) low-fat dry milk, 0.01 thimerosal and 0.005% Antifoam A in 20 mM sodium citrate. The remaining portion of the ELISA assay was performed as described in Example I.

The determination of the neutralizing activity with the antibodies gpllO-3, -4, -5 and -6 gave the following results. The highest titers with retained neutralizing activity were: gPL103 = 15,625: gpl104 = 9,765,625: gpl105 = 125; and gPL106 = 625.

Based on the predicted genetic variability of the range defined by the peptide 29, the ability of the monoclonal antibody gpl10-4 to recognize other HIV isolates was examined. The immunofluorescence assays were performed as described above. The antibody gpl10-O could detect antigen in cultures of at least three of 16 HIV isolates.

The antibody gpl10-4 was able to neutralize viruses,

which were isolated over a period of 15 weeks from a chimpanzee _{who was} inoculated with LAV _DDfl as a control _animal in an AIDS vaccine trial. The monoclonal antibody

BKU

was able to neutralize the isolates, though that

Animal serum antibodies "neutralized HIV in vitro and although the animal had a measurable" cell-mediated immune response to HIV infection. This demonstrates the lack of antigenic drift in vivo for the epitope; that is recognized by the gpllO-4 antibody.

Example III

Neutralization of HIV infectivity by a cocktail of anti-gPL10 and anti-p25 monoclonal antibodies

This example describes the neutralization of HIV-Ig, infectivity using monoclonal antibodies which bind to gpl10 and peptides within gpl10 in combination with monoclonal antibodies which bind to p25 and to peptides within p25 and which alone are of low or low toxicity have no neutralizing activity. The results show that the monoclonal antibody gpl10-2 in combination with p25-6 or p25-7 has a particularly high neutralizing activity.

Hybridoma cell lines p25-6 and p25-7 were generated by the methods described above using the modifications "including the use of inactivated disrupted viruses or purified gag recombinant fusion proteins expressed in E. coli as immunogen" and the characterization of the monoclonal antibodies in terms of specificity and reactivity, the recombinant fusion proteins referred to as GAG-1 "GAG-2 and GAG-3 and the synthetic peptides 15/88" 150 "147 and 148 were used. The synthetic peptides are derived from the LAV _B _ _M genome

BRU

richly encodes the following amino acid residues: gg peptide 15 amino acid residues 329 to 350; Peptide 88 amino acid residues 315-350; Peptide 150, amino acid residues318 to

? 63; Peptide 147 "amino acid residues 278 to 319; and peptide 148, amino acid residues 290 to 319. The monoclonal antibodies produced by the hybridoma cell lines p25-6 and p25-7 react with the recombinant fusion protein GAG-3; p25-6 reacts with synthetic peptides 147 and 148 / and p25-7 with synthetic peptides 15, 88 and 150.

The neutralization assays were performed as described above except that when using cocktails, the individual monoclonal antibodies were first diluted 1: 5 in culture medium and then mixed in equal proportions to give a final dilution of 1:10. The remaining part of the assay was performed as above.

The monoclonal antibodies gpl10-2, p25-6 and p26-7 show

less than 50% neutralizing activity when used alone. When using a cocktail comprising the monoclonal antibodies gpl10-O2 together with p25-6 or gpl10-2 with p25-7 at a dilution of 1:10, complete neutralization occurs. A cocktail containing the monoclonal antibodies p25--6 in combination with p25-7 gave a neutralizing activity in the range of 60-90%.

Example IV Immunoefficacy of peptide 29 and the homologs thereof

The Ability of Peptide 29 and the Homologous Peptides, a-30

Finally, the peptide 177, an immune response to HIV

was stimulated on two mouse strains. The preparation of the peptide immunogens, the immunization methods and the characterization of the triggered immune responses are described below. 35

Peptide 29 is prepared for immunization by conjugation to a purified thyroglobulin. Thyroglobulin can be derivatized for conjugation with N-succinimidyl-4- (N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) according to the methods described in U.S. Patent 4,629,783 / column 10, lines 28-51. As a second immunogen, thyroglobulin is derivatized with glutaraldehyde as follows. 27 mg porcine thyroglobulin are dissolved in 1 ml 0/1 M sodium bicarbonate. For this purpose, 8/3 μΐ of a 25% glutaraldehyde solution is dried and the mixture is stirred overnight at room temperature. 1 ml of sodium carbonate / bicarbonate buffer of pH 9.3 to the solution and then dialyzed for 8 hours against 2 1 of the same buffer at 4 ⁰ C / wherein a complete exchange of dialysate after 4 h occurs. The peptide 29 is then added to the derivatized thyroglobulin in about a 100-fold molar excess and the mixture is stirred overnight at room temperature. Block unreacted glutaraldehyde with 200 μL of a 0/2 M lysine solution and stir the mixture for several hours (or overnight) at room temperature. The peptide-thyroglobulin conjugate is then dialyzed extensively against PBS at 4 ⁰ C.

Two mouse strains (C57 black and BALB / c) are inoculated with the peptides »; which were produced by the respective conjugation process. All animals were about 2 to 4 weeks old at the time of inoculation. Inoculation may be in the footpad / by tail scarification, subcutaneous / intranasal or intraperitoneal. The inoculum consists of 25 pg of the conjugated peptide / suspended in 0/5 ml of complete Freunds ¹ S adjuvant / being after the 2nd, 3rd and

Week 5 booster inoculations with the same immunogen / suspended in incomplete Freund's ¹ S adjuvant. Serum samples are collected from the individual mice before immunization / 4 days after booster immunization after 3 weeks and 4 days after the last booster immunization after 5 weeks. The serum samples were for antibodies against

homologous peptides or whole viruses analyzed by screening in an ELISA assay. Those sera / antibody activity against LAV will / will undergo further screening for neutralizing activity. This is followed by analysis of the sera in immunoblot assays against disrupted LAV antigen and radioimmunoprecipitation assays with radiolabeled gPL10.

The results of the immunizations show that the mice immunized with peptide 29 develop antibodies / react with peptide 29 and destroyed LAV-1 viruses in ELISA assays. Conjugation of peptide 29 by maleimide results in the formation of anti-peptide-29 antibodies in some balb / c casings. Conjugation of peptide 29 by glutaraldehyde generally gives higher titres of antibodies to peptide 29 in balb / c mice. Mice immunized with peptide 177 will develop antibodies to the peptide. Conjugation of peptide 177 by glutaraldehyde was better in eliciting an immune response.

20

C57 mice are more responsive to immune stimulation

the peptide 177 as balb / c mice. Mice immunized with LAV-2 peptide 110-2-2 develop antibodies to 110-2-2 and LAV-2 viruses / as demonstrated by ELISA assays. Glutaraldehyde-conjugated peptide 110-2-2 is immunogenic in both C57 and balb / c mice, with titers to the 110-2-2 peptide being generally higher in balb / c mice than in C57 subjects. Mice are generally present during the titer against the LAV-2 virus

C57 mice are higher than balb / c mice. 30

35

Those serum samples from immunized mice / the

(i) show antibodies to whole viruses; (ii) are able to neutralize HIV / as in the assays described in Example II, for example, and (iii) react with peptide 29 in ELISA assays cumulatively demonstrate the efficacy of applying Peptiäs 29 in a vaccine formulation.

Example V

t - Immunoaffinity separation of qpllO using monoclonal

clonal antibody

Monoclonal antibodies to the gpl10-HIV antigen can be obtained

use in immunoaffinity separation procedures / around the 15th

bacterially expressed recombinant fusion proteins. When the expressed protein is secreted by the bacteria, the protein can be isolated from the culture supernatant. If the protein is not secreted /

it may be necessary to destroy the bacterial cells. 20

The construction of plasmid pENV-5 (ATCC No. 53074) is described in USSN 721,237, incorporated herein by reference. The plasmid pENV-5 codes for the main part

the carboxyl end of gPL10 and part of the amino-25

tusmin of gp41 of LAV / inserted into the trp expression vector. E. coli C600 transformed by this vector express the gPL10 fusion protein but do not secrete it.

E. Coii C600 / which contain the plasmid pENV-5 / leaves

grow overnight at 37 ^° C. with aeration in a medium containing tryptophan (20 pg / ml) and ampicillin (3.00 pg / ml). The overnight cultures are then inoculated to 1: 100

in fresh minimal medium / ampicillin (100 pg / ml) * not 35

but contains tryptophan. These cultures are allowed to

Ventilation at 37 ⁴ C for 2 to 3 h grow (until the early log phase). The inducer »3-B indole-acrylic acid (Sigma Chemical Co./ St. Louis / MO) is added from a freshly prepared stock solution of 20 mg / ml in 95% ethanol to a final concentration of 20 μg / ml. The induced cultures are allowed at 37 ⁰ C with aeration for 4 to 5 h grow / then pelletized and optionally a freeze. The protein yields of pENV-5 are typically less than 1 mg / l.

The pelleted bacterial cells are lysed using P-RIPA buffer (PBS containing 1% Triton X-100, 1% deoxycholate / 0.1% sodium dodecylsulfate and 1% aprotinin), which lyses E. coli cells. The suspension is ultrasonicated for shearing DNA and RNA and then centrifuged to remove particles. Dilution or concentration may be required to standardize the protein concentration.

The monoclonal antibody HIV-gpl10-1 is originally precipitated from ascites fluid or cell culture supernatants at room temperature or in the cold with (NH ₄ J ₂ SO ₄ or Na ₂ SO.-solutions which have a final saturation of 33 or 18 at pH 7.3 The precipitated proteins are removed by centrifugation and redissolved in PBS and precipitated a second time with 33% (NH ₄ J ₂ SO ₄ or 12-15% Na ₃ SO _4. If necessary, this step can be repeated. The pellet is redissolved in PBS and the excess salts are removed by gel filtration through a desalting matrix or by exhaustive dialysis against PBS.

The purified monoclonal antibody 110-1 can then be coupled to 3 g of cyanogen bromide-activated Sepharose. The

The required amount of gel is allowed to swell in a 10M HCl solution on a glass filter (1 g of freeze-dried material gives a gel volume of about 3/5 ml), washed with the same solution for 15 min, and the antibody is added immediately thereafter. In general, the coupling reaction is most effective in a pH range of 8 to 10 / but can also operate at a lower pH / if required for reasons of antibody stability. The antibody should be dissolved in PBS or in a carbonate / bicarbonate or borate buffer of high ionic strength with 150 mM NaCl. The activated Sepharose and the antibody suspension are gently stirred at room temperature for 2 to 4 h or overnight at 4 ⁰ C and then washed on a coarse glass filter frit with coupling buffer. If active groups remain, they are blocked by treatment with 1/0 M ethanolamine at pH 8 for 2 hours. The final antibody-sepharose product is then washed alternately 4 or 5 μl with high or low pH buffer solutions (borate buffer / 0 / 1M / pH 8/5 / IM NaCl and acetate buffer / 0 / 1M / pH 4/0 / 1M NaCl). Washing removes traces of non-covalently adsorbed materials. The finished immunoaffinity separation matrix is layered below 8 ⁰ C in the presence of a suitable bacteriostatic agent / such as 0/01% sodium azide.

The addition of the expressed protein suspension to the immunoaffinity separation matrix results in the selective removal of the gPl10 antigen. The mixture is allowed to act for 2 to 24 hours, preferably 12 to 18 hours, with gentle stirring or shaking. It is also possible to / equilibrate the immunoaffinity matrix in a column and slowly add the expressed protein suspension to the column. After addition of the protein suspension, the flow should be stopped / to accomplish the formation of the immune complex in the best way possible.

Unbound material is washed by extensive washing

Wash adsorption buffer or separated. For this purpose, you can use a coarse Glasfilterfritte under application of a vacuum or treat the column in the flow. The unbound material is then eluted using low or high pH buffers (acetate buffer pH 4/0 or borate buffer pH 8/56) or a chaotropic agent.

Example VI Immunoaffinity purification of recombinant gpl10 from a Mammalian expression system

The monoclonal antibodies of the present invention find use in immunoaffinity purification of recombinant fusion gp10 expressed by mammalian cells. The mammalian cells are infected with recombinant vaccinia (Mackett et al., J. Virol. 49: 857 (1984), incorporated herein by reference) containing sequences encoding at least the portion of gpl10 which is antigenic and the formation of neutralizing antibodies.

The recombinant vaccinia are constructed according to the method described in USSN 842,984, which is hereby incorporated by reference. The sequences coding for the envelope glycoprotein of HIV are inserted in a plasmid vector (pGS20) downstream from a vaccinia transcriptional control element. This chimera gene is flanked by sequences coding for the viral thymidine kinase (TK) gene.

The chimeric plasmid vectors containing vaccinia virus promoters ligated to the LAV envelope gene are used to transform the E. coli strain MClOOO. insertion

the chimeric LAV env sequences into the vaccinia virus genome were made by in vivo recombination, which was made possible by flanking the chimeric genes in the plasmids pv-env5 of vaccinia virus sequences " Encode gene. This plasmid is then introduced into cells previously infected with wild-type vaccinia virus. One then allows recombination between the TK sequences on the plasmid and the homologous sequences in the vaccinia virus genome with insertion of the chimeric gene. African Green Monkey kidney cells (strain BSC-40 / a BS-1 derived cell line ATCC # CCL26) are used as host in the expression system.

Confluent BSC-40 cells are infected at a multiplicity of infection of 10 by recombinant vaccinia viruses. The infection is allowed to proceed for 12 h / after which the cells are harvested, washed once with PBS and centrifuged off. The cell pellets are suspended in Lyf, Epuffer (1 0% NP-40 2% 4% sodium deoxycholate 0.1 M NaCl, 1 O 1 M Tris-HCl, pH 7/4/1 mM EDTA) and the lysate cleared by centrifuging. The immunoaffinity separation of the expressed recombinant fusion protein is performed as described above for the bacterial expression system using the monoclonal antibody gpl10-1. The proteins produced by this expression system are more naturally produced by HIV-gPL10 due to the treatment and glycosylation performed by the mammalian cells.

Example VII Inhibition of HIV infection with blocking peptides

The efficacy of blocking peptides in inhibiting the infection of tissue culture cells by the LAV_ _RU -HIV-

Strain was made using a modification of the method

for the evaluation of peptide T, by Pert et al., see

DD

, above "published" was examined. The preferred HIV inhibition assays are by combining equal volumes of blocking peptides and CEN cells (2.5χχ ⁵ ) in medium (RPMI / 10% PCS and 2 mg / ml polybrene) and

t 45 min. At 37 ⁰ C incubated. The virus is then added at different dosages (10/50/500 TCID 50) and the mixture is incubated for 14 days at 37 ⁰ C. The supernatant is then subjected to an assay for the production of viral antigen (zD p25 core antigen).

Preincubation of the CEM cells with the peptides before

Virus addition to the cultures enhances the inhibitory effect in the assays. It has been shown that the inhibition is dependent on the virus dosage / wherein a

high activity at low and medium doses / 15

however, a lesser effect was observed at the highest virus doses.

With peptide T who in experiments with low virus doses inhibition of virus antigen production 20

from about 60% to 90%. Further experiments with the peptides X to XV / which are typically amidated at the COOH terminus and acetylated at the NHj terminus gave similar results / wherein the peptide XI had a

wide dose range was particularly effective. It is see-25

lent / that on the basis of the monoclonal antibodies and peptides / including the blocking peptides according to the invention / a better method for the neutralization and / or inhibition of HIV infections is available. this makes possible

the creation of prophylactic and therapeutic agents / 30

which are effective against infection by the master / if not all / HIV strains are effective. In addition, the new materials are used in diagnostic assays and other known methods.

66

Deposit numbers of microorganisms

The following microorganisms; the part of the present invention are / were in the American Type Culture Collection; 12301 Parklawn Drive; Rockville; Maryland 20852; UNITED STATES; deposited. The background data is as follows:

Wissenschafti. designation Name of the depositor ATCC-No. 9175 Deposit data Mouse hybridoma (ba: ibc / NS-1) HIV gp 110-1 HB 9176 August 15, 1986 N HIV gp 110-2 HB 9177 August 15, 1986 H HIV gp 110-3 HB 9404 August 15, 1986 H HIV gp 110-6 HB 9405 April 10, 1987 n HIV gp 110-4 HB 9406 April 30, 1987 M HIV gp 110-5 HB 9407 April 30, 1987 N HIV-p 25-2 HB 9408 April 30, 1987 N KIV-p 25-3 ι HB 9409 April 30, 1987 H HIV-p 25-6 HB 9410 April 30, 1987 N HIV-p 25-7 HB 9177 April 30, 1987 5 Hybridomas HB9175, HB 9176 and HB The were tested and were on the 26th August 1986 viable. were on the 4th remaining hybridomas were also tested and May 1987

able to.

Claims (2)

_c ο 1. A method for determining the presence of HIV in a biological sample, characterized in that
you a) a monoclonal antibody capable of HIV-gPL10 of the biological sample * "react, incubate; and detecting the presence of immune complexes of the monoclonal antibody and the antigenic determinant in the biological sample, and therefrom the Presence or absence of HIV in the sample 20 certainly; or b) a peptide from a neutralizing region; of HIV gPl10 or p25 with the biological sample inkubierfc; and the presence of immune complexes the peptide and the antibodies in the sample, which are 25 Reacting to the peptide, and detects the resulting. Presence or absence of HIV in the sample determines ^ or c) a nucleic acid segment which is responsible for at least one 30 Part of a neutralizing region of HIV encoded, incubated with a nucleic acid in the biological sample under hybridization conditions; and detecting the presence of hybrid complexes of the nucleic acid segment and nucleic acid in the sample and determining therefrom the presence or absence of HIV in the sample; or (J lt.) d) incubating a biological sample of the host with a peptide of a neutralizing region of HIV; and detecting the presence of immune complexes from the peptide and the antibodies in the sample and determining therefrom the HIV strain with which the host is infected. 2. The method according to claim 1, characterized in that the monoclonal antibody according to paragraph a) is able to with a neutralizing region or a blocking peptide of gPLIO to react.
16