DD280118A5 - METHOD FOR THE PRODUCTION OF MONOCLONARY ANTIBODIES AND PEPTIDES, WHICH ARE NECESSARY FOR THE TREATMENT AND DIAGNOSIS OF HIV INFECTIONS - Google Patents

Abstract

The invention relates to a method of producing monoclonal antibodies that specifically react with one or more neutralizing HIV regions. The monoclonal antibodies are produced by immortalizing antibody-producing cell lines and cultivating these cell lines. The products of the present invention are useful in medicine for the prophylactic and therapeutic treatment of HIV infection for the diagnosis of HIV infection.

Description

Field of application of the invention

The invention relates to a method for producing monoclonal antibodies. These may be formulated into pharmaceutical agents useful in the treatment of diagnosis / neutralization and vaccination associated with the treatment of human immunodeficiency virus (HIV) infections.

Characteristic of the known state of the art

The infectious agent responsible for Acquired Immunodeficiency Syndrome (AIDS) and its prodromal phases / AIDS-related complex (ARC) and lymphadenopathy syndrome (LAS) is a novel lymphotropic retrovirus. This virus has been referred to in various ways, namely as LAV, HTLV-III, ARV and more recently as HIV.

Since the pandemic spread of HIV, the treatment of infected persons and the prevention of transmission to uninfected risk groups is of paramount importance. A variety of treatment strategies address different phases in the life cycle of the virus. They are described in Mitsuya and Broder / 1987, Nature 325: 773. One possibility involves the use of antibodies / bind to the virus and inhibit viral replication / either because they interfere with the virus entering the host sites or due to other mechanisms. Once the viral component (η) / which is subject to intervention by the antibody (s) is (are) identified, it is hoped that antibody

To be able to produce titers; to neutralize viral infectivity by vaccination or, alternatively, by passive administration of immunoglobulins or monoclonal antibodies of the desired specificity.

It is believed that the envelope glycoproteins of most retroviruses react with receptor molecules on the surface of the virus-susceptible cells, thus determining viral infectivity to particular hosts. Antibodies / bind to the glycoproteins / can block the interaction of the virus with the cell receptors and thus neutralize the infectivity of the virus / see The Molecular Biology of Tumor Viruses / 534 (J. Tooze, ed.

1973) and RNA Tumor Viruses / 226, 236 (R.W. et al., Eds. / 1982) to both publications are hereby incorporated by reference. Compare also

Gonzalez-Scarano et al., 1982, Virology 120: 42 (La Crosse Virus); Matsuno and Inouye, 1983, Infect. Immune. 39: 155 (Neonatal Calf Diarrhea Virus); and Mathews et al., 1982, J. Immunol., 129: 2763 (encephalomyelitis virus).

The general structure of HIV is a ribonucleoprotein core / surrounded by a lipid-containing shell which, in the course of its development, forms the virus from the membrane of the infected host cell. The viral coded glycoproteins are embedded in the envelope and protrude outward. The envelope glycoproteins of HIV are originally produced in the infected cell as precursor

₃ q molecule of 150,000 to 160,000 daltons (gpl50 or gpl60) and then synthesized in the cell into an N-terminal fragment of 110,000 to 120,000 daltons (gp 110 or gp 120) to generate the external glycoprotein and into a C-terminal fragment from 41,000 to 46,000 daltons (gp41) representing the transmembrane envelope glycoprotein.

'Ml fctf'l ·

?. 8 OI ί

For the reasons given above, the gpl10 HIV glycoprotein has been the subject of much research into a potential target to disrupt the life cycle of the virus. It was shown; sera from HIV-infected individuals neutralize HIV in vitro and antibodies that bind to purified gPL10 are present in the sera / Robert-Guroff et al., 1985 / Nature 316: 72, Weiss et al., 1985, Nature 316: 69 and Mathews et al., 1986, Proc. Natl. Acad. Be. USA, 33: 9709. Purified and recombinant gplOO stimulated the production of neutralizing serum antibodies when administered to animals for immunization, Robey et al., 1986, Froc. Natl. Acad. Be. USA, 83: 7023; Lasky et al., 1986, Science 233: 209; and Zagury et al., 1986, Nature 326: 249. Furthermore, it has been shown that the gpl10 molecule binds to the CD4 (T4) receptor and that monoclonal antibodies recognizing certain epitopes of the CD4 receptor block HIV binding, syncytium formation and infectivity, McDougal et al., 1986, Science 231: 382. Putney et al. (1986, Science 234: 1292) detected neutralizing serum antibodies in animals after immunization with a recombinant fusion protein containing the carboxyl-terninal half of the gpl10 molecule. Sis could further demonstrate that glycosylation of the cat protein is unnecessary for response to the neutralizing antibody.

It would therefore be desirable to have a subunit vaccine against AIDS using the HIV gpl10 molecule or parts thereof. Subunit vaccines are an alternative to vaccines made from inactivated or weakened viruses. Inactivated vaccines are problematic because not all virus particles may have been killed and their weakened viruses have the ability to mutate and regain their disease-causing effects. Subunit vaccines use only those

/ ι /: r. '"> ⁿ

• ιιινικ'ς '; ν ¹ ; , , ^, L -. / ij Ii;

Parts of the virus to immunize the host / which contain the antigens or epitopes / are capable of / trigger the immune response / i. a neutralizing antibody response / ADCC and a cytotoxic T cell response. The main advantage of subunit vaccines is that irrelevant viral material is excluded.

Viral subunits for use in a vaccine can be generated by a variety of methods, for example, the envelope glycoprotein can be expressed and purified by a bacterial host, although this molecule has the most post-translational modifications (such as glycosylation) or other processing Such a modification can be achieved by using a eukaryotic expression system, for example, yeast or cultured mammalian cells, Viral genes have been introduced into mammalian cells using vaccinia virus as a vector / see, for example, Mackett / M. et al / 1982 / Proc Acad., P. USA 79: 7415; D. Panicali and

E. Paoletti, 1982, Proc. Nat. Acad. Be. USA 79: 4927.

Recombinant vaccinia viruses can be made according to the methods of Hu et al / Nature 320: 537 (1986) or Chakrabarti et al., Nature 320: 535 (1986) / incorporated herein by reference. In these systems, the viral glycoproteins produced by cells infected with recombinant vaccinia are suitably glycosylated. They can be transported to the cell surface for extrusion and final isolation.

An important step in the production of a subunit vaccine is adequate purification of the desired glycoprotein from the complex mixture of the expression system. For this purpose, several methods are suitable. These include, but are not limited to, preparative polyacrylamide gel electrophoresis / gel permeation chromatography.

η Kh

various chromatographic methods (i.e., ion exchange / reverse phase / immunoaffinity and hydrophobic interaction chromatography) and others. Most of these methods are used in various combinations to obtain substantially pure preparations / see D.G. Dress et al., 1981, Science 214: 1125, CD. Cabradilla et al. 1986, Biotechnology 4: 128, D.J. Dovbenko, 1985, Proc. Nat. Acad. Be. USA 82: 7748, which is hereby incorporated by reference.

To produce subunit vaccines, methods are needed which reduce the number of steps required to obtain the best purification of a particular viral antigen from a complex expression mixture.

_{] (.} Aim. An efficient separation of the antigens of foreign components can be accomplished using the immunoaffinity chromatography. This method, also known as Iminunoadsorption is basically in the selective adsorption of an antigen to a solid support to the

_on a specific antibody was covalently linked. The selectively adsorbed antigen is then eluted from such an adsorbent or antibody affinity by, for example, changing the pH and / or ionic strength of the buffer.

Polyclonal antibodies obtained from animals immunized with the desired antigen or from naturally infected individuals (see, for example, Laksy et al., Supra) were frequently used as immunoadsorbents. However, these reagents generally have significant disadvantages, for example that (i) not all of the antibodies that bind to the insoluble support are specific to the molecule of interest, thus requiring further purification; (ii) the yields of the desired antigen are often low; and (iii) the

η ni

/. ι: r a

28 O i ί

Antibody affinities often vary from one preparation to another / so that modifications to the elution method are required. With the use of monoclonal antibodies / specific for the desired viral antigen / subunit vaccine preparations instead of polyclonal antibodies one could avoid these difficulties.

Monoclonal murine antibodies / HIV antigens have been / are already described. Several groups have reported monoclonal antibodies specific for the core protein p25 (see, for example, Marzo Veronese et al., 1985 / Proc Nat National Acad., U.S.A. 82: 5199 and J. Chassagne et al / 1986 / J Immunol., 136: 1442). Monoclonal antibodies specific for the membrane glycoprotein gp41 have also been described (see, for example, Marzo Veronese et al. _, 1985 / Science 229: 1402).

Object of the invention

There is a need for monoclonal antibodies specific for epitopes in well defined regions of the major envelope glycoprotein gPL10. Monoclonal antibodies which bind to these regions and cause a reduction or elimination of HIV replication and transmissibility would be of great therapeutic and prophylactic benefit. In addition, you could also use the monoclonal antibody / Cen desired range of gpllO example, for use in vaccines from destroyed viruses or recombinant expression systems to clean. Further, the region could be chemically synthesized / containing the epitope (s) that are recognized by the monoclonal antibodies, resulting in the purification and administration of larger fragments of the gpl10 molecule

') I) HH 7

2 8 O M

Difficulties could be avoided. The present invention fulfills these and other needs.

Explanation of the essence of the invention

According to the invention, monoclonal antibodies are provided which are capable of immunologically mimicking the neutralizing epitopes of HIV proteins. These "novel" materials are used, for example, in diagnostic assays for the detection of HIV infection and in the therapeutic treatment of or vaccination against HIV infection.

The invention relates to new means and methods for the neutralization of HIV infections, i. for preventing or substantially inhibiting the formation or cellular transmission of infectious HIV in a host. In particular, peptides which mimic a neutralizing region of HIV, as well as monoclonal antibodies reactive with such region, are used for the diagnosis and treatment and vaccination against HIV infections. The term "neutralizing region" in this context refers to those parts of HIV, in particular HIV proteins, which contain amino acid segments which define one or more epitopes which react with antibodies, either alone or in combination with other antibodies according to the invention Are able to neutralize HIV infection Suitable assays for neutralization are known, including reduction of HIV infection in T cell lines / reduction of plaque forming units of VSV (HIV), pseudotypes / which

3 (3 nepeglycoproteins of HIV carry / Syncytium inhibition tests

and virion receptor binding assays. As desired; For example, neutralizing activity is comparable to antibody reactivity in immunochemical assays / immunocellicity, immunoblot and radioimmunoprecipitation assay.

The new peptides, typically less than about 50 amino acids in length, contain 5 or more contiguous amino acids that form epitopes / which are substantially similar to those epitopes / are located at the neutralizing regions IU of HIV gPl10 or p25 / which are blocked by the env and gag Of particular interest are those regions ranging from amino acid residue 301 to about 336 from gPL10 and from about 278 to about 319 and from about 315 to about 363 of p25 (all of which are expressed as LAVs).

BKU

recorded HIV strain). The name of the amino acid residues comes from the Los Alamos database (AIDS virus sequence database, Los Alamos National Laboratory / Theoretical Division / Los Alamos / NM 87545).

It will be apparent to those skilled in the art that other analogous regions ("homologues") of other HIV isolates can be identified / based on their location in related proteins from different isolates. In practice

For example, such homologs may be described with reference to LAV _Dn sequence DK U

data can be identified as follows:

a) the amino acid sequences of HIV isolates and LAV ' _ir .

BKU

can be aligned so that there is maximum homology between the two sequences.

30

b) one can identify peptides / which comprise those amino acid sequences of HIV isolates / which correspond to the location of the LAV peptides / which are immunogenic

BKU

logically mimic the LAV ^^ proteins. Peptides / which

DKU

the amino acid derivatives of HIV isolates identified in this way preferably comprise the

ι j ", f." C °

2 Π Ο Μ

immunogenic proteins of the HIV isolate,

This method can also be applied to HIV strains; the ersi. ·. are still aufz find. For example, when new HIV strains are identified, their envelope and core amino acid sequences can be matched with those of LAV _{or> r} for maximum homology. The methods / with which the sequences are brought into agreement; are known in the art. When the sequences are matched, it is desirable to keep the homology between the cysteine residues as large as possible. The amino acid sequence of the new HIV strain or HIV species / location of the peptides disclosed herein / can be synthesized and used in the present invention.

A white method for the determination of sequences of a homologous region in other HIV strains has been described by Scharf et al., Science (1986) 233: 1076. Two oligonucleotide primers are used here / which bind to conserved sequences outside the sequence region of interest here / wherein different restrictive sites are present in each primer. The DNA of HIV strains can then be multiplied in vitro and the resulting oligonucleotides can be cloned into vectors for sequence analysis and incorporated into a vaccine as a cassette / representing a particular epitope of the HIV strain.

It is not required in the present invention that the epitopes present within such sequences / cross-react with antibodies of all HIV strains or species. Peptides comprising immunological epitopes / distinguishing one species or serogroup from another are used for identification.

2 8 OM ίο

specific species or serogroups and may be used to identify individuals / individuals infected with one or more HIV species or serogroups. They are also useful in therapeutic agents in combination with other peptides / derived either from a homologous region or other neutralizing region.

The peptides of interest here are preferably derived from the gPL10 region of the virus. Of particular interest in this area are peptides encoded in the open env reading frame / extending from about base pair (bp) 6667 to about the base pair 6774 of the LAV _D _ isolate. different

tSKU

homologous regions of other HIV isolates thus include / as listed in Table I / the homologous sequences / obtained from the Los Alamos database (except LAV2).

Other peptides _(which are useful for generating and ZJM screening for monoclonal antibody / are those / that in the: ^r Z enes env reading frame about from bp 7246 to about 7317 of LAV _._ _M encoded Such antibodies and reactive peptides are particularly suitable. useful in immunoassay.

In the gag region of the LAV isolate, the p25 amino acid

dk U

acid sequences of about 278 to 3L9 and 315 to 363 further neutralizing regions of HIV.

It will be apparent to those skilled in the art that other neutralizing regions of HIV can be identified based on the teachings of the present invention. In particular, combinations of monoclonal antibodies / reacting with different HIV epitopes / show a neutralizing activity.

/ F. i: i; ^

'Mi H Hi < - ^ - ·

2 8 O i

11

TABLE 1 MXB2 TGTACAAGACCCAACAACAATACAAGAAAAGA ATCCGTATi; CysThrArg ProAenAsnAsnThrArgLysArg IleArglle 309

BHiO2 Ser 309

BH8 Lye-309

HXB3 Lye Z09

H9M Ser 309

BRU -Ser 314

MAL GIy ArgGly HiePhe 314 ELI Ala TyrGln Gin ThrPro 310 ARV2 Ser -Tyr-312 WMJ2 Tyr VaI ArgSer LeuSer --- 306 RFENV Ser ThrLys 322

26 TyrLys GlnSer ThrPro 311

Z3 GlySerAspLysLyslle GlnSer 306 NY5 Lye GIy Ala 304 CDC42 Here's ValThrLeu 320 LAV2 GIy Lye VaI Gin MetLeu 302

,,. HXB 2 CACAGA GGACCAGGGAGAGCATTTGTTACAATAGGAAAATAGGAAATATG

GlnArg, .ClyProGlyArgAlaPheValThrlleGlyLysIleGlyAsnMet 326

BH102 326

BH8 326

HXB3 326

H9M 326

BRU 331

MAL Gin LeuTyr Thr IleVal-Asplle 329 ELI GlyLeu ... GlnSerLeuTyrThr Arg- IleValSerArgSer 323 ARV2 HiB Thr Arg IleGlyAsp 327 WMJ2 Arg ArgO'lu ... HeGIyIIe 320 RFENV VallleTyrAlaThr Gin IleGlyAep 337 Z6 GlyLeu .. GlnAlaLeuTyrThr Arg - ArgThrLysllelle 327 Z3 Arglle LyeVal TyrAlaLys GIy 319

ΝΎ5 GlyPro ... ThrLeuTyrAlaArgGlu '-Asplle 320

_? , CDC42 ValTrpTyr Thr GIu LeuGlyAsn 335

LAV2 MetSer HisVal HisSerHieTyrGinProIle-Lys 323 HXB 2 ... AGA ... CAAGCACATTGT

... Arg ... GlnAlaHisCys 331

BH102 331

BH8 331

HXB3 331

H9M 331

BRU 336

MAL Arg-Tyr 334

tLl IlelleGly- 330

ARV2 lets Lys ... 333

WMJ2 left - 326

RFhNV let Lys ... 343

^, Z6 GIy ... 334

Z3 IleThrUly 326

NY5 J25

CDC42 He 341

LAV2 ArgProArg Met- 330

V !!

Peptide I; also referred to as peptide 29 / is encoded in the open env reading frame approximately from amino acid residues 308 to 328 and has the following amino acid sequence / in which the oligopeptides within this sequence comprise linear epitopes of their sequence:

I (29)

Y-Thr-Arg-Lys-Ser-Ile-Arg-Ile-Gln-Arg-Gly-Pro-Gly-Arg-Ala-Phe-Val-Thr-Ile-Gly-Lys-Ile-Y ·

in which Y and Y ¹ / if present / each represent sequences of up to about 20 amino acids. For example, when Y and / or Y 'are present, they may include one or more amino acids from sequences / flanking amino acid residues 308-328 of the HIV envelope sequence, or comprise any portion of these flanking sequences. For example, Y may be limited to, but not limited to, LAV _nri -

BKU envelope amino acid sequence "wholly or partially comprise residues 301 to 307 and Y ¹ may be the LAV. Envelope

BKU

amino acid sequence approximately from residues 329 to 336 in whole or in part / as follows

17. (29a)

Cys-Thr-Arg-Pro-Asn-Asn-Asn-Thr-Arg-Lys-Ser-Ile

Arg-Ile-Gln-Arg-Gly-Pro-Gly-Arg-Ala-Phe-Val-Thr-Ile-Gly-Lys-Ile-Gly-Asn-Met-Arg-Gln-Ala-His-Cys.

Alternatively, one can prepare shortened sequences of the peptides according to the invention. In this regard, the following sequences of peptide 29 are particularly useful:

III (29b)

Y-Thr-Arg-Lys-Ser-Ile-Arg-Ile-Gln-Arg-Gly-Pro-Gly

Y '

i Γ f. ° '"

2 8 O ί ί 8

wherein Y and / or Y ¹ / if present / each represents sequences of up to about 20 amino acid residues.

IV (29c)

Y-Ile-Gln-Arg-Gly-Pro-Gly-Arg-Ala-Phe-Val-Thr

Ile-Gly-Lys-Ile-Y ¹ . ,

wherein Y and Y are ¹ , if any, / each of sequences up to about 20 amino acid residues.

In another embodiment, particularly interesting homologous regions of the ARV-2 isolate in the env ~ open reading frame are encoded from about amino acid residues Nos. 306 to about 323. They typically have the following amino acid sequence / in which oligopeptides within this amino acid sequence comprise linear epitopes within such sequence.

V (177)

Y-Thr-Arg-Lys-Ser-IIe-Tyr-1Ie-Gly-Pro-Gly-Arg-Ala-Phe-His-Thr-Thr-Gly-Arg-Ile-Y ¹

wherein Y and Y comprise ¹ / as present / each 1 to about 20 or more amino acid residues. If Y and / or Y ¹ are present, they may flank 1 or more amino acid residues of sequences / flanking amino acid residues 306 to 323 of the ARV-2 envelope sequence or comprise part of these flanking sequences. In particular, Y may comprise in whole or in part the HIV envelope amino acid sequence approximately from residues 299 to 306; Y ¹ may comprise all or part of the HIV envelope amino acid sequence from residues 324 to 333 approximately.

Alternatively, truncated sequences of peptides V can be made. In this regard, the following are

2 8 O 1 ί

14 sequences particularly useful:

VI (177a)

Y-Thr-Arg-Lys-Ser-Ile-Tyr-Ile-Gly-Pro-Gly-Y '; and VII

Y-Asp-Cys-Lys-Thr-Ile-Leu-Lys-Ala-Leu-Gly-Pro-

Ma-Ala-Thr-Leu-Glu-Glu-norLeu-norLeu-Thr-Ala-Cys-Y ·

wherein Y and / or Y ¹ / as far as available; each represent sequences of up to 20 or more amino acid residues.

Another example involves homologous regions of the LAV-2 isolate, such as in the open env reading frame

, _c are encoded by amino acid residues 311 to 330, ο

They typically have the following sequence:

VIII (110-2-2)

Y-Lys-Thr-Va1-Lys-IIe-Nor-Leu-Nor-Ser-Gly-His-Val-Phe-His-Ser-His-Tyr-Gln-Pro-Y ¹

wherein Y and / or Y ¹ / if present / each represents sequences of up to 20 or more amino acid residues (see Nature 326: 662 (1987) / which is incorporated herein by reference).

The invention further relates to novel cell lines capable of producing monoclonal antibodies and agents containing these antibodies. The antibodies are

Neutralizing regions contained in a predetermined sequence of the envelope glycoprotein gp110 or p25, their protein precursors, biologically expressed recombinant fusion proteins, and syngeneic acid at high titer (from 10 to 10 to about 10 or more).

Vt! vi H7

2 8 O ί ί

to selectively recognize thetic peptides containing one or more epitopes within the predetermined sequence region of gp110 or p25. The hybrid cells have an identifiable chromosome in which the germline DNA has rearranged to encode an antibody that has a binding site for an epitope on gp110 or p25 that has some or all clinical HIV isolates. These monoclonal antibodies can be used in a variety of ways. These include the applications in diagnosis and therapy as well as the application to identify other cross-reactive antibodies, such as blocking antibodies. Peptides or polypeptides containing the epitope (s) with which they react find separate application as immunogens for vaccines or as therapeutic agents.

Blocking peptides

Another embodiment of the invention is / mainly for use with the above peptides or neutralizing monoclonal antibodies / other peptides or antibodies that interfere with HIV binding to receptors / to further attenuate HIV infectivity. Preferably, the so-called "blocking peptides" capable of inhibiting viral proliferation / as well as monoclonal antibodies / specific for epitopes / contained in such blocking peptides may be used / the efficacy of the treatment of HIV infections to increase. HIV-blocking peptides are typically / corresponding to the HIV amino acid sequence / thought to be essential for attachment of the virus to a host cell, for example the env-encoded amino acid residues about 190 to about 197 of LAV _nnM and about 185 to about

BKU

192 of ARV-2 and HTLV-IIl (BH-IO). These include the peptide

T-octapeptide (Ala-Ser-Thr-Thr-Thr-Asn-Tyr-Thr) and its various derivatives (eg IX below) and analogs (eg XI, below) described by Pert et al (1986, Proc. Nati. Acad. Ser. USA 83: 9254-9258 / which is hereby incorporated by reference)

Vi! J; }: /

which is located on the envelope glycoprotein (gpl10 or 120).

Of particular interest are, for example, blocking peptides having the following sequences; wherein preferably the NH_-terminus is acetylated and the COOH-terminus is amidated:

IX (173D) Y-.Ala-Ser-your-Thr-Thr-Asn-Tyr-Thr-Y ¹ ;

X (.86) Y-Thr-Thr-Asn-Tyr-Thr-Y ';

XI (187) Y-Thr-Thr-Ser-Tyr-Thr-Y ¹ ;

XII (188)

Y-Thr-Asp-Asn-Tyr-Thr-Y ';

XIII (189) Y-Asn-Thr-Ser-Tyr-Gly-Y ^1;

XIV (190) Y-Asp-Thr-Asn-Tyr-Ser-Y ';

XV (191) Y-Ala-Val-Phe-Thr-Asp-Asn-Tyr-Thr-Y ';

wherein for each peptide Y and Y ¹ / if present, 25 each

an amino acid sequence of up to about 20 amino acids. Epitopes or antigenic determinants within these peptides are more typically defined by at least 5 contiguous amino acids, and are used, for example, to mimic naturally occurring HIV antigen sites in the production of iJIV-reactive antibodies and vaccines.

Obtaining monoclonal antibodies

The production of monoclonal antibodies can be carried out by inrarcalizing the expression of nucleic acid sequences coding for

2 8OiIS

Encode antibodies; specific for HIV / by introduction of such sequences; typically cDNA encoding the antibody, or a host capable of culturing. The immortalized cell line may be such a mammalian cell line / by oncogenesis,

Transfection / mutation or the like was transformed. Such cells include myeloma / lymphoma lines or other cell lines _; who are able _; to induce the expression and secretion of the antibody in vitro. The antibody may be a naturally occurring immunoglobulin of a mammal, by transformation of a lymphocyte / in particular a splenocyte / by means of a virus or by fusion of the lymphocyte with a neoplastic cell; for example, a myeloma; is produced to form a hybrid cell line. Typically, the splenocytes are obtained from an animal; which has been immunized against the HIV virus or a fragment having an epitopic site thereof.

Immunization methods are known; they can vary considerably and still remain effective; see goding _; Monoclonal Antibodies: Principles and Practice; Academic Press; 2nd ed. (1986); to which reference is hereby made. Destroyed viruses; synthetic peptides and bacterial fusion proteins; containing the antigenic fragments of the gPL10 or p25 molecule can be used as immunogens. Preferably, the immunogen of destroyed viruses / peptides or recombinant proteins is enriched by proteins or fragments thereof; which contain the epitopes; for which antibody-producing B-cells or splenocytes are desired. In particular, you can solutions; containing lysates or extracts of destroyed viruses; or to accumulate supernatants of biologically expressed recombinant proteins or disrupted expression vectors by glycoproteins as desired; using cleaning methods; such as polyacrylamide gel electrophoresis; used.

Ί i! κ F

2 3Oi ΐ

Lectin affinity purification is a preferred convenient method for purifying gPL10 and other glycoproteins; for example, affinity purification using lectin lectin. The extent to which the glycoproteins are purified from the solutions for use as an immunogen; can vary widely, i. from less than 50% to usually at least 75 to 95%, desirably 95 to 99% and most desirably to absolute homogeneity.

Having purified the proteins to the desired extent, they can be suspended or dissolved in a physiological carrier suitable for immunization, or they can be coupled to an adjuvant. For example, one preferred technique involves adsorption of the proteins and fragments thereof to lectin lectin agarose or another macromolecular carrier for injection. Immunogenic amounts of antigenic preparations / enriched in HIV proteins / including the gPL10 glycoprotein and the p25 core protein (s) are / are generally injected in concentrations ranging from 1 μg to 20 mg / kg of the host. The administration can _; for example, by intramuscular / peritoneal / subcutaneous / intravenous, etc., injection. Administration may be 1 χ or more times and usually at 1 to 4 week intervals. The immunized animals are controlled for the production of antibodies against the desired antigens / then the spleen is removed / isolated the spleen B lymphocytes and fused. with a myeloma cell line or transforms it. The transformation or fusion can be carried out in a conventional manner / the fusion method is described in numerous patents / for example in US Pat. Nos. 4,172,124 / 4,350,683, 4,363,799, 4,381,292 and 4,423,147; See also, Kennett et al., Monoclonal Antibodies (1980) and those cited therein, and Godin as mentioned above; All of these publications are hereby incorporated by reference.

m /

2 δ Ο ί ί

The immortalized cell lines can be cloned and screened according to conventional procedures. In the cell supernatants, one can have the antibodies / capable; bind to the desired gpl10 or p25 HIV proteins / detect the recombinant fusion proteins or the synthetic peptides / contain the desired epitope range. Suitable immortalized cell lines may then be grown in vitro or injected into the peritoneal cavity of a suitable ascites fluid recovery host. Because antibodies of the invention are present / known to be specific for epitopes / which are present, for example, within the regions / regions defined by the LAV gene range from about bp6688 to about bp 6750

BKU

(encoding peptide 29) or from about bp7246 to about 7317 (encoding peptide 36) (bp numbering according to Wain-Hobson et al / Cell 44: 9 1985 / incorporated herein by reference) / can be coded the supernatants with the monoclonal antibodies one competitivet. Undergo assay. Thus, other immortalized hybridoma cell lines with the desired binding properties can readily produce from a variety of sources due to the availability of the antibody of the invention specific for a particular antigen. Alternatively, one may fuse these cell lines with other neoplastic B cells, these other B cells being able to serve as the recipient for the genomic DNA (s).

Neoplastic rodent B cells, particularly mice or rats, are preferred. You can. however, also from other mammalian species / for example from Lagomorpha / cattle / sheep / horses / pigs / birds (Avian) or the like. It is possible to carry out the immunization of these animals in a simple manner and their lymphocyte - η _; especially the splenocytes / for mergers win.

/ l; ή Γ

2 8 O 1 ί

The monoclonal antibodies secreted by the transformed or hybrid cell lines may be from one of the classes or subclasses of the immunoglobulins; as IgM / IgD, IgA, IgG, _ ₄ or IgE. IgG is preferred / because it is the most common isotype / used in diagnostic assays. The monoclonal antibodies can be used intact or as fragments / as Fv. Fab / F (ab ') ₅ /. However, they are usually used intact.

In order to circumvent a possible antigenic / non-animal monoclonal antibody (s) in a human host, one can construct chimeric antibodies in which the antigenic binding factor of an immunoglobulin inmolekul (variable region) by means of a Pcptidverknupfung of at least a part of another Protein is / is not recognized as foreign in humans / such as the "cast out portion" of a human immunoglobulin molecule. This can be done by fusing the variable region exons of the animal to human kappa or gamma exons of the constant region. For this purpose, the skilled person several methods are known, for example, those described in PCT 86/01533, FP-A-171496 and EP-A-173494 / which is incorporated herein by reference.

Pharmaceutical Formulier nts u u n d Applications

The neutralizing effect monoclonal antibodies of the present invention, for example, those which react with an epitopic site on gPl10 or p25 or with a blocking peptide, can be incorporated as a component of pharmaceutical agents to attenuate HIV infection. The agent should contain a therapeutic or prophylactic amount of at least one of the monoclonal antibodies of the invention together with a pharmaceutically active carrier. The pharmaceutical

Carrier should be a compatible / non-toxic substance / suitable to mediate the monoclonal antibodies to the patient. One may use sterile water, alcohol / fats / wo plus hse and inert solids as carriers Pharmaceutically acceptable adjuvants (buffers / dispersants) may also be incorporated in the compositions of the invention. Alternatively, a pharmaceutical agent may contain one or more monoclonal antibodies and form a "cocktail." For example, a cocktail of the monoclonal antibodies against contains various HIV strains, a universal product with therapeutic or prophylactic activity against most clinical HIV isolates. The cocktail may contain monoclonal antibodies that bind to HIV proteins or glycoproteins / that are different from gPl10 or p25 / such as gp41 glyhoprotein or p34 nuclease / integrase. The molar ratio of the various monoclonal antibody components generally does not differ by more than a factor of 10 / more particularly by not more than a factor of 5, and is generally about 1: 1-2 per each other antibody component.

The monoclonal antibodies of the present invention may be used as a separate agent to be co-administered with other anti-retroviral agents / including blocking peptides. The current state of development of anti-retroviral agents and anti-HIV agents is described in detail in Mitsuya et al., Nature 325: 773-778 / 1987, which is incorporated herein by reference.

; 'Κ <Γ, ⁿ °;. ι · ·. - · ν. -

2 8 O ι ί

The monoclonal antibodies / peptides and pharmaceutical agents of the invention are especially useful for oral and parenteral administration. Preferably, the pharmaceutical agents are administered parenterally / ie, subcutaneously / intramuscularly or intravenously. The present invention therefore also provides means for parenteral administration comprising a solution of the monoclonal antibodies / peptides or a cocktail thereof in an acceptable carrier / preferably an aqueous carrier. A variety of aqueous carriers may be used, for example, water / buffered water / 0/4% saline, .0 / 3% glycine, and the like. These solutions are sterile and generally free of particles. The agent may be sterilized by conventional and known methods. The agents may contain pharmaceutically acceptable excipients / as required / to approximate physiological conditions / such as pH adjusters and buffers / toxicity adjusting agents and the like / for example sodium acetate / sodium chloride / potassium chloride / calcium chloride / sodium lactate and the like , The amount of antibody in this formulation can vary widely, ie, less than about 0/5 wt% _; usually about or at least about 1% by weight up to 15 or 20% by weight. This amount is chosen mainly with regard to the liquid volumes / viscosities and the like / and preferably with regard to the mode of administration.

, A typical pharmaceutical agent for intramuscular injection may thus contain 1 ml of sterile buffered water and 50 mg monoclonal antibodies. A typical intravenous infusion may contain 250 ml of sterile Ringer's solution and 150 mg of monoclonal antibody. Methods for the preparation of parenterally administrable agents are known or are familiar to the person skilled in the art and are described in detail, by way of example.

 mi? "./

2 S O i

in Remington's Pharmaceutical Science / 15th ed .; Mack Publishing Company; Easton ₇ Pennsylvania (1980); to which reference is hereby made.

The monoclonal antibodies and peptides of the invention may be lyophilized for storage and reconstituted in a suitable carrier before use. This method has proven to be effective in conventional immunoglobulins. One can apply known Lyophilisierungs- and Rekonstitution¬chiiiken. It will be apparent to those skilled in the art; that lyophilization and reconstitution can lead to a variable degree of antibody activity loss (in conventional immunoglobulins, IgM antibodies are prone to more loss of activity than IgG antibodies) and therefore, the amount applied must be adjusted; to compensate for the loss.

The means; the monoclonal antibodies of the invention; Containing peptides or cocktails thereof; can be administered for prophylactic and / or therapeutic treatment of HIV infection. In therapeutic administration, the agents are given to a patient; who is already infected with HIV / administered in quantity; which is sufficient / to heal the infection and the associated complications or at least partially bring to a halt. The dose; which one needs / to achieve this; is defined as a "therapeutically effective dose". The effective amounts for this application depend on the severity of the infection and the general condition of the immune system.

The patient's OQ systems are generally in the range of about 1 to 200 mg of antibody per kg of body weight; dosages of 5 to 25 mg per kg are commonly used. Since the products according to the invention are generally used in severe diseases; i.e. in life-threatening

"P. potentially life-threatening situations, it is possible and may be provided by the attending physician.

\ Ί

2 8 OM

ι wishes to be / administer a significantly larger amount of these antibodies.

In the case of prophylactic use, the agent (s) containing the peptides / antibodies of the invention or a cocktail thereof is administered to a patient who has not yet been infected with HIV or who may have been recently exposed to / have suspected such infection exposed or at risk of being exposed to the virus. Prophylactic administration serves to strengthen the patient's resistance to a potential infection or to vaccinate the patient against the virus. An appropriate amount is defined as a "prophylactically effective dose". Also in this application, the exact to ver-ο

Sufficient quantities according to the state of health and the general state of the immune system of the patient / they are generally in the range of 0/1 mg to 25 mg per kg / in particular 0/5 mg to 2/5 mg per kg.

One can make single or multiple administrations of the agent / wherein the dose and administration regimen are selected by the attending physician. The pharmaceutical formulations should in any case provide an amount of antibodies according to the invention

sufficient to treat the patient effectively.

In addition, the monoclonal antibodies according to the invention are used as target-specific carrier molecule. An antibody may be linked to a toxin to form an immunotoxin or to a radioactive material or drug agent to form a radiopharmaceutical or drug. Methods for producing immunotoxins and radiopharmaceuticals are known (see, for example, Cancer Treatment

Reports 68: 317 (1984))

 35

2 3 0

It is also possible / that heteroaggregates of monoclonal antibodies according to the invention and human T cell activators / such as monoclonal antibodies against the CD3 antigen or against the F -I ^ receptor on T cells / human T cells or F - Jf * enable cells (such as K-cells or neutrophils) to form; Kill HIV-infected cells via antibody-dependent / cell-mediated cytolysis (ADCC). Such heteroaggregates can be formed, for example, by covalently crosslinking the anti-HIV antibodies with the anti-CD3 antibodies using the heterobifunctional reagent N-succinimidyl-3- (2-pyridyldithiol) propionate / as described by Karpowsky et al. J. Exp. Med. 160: 1686 (1984) / which is hereby incorporated by reference.

The compositions of the invention based on the peptides alone may also find therapeutic use / wherein the administration results in a reduction or elimination of HIV in an infected host. These agents / such as peptide 29 / the blocking peptides and peptide 126 / which is described in USSN 930785 / which is referred to herein / can be administered in suitable physiological carriers intravenously / subcutaneously / intramuscularly / intraperitoneally, etc. Various carriers are suitable / include phosphate buffered saline / saline / water / potassium chloride / sodium lactate or the like. The peptide concentration may vary widely, depending on the final application / activity and route of administration. Preferably, the peptides have an amidation of the COOH terminus / a formylation of the NH_ terminus, or other pharmaceutically acceptable derivatization. The addition of blocking peptides to the peptides / mimicking a neutralizing HIV region / and / or the specifically reactive inventive

HH /

2 8 O M

Antibodies lead to a significantly increased therapeutic efficacy. The formulations may also contain other anti-HIV agents (other than the monoclonal antibodies that bind the peptides), such as 3'-azido-3'-deoxythymidine / 2 '/ 3'-dideoxycytidine / 2' / 3 ' Dideoxy-2 '/ 3'-didehydrocytidine etc.

Application of monoclonal antibodies to the immune system

affinity purification

The monoclonal antibodies / specific for polypeptides / containing gPL10 or other antigenic determinants / especially those antigenic determinants / derived from biologically expressed recombinant fusion proteins or lysates or extracts of cultured HIV / are most advantageously used in purification procedures. Generally, the antibodies will have affinity association constants in the range of 10 to 10 M. Such antibodies may be used to purify recombinant fusion proteins from the culture medium of the recombinant expression system / when the expressed protein is secreted / or from the components of the recombinant expression system destroyed / biological expression system / if the protein is not secreted. The monoclonal antibodies / capable of reacting with gPL10 or other antigenic determinants are generally bound or immobilized to a substrate or support. The solution / containing the HIV antigenic determinants is then contacted with the immobilized antibody under conditions appropriate for the formation of immune complexes between the antibody and the polypeptides containing the gpl10 antigen determinants. Unbound material is separated from the bound immune complexes

' C k κ / ·', ^L ί 6 ? Γ

Complexes or the gPL10 antigen fragments are then separated from the carrier.

The monoclonal antibodies are typically roughly purified prior to being bound to the carrier / ascites fluid or cell culture supernatants. Such purification processes are known to the person skilled in the art / this includes fractionation with neutral salts at high concentration. Other methods / such as DEAE chromatography / gel filtration chromatography / preparative gel electrophoresis or protein A affinity chromatography / can also be used; to purify the monoclonal antibodies before they are used as Immunoadsorbens application.

The carrier (s) to which the monoclonal antibodies are immobilized should have the following general characteristics:

(a) generally weak interactions with

Proteins / to minimize non-specific binding /

(b) good flow properties _; permitting a flow of high molecular weight materials

(c) presence of chemical groups / which can be activated or modified / to facilitate chemical binding of the monoclonal antibody

(d) physical and chemical stability under conditions / conditions applicable to monoclonal antibody binding and

(e) Stability to the conditions and constituents of the buffers required for the adsorption and elution of the antigen. Some commonly used

*

2 8 O ί ί

used carriers are agarose # derivatized polystyrenes; Polysaccharides / polyacrylamide beads / activated cellulose / glass and the like. There are various chemical methods to attach the antibodies to the substrate carriers / see generally Cuatrecasas P. Advances in Enzymology 36:29 (1972). The antibodies of the invention can be attached directly or alternatively via a link or spacer (linker / spacer) to the support.

The general conditions required for the immobilization of monoclonal antibodies on chromatographic supports are known / see for example P. Tijissen / 1985 / Practice and Theory of Enzyme Immunoassay / which is incorporated herein by reference. The actual coupling method used depends to a small extent on the property and the type of antibody to be coupled. Monoclonal antibodies have properties which are usually consistent from batch to batch, so that the conditions mentioned can be optimized. The linkage is typically via covalent bonds.

To the separation matrix is then added a suspension of extracts or lysates of HIV virus / the supernatant from a cultured biological expression system or a suspension of the disrupted cells. The mixture is incubated under conditions and for a time sufficient to form the immune complex / usually at least 30 minutes _; expediently 2 to 24 h. The immune complexes / polypeptides with antigenic parts of gPL10 contain / separate from the reaction mixture. For example, the mixture is removed by elution and the bound immune complexes extensively washed with adsorption buffer. The immune complexes can then be detected by the

Separation matrix eluiereri; using an eluant / compatible with the carrier used. Such eluents are known in the art. Also the polypeptides; the gPL10 or other antigenic parts can be selectively removed. For example, peptides / containing an epitope / recognized by the antibodies / can be used to compete for antibody binding sites. This represents an alternative elution process / which can be carried out under mild elution conditions. The selectively adsorbed polypeptide / containing the ςρΙΙΟ antigen can be eluted from an antibody affinity adsorbent / by changing the pH and / or ionic strength of the buffer. Chaotropic agents are also used to remove the bound antigen. The choice of a chaotropic agent / concentration and the elution condition will depend on the characteristics of the antibody-antigen interaction, but once established, they should not undergo any change / commonly required in polyclonal affinity separation systems.

It may be necessary to adjust the pH of the eluted material to the physiological pH / if a high or low pH or ionic strength buffer was used / to separate the bound gPL10 antigens from the separation matrix. Also, dialysis or gel filtration chromatography may be required to remove excess / eluent-used salts / to allow reconstitution of gpl10 or polypeptides / antigen fragments of gpl10 / to native conformations.

For example, the methods of the present invention yield substantially pure gPl10 or substantially pure polypeptides / containing antigenic fragments thereof

Ί I! S u /

28 O I I β

either naturally by infected cell cultures or recombinant expression systems of bacteria / yeasts or cultured insects or mammalian cells. gpllO; the fragments thereof or other purified proteins typically have a purity greater than 50%; usually at least 75% and often more than 95 to 99%. These products have many uses.

The HIV-gpl10 proteins that contain polypeptides / antigen fragments thereof or other proteins that have been substantially purified by the method of the present invention have many uses. These include AIDS subunit vaccine formulations / in which the immunogen comprises an effective dose of antigenic determinants of, for example, gPL10 or a neutralizing region thereof. Other components of the formulation may include those antigenic portions of HIV proteins or glycoproteins which stimulate the production of antibodies (preferably neutralizing antibodies) in an immunized host / which antibodies are capable of / / a protective against subsequent HIV infection exercise.

Application of monoclonal antibodies in the diagnosis

The monoclonal antibodies of the invention are also useful for diagnostic purposes. They can be marked or unmarked for this purpose. Typically, a diagnostic assay involves the detection of complex formation by the binding of a monoclonal antibody to an HIV antigen.

Unlabeled antibodies are used, for example, in agglutination assays. In addition, unlabelled antibodies in combination with other labeled antibodies (broad antibodies) / which are reactive with the monoclonal antibodies / antibodies, for example, may be specific

gg for Immunoglobu.lin are / are used. Alternatively, the monoclonal antibodies can be labeled directly

', h ϊ G

2 8 O I

become. One can use a variety of labels / radionuclides / fluorescent substances / enzymes / enzyme substrates / enzyme cofactors _; Enzyme inhibitors / ligands (especially haptens) etc. Numerous types of immunoassays are available / these include, for example, those described in U.S. Patents 3,817 and 27,

3,850,752, 3,901,654, 3,935,074 / 3,984,533, 3,996,345 _;

4 034 074 and 4 098 876, to which reference is hereby made.

Usually, the monoclonal antibodies and peptides according to the invention are used in enzyme immunoassays, whereby, for example, the antibodies according to the invention or the second antibodies of another species are conjugated to an enzyme. When combining a biological sample with HIV antigens, such as human blood serum, saliva, semen, vaginal oecretions or a virus-infected cell culture suspension, with the antibodies, binding between the antibodies and those molecules / having the desired epitope occurs. One can then such proteins or

Separate virus fragments from the unbound reagents and add a second antibody (labeled with an enzyme). Subsequently, the presence of the antibody-enzyme conjugate / specifically bound to the antigen is determined. It is also possible to use other conventional methods known to the person skilled in the art.

To detect HIV infection or the presence of HIV antigens, one can also provide kits using the antibodies of the invention. The monoclonal antibody compositions of the present invention may be provided, usually in lyophilized form, either alone or together with other antibodies specific for other HIV epitopes. The antibodies, which may be conjugated to a label or may be unconjugated, are included in the kits along with buffers such as

/ ι! η Γ; ι

2 8 Q 1

Tris- / phosphate-; Carbonate buffer etc./ stabilizers / biocides; inert proteins / such as bovine serum albumin or the like. In general, these materials are present in an amount of less than about 5% by weight / based on the amount of active antibody and usually in a total amount of at least about 0/001% by weight / based on the antibody concentration /. It is often desirable to add an inert extender or excipient to dilute the active ingredients / wherein the excipient may be present in an amount of from about 1 to 99 percent by weight of the total composition. If a second antibody capable of binding to the monoclonal antibodies is used, it is usually in a separate vial. The second antibody is typically conjugated to a label and analogous to those described above. Ant ikörpei; formulated formulations.

The detection of gPl10 or p25 antigens or whole virus in biological samples is used in the diagnosis of HIV viral infection. Biological samples include, but are not limited to / blood serum / saliva / semen / tissue biopsy samples (brain / skin / lymph nodes / spleen, etc.) / cell culture supernatants; The presence of the virus is assayed by incubating the monoclonal antibodies with the bioloyic sample under conditions which result in immune complex formation and subsequent detection of complex formation by the use of a second antibody capable of binding to a monoclonal antibody / which is typically conjugated to a labeling agent and formulated in an analogous manner as the antibody formulations described above In another embodiment, the monoclonal antibody is conjugated to a monoclonal antibody Firmly-

2 B O ί Ι

phase carrier bound / which is then brought into contact with the biological sample. After incubation, the labeled monoclonal antibody is added / to detect the bound antigen.

H Preparation and application of synthetic peptides

The invention provides; Also available are other peptides which, among others, immunologically mimic the protein epitopes / encoded by the HIV retrovirus / in particular the epitopes encoded within the env or gag regions of the virus genome / which encode the gpl10 or p25. In order to adapt to the different ratios of strain to strain in the respective isolates, an adaptation to conservative substitutions and a selection of alternatives with non-conservative substitutions can be made. These peptides can be used to inhibit or immunopotiate HIV antigen production in vitro or in vivo as immunocjeins for the detection of virus or antibody. against the virus in a physiological sample. Depending on the nature of the scheme, one may conjugate the peptides to a carrier or other compounds / which may be labeled or unlabeled / bound to a solid surface, etc.

In one embodiment, the peptides of the invention are derived from the gp] 10 region of the virus. Of particular interest is the region within the env-open reading frame extending from base pair (bp) 6688 to about bp6750 and from about hp724t> to about 7317. The peptides of interest, including blocking peptides, comprise at least: 5 / sometimes 6, sometimes 8 / sometimes 12, sometimes 21, often less than about 50, more preferably less than about 5, and preferably less than about 25 amino acids in a sequence, which is encoded by a HI V-Retrov.vrus.

V Ü H \ - I

2 3 0

Desirably, the peptides are as small as possible / yet contain substantially all of the immunoreactivity or antiviral activity of a larger peptide. In some cases, it may be desirable to join two or more non-overlapping oligopeptides to form a single peptide structure, or to use them as single peptides simultaneously, these peptides having separately or together an equivalent sensitivity of the starting material.

The peptides can be modified by introducing conservative or non-conservative substitutions, generally with less than 20% points, especially less than 10% points, of the amino acids being exchanged. When polymorphic regions are present, it may be desirable to change one or more particular amino acids to more efficiently mimic the different epitopes of the different retroviral strains. Frequently, methionine will be replaced by norleucine (Nor) to achieve chemical stability.

It should be noted that the peptide used in the present invention need not be identical to a particular HIV polypeptide sequence / as long as the subject compound is capable of immunological competition with the proteins of at least one strain of HIV retrovirus. The subject peptides can therefore be altered in a variety of ways, for example, by insertions / deletions and substitutions in a conservative or non-conservative manner / if such changes entail application benefits. By conservative substitution is meant substitutions / within the groups / as gly / ala; val / ile leu; asp / glu; asn, gin; ser> thr; lys / arg; phe / tyr; and nor, met. Usually, the sequence will not differ by more than 20% from the sequence of at least one strain of HIV retrovirus / unless further amino acids are present on the two

/ ir r η ι-

Vf! H H /

ir r

H H /

2 8 O 1

Termini can be added / to provide an "arm" / by means of which the peptide according to the invention can be immobilized in a simple manner. The arms are usually at least one amino acid in length and may be 50 or more amino acids / more usually 1 to 10 amino acids / long.

The peptide / amino acid sequence modified by substitution / addition or deletion of amino acid residues is / should retain substantially all of the immunoreactivity or antiviral activity of the unmodified peptides. This can be readily determined by various assays described herein. If desired, one may use the d-isomer of one or more amino acids / to modify the biological properties / such as the activity / degradation rate and the like /.

In addition, one or two or more amino acids may be added to the termini of an oligopeptide or peptide to facilitate coupling of the peptides together for coupling to a carrier or larger peptide / for the reasons explained below / for modifying the physical or chemical properties of the peptide Peptides or oligopeptides or the like.

Amino acids / such as tyrosine / cysteine / lysine / glutamic acid or aspartic acid or the like / may be introduced at the C- or N-terminus of the peptide or oligopeptide / to provide suitable linkage functionality.

Cysteine is especially preferred for facilitating covalent attachment to other peptides or for formation of polymers by oxidation.

In addition, the peptide or oligopeptide gene sequences can be separated from the natural sequence by a sequence

ι / Γ Γ Γ

2 8 O Ι ί

differ; by terminal NH ^ acylation / for example acetylation or amidation with thioglycolic acid / terminal carboxyamidation; For example, with ammonia or methylamine, modified / to achieve a better stability / increased hydrophobicity for a compound with or binding to a support or other molecule or for a polymerization.

A preferred embodiment of the above-described peptides I to VIII and IX to XV / when Y or Y ^{1 is} present / is present, for example, when Y or Y ¹ comprises one or more cysteine residues or a combination of one or more spacer amino acid cysteine residues , Glycine is a particularly preferred spacer. Preferred peptides for use in oxidative polymerization are those in which Y or Y ^{1 represent} at least two cysteine residues. When two cysteine residues are present at the same end of the peptide, a preferred embodiment is when the cysteine residues are separated by 1 to 3 spacer amino acid residues / preferably glycine. The presence of cysteine residues may allow the formation of peptide dimers and / or increase the hydrophobicity of the resulting peptide / which facilitates immobilization of the peptide on solid phase or immobilized assay systems.

Of particular interest is the use of the mercaptan groups of the cysteines or thioglycolic acids or the like used to acylate the terminal amino groups to link two peptides or oligopeptides or combinations thereof via a bisulfide bridge or a longer bridge to form polymers / containing a series of epitopes. Such polymers have the advantage of an enhanced immunological reaction. In addition, when different peptides are used to make the polymer, they have the ability / antibody

') 11 HH / -

2 8 O! !

/ immuno-responsive to some antigenic determinants of various HIV isolates.

For the formation of antigenic polymers (synthetic multimers), one can use compounds having bis-haloacetyl groups / nitroarylhalcgenides or the like; the reagents being specific for thio groups. The linkage between two mercapto groups of different peptides or oligopeptides may thus be a single bond or a linker of at least 2 / usually at least 4 and not more than about 16 / usually not more than about 14 carbon atoms.

The peptides in question may be used bound to a soluble macromolecular carrier (for example not less than 5 kDal). Conveniently, the carrier is a naturally occurring or synthetic poly (amino acid) against which antibodies in human serum are unlikely. Examples of such carriers are poly-L-lysine / keyhole limpet-hemocyanin / thyroglobulin / albumins / such as bovine serum albumin / tetanus toxoid, etc. The choice of carrier will depend primarily on the intended use for the antigen and will depend on the desirability and availability of the antigen Trägars. In such conjugates there is at least 1 molecule of at least one peptide per macromolecule and not more than 1 per 0/5 kDal / usually not more than about 1 per 2 kDal of the macromolecule /. One or more different peptides can bind to the same macromolecule.

The compound is usually carried out using reagents such as p-maleimidobenzoic acid / p-methyldithiobenzoic acid / maleic anhydride / succinic anhydride / glutaraldehyde, etc. Binding may be at the N-terminus / C-terminus or between the ends of the molecule.

2 3 0

The peptide can be derivatized by linkage / linked while attached to a support, or the like.

In order to detect the presence of antibodies against retroviral proteins or retroviral proteins themselves, one can proceed according to various, familiar to the expert assay method. Of particular interest is to use the peptide as a labeled reagent, wherein the label provides a detectable signal, or to bind the peptide directly or indirectly to a surface, wherein the antibody binds to the peptide in the sample at the surface of the peptide becomes. The presence of a human antibody bound to the peptide may then be accomplished using a xenogenic antibody specific for human immunoglobulin, usually both human IgM and IgG, or a labeled protein specific for immune complexes, for example the Rf factor of S. aureus protein A.

An example of an assay method is the use of a sample container, for example the wells of microwell plates, wherein the polypeptide or conjugates thereof are covalently or non-covalently adsorbed to the bottom and / or walls of the container. The sample, usually human blood or serum diluted with a suitable buffer medium, is placed in the container and allowed sufficient time for the complex to form between the polypeptide (s) and a corresponding antibody in the sample. Remove the supernatant and wash the container to remove non-specifically bound proteins. For detection, use is made of a labeled specific binding protein that specifically binds to the complex, such as xenogeneic human immunoglobulin antiserum.

/ ι. π Γ-. °

The peptide can be prepared in a variety of ways. The peptide can be synthesized because of its relatively short length in solution or on a solid support according to conventional methods. Various automatic synthesizers are commercially available and can be used in a known manner. See, for example, Stewart and Young / Solid Phase Peptide Synthesis / 2nd Edition / Pierce Chemical Co./1984; and Tarn et al. J. Am. Chem. Soc. (1983) 105: 6442.

Alternatively, hybrid DNA technology can be used in which a synthetic gene is produced using single strands encoding the polypeptide or substantially complementary strands thereof, with the single strands overlapping and annealing can be brought together to hybridize. The hybridized strands can then be ligated to a complete gene and the gene inserted by choosing appropriate terms in readily available expression vectors, see, for example, Maniatis et al / Molecular Cloning, A Laboratory Manual, CSH / Cold Spring Harbor Laboratory / 1982 may clone and express the region of the viral genome (s) encoded by the peptide by conventional recombinant DNA techniques (see above Maniatis et al.).

DNA code sequences of LAV and ARV 2 isolates of HIV /

BKU

which can be used to express the peptides include the following: 30

H! fc! · / ·.

LAV TGT ACA AGA CCC AAC AAC AAT ACA AGA AAA AGT ATC CGT ATC CAG AGG GGA CCA GGG AGA GCA TTT GTT ACA ATA GGA AAA ATA GGA AAT ATG AGA CAA GCA CAT TGT

ARV-2 TGT ACA AGA CCC AAC AAC AAT ACA AGA AAA AGT ATC TAT ATA GGA CCA GGG AGA GLA TTT CAT ACA ACA GGA AGA ATA ATA GGA GAT ΑΤΑ AGA AAA GCA CAT TGT

For expression of peptide fragments one can use fragments of a sequence. One can / do not encode conservative base changes / where the modified codon (s) encode (encode) the same amino acid (s)

perform conservative base changes in the coding sequence; wherein the resulting amino acid may be a conservative or non-conservative change in amino acid sequence / as described above.

The code sequence may be extended at the 5 'or 3' terminus or at both / to extend the peptide / while retaining the epitope site (s). The extension may serve to provide an arm for attachment to, for example, a label product / enzyme such as two or all peptides together in the same chain / antigenic activity and appropriate restriction sites for cloning or the like ,

The DNA sequence itself / the fragments thereof or larger sequences / usually at least 15 bases / preferably at least 18 bases ₍ can be used as nucleotide probes for detection of retroviral RNA or proviral DNA or for homologous region identification for cloning or sequencing Methods described / how the Grunstein-Hogness method / Southern method /

Northern method, dot blot / improvements thereof, as well as other methods / such as those; U.S. Patent 4,358,535, which is incorporated herein by reference.

The peptides of the invention, including the blocking peptides and their analogs, are used alone or in combination in vaccines. Similarly, vaccines can also use anti-idiotype antibodies, i. Antibodies that react with the idiotype of the antibodies of the invention containing epitopes that mimic the neutralizing HIV regions. The peptides or anti-idiotypic antibodies may be formulated in a conventional manner, generally in concentrations ranging from 1 pg to 20 mg / kg of the host.

Physiologically acceptable media may be used as the carrier, for example, sterile water, saline, phosphate buffered saline, and the like. Adjuvants such as aluminum hydroxide gel, surfactants such as lysolecithin, pluronic polyols, polyanions, peptides, proteins (e.g., diphtheria and cholera toxin) and oil emulsions may be employed. The peptides can also be incorporated into vaccine formulations and liposomes or conjugated to polysaccharides, polypeptides or polymers. Administration may be by injection, for example intramuscularly, peritoneally, subcutaneously, intravenously, etc. Administration of an immunogenically effective dose may be one or more times, usually at intervals of 1 to 4 weeks. An "immunogenically effective dose" is that amount of a vaccine that is capable of eliciting an immune response in a host, the host exhibiting an increased infection.

The following examples illustrate the invention without limiting it

 35

2 3

Example I

Generation and Characterization of Monoclonal Antibodies 5

Example I describes the generation of hybrid lines / producing monoclonal antibodies specific for HIV envelope glycoproteins. This method involves the use of lectin-purified extracts of LAV,

which is bound to lentile lectin agarose as an immunogen.

The monoclonal antibodies subsequently generated by the hybrid lines are characterized by their ability to immunoblot gpl10 from purified LAV and to precipitate in a radioimmunoassay as well as a biologically expressed recombinant fusion protein. The monoclonal antibodies / binding to the epitopes on gpl10 also react and react in ELISA's with disrupted whole virus / fusion proteins and synthetic peptides

with whole viruses in indirect fluorescence assays. 20

Generation of the monoclonal antibody producing hybrid cell lines and characterization of the antibodies are as follows:

LAV viruses purified from infected CEM cells (ATCC No. CRL 8904) in 50 mM Tris / pH 7 _; 4/0 / 15M NaCl / 1.0% aprotinin, 2.0% Nonidet P-40 ^ (NP-40) (octylphenoxypolyethoxyethanol) destroyed. The extract was clarified 2 χ by centrifugation and brought to 0 _; 5% NP - 40 through

SQ addition of 3 volumes of disruption buffer set without NP-40. Lentil lectin-pharose (Pharmacia / Piscataway / NJ) was prewashed in disruption buffer without NP-'O and then in adsorption buffer (50mM Tris / pH 7/4 / 0.15M NaCl., 1.0% aprotinin, 0.5% NP -40) equilibrated.

The clarified virus extract was incubated with lentil lectin

'ί. Γ ;; '> ⁿ

sepharose adsorbed at 4 ^{C for} 42 h. Unadsorbed material was removed by washing with excess adsorption buffer. The elution of the adsorbed material was carried out with 0/2 M öc ^ -Methylmannosid in adsorption buffer. The eluate was dialyzed against PBS to remove the sugar and the material was re-adsorbed to lenlile lectin sepharose.

The glycoprotein-lentil lectin-phosse complex was used; BALB / c mice by three intraperitoneal injections without adjuvant; immunized at intervals of 2 to 3 weeks »The spleen of the immunized! Mice were removed. Immunoblot RIP and / or ELISA reveals circulating antibodies to glycoproteins.

Cell line production was generally carried out according to the Kohler and Milstein protocols (Nature 256: 495 (1985)) with the modifications of L.C. GoIdstein et al., (Infect Immun, 38: 273 (1982);) The spleen B lymphocytes from the immunized mice were fused with NS I myeloma cells using 40% (w / v) polyethylene glycol to fusion, the cell mixture was resuspended in HAT medium (RPMI-1640

-4 supplemented with 15% fetal calf serum, 1 × 10 M hypoxanthine, 4 × 10 -3 M amine pterin and 1.6 × 10 -3 M thymidine), in order to select for growth of the hybrid cells and then to 96-well Micro culture plates at a concentration of 1 to 3 χ 10 cells / ml and incubated at 37 ⁰ C in a humid atmosphere containing 6% C0_.The cultures were fed by half of the Ub:? Rstandes by fresh HAT medium The wells were observed using a plankton microscope for signs of cell proliferation and as soon as the cells

2 8 ο: ι a

had sufficient density, the supernatants were tested for anti-LAV antibody.

Those wells containing antibodies to LAV-producing hybrid cells were identified by ELISA's, determining binding to purified, disrupted whole viruses, or biologically expressed fusion proteins. The ELISA assays using disrupted viruses were performed on LAV EIA plates (Genetic Systems, Seattle, Washington). The plates were incubated with cell culture fluid at 37 ° C for 45 min and then washed 3x with 0.05% Tween 20 in phosphate buffered saline (PBS-Tween).

Peroxidase goat anti-mouse IgG (1: 2,000 dilution in PBS-Tween, Zymed Laboratories, Inc., South San Francisco, California) was added (100μl per well) and the plates were left at 37 ° C for 45 min incubate and wash as above. It was added substrate (0.025 M citric acid, 0.05 M dibasic sodium phosphate, pH 5, containing 14 mg of o-phenylenediamine and 10 \ i \ of 30% Wisserstoffperoxid per 50 ml) and the plates were incubated for 30 min. At room temperature in the dark incubated. The reaction was quenched with 3N sulfuric acid and the colorimetric reactions were quantitated with an automatic microplate reader. Those wells that gave positive results were durci. Boundary dilution subcloned, re-tested for specificity and then expanded.

The monoclonal antibodies secreted by the resulting hybrid cell lines were further evaluated for specificity and reactivity by immunoblotting, immunoprecipitation and ELISA using disrupted LAV viruses, recombinant LAV fusion proteins and synthetic LAV

3g peptides characterized. It was found that other antibodies are of the IgG isotype. Cell lines HIV-gPL10-1,

2 3 0

HIV gpl10-2 and HIV gpl103 were in the Amercian Type

Culture Collection deposited before filing this application and have the deposit nos. ATCC HB 9175 / HB9176 and HB9177

 5

The recombinant fusion proteins tested for their reactivity were designated ENV2, ENV3 / ENV4 and ENV5. The protein ENV2 is expressed from pENV2 (ATCC No. 53071) and comprises the LAV region from base pair (bp) 6598 to bp / 178 (numbering according to Wain-Hobson et al., Cell 44: 9 (1985) pENV3 (ATCC No. 53072) and comprises the LAV region from bp 7178 to bp 7698. ENV4 is expressed from pENV4 (ATCC No. 53073) and comprises bp7698 to bp 8572. ENV5 is expressed from pENV5 (ATCC No. 53074) and covers the LAV range from bp 5889 to bp 7698. The production of the recombinant fusion proteins is described in detail in USSN 721,237, which is hereby incorporated by reference.

Assembly of synthetic peptides

Peptides I (29) and VIII (110-2-2) were assembled on a benzhydrylamine resin (polystyrene / divinylbenzene (Applied Biosystems, Inc., Foster City, California).

Peptide V (177) was assembled on a t-butyloxycarbonyl (Boc) -ethylbenzylcysteine-phenylacetamidomethyl (PAM) -polystyrene / divinylbenzene resin. Symmetric anhydride couplings were performed in an Applied Biosystems 430A Synthesizer. Cysteine was added as the first residue to the two peptides.

Couplings with dicyclohexylcarbodiimide in the presence of hydroxylbenzotriazole were used for asparagine and glutamine. The protecting groups used were side chains based on benzyl groups and Boc- <Xy-amine upper ». Further

fi i; :

i; rt f. I

2 3 O M

Side chain protecting groups routinely used were Boc (formyl) -tryptophan / Boc-methionine sulfoxide / Boc (tosyl) arginine / Boc (methylbenzyl) cysteine / Boc (tosyl) histidine / Boc (chlorobenzyloxycarbonyl) lysine and Boc (bromobenzyloxycarbonyl) tyrosine.

The radiolabeling of the peptides was carried out by acetylation of the amino terminus with Η-acetic acid and an excess of dicyclohexylcarbodiimide.

Removal of the protecting groups and cleavage of the peptide from the resin was done according to the Tarn "low-high" HF method (Tarn et al / supra). The extraction of the resin was carried out with 5% acetic acid and the extract was subjected to gel filtration chromatography in 5% acetic acid.

Synthetic HIV peptides / tested for reactivity with the monoclonal antibodies included peptides 29, 36, and 39. Peptide 29 is encoded by the LAV _0n , genomic region from about bp 6688 to bp 6750; peptide 36 is encoded by the range from about bp 7246 to bp 7317; and peptide 39 is encoded by the range of about bp 7516 to bp7593. Peptides 3d and 39 are described in detail in U.S. Patent 4,629,783, incorporated herein by reference.

The blocking peptides IX-XV were assembled essentially as described above on a methyl benzhydryl amine resin (polystyrene / divinyl benzene) (Applied Biosystems, Inc. Foster City, California). Symmetric anhydride couplings were performed on an Applied Biosysteins 43OA synthesizer. For asparagine couplings were mii. Dicylcohexylcarbodiimid used in the presence of hydroxybenzotriazole. As protective groups, side effects

' ΐ. r: Π

benzyl group-based chains and boc- c, amine protecting groups were used, whereas Boc (bromobenzyloxycarbonyl) was used specifically for tyrosine side chains. Acetylation was carried out / if present / using acetic anhydride or glacial acetic acid and dicyclohexylcarbodiimide. Deprotection and cleavage of the peptide from the resin was done according to the "high" standard HF procedure (Stewart et al., Supra). Extraction from the resin was done with 50% acetic acid and the extract was then subjected to gel filtration chromatography in 20% acetic acid. If desired, high pressure liquid chromatography was performed on a Vydac C18 column (Rainin Instrument Co., Emeryville, CA) using a 0/1% trifluoroacetic acid acetonitrile gradient.

immunoblotting

Immunoblotting characterization was performed on clone supernatants or ascites fluid using purified LAV viruses and recombinant fusion proteins as antigens. The antigens were first separated by polyacrylamide gradient gel electrophoresis (7/0-15 _; 0%) and transferred to a nitrocellulose membrane (NCM) by 4 hours of electrophoresis at 25 V in 25 mM sodium phosphate (pH 7/0). After transfer, the NCM was blocked by incubation at room temperature for 1 hour in PBS-Tween or Blotto (5% low-fat dry milk in PBS) / to prevent nonspecific interactions. The NCM was incubated with cell culture supernatant or ascites fluid / diluted in PBS-Tween / 1h at room temperature and rinsed 3χ with PBS-Tween. In the second step, the NCM was incubated with goat anti-mouse IgG horseradish peroxidase / diluted in PBS-Tween / 1 h at room temperature. Following incubation, washing was performed with PBS-Tween / followed by immersion for 20 minutes in horseradish peroxidase color developing solution (Bio-Rad Laboratories / Richmond, California).

Vi!

2 8 O 1 ί

The reaction was stopped by immersion in deionized water. The monoclonal antibody activity was compared with a positive control serum _; that reacts with purified disrupted viruses or expressed fusion proteins. It was shown that all antibodies bound to gpl10 or its precursor molecule gpl50 using destroyed virus preparations. Antibodies 110-1 and 110-2 also recognized the ENV3 fusion protein whereas antibodies 110-3, 110-4, 110-5 and 110-6 converted ENV2 into an immunocomplex.

immunoprecipitation

Virus extracts for radioimmunoprecipitation were prepared from CEM cells _spiked with LAV _onrl HIV isolate.

BKU

which was adapted to lytic growth by continuous passage. Once early cytopathic effects were seen, the cells were transferred to labeling media containing S-methionine (0.05 mCi / ml) or [h] -glucosamine (0.025 mCi / ml), then incubated for 24 h, until most of the cells had lysed and released the virus into the culture supernatant. The viruses were pelleted from the cell-free supernatant (1 h at 100,000 xg) and detergent extracts were added to P-RIPA buffer (phosphate buffered saline containing 1.0% Triton X-100, 1.0% deoxycholate, 0.1% SDS and 1% aprotinin). Similar extracts were prepared from the supernatants of uninfected CEM cells.

Immunoprecipitation assays were performed with 100 μM virus extract, which was incubated for 1 h on ice with 100 μM culture supernatant from the hybrid cell lines. 4μl rabbit anti-mouse Ig (Zymed Laboratories, So. San Francisco, California) was added to each sample and incubated for 30 min. Immuno-precipitin was added to each sample (100μ 1ϊ

Ί << K Ij '' / ', η ι. 1

2 8 O M

Bethesda Research Laboratory / Bethesda; Maryland) / which was resuspended in P-RIPA buffer / containing 1% ovalbumin and incubated for a further 30 min. The bound complexes were washed and separated by SDS-polyacrylamide gel electrophoresis (15/0% acrylamide: DATD-GeI). Following electrophoresis, the gels were fixed / soaked / dried in Enhance (New England Nuclear, Boston, Mass.) And contacted with a Kodak XR-5 film. A positive reference serum that immunoprecipitates with all HIV virus proteins: / was reacted as positive and negative controls with virus-infected and mock-infected CEM cell supernatants.

The results show that all six monoclonal antibodies specifically immunoprecipitated gpl10 and gpl50.

Enzyme-linked immunoadsorbant assay

In order to map the gpl10-epitopes recognized by the monoclonal antibodies of the present invention, the culture supernatants from hybrid cell lines or ascites fluid were further characterized by reactivity in ELISA assays with biologically expressed fusion proteins and synthetic peptides. The procedures were the same as those described above / except that the fusion proteins or synthetic peptides replaced the purified viruses as antigens / adsorbed to the surface of the microtiter wells.

, When using peptides as antigen, the procedure was as follows. The lyophilized peptides were dissolved in 6 M guanidine-HCl. Immediately before plating into the 96-well plates, the guanidine solution in 0/05 M carbonate / bicarbonate buffer (pH 9/6) was assayed for peptide

71! K! -7

κ> · Γ,

3 0

diluted final concentration of up to 100 μ9 / Ίη1. 50 μΐ of the diluted peptide was added to each microtiter well. The plates were then incubated overnight at 4 ° C. Excess peptide solution was "shaken out"; the plates were blocked with blotto and the further ELISA assay was performed according to the procedure described above. Similarly, recombinant protein was diluted to a final concentration of about 2 pg / ml in 0.05 M carbonate / bicarbonate buffer (pH 9.6) and the same procedure repeated.

The results; are shown in Table II. The monoclonal antibodies produced by the cell lines HIV-gpl10-1 and HIV-gpl10-2 reacted with ENV3, ENV5, peptide 36 and destroyed viruses. The antibodies from the HIV-gPL10-3, HIV-gpl10-4, HIV-gpl10-5 and HIV-gpl10-6 cell lines reacted with ENV2 and peptide 29 as well as with destroyed viruses.

TABLE II

ELISA assays showing the reactivity of the monoclonal antibodies with recombinant proteins and synthetic peptides

Recombinant fusion protein Synthetic peptides LAV CEM

EN V 2 ENV 3 ENV4 ENV 5 29 36 39 Control Control

³⁰ 110-1 0.077 3.ΟΟΟΟ.113 3.ΟΟΟ

110-2 -0.003 3.000 0.000 3.000

110-3 3.000 0.011 ND ND

110-4 3.000 0.020 ND ND

110-5 3,000 0.014 ND ND

35 110-6 3.000 0.033 ND ND

ND 2 .421 0054 0908 0125 ND 2 .305 -0,005 1214 0009 3000 ND 0017 0363 0046 3000 ND 0016 0383 0067 3000 ND 0016 0368 0025 1937 ND 0017 0486 0032

'! Whel

i.v-

The results compiled in Table II show that the monoclonal antibodies 110-1 and 110-2 recognize an antigenic determinant / encoded by the DNA sequence in the pENV3 region / particularly by the region of the HIV genome Sequence of amino acids in peptide 36 is defined. That is, the monoclonal antibodies gpl10-O and 110-2 bind to a peptide region of gpl10 / encoded in bp 7246-7317 / as shown by the formation of immune complexes with peptide 36 and ENV3. This region of the HIV genome has been identified as conserved / dh with only minor changes i _n the DNA sequence in the region / that is encoded by peptide 36 at various viral isolates of different geographical origin / see Starcich et al, Cell 46:. (637 1986). In contrast, the monoclonal antibodies gpllO-3 / -4 / -5 and -6 bind to HIV peptides / defined by the region encoded by peptide 29 from bp6688 to about bp 6750. The region in gpl10 defined by peptide 29 was identified as containing several nucleotide substitutions in different virus isolates. The monoclonal antibodies that selectively bind gp110 polypeptides / which contain conserved epitopes / such as antibodies 110-1 and 110-2, may often be particularly useful, for example, in affinity chromatography, etc. The peptide also reacts in an ELISA assay 110 * - 2-2 with sera isolated from the person / LAV-2.

Indirect immunofluorescence assay

Indirect immunofluorescence assays using monoclonal antibodies against HIV gpl10 antigen were performed on acetone-fixed and live cells. Acetone-fixed slides / prepared from LAV-infected CEM cells were incubated with V3-thinned culture supernatants.

Vfi R

* Or ascites fluid was 1 h at 37 ⁰ C incubation / whereas living cells with culture supernatant or ascites fluid 1 h at 4 ° C were incubated / before the cells were added to the slides and fixed with acetone. Both methods used fluorescein isothiocyanate labeled anti-mouse IgG; to detect those cells; having the reactive gPL10 antigen. The monoclonal antibodies HIV-gpl10-1 gave positive results both when using live or acetone-fixed LAV-infected cells.

Example II

Neutralization of HIV infectivity by anti-gPL10 monoclonal antibodies

This example describes and characterizes the neutralization of HIV infectivity using monoclonal antibodies / binding to gpl10 and peptides within gpl10. The results show that the antibodies have gpllO-3 / -4 / -5 and -6 neutralizing activity and that gpHO-3 and -4 have particularly high neutralizing activity.

Neutralization assay

A sensitive neutralization assay was developed to quantify the effect of monoclonal antibodies on HIV infectivity. A CD4 + cell line / CEM / which is particularly sensitive to HIV infection / was chosen as the target cell for infectivity comparisons. ascites; prepared as described in Example I; or the IgG fraction thereof; which was / was purified using ammonium sulfate precipitation

2 8 O I

Inactivated at 56 ^° C. for 30 minutes; then, as necessary, in RPMI medium / containing 10% fetal calf serum. A suspension of HIV strain LAV was harvested from about 4 days old CEM cultures in log phase of growth / by a 0/2 or 0/45 microfilter filtered / divided into aliquots and frozen at -70 ⁰ C. An aliquot was thawed / titrated to determine TCID ₅₀ and then assays were performed with freshly thawed aliquots / diluted to a ratio of 1: 500 in culture medium to about 10-fold concentration / required / by 50% of CEM cells in the culture (10 TCID ₅₀ ) to infect. The virus suspension was mixed with the same volume (250 μΐ) of a monoclonal antibody preparation in 5-fold dilutions of 1: 5 to 1: 9,765,625. The virus / antibody mixture was incubated at 37 ^° C. for 45 min and then duplicated from 1: 5 to 1: 9 765 625. The virus / antibody mixture was then incubated at 37 ° C for 45 min. Subsequently, duplicate samples ^of 200 μΐ were used to inoculate / wells containing 1 ml of approximately 2 χ 10 CEM cells per well. The cultures were incubated at 37 ° C in a humidified atmosphere with 5% CO 2 for 14 days. Cells were harvested / pelleted and treated with 1% Triton-X-100 in PBC for about 10 min.

lysed. The amount of virus (or viral antigen) / present in the lysed cells was quantitated using a sensitive HIV antigen capture "sandwich" enzyme immunoassay as described below. The titer of neutralizing activity, if any, / was determined to be the reciprocal of the dilution of the monoclonal antibodies / which inhibited more than 5% of the antigen production of the virus control cultures / which were incubated without antibody or with a " ¹ " non-monoclonal antibody of the same isotype previously shown / that it has no neutralizing activity.

2 S O 11

In the above-mentioned HIV antigen capture assay, two monoclonal antibodies to p25 antigens were used as the capture reagent. These hybridoma cell lines were generated by the methods described above with minor modifications / including the use of a purified gag recombinant fusion protein as immunogen and characterization of the resulting monoclonal antibodies for specificity and reactivity using those as GAG-I / GAG-2 and GAG-3 The recombinant fusion protein and the synthetic peptide 141 are described. The protein GAG-I is expressed from PGAG-I (ATCC No. 53379), GAG-2 is expressed from pGAG-2 (ATCC No. 53111) and GAG-3 is isolated from pGAG- 3 (ATCC No. 53112). The production of the recombinant fusion proteins is described in detail in USSN 764,460 and 828 / incorporated herein by reference. Synthetic peptide 141 is driven by the LAV__ _r gene region

BKU

encodes / corresponds to the amino acid residues 198 to 242. The monoclonal antibodies produced by the hybridonelial 1-liners p25-2 and p25-3 react / react with the recombinant fusion proteins GAG-I / GAG-2 and GAG-3. The monoclonal antibodies obtained from p25-3 also react with the synthetic peptide 141.

To perform the antigen capture assay, the capture reagents were first adsorbed to a solid support. Ascites fluid / derived from hybridoma cell lines p25-2 and p25-3 was diluted 1: 5000 in 25mM Tris buffer pH 8.5. 200 μΐ were placed in the wells of microwave

3Q plates given. The wells were sealed and incubated for approximately 16 hours at 4 ⁰ C. The solution was aspirated from the plates before adding a blocking solution of 0.3% Blotto in PBS. The blocking took place 15 Hin. at room temperature. The blocking solution was aspirated and the sample was added. 200 μΐ of the lysed

f. i "; ti 'I, ^l I ·

ι Λ {, I ' ι -> - - ·

Cell suspension and 5 μΐ detection conjugate / prepared as described below / were added to each well. The corrugated strips or plates were incubated for 2 h at 37 ⁰ C; then the suspension was filtered off with suction and the wells were washed 4 × with buffer (0/05% Tween 20 in PBS).

The detection conjugate was prepared as follows. The monoclonal antibodies p25-6 and p26-7 were subjected to horseradish peroxidase (HRP) in a molar ratio of 3: 1 (ex: HRP) for 3 h using the periodate oxidation method (Nakane et al / J. Histochem., Cytochem : 1084 (1974)). The conjugates were diluted 1: 1500 in 2/5% (w / v) low-fat dry milk / 0/01 thimerosal and 0/005% antifoam A in 20 mM sodium citrate. The remaining portion of the ELISA assay was performed as described in Example I.

The determination of the neutralizing activity with the antibodies gpllO-3 / -4 / -5 and -6 gave the following results. The highest titres with retained neutralizing activity were: gp.UO-3 = 15,625; gPL104 = 9,765,625; g p lO-5 = 125; and gPL106 = 625.

Based on the predicted genetic variability of the range defined by peptide 29, the ability of the monoclonal antibody gPl10-4 / other HIV isolates to be recognized / investigated. The immunofluorescence assays were performed as described above. The antibody gpl10-O could detect antigen in cultures of at least three of 16 HIV isolates.

The apllO-4 antibody was able to neutralize / isolate viruses / isolated from a chimpanzee over a period of 15 weeks / inoculated into a control animal with LAV in an AIDS vaccine trial. The monoclonal antibody was able to neutralize / isolate zi ¹ / although the

/ r i; c; ο -

2 8 O 1 1

Animal serum antibody; neutralized HIV in vitro and although the animal had formed a measurable / cell-mediated immune response to HIV infection. This demonstrates the lack of antigenic drift in vivo for the epitope / recognized by the gpl10-4 antibody.

Example III

Neutralize HIV infectivity with a cocktail of anti-gPL10 and anti-p25 monoclonal antibodies

This example describes the neutralization of HIV infectivity using monoclonal antibodies; which bind to gpl10 and peptides within gpl10; in combination with monoclonal antibodies which bind to p25 and to peptides within p25 and which have only little or no neutralizing activity. Di ^ results show; that the monoclonal antibody gpl102 in combination with p25-6 or p25-7 has a particularly high neutralizing activity.

Hybridomas ^{1, 1 and} 2 p25-6 and p25-7 were generated by the methods described above using the modifications; including the use of inactivated disrupted viruses or purified gag recombinant fusion proteins; which were expressed in E. coli as immunogen; and characterizing the monoclonal antibodies for specificity and reactivity; the GAG-I; GAG-2 and GAG-3 designated recombinant-fusion proteins and the synthetic peptides 15; 88, 150/147 and 148 were used. The synthetic peptides are derived from the LAV __, _ genome

BKU

which encodes the following amino acid residues: gg peptide 15, amino acid residues 329 to 350; Peptide 88, amino acid residues 315 to 350; Peptide 150, amino acid residues 318 to

nui

2 8 O ί ί

363; Peptide 147 / amino acid residues 278 to 319; and peptide 148 / amino acid residues 290 to 319. The monoclonal antibodies produced by the hybridoma cells p25-6 and p25-7 react with the recombinant fusion protein GAG-3; p25-6 reacts with synthetic peptides 147 and 148 / and p25-7 with synthetic peptides 15/88 and 150.

The neutralization assays were performed as described above except that when using cocktails, the individual monoclonal antibodies were first diluted 1: 5 in culture medium and then mixed in equal ratios / to give a final dilution of 1:10. The remaining part of the assay was performed as above.

The monoclonal antibodies gPl10-p25-6 and p26-7 show less than 50% neutralizing activity when used alone. When using a cocktail / monoclonal antibody gpl3O-2 together with p25-6 or gpl10-2 with p25-7 at a dilution of 1:10, complete neutralization will occur. A cocktail containing monoclonal antibody p25-6 in combination with p25-7 gave a neutralizing activity in the range of 60 to 90%.

Example IV Immunoefficacy of peptide 29 and the homologs thereof

The Ability of Peptide 29 and the Homologous Peptides / a-30

finally, the peotid 177, an immune response to HIV

stimulated / was examined on two mouse strains. The preparation of the peptide immunogens / immunization methods and the characterization of the immune responses elicited are described below. 35

'/ 0 HH / ι bi: 6? "

Peptide 29 is prepared for immunization by conjugation to a purified thyroglobulin. Thyroglobulin can be derivatized for conjugation with N-succinimidyl 4- (N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) according to the methods described in U.S. Patent 4,629,783 / column 10 / lines 28-51. As a second immunogen, thyroglobulin is derivatized with glutaraldehyde as follows. 27 mg of porcine thyroglobulin are dissolved in 1 ml of Oil M sodium bicarbonate. For this purpose, dry 8/3 μΐ of a 25% glutaraldehyde solution and the mixture is stirred overnight at room temperature. Add 1 ml of sodium carbonate / bicarbonate buffer of pH 9/3 to the solution and then dialyze for 8 hours against 2 liters of the same buffer at 4 ° C., with complete replacement of the dialysate after 4 hours. Peptide 29 is then added to the derivatized thyroglobulin in about 100-fold molar excess and the mixture is stirred overnight at room temperature. Block unreacted glutaraldehyde with 200 μL of a 0/2 M lysine solution and stir the mixture for several hours (or overnight) at room temperature. The peptide-thyroglobulin conjugate is then extensively diaβysed against PBS at 4 ° C.

Two mouse strains (C57 black and BALB / c) are inoculated with the peptides / which were prepared by the respective conjugation method. All animals were about 2 to 4 weeks old at the time of inoculation. Inoculation may be in the footpad / by tail scarification / subcutaneous / intranasal or intraperitoneal. The inoculum consists of 25 μg of the conjugated peptide / suspended in 0/5 ml complete Freund's adjuvant / according to dar 2. / 3. and

Week 5 booster inoculations with the same immunogen / suspended in incomplete Freund's adjuvant / are given. Serum samples are collected from the individual mice before immunization / 4 days after booster immunization after 3 weeks and 4 days after the last booster immunization after 5 weeks. The serum samples were for antibodies against

') η OO 7. , '· * · ^R ( ^{η η}

homologous peptides or whole viruses were analyzed by screening in an ELISA assay. Those serums; show antibody activity against LAV; are subjected to further screening for neutralizing activity. This is followed by analysis of the sera in immunoblot assays against disrupted ^T jAV antigen and radioimmunoprecipitation assays with radiolabelled gpl10.

The results of the immunizations show; that with the

Peptide 29 immunized mice to develop antibodies; which react with peptide 29 and destroyed LAV-1 viruses in ELTSA assays. Conjugation of peptide 29 by maleimide results in the formation of anti-peptide-29 antibodies in some balb / c mice. The conjugation of the peptide 29 by

Glutaraldehyde generally gives higher titers of antibodies to peptide 29 in balb / c mice. Mice immunized with peptide 177 will develop antibodies to the peptide. Conjugation of peptide 177 by glutaraldehyde was better in eliciting an immune response.

C57 mice respond more strongly to peptide 177 immunostimulation than balb / c mice. Mice immunized with LAV-2 peptide 110-2-2 develop antibodies to 110-2-2 and LAV-2 viruses; as demonstrated by ELISA assays. The glutaraldehyde-conjugated peptide

110-2-2 is immunogenic in both C57 and balb / c mice; the titers against the 110-2-2 peptide are generally higher in balb / c mice than in C57 mice; while titers against the LAV-2 virus in general

C57 mice are higher than balb / c mice. 30

Those serum samples from immunized mice that (i) antibodies to whole viruses show; (ii) being able to neutralize HIV, as in the assays described in Example II, and (iii) reacting with peptide 29 in ELISA assays, cumulatively demonstrate the efficacy of using peptide 29 in a vaccine formulation

Example V

Immunoaffinity separation of gPl10 using monoclonal antibodies

Monoclonal antibodies to the gpl10-HIV antigen can be obtained

in immunoaffinity separation procedures to use the 15

bacterially expressed recombinant fusion proteins. When the expressed protein is secreted by the bacteria, the protein can be isolated from the culture supernatant. If the protein is not secreted, destruction of the bacterial cells may be required.

The construction of plasmid pENV-5 (ATCC No. 53074) is described in USSN 721,237, which is hereby incorporated by reference. The plasmid pENV-5 codes for the main part

the carboxyl end of gPL10 and part of the amino A o

terminus of gp41 of LAV inserted into the trp expression vector. E. coli C600 transformed by this vector express, but do not secrete, the gpl10 fusion protein.

  E. coli C600 containing the plasmid pENV-5 is allowed to grow overnight at 37 ° C with aeration in a medium containing tryptophan (20 μg / ml) and ampicillin (100 μg / ml). The overnight cultures are then inoculated to 1: 100

in fresh minimal medium containing ampicillin (100 μg / ml), not 35

but contains tryptophan. These cultures are allowed to

') D HH /

Ventilation at 37 ⁰ C 2 to 3 h grow (until the early log phase). Inductor / 3-B indole-acrylic acid (Sigma Chemical Co., St. Louis, MO) is added from a freshly prepared stock solution of 20 mg / ml in 95% ethanol to a final concentration of 20 μg / ml. The induced cultures are allowed at 37 ⁰ C with aeration for 4 to 5 h grow / then pelletized and optionally a freeze. The protein yields of pENV-5 are typically less than 1 mg / l.

The pelleted bacterial cells are lysed using P-RIPA buffer (PBS containing 1% Triton X-100, 1% deoxycholate, 0.1% sodium dodecylsulfate, and 1% aprotinin) to lyse E. coli cells. The suspension is ultrasonicated for the purpose of cinching DNA and RNA and then centrifuged to remove particles. Dilution or concentration may be required to standardize protein concentration.

The monoclonal antibody HIV-gpl10-1 is originally precipitated from ascites fluid or cell culture supernatants at room temperature or in the cold with (NH 2) 2 SO 2 or Na 2 SO 4 solutions which have a final saturation of 33 or 18 at pH 7.3 % are buffered. The precipitated proteins are removed by centrifugation and redissolved in PBS and precipitated a second time with 33% (NH ₄ KSO ₄ or 12-15% Na ₃ SO _4. If necessary, this step can be repeated The pellet is reconstituted in PBS dissolved and the excess salts are removed by gel filtration through a desalting matrix or by exhaustive dialysis against PBS.

The purified monoclonal antibody 110-1 can then be coupled to cyanogen bromide-activated sepharose. The

Ί \

Required amount of gel is allowed to swell in 10 ~ M HCl solution on a glass filter (1 g of freeze-dried material gives a gel final volume of about 3/5 ml) * washes for 15 min. with the same solution and the antibody is added immediately thereafter. In general, the coupling reaction is most effective in a pH range of 8 to 10; however, one can also work at a lower pH; The antibody should be dissolved in PBS or in a carbonate / bicarbonate or borate buffer of high ionic strength with 150 mM NaCl The activated Sepharose and the antibody suspension are allowed to incubate at room temperature for 2 to 4 hours Stirred overnight at 4 ^° C. and then washed on a coarse glass filter frit with coupling buffer, as far as active groups remain, they are blocked by 2 hours treatment with 1/0 M ethanolamine at pH 8. The final antibody-Sepharose product then becomes Wash alternately 4 or 5 μl with high or low pH buffer solutions (borate buffer / 0 / 1M; pH 8; 5; 1M NaCl and acetate buffer, 0.1M, pH 4.0, 1M NaCl) Washing removes traces of non-covalently adsorbed materials The final immunoaffinity separation matrix is stored below 8 ° C in the presence of a suitable bacteriostatic agent such as 0.01% A zid.

The addition of the expressed protein suspension to the immunoaffinity separation matrix results in the selective removal of the gPl10 antigen. The mixture is left for 2 to 24 h,

3P preferably for 12 to 18 hours, with gentle stirring or shaking. One can also proceed by placing the immunoaffinity matrix in a column, equilibrating and slowly dispensing the expressed protein suspension onto the column. Upon addition of the protein suspension, the flow should be stopped to best effect the formation of the immune complex.

Unbound material is washed out or separated by extensive washing with adsorption buffer. For this purpose, you can use a coarse Glasfilterfritte under application of a vacuum or treat the column in the flow. The unbound material is then eluted using low or high pH buffers (acetate buffer, pH 4/0 or borate buffer, pH 8 _, 56) or a chaotropic agent.

Example VI

Immunoaffinity purification of recombinant gpl10 from a mammalian expression system

The monoclonal antibodies of the invention find in the immunoaffinity purification of recombinant _; mammalian cell-expressed fusion gpl] 0 application. The mammalian cells are infected with recombinant vaccinia (Mackett et al., J. Virol. 49: 85 (19 lb. <4), which is hereby incorporated by reference) containing the sequences; which encode at least the portion of gpl10, which is antigenic and elicits the formation of neutralizing antibodies.

The recombinant vaccinia are constructed according to the method; which is described in USSN 842,984; on

which is hereby incorporated by reference. The sequences; coding for the envelope glycoprotein of HIV; are inserted in a plasmid vector (pGS20) downstream from a vaccinia transcriptional control element. This chimeric gene is flanked by sequences coding for the viral thymidine kinase (TK) gene.

The chimeric plasmid vectors; containing the vaccinia virus promoters; which are ligated to the LAV envelope; used gg to transform the E. coli strain MClOOO. insertion

'ί. Γ Γ ..

2 8 O I ί

the chimeric LAV env sequences into the vaccinia virus genome were made by in vivo recombination / which was made possible by the chimeric genes flanked in the plasmids pv-env5 of vaccinia virus sequences coding for the TK- Encode gene. This plasmid is then introduced into the cells / previously infected with wild-type vaccinia virus. One then allows recombination between the TK sequences on the plasmid and the homologous sequences in the vaccinia virus genome with insertion of the chimeric gene. African Green Monkey kidney cells (BSC-40 strain, a BS-1 cell-derived cell line / ATCC No. CCL26) are used as host in the expression system.

Confluent BSC-40 cells are infected at a multiplicity of infection of 10 by recombinant vaccinia viruses. The infection is allowed to proceed for 12 h / after which the cells are harvested / washed once with PBS and centrifuged off. The cell peliets are suspended in lysis buffer (1.0% NP-40, 2.4% sodium deoxycholate, 0/1 M NaCl, 0.01 M Tris-HCl, pH 7/4/1 mM EDTA) and the lysate is clarified by centrifugation , The immunoaffinity separation of the expressed recombinant fusion protein is performed as described above for the bacterial expression system using the monoclonal antibody gpl10-1. The proteins produced by this expression system are more naturally produced by HIV gpl10, due to the treatment and glycosylation performed by the mammalian cells.

Example VII

Inhibition of HIV infection with blocking peptide eη

The Efficacy of Blocking Peptides in Inhibiting Infection of Tissue Culture Cells by LAV HIV

BKU

Strain was made using a modification of the method

for the evaluation of peptide T / that of Pert et al / see

, top / published / examined. The preferred HIV inhibition assays can be achieved by combining equal volumes of blocking peptides and CEM cells (2 _, 5χ10) into medium (RPMI, 10% FCS and 2 mg / ml polybrene) and

c incubated at 37 ° C for 45 min. The virus is then broken down

various doses (10/50/500 TCID 50) are added and the mixture is incubated for 14 days at 37 ° C. The supernatant is then assayed for the production of viral antigen (e.g., p25 core antigen).

Preincubation of the CEM cells with the peptides prior to virus addition to the cultures enhances the inhibitory effect in the assays. It has been shown that the inhibition is dependent on the virus dosage / where a high activity at low and medium doses / ο

however, a lesser effect was observed at the highest virus doses.

With peptide T, inhibition of virus antigen production of about 60% to 90% could be achieved in experiments with low virus doses. Further experiments with the peptides X to XV ₇ which are typically amidated at the COOH terminus and acetylated at the NH.sup. + Terminus gave similar results, with the peptide XI crossing a

wide dose range was particularly effective. It is see-25

lent / that on the basis of the monoclonal antibodies and peptides according to the invention, including the blocking peptides / a better method for the neutralization and / or inhibition of HIV infections is available. This allows the creation of prophylactic and therapeutic agents / which are effective against infection by most / if not all / HIV strains. In addition, the new materials are used in diagnostic assays and other known methods.

8th

Deposit number of microorganisms

The following microorganisms which are part of the present invention have been deposited at the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland, 2085 ", USA The slide data are as follows:

Wissenschafti. designation Name of the depositor ATCC-No. August 1986 viable. 9175 Deposit data , 2986 Mouse hybridoma (balb c / NS-1) HIV gp 110-1 HB 9176 August 15, , 1986 Il HIV tjp 110-2 HB 9177 August Ib, , 1986 H HIV gp 110-3 HB 9404 August 15, 1987 H HIV gp 110-6 HB 9405 April 30, 1987 Il HIV gp 110-4 HB S406 April 30, 1987 Il HIV gp 110-5 HB 9407 April 30, 1987 M HIV-p 25-2 HB 9408 April 30, 1987 Il HIV-p 25-3 HB 9409 April 30, 1987 η HIV-p 25-6 HB 9410 April 30, 1987 N HIV-p 25-7 HB 91- / 7 April 30, and 5 Hybridomas HB9175, HB 9176 and HB The Were tested remaining hybridomas were on the 26th were also tested and were on ',. May 1987

able to.

7! I ft}: /

¹ : 6

Claims (7)

1. A method for producing monoclonal antibodies that specifically react with one or more neutralizing regions of HIV, characterized in that administering to a host an immunogenically effective amount of an HIV antigen enriched antigen preparation; monitors the production of the specifically reactive antibodies in the immunized host; recovering and immortalizing the antibody-producing cells from the host; selecting the immortalized cells producing antibodies to HIV; the immortalized cells are cloned for the production of cell lines; and the cell lines capable of producing antibodies that react with one or more neutralizing HIV regions, cultured and the antibodies recovered. 2 8 0 ί ί β 69 2. The method according to claim 1, characterized in that one uses as HIV proteins recombinant fusion proteins that are expressed by a eukaryotic or bacterial host, or that the HIV proteins are obtainable from an HIV extract or lysate. jQ 3. The method according to claim 1 or 2, characterized in that one uses an immortalized cell line. which produces monoclonal antibodies capable of reacting with an envelope glycoprotein pllO antigenic determinant within J5 of the neutralizing region or blocking peptide of HIV is included. 2 8 0MS 2 8 O f I S
5 4. The method according to any one of the preceding claims, characterized in that one receives antibodies, 2Q specifically reactive with a neutralizing region comprising epitopes encoded in the env or gag regions of the HIV genome. A method according to any one of the preceding claims, characterized by obtaining monoclonal antibodies which specifically react with a neutralizing region comprising epitopes located on the LAV _DnrI HIV proteins gpl10 or ρ25. "Q 6. The method according to any one of the preceding claims, characterized in that one obtains monoclonal antibodies which react specifically with a neutralizing region having the HIV gpl10 amino acid sequence of about 301 to 336 or 308 to 328 or homologues _ _{r of} these sequences. 7. The method according to any one of claims 1 to 5, characterized in that one obtains monoclonal antibodies which are specific for a neutralizing region comprising the HIV p25 amino acid sequence of about 278 to 319 or about 315 to 363 or homologs of these sequences ,