PL155084B1 - A method of monoclonic antibodies generating and the useof theses antibodies in distributions based on immulogical affinity - Google Patents

Description

RZECZPOSPOLITA PATENT DESCRIPTION 155 ®84

POLAND

OFFICE

PATENT

RP

Additional patent to patent no. Pending: 87 08 20 (P. 267 401)

Int. Cl. ⁵ A61K 39/42 A61K 39/21

Priority: 86 08 20 for claims 1-3

United States of America Mllllll

05 01 for claims 4-6 Η ό B A fi

United States of America '

Application announced: 88 07 21

Patent description published: 1992 04 30

Creators of the invention: Mary K. Shriver, Elaine K. Thomas, Wesley L. Cosand,

Larry H. Gosting, Edna S. Dickinson, Janela / NMI / McClure, George J. Todaro, Robert C. Nowiński

The holder of the patent: Genetic Systems Corporation,

Seattle (United States of America)

A method of producing anti-HIV antibody cell lines

The invention relates to the production of anti-HIV antibody cell lines, in particular antibodies reactive with HIVgp 110 or p25 antigenic determinants.

The antibodies obtained from the cell lines of the invention find use in the detection and neutralization of HIV. They can also be used in protective vaccines against this virus in the form of pharmaceutical compositions containing these antibodies.

The causative agent of Acquired Immunodeficiency Syndrome (AIDS) and its precursor infections, ADIS-related syndrome (ARC) and lymphocytic leukemia (LAS) infections is a novel retrovirus growing in lymphocytes. Various names have been adopted to denote this virus, namely LAV, HTLV-III, ARV and more recently HIV.

In the face of the pandemic spread of HIV, treatment of infected patients and prevention of disease transmission to uninfected individuals at risk of this virus is a fundamental task. The various treatment strategies proposed so far are based on an attack targeting different development stages of this virus. They are described by Mitsuya and Broder in Nature, 325,773 (1987). One such strategy is the use of antibodies that bind to the virus and inhibit its replication either by interfering with the entry of the virus into the host cell or by some other mechanism. With the identification of a viral component (or component) sensitive to antibody, hope has arisen that by vaccination or passive immunization, by administering immunoglobulins or monoclonal antibodies with the desired specificity, it will be possible to obtain the appropriate antibody titer in the body sufficient to neutralize the infectiousness of the virus.

155 084

The coat glycoproteins of most retroviruses are believed to react with receptor molecules on the surface of sensitive cells, which determines viral contagiousness towards certain hosts. Antibodies that bind to glycoproteins can block the action of the virus and the receptor cells, neutralizing its infectivity. See: / The Noleculer Biology of Tumor Viruses, 534 (ed. J. Tocza, 1973) and RNA Tumor Viruses, 226, 236 (R. Wiss et al., 1982). See also: Gonzalez-Scarano et al. Virology 120,42 (1982), La Grosse virus /; Matsuno and Inouyc, Infect. IMMun., 39, 155 (1983) - Neonatal Calf Diarrhea Virus and Mathews et al., J. Immunol., 129, 2763 (1982) - Encephalitis virus.

The general structure of HIV has a ribonucleoprotein core surrounded by a lipid-containing coat which the virus acquires from the membrane of the infected host cell during its development. The glycoproteins encoded by the virus are embedded in the coat and protrude outside. HIV coat glycoproteins are initially synthesized in the infected cell as a precursor molecule of 1,500 (X) -160,000 daltons (gp 150 or gp 16X) and then processed in the cell into an N-terminal fragment of 1,100ΧΟ-12ΧΧΧΧΧ daltons (gp 110) or gp 120) with the simultaneous generation of an external glycoprotein and a C-terminal fragment of 41,000-46,000 daltons (gp41) representing the transmembrane mantle glycoprotein.

For the reasons discussed above, HIV gp 110 glycoproteins have been the subject of much research, serving as a potential target by which the viral life cycle can be broken. Sera of HIV infected patients neutralized HIV in vitro. Antibodies binding to purified gp 110 were present in these sera (Robert Guroff et al., Nature, 316, 72, 1985; Weiss et al., Nature 316, 69 (1985) and Mathews et al., Proc. Natl. Acad. Sci. USA, 83, 9709 (1986) Purified and recombinant gp 110 used to immunize animals stimulated the production of neutralizing antibodies in serum (Robey et al., Proc. Natl. Acad. Sci. USA, 83, 7023 (1986) ; Lasky et al., Science, 233, 209 (1986). Zagury et al., (Nature, 326, 249 (1986) report the same immunization experience in humans. Binding of gp 110 to the CD4 / T4 receptor has also been demonstrated. Moreover, monoclonal antibodies that recognize certain CD4 receptor epitopes have been shown to block HIV binding, syncytia formation and infectivity. McDougal et al., Science, 231, 382 (1986). Putney et al., Science 234,1392 ( 1986) / demonstrated the presence of neutralizing antibodies in serum in animals after immunization with a recombinant fusion protein containing Ct half of the gp 110 molecule, and then proved that glycosylation of the coat protein is necessary for the immune response of neutralizing antibodies.

Thus, a subunit vaccine for AIDS in which the HIV gp 110 molecule or part thereof is used may prove useful. Vaccines containing antigenic subunits are an alternative to vaccines prepared from inactivated or non-virulent (attenuated) viruses. In the case of inactivated vaccines, it should be borne in mind that not all viral particles have been killed during the preparation of the vaccine, while attenuated viruses may be able to mutate and recover disease-causing activity. In the case of subunit vaccines, only viral particles containing antigens or epitopes capable of eliciting an immune response are used to immunize the host, i.e. antibody neutralization, ADCC and lymphocytic T cell cytotoxic responses. The main advantage of subunit vaccines is that they exclude irrelevant viral material.

The viral subunits for vaccine preparation can be generated by several methods. For example, one may express a coat glycoprotein in a bacterial host and then purify the glycoprotein, although post-translational modifications (such as glycosylation) or other processes of this type are unlikely to occur in that host. Such modifications can be achieved using a eukaryotic expression system such as yeast or mammalian cell culture. Viral genes are introduced into mammalian cells using vaccinia virus as vectors (Mackett M. et al., Proc. Natl. Acad. Sci. USA, 79, 7415 1982; Panicali D. and Paoletti E., Proc. Natl. Acad. Sci. USA, 79, 4927, 1982).

155 ¢ 84

Recombinant vaccinia virus can be obtained by the method of Hu et al., Nature, 320,537 (1 ^ 86) or Chakrabarti et al., Nature, 320, 535 (1986). Both of these methods are given in this specification. In such systems, the viral glycoproteins produced by cells infected with recombinant vaccinia virus are suitably glycosylated and can be transported to the cell surface, removed outside the cell and isolated.

An important step in the production of subunit vaccines is the appropriate purification of the desired glycoprotein from the complex mixture of the expression system.

For purification purposes, a number of methods can be used, such as preparative polyacrylamide gel electrophoresis, gel permeation chromatography, as well as various other chromatographic methods (e.g., ion exchange, reverse phase, immunological affinity, hydrophobic interaction) and others. To obtain truly pure preparations, most of these methods are used in various combinations (Kleid DG et al., Science, 214, 1125, (1981), Cabradilla CD, et al., Biotechnology, 4, 128 (1986), Dowbenko DJ, Proc. Natl. Acad. Sci. USA, 82, 7748, (1985)) reported herein.

For the production of subunit vaccines, methods are needed to limit the number of steps required to maximize purification of a particular viral antigen isolated from a complex expression mixture. The efficiency of separating antigens from the components present is achieved using affinity chromatography. This technique, also known as immunoadsorption, basically relies on the selective adsorption of an antigen onto a solid support previously covalently bound to a specific antibody. The antigen, selectively absorbed in the antibody-adsorbent system, is then eluted by changing, for example, the pH and / or ionic strength of the buffer.

Often used as immunoadsorbents are polyclonal antibodies obtained from animals immunized with the desired antigen or from naturally infected individuals (e.g., Lasky et al., Supra). However, such reagents generally suffer from major disadvantages, namely, (i) not all antibodies bound to the insoluble carrier are specific to the molecule, requiring additional purification, (ii) the yields of the desired antigen are generally low, and (iii) the affinity of an antibody often differs from preparation to preparation, necessitating modification of the elution process. The use of monoclonal antibodies specific for the desired viral antigen to be used in the subunit vaccine formulation in place of polyclonal antibodies overcomes these disadvantages.

Murine monoclonal antibodies binding to HIV antigens have been described in the literature. There have been reports of monoclonal antibodies specific for the p25 core protein (e.g., di Marżo Veronese et al., Proc. Natl. Acad. Sci. USA, 82, 5199, (1985) and Chassagne J., et al., J. Immunol. 136, 1442 (1986) Monoclonal antibodies specific for the membrane glycoprotein gp 41 have also been described (di Marżo Veronese et al., Acience, 229, 1402, (1985).

It remains to obtain epitope-specific monoclonal antibodies within the well-known regions of the larger gp 110 coat glycoprotein. Monoclonal antibodies that bind to these regions and reduce or completely eliminate HIV replication and transmission could have important therapeutic and prophylactic applications. Such monoclonal antibodies could also be used to purify the desired region of gp 110 into cleaved parts of the virus or to isolate it from recombinant expression systems, for example as vaccines.

Moreover, the region containing the epitope or epitopes recognition by monoclonal antibodies could be chemically synthesized, thereby avoiding the difficulties associated with purification and administration of larger fragments of the gpl O molecule.

The present invention relates to a method of producing new cell lines capable of producing monoclonal antibodies.

These antibodies, with extremely high titers (from 10 ² -10 ⁴ to about 10 ⁷ and even higher), have the ability to recognize the neutralizing regions contained in a specific sequence of the gp 110 or p25 coat glycoprotein in the protein precursors of these glycoproteins, in fusion proteins produced by expression biological and in synthetic peptides that contain one or more epitopes in that particular region of gpl10 or p25. Hybrid

155 084 the cells of the invention have an identifiable chromosome in which the DNA rearrangement has occurred in the newly emerging lines such that it encodes an antibody having a binding site with an epitope contained in gpUO or p25, common to some or all clinical HIV isolates . These monoclonal antibodies have a wide variety of uses, including diagnosis and therapy, as well as the identification of other cross-reactive antibodies, such as blocking antibodies. The peptides or polypeptides containing the epitope with which they react are intended for separate use as immunogens for vaccines or as therapeutic agents.

According to the invention, the method of producing cell lines producing antibodies reactive with the antigenic determinants of HIV gpl10 or p25 consists in introducing an immunogenic amount of an antigen preparation enriched in HIV protein into the host and monitoring the immunized host for production of antibodies reactive with the antigenic determinants gpl10 or p25 . Antibody producing cells are then harvested from the host and these cells are immortalized, the immortalized cells producing anti-HIV gpl10 or p25 antibodies are selected and the immortalized cells are cloned to give cell lines. The cell lines are grown "in vitro" in the medium, or they are injected endothelially into the host and then the monoclonal antibodies are recovered. The monitoring of the host for antibody production consists in inoculating a biological sample from the host "in vitro" with a protein from the neutralizing region of HIV, and detecting the presence of immunocomplexes formed between the protein and antibodies in the sample.

Monoclonal antibodies are obtained by "immortalizing the expression of nucleic acid sequences encoding HIV specific antibodies. These sequences, generally the cDNA encoding the antibody of interest, are introduced into a culturable host. Such an "immortalized cell line may be a mammalian cell line transformed by oncogenesis, transfection, mutation or other means." Such cells include myeloma, lymphoma, or other lines capable of promoting antibody expression and secretion in vitro. The antibody may be a naturally occurring mammalian immunoglobulin produced by transforming a lymphocyte, especially a spleen lymphocyte with a virus, or by fusing a lymphocyte with a myeloma cell to generate a hybrid cell line. Generally, spleen lymphocytes are obtained from animals immunized against HIV or the virus fragment containing the epitope site.

The methods of immunization are known and, despite their mutual differences, are effective. (Monoclonel Antibodies: Principles and Practice, Academic Press, 2nd ed. (1986).

Disrupted viral particles, synthetic peptides, and bacterial fusion proteins containing antigenic fragments of the gpl10 or p25 molecule are used as immunogens. Preferably, the cleaved viral particle, peptide or recombinant protein immunogen can be enriched with proteins or fragments thereof containing epitopes against which B lymphocytes or spleen lymphocytes will produce antibodies. If necessary, solutions containing lysates or viral extracts or supernatants of biologically produced recombinant proteins or cleaved expression vectors can be enriched in glycoproteins by a purification method such as polyacrylamide gel electrophoresis. A preferred and convenient method of purifying gpl10 and other glycoproteins is lectin affinity purification, especially lentil lectin. The degree of purification of glycoproteins from solutions intended for use as immunogens can vary widely. It can be as low as 50 percent, typically it will be 75-90 percent, preferably 95-99 percent, with absolute homogeneity being the most preferred degree of purification.

After the proteins have been purified to the desired purity, they are either suspended or diluted in a suitable physiological vehicle for immunization or coupled with an adjuvant. A preferred technique is, for example, the adsorption of proteins and fragments thereof for injection onto lentil lectin-agarose or other multiparticulates. Immunogenic amounts of antigen preparations, enriched in HIV proteins, containing gpl10 glycoprotein and p25 core protein or antigenic portions thereof, are injected into the host, generally at concentrations of 1 µg to 20 mg / kg. Intramuscular, intraperitoneal, subcutaneous or intravenous injections can be used. It is given once or more, usually at intervals of one to four weeks. The immunized animals are monitored for antibody production against the desired antigen, then spleens are removed, B lymphocytes are isolated from them and fused with or transformed with a myeloma cell line. The transformation or fusion is carried out in any known manner. Fusion techniques are described in U.S. Patent Nos. 4,172,124.4 350,683, 4,363,799, 4,381,292 and 4,423,147 and described by Kennett et al. (Monoclonal Antibodies (1980)) and Goding (see higher).

Immortalized cell lines are cloned and screened in a known manner. Antibodies capable of binding to the desired HIV gpl10 or p25 proteins with recombinant fusion proteins or synthetic peptides containing the desired epitope region are detected in the cell supernatants. Suitable immortalized cell lines can be cultured in vitro or injected into the peritoneal cavity of a suitable host to obtain exudate fluid.

To prove that antibodies according to the invention specific for epitopes contained, for example, in the regions encoded by the genomic LAV / BRU region from 6688 bp to 6750 bp (encoding peptide29) or from 7246 to 7317 bp (encoding peptide36), have been generated, screening of the supernatants is shown by comparing go with the reference monoclonal antibodies in the comparative text (base pair numbering according to Wein, Hobson Cell, 44, 9/1985 /}. Thus, immortalized hybridoma cell lines with the desired binding characteristics can be easily generated, starting from a variety of sources based on o the availability of antibodies of the invention specific for a particular antigen Alternatively, these cell lines may be fused to other malignant B lymphocytes, where such other B cells can serve as recipients of the genomic DNA encoding the antibodies.

Although rodent, especially murine, neoplastic B cells are preferred, lymphocytes from other mammalian species, for example lagomorpha, bovine, ovine, equine, porcine, avian, may also be used for this purpose. These animals can be easily immunized and their lymphocytes, especially spleen lymphocytes, isolated for further fusion.

The monoclonal antibody secreted by the transformed or hybrid cell lines produced by the method of the invention may belong to any class or subclass of immunoglobulins, such as IgM, IgD, IgA, IgGi-4, or IgE. As IgG is the isotype most used in diagnosis, it is often preferred. Monoclonal antibodies can be used in whole or as fragments thereof, such as Fv, Fab, F / ab '/ 2, but usually as intact molecules.

To avoid antigenicity in the human body, a monoclonal antibody derived from a non-human animal, chimeric antibodies can be constructed in which an antigen-binding fragment in the molecule of this immunoglobulin (variable region) is peptide bonded with at least a part of another protein not recognized as foreign by humans, such as the rejected portion of a human immunoglobulin molecule. This can be done by fusing animal exons with variable regions with human constant region kappa or gamma exons. Techniques for carrying out this operation are known (for example POT 86/01533, European Patent EP 171496 and EP 173 494).

The monoclonal antibodies produced by the cell lines of the invention react with peptides capable of immunologically mimicking (mimicking) neutralizing HIV protein epitopes.

Peptides mimicking the HIV neutralizing region and monoclonal antibodies reactive with this region are useful in the diagnosis, treatment, and vaccination against HIV infection. In this aspect, the term "neutralizing region" denotes those parts of the HIV virus, especially HIV proteins containing amino acid segments defining one or more antibody-reactive epitopes that are either single or combined with other antibodies and are capable of neutralizing HIV infection. Appropriate neutralization tests are known. These include: HIV reduction assays in T-cell lines, reduction of plaque-forming units in VSV / HIV / pseudotypes containing HIV coat glycoproteins, syncytia inhibition assays, and virion receptor binding assays. If necessary, the neutralizing activity is compared with the reactivity of the antibodies in immunochemical tests such as immunofluorescence, colored immune reaction (immunoblot) and radioimmunoprecipitation.

155 084

Peptides capable of immunologically mimicking HIV neutralizing epitopes of proteins of less than 50 amino acids have five or more contiguous amino acids forming epitopes substantially similar to epitopes located in the HIV gpl 10 or p25 neutralizing regions encoded by the env and gag regions of the HIV genome, respectively. Regions of particular interest are those extending from amino acid residues 301 to 336 in gpl10 and in p25 peptide, residues 278 to 319 and from residue 315 to residue 363. All these regions are derived from the HIV strain designated LAV / bru. The designation of the amino acid residues is derived from from Los Alamos Data Bank (AIDS virus sequence database, Los Alamos National Laboratory, Theoretical Division, Los Alamos, NM 87545).

It is clear that additional analogous regions ("homologues) from other HIV isolates can be identified based on their localization in related proteins from different isolates. In practice, these homologues can be identified by comparison with the LAVbru sequence data as follows:

/ a / the amino acid sequences of the LAVbru isolates can be aligned so as to obtain the maximum homology of these two sequences, / b / peptides containing the amino acid sequences of the HIV isolates corresponding to the location of the LAVbru peptides immunologically mimicking the LAVbru proteins can be identified- These peptides containing the amino acid sequences from the HIV isolates will be immunologically mimic the corresponding proteins from HIV isolates.

This method can be applied to strains of HIV that have not yet been detected. For example, when a new HIV strain is detected, its coat and core amino acid sequences are compared to LAV / bru so as to obtain maximum homology.

Methods for serial comparison of sequences are known. In carrying out this work, the greatest possible homology should be maintained between the cysteine molecules. An amino acid sequence of a new HIV strain or species that corresponds to the logalization of the peptides disclosed herein may be synthesized and used in accordance with the invention.

Scharf et al. (Science, 233, 1076 (1986)) describe another method for determining the sequence of the homologous region in other HIV strains. This method uses two oligonucleotide primers, each having a different restriction site in each, binding to conserved sequences outside the region of interest.

DNA from HIV strains can then be amplified in vitro and the resulting oligonucleotides cloned into vectors for sequence analysis and inserted into a vaccine as a cassette representing a specific epitope from that HIV strain.

The present invention does not require epitopes contained in such sequences to cross-react with antibodies against all HIV strains or species. Peptides incorporating immune epitopes that distinguish between a particular species or serogroup will find use in identifying those particular species or serogroups and may be helpful in detecting individuals infected with one or more HIV species or serogroups. In combination with other peptides derived from the homologous region or another neutralizing region, they may also be useful in the preparation of therapeutic compositions.

These peptides should be derived from the gp 110 region of the virus, and within this region they should be encoded in the env open reading frame extending from 6667 bp to 6774 bp of the LA V / bru isolate, and thus the different homologous regions of other HIV isolates contain homologous sequences obtained from the Los Alamos Data Bank (except LAV2) as shown in Table I.

Other peptides suitable for generating or screening monoclonal antibodies include peptides encoded in the open reading frame env from 7246 bp to 7317 bp LAVbru. Such antibodies and reactive peptides are useful, especially for immunoassays.

In the gag region of the LAVbru p25 isolate, amino acid sequences 278 to 319 and 315 to 363 are additional neutralizing regions for HIV. It will be appreciated by those skilled in the art that additional HIV neutralizing regions can be identified based on the teachings provided herein. In particular, neutralizing activity will be exhibited by combinations of monoclonal antibodies reactive with many different HIV epitopes.

155 084

Table I

ΗΧΒ2

ΒΗ102

ΒΗ8

ΗΧΒ3

Η9Μ

BRU

MAL

ELI

ARV2

WMJ 2

RFENV

Z6

Z3

NY5

CDC42

LAV2

ΗΧΒ2

TGTACAAGACCCAACAACAATACAAGAAAAAGA .................. ATCCGTATC

CysThrArgProAsnAsnAsnThrArgLysArg .................. IleArglle

----------------------------- Sir -------------------- ------------------------------------ Lys ------------- ----------------- LYS -------------------------------- ------------------------ Sir ------------------------- ------------------------------- Sir ------------------ ---------------------- Gly ---------- ArgGly ---------------- ----- HisPhi

--- Ala ------ TyrGln -------- Gin ----------------------- Thrpro—

----------------------------- Sir -------------------- -Tyr --------------- Try ------ Val --- ArgSir ----------------- LiuSir --- ------------------------------ Sir ------------------- ThrLys

------------ TyrLys --------- GlnSir ----------------- Thrpro --------- ------ GlySirAspLysLysili -------------------- GlnSir ---------------------- ----- Lys --- Gly -------------------- Ala ------------------- --His ------------ ValThrLiu ..................

------------ Gly --- Lys --- Val --- Gin ------------------- MitLiu

CAGAGA ......... CGACCAGGGAGAGCATTTGTTACAATAGGAAAAATAGGAAATATG

GlnArg ......... GlyProGlyArgAlaPhiValThrIliGlyLyslliGlyAsriMet

BH102 ------------------------------------------------- ------------- BH8 ------------------------------------ -------------------------- ΗΧΒ3 ----------------------- --------------------------------------- H9M ---------- -------------------------------------------------- --BRU ----------------------------------------------- --------------- MAL ----------------------- Gin LiuTyr --- Thr. . .IliVal --- Aspili

ELI GLyLiu -------------. . . GlnSirLiuTyrThr --- Arg --- IliValSirARGSir

ARV2 His --- Thr --- Arg --- IliGlyAsp

WMJ Arg --- ArgGlu. . --- IleGlylle

RFENV ValIliTyrAgaThr --- Gin --- IliGlyAso

Z6 GlyLiu --------------. . .GlnAlaLiuTyrThr --- Arg --- ArgThrLysllilli

Z3 ArgI li ---------: ----------- LysVal --- TyrAlaLys --- Gly ............

NY5 GlyPro --------------. . .------ ThriiuTyrAlaArgClu --------- Aspili

CDC4 2 ............................. ValTrpTyr --- Thr --- Glu --- LiuGlyAsn

LAV2 MitSir -------------------- HisVal --- HisSirHisTyrGgnProIll --- Lys

HYB2 ... AGA ... GAAGCACATTGT

... Arg ... GlnAlaHisCys 331

BH102 --------------------- 331

BH8 --------------------- 333

ΗΧΒ3 --------------------- 331

H9M --------------------- 331

BRU --------------------- 336

MAL ---------- Arg --- Tire— 334

309

309

309

309 314

314

310

312

306

322

311

306

304

300

302

326

326

326

326

326

331

329

323

327

320

337

327

319

320 335 323

155 084

Table I - continued

ELI IlelleGly ------------- 330

ARV2 Ile --- Lys. . .---------- 333

WMJ2 Ile ------------------- 326

RFENV Ile --- Lys,,, ---------- 34 3

Z6 Gly. . .---------------- 334

Z3 IleThrGly ------------- 326

NY5 ---------------------- 325

CDC42 Ile ------------------- 341

LAV2 ArgProArg ------ Met ---- 330

Peptide I, also designated peptide29, is encoded in the open reading frame enr from 308 to 328 amino acid residues. It will have the following amino acid sequence (the oligopeptides contained in this sequence will contain linear epitopes):

I / 29 /

Y-Thr-Arg-Lys-Ser-Ile-Arg-I! E-Gln-Alg-Gly-Pro-Gly-Arg-Ala-Phe-Val-Thr-Ill-Gly-Lys-Ill-Y 'in which Y and Y ', if present, are sequences up to about 20 amino acids in length. If present, Y and / or Y 'may include, for example, one or more amino acids derived from the flanking sequences, amino acid residues 308 to 328 of the HIV coat sequences, or any portion of these flanking sequences. For example, Y may contain the entire amino acid sequence of the LAVbru coat from 301 to 307 or a portion thereof, and Y 'may contain all or a portion of the LAVbru amino acid sequence from residues 329 to 336 as shown below;

II / 29a /

Cys-Thr-Arg-Pro-Asn-Asn-Asn-Ίhir-Arg-Lys-Slr-Ώe-Arg-Ill-GIn-Arg-Gly-Pro-Gly-AIg-Ala-Phe-ValThr-Ile-Gly- Lys-ne-Gly-Asn-Met-Arg-Gln-Ala-His-Cys.

Alternatively, truncated ("truncated) peptide sequences can be obtained, of which sequences derived from peptide 29 are particularly useful with the following structure:

III / 29b /

Y-Thr-Arg-Lys-Ser-Ile-Arg-Ile-Gln-Arg-Gly-Pro-Gly-Y 'wherein Y and / or Y', if present, are sequences of up to 20 amino acid residues, and

IV / 29c /

Y-Il-Gln-Arg-Gly-Pro-Gly-Arg-Ala-Phe-Val-Thr-Ile-Gly-Lys-Ile'Ύ ', where Y and Y', if present, are sequences containing up to 20 amino acid residues.

The homologous regions of the ARV-2 isolate of interest are encoded in the open reading frame enr from 306 to 323 amino acid residues. They will have the V amino acid sequence, and the oligopeptides contained in this sequence will contain linear epitopes:

V / 177 /

Y-Thr-Arg-Lys-Ser-Πe-Thr-Ile-Gly-Pro-Gly-Arg-Ala-Phl-His-Thr-Gly-Arg-Ill-Y 'where Y and Y' if present, are from 1 to 20 amino acid residues. Y and / or Y ', if present, may contain one or more amino acid residues derived from the flanking sequences, amino acid residues 306 to 323 of the ARV-2 coat, or any portion of these flanking sequences. More particularly, Y may contain all or part of the HI V coat amino acid sequence from residue 299 to 306 of amino acid residues, Y 'may contain all or part of the HIV coat amino acid sequence from residue 324 to residue 333.

Alternatively, truncated ("truncated) V peptide sequences are prepared. In this case, sequences VI and VII are particularly useful."

VI / 177a /

Y-ThrAro-T, vs-Ser-IH-Tvr-He-Glv-Pro-Glv-Y 'and

155 084

VII

Y-Asp-Gys-Lys-'nir-Ile-Leu-Lys-Ala-Leu-Gly-PiO-Ala-Ala-'nir-Leu-Glu-Glu-Leu-Nor-Leu-ThrAla-Cys-Y ' wherein Y and / or Y ', if present, are sequences of up to 20 or even more amino acids.

Another example are the homologous regions of the LA V-2 isolate, encoded for example in the open reading frame env from 311 to 330 amino acid residues with the following sequence:

VIII / 110-2-2 /

Y-Lys-Thr-Vl-] Lys-Ile-Nor-Leu-Nor-Ser-Gly-His-Val-Phe-His-Ser-His-Tyr-Gln-Pro-Y 'where Y and / or Y ', when present, are sequences of up to 20 and even more amino acids (Nature, 326, 662, 1987).

Additional peptides or antibodies are used in conjunction with the above-described peptides or neutralizing monoclonal antibodies to interfere with HIV binding to its receptors and further reduce its infectivity. The so-called "blocking peptides have properties to inhibit viral proliferation, as well as monoclonal antibodies specific for the epitopes contained in these blocking peptides can be used to increase the efficacy of the treatment of HIV infection.

HIV blocking peptides generally correspond to the amino acid sequences of HIV thought to be necessary for virus attachment to the host cell, such as the env encoded amino acid residues 190 to 197 LAVbru and 185 to 192 amino acid residues ARV- 2 and HTLV-III (BH-10). These include the octapeptide called T-peptide (Ala-Ser-Thr-Thr-Thr-Asn-Tyr-Thr) and its various derivatives (e.g. IX, below) and analogs (e.g. XI, below) described by Pert and et al. (Proc. Natl. Acad. Sci. USA, 83, 9254-9258 / 1986 // located in the mantle glycoprotein gpl10 or gpl20).

For example, blocking peptides have the following amino acid sequences, often acetylated at the amino terminal group and mated at the carboxyl terminal group:

IX / 177D /

Y- _d Ala-Ser-'Thr-Thr-Thr-Asn-Tyr-Thr-Y '

X / 186 /

Y-Thr-Thr-Asn-Tyr-Thr-Y ',

XI / 187 /

Y-Thr-Thr-Ser-Tyr-Thr-Y ',

XII / 188 /

Y-Thr-Asp-Asn-Tyr-Thr-Y ',

XIII / 189 /

Y-Asn-Thr-Ser-Tyr-Gly-Y ',

XIV / 190 /

Y-Asp-Thr-Asn-Tyr-Ser-Y ',

XV / 191 /

Y-Ala-Val-Phe-Thr-Asp-Asn-Tyr-Thr-Y ', wherein, in each of the peptides Y and Y', if present, are amino acid sequences up to 20 amino acids. Epitopes or antigenic determinants in these peptides are usually defined by the presence of at least 5 contiguous amino acids and find use, inter alia, in mimicking naturally occurring HIV antigenic sites and in producing HIV-reactive antibodies and vaccines.

Monoclonal antibodies obtained from the cell lines of the invention having neutralizing activity, such as that react with an epitope site in gpl10 or p25, can also be included in pharmaceutical compositions intended to combat HIV infection. Such a composition should contain a therapeutically or prophylactically effective amount of at least one monoclonal antibody of the invention, together with a pharmaceutical carrier. The pharmaceutical carrier should be a non-toxic, non-incompatible substance suitable for introducing monoclonal antibodies into the patient's body. As a carrier, you can use sterilized water, alcohol, fat10

155 084 pure, wax and inert solids. Pharmaceutically acceptable auxiliaries (buffering, dispersing) can also be incorporated into such compositions. These compositions may contain single monoclonal antibodies specific for, for example, strains of HIV with coat glycoproteins containing an epitope site in the base pair coding region of 6688 to 6750.

Alternatively, the pharmaceutical composition may contain one or more monoclonal antibodies to form a mixture ("cocktail"). Such a mixture of monoclonal antibodies against various strains of HIV could be a universal product, useful in the treatment and prevention of infection with most clinical HIV isolates. Such a mixture may contain monoclonal antibodies that bind to HIV proteins or glycoproteins other than gpl10 or p25, such as gp41 glycoprotein or p34 nucleose / integrase.

The molar ratio of the various components of the monoclonal antibodies should not exceed a factor of 10, usually not more than 5, and in practice the molar ratio of the individual antibodies is 1: 1-2.

Monoclonal antibodies obtained from the cell lines produced by the method of the invention can be used as a separate dosage form when co-administered with other anti-retroviral agents, including blocking peptides. The current state of research in the field of anti-retroviral agents is reported by Mitsua et al., Nature, 325, 773-778 (1987).

Monoclonal antibodies and pharmaceutical compositions containing these antibodies are suitable for oral or parenteral administration. Preferably, these pharmaceutical compositions are administered parenterally, that is, subcutaneously, intramuscularly or intravenously. Thus, compositions for parenteral administration are prepared containing a monoclonal antibody solution, a peptide, or a mixture (cocktail) thereof, dissolved in a suitable carrier, for example an aqueous carrier. A variety of aqueous carriers can be used, such as water, buffered aqueous solutions, 0.4% saline, 0.3% glycerin, and the like. These solutions are sterile and substantially free of insoluble particles. These compositions are sterilized in a known manner. They can contain pharmaceutical prophylactic additives required to achieve the appropriate physiological conditions. PH adjusting agents such as buffering agents, toxicity lowering agents and the like, for example, sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate and the like. The antibody concentration in these dosage forms can vary from less than 0.5%, more usually from at least 1% to 15-20% (by weight). The concentration is selected according to the route of administration, taking into account liquid volume, viscosity and other parameters.

Thus, a typical pharmaceutical composition intended for intramuscular injection will contain 50 mg of the monoclonal antibody in 1 ml of a sterile, buffered aqueous solution. A typical composition for intravenous infusion will contain 150 mg of monoclonal antibody and 250 mL of sterile Ringer's solution. Current methods of formulating compositions intended for parenteral administration are known and apparent to those skilled in the art, and are also described in detail in "Remington Pharmaceutical Science *, 15th Edition, Mack Publishing Company, Easton, Pennsylvania (1980)).

For storage purposes, the monoclonal antibodies and peptides may be lyophilized and reconstituted with a suitable vehicle before use. The technique has proven to be effective with conventional immunoglobulins. Known techniques of lyophilization and reconstitution can be used for this. However, it should be borne in mind that lyophilization and reconstitution may reduce antibody activity to varying degrees (for example, with conventional immunoglobulins, IgM antibodies show a greater loss of activity than IgG antibodies), so an amount of preparation should be given to compensate for these losses. .

Compositions containing monoclonal antibodies, peptides, or a mixture thereof are intended for use in the prophylactic and / or treatment of HIV infection. When used in therapy, these compositions are administered to patients already infected with HIV in amounts sufficient to cure, or at least partially arrest, the development of the disease and its complications. This amount is defined as "therapeutically effective dose. The amount will depend on the severity of the disease and the overall health of the patient's immune system, but will generally be between 1 and 200 mg of the antibody per kilogram of body weight.

155,084 and doses of up to 5 to 25 mg / kg will be generally used. It should be noted that these substances will generally be used in severe, life-threatening or at least potentially life-threatening disease states. In such cases it is possible and recommended to administer a significant excess of these antibodies.

For prophylactic purposes, these compositions are administered to patients not yet infected with HIV, but likely to have recently been exposed to, or suspected of being exposed to, the virus, or to patients at risk of exposure to the virus, in order to strengthen the patient's own immunity to potential infection or to HIV vaccination. The amount administered for this purpose is defined as "prophylactically effective dose. Again, the specific dosage adopted will depend upon the patient's state of health and general immunity, but will generally be in the range of 0.1 mg to 25 mg / kg, more typically 0.5 mg to

2.5 mj ^ kg.

The choice of single or multiple administration of the above compositions, the dosage amount and the dosage regimen should be made by the attending physician. In any event, the dosage forms should contain an amount of antibodies obtained from the cell lines of the invention that is sufficient to treat the patient effectively.

Moreover, the monoclonal antibodies in question may find application specific to the target carrier molecule (target substances). The antibody can be bound to the toxin to form an immunotoxin, or to a radioactive material or drug to form a radiopharmaceutical or pharmaceutical agent. Methods for producing immunotoxins and radiopharmaceuticals are known (for example: Cancer Treatment Reports 68, 317/1984).

It is also possible that heteroaggregates made of monoclonal antibodies produced by the cell lines of the invention and human T cell activators, such as monoclonal antibodies against the CD3 antigen or the Fc gamma receptor on T cells, will allow human T cells or cells with receptors to Fc-gamma (such as K cells or neutrophils) destroys HIV infected cells by antibody dependent cell-mediated cytolysis (ADCC). Such heteroaggregates can be prepared, for example, by conventionally cross-linking anti-HIV antibodies to anti-CD3 antibodies, using N-auxinimidyl-3- (2-pyridyl dithiol / propionate) as a heterobifunctional reagent (Karpowsky et al., J. Exp. Med., 160, 1686) 1984 /.

As such, the compositions of the peptides described above may also find therapeutic use in cases where their administration will reduce infection or eliminate HIV from the host organism. Such compositions, comprising peptide 29, blocking peptides, and peptide 126 (the latter disclosed in pending US Patent Application No. 930,785) can be administered in suitable physiological vehicles intravenously, subcutaneously, intramuscularly, intraperitoneally or otherwise. Phosphate buffered saline, saline, water, potassium chloride, sodium lactate, or other known agents can be used as carriers. The concentration of peptides in these compositions will vary depending upon the intended use, activity, and route of administration. Preferably, in these peptides, the carboxyl terminal group is converted to an amide group, the amino terminal group is formylated, or other pharmaceutically acceptable derivatives are prepared. The addition of blocking peptides to peptides mimicking the HIV neutralizing region and / or the specific reactive antibodies of the invention will greatly enhance their therapeutic efficacy. Other anti-HIV agents (apart from monoclonal antibodies that bind peptides), such as 3'-azido-3'-deoxytimidine, 2 ', 3'-didesoxycytidine, 2', 3'-didesoxy-, can also be used in these drug forms. 2 ', 3'-didehydrocyidine and the like.

The use of monoclonal antibodies produced by the cell lines according to the invention for immunoaffinity purification.

Monoclonal antibodies specific for polypeptides containing gp110 or other antigenic determinants, especially those antigenic determinants that are obtained from recombinant fusion proteins produced by biological expression or from HIV culture lysates or extracts, are particularly useful in the purification process. In general, these antibodies will have associative affinity constants of 10 ⁸ to 10 ¹² m.

155 084

These antibodies can be used to purify recombinant fusion proteins from the culture broth of a recombinant expression system where the protein is secreted outside the cells, or from a component of a disrupted biological expression system if the protein is not secreted outside the cell. In general, monoclonal antibodies capable of reacting with gpl10 or other antigenic determinants are attached to the substrate or support, or immobilized on the support. The solution containing the HIN antigen determinants is then contacted with the immobilized antibody under conditions suitable for the formation of immune complexes between the antibody and polypeptides containing the gp 110 antigenic determinants. Unbound material is separated from the bound immune complexes, and the complexes or gpl 10 antigen fragments are then separated from carrier.

In general, monoclonal antibodies are pre-purified from exudate or cell culture supernants prior to being deposited on the support. This procedure is known to those skilled in the art and involves fractionation in highly concentrated salt solutions. Other methods such as DEAE chromatography, gel filtration chromatography, preparative gel electrophoresis, or protein A affinity chromatography may also be used to purify monoclonal antibodies prior to their use as immunoadsorbants.

The carrier on which the monoclonal antibodies are immobilized should have the following properties:

/ a) poor overall interaction with proteins to minimize non-specific binding;

/ b) good flow characteristics allowing the flow of high molecular weight materials;

/ c / should have chemical groups that can be activated or modified, allowing the chemical binding of monoclonal antibodies;

/ d / physical and chemical stability under the conditions used to bind monoclonal antibodies; and / e / insensitivity to the conditions and buffers used for antigen adsorption and elution. Commonly used carriers include agarose, derivatized polystyrenes, polysaccharides, polyacrylamide beads, activated cellulose, glass, and the like. There are different chemical methods for attaching antibodies to carriers (Cuatrecasas P, Advances in Enzymology, 36, 29 (1972)).

The antibodies produced by the cell lines produced by the method of the invention can be attached to the carrier directly, either via a linker or via the arm.

The general conditions required for the immobilization of monoclonal antibodies on chromatographic supports are known (e.g., Tijssen P., Practice and Theory of Enzyme immunoassay, 19185). In practice, the conjugation procedures will depend only to a small extent on the characteristics and type of antibody to be coupled. Monoclonal antibodies have properties that generally remain constant from batch to batch, allowing process conditions to be optimized. The attachment is generally via covalent bonds.

Subsequently, a suspension of HIV extracts or lysates or supernatants derived from cultures of biological expression systems or a suspension of disrupted cells are added to such a matrix, and the mixture is incubated under conditions and at a time that allow the formation of an immune complex, i.e. for at least 30 minutes, usually 2 up to 24 hours. The complexes containing the polypeptides with the antigenic portions of gpl10 are then separated from the mixture. Typically, the mixture is removed by elution and the bound immune complexes are eluted extensively with an adsorption buffer. The complexes are then eluted from the matrix using an eluant appropriate to the given support. Such eluants are known. Polypeptides containing gpl10 or other antigenic components can also be selectively removed. For example, peptides containing an epitope recognized by these antibodies can be used for competitive binding to an antibody. This is an alternative elution technique that can be performed under mild conditions. A selectively adsorbed polypeptide containing the gpl10 antigen can be eluted from the antibody-adsorbant complex by changing the pH and / or ionic strength of the buffer.

Chaotropic agents can also be used to remove the bound antigen. The choice of the appropriate chaotropic agent, its concentration, and other elution parameters depends on the characteristics of the antibody-antigen interaction, but labeled once should not be changed as is the case in polyclonal affinity separation systems.

The eluted material may need to be adjusted to a physiological pH as long as the pH is too low or too high, or adequate ionic strength buffers are used to separate bound gpl antigens from the matrix. Dialysis or gel filtration chromatography may also be required to remove excess salt used in the elution solution to allow reconstitution of gpl10 or polypeptides containing gpl10 antigenic fragments to their original conformation.

Substantially purified gpl 10 or polypeptides containing antigenic fragments of this glycoprotein produced either naturally in infected cell cultures, or in recombinant bacterial, yeast, or insect or mammalian expression systems can be obtained. The purity of gpl 10 and the above fragments or other purified proteins as obtained by this procedure is generally greater than 50%, typically at least 75%, and often greater than 95 to 99%. The particles purified in this way can find a further multiple use.

The HIV gpl 10 protein, polypeptides containing antigenic fragments of this protein, or other purified proteins can be used for a variety of purposes, including the production of AIDS subunit vaccines in which the immunogen contains an effective dose of antigenic determinants, for example the gpl10 glycoprotein or region thereof neutralizing. Other components of this vaccine include those antigenic HIV protein or glycoprotein molecules that stimulate the production of antibodies (preferably neutralizing antibodies) prior to subsequent HIV infection.

The use of monoclonal antibodies produced by the cell lines according to the invention in diagnostics.

Monoclonal antibodies are also suitable for diagnostic purposes. For this purpose, they can be marked or unmarked. Generally, in a diagnostic assay, complex formation is detected by the binding of the monoclonal antibody to an HIV antigen. Unlabeled antibodies are of use, for example, in agglutination assays. In addition, they can be used in combination with other labeled antibodies (second antibodies) that react with the monoclonal antibody, such as anti-immunoglobulin antibodies. Alternatively, monoclonal antibodies can be directly labeled. A variety of labeling agents can be used for this purpose, such as redionuclides, fluorescers, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, ligands (especially heptens) and the like. There are many immunoassays available. Examples of such tests are given in U.S. Patent Nos. 3,817,827, 3,850,752, 3901654, 3935074, 3984533, 3996 345, 4034074, and 4,098,876.

In general, monoclonal antibodies and peptides are used in enzyme immunoassays where these antibodies or other antibodies from other species are combined with the enzyme. When a biological sample containing HIV antigens, such as human serum, saliva, semen, vaginal swabs, or a virally infected cell culture suspension is combined with these antibodies, binding of the antibodies to those molecules having the desired epitope occurs. Such proteins or viral particles are separated from unbound reagents and a second antibody (labeled with the enzyme) added. The presence of an antibody-enzyme conjugate specifically bound to the antigen is then determined. Other known techniques can also be used.

Kits using the antibodies produced by the cell lines produced by the method of the invention are prepared for detecting HIV infection or the presence of HIV antigen. Such kits include monoclonal antibody compositions, usually in lyophilized form, either as such or in combination with additional antibodies specific for other H1V epitopes. Antibodies that can be conjugated or unconjugated to the labeling agent are put into kits including buffers such as tris, phosphate, carbonate and the like, stabilizers, biocides, neutral proteins, for example bovine serum albumin. Generally, these materials are present in an amount less than 5% based on the amount of active antibody, typically together making up at least 0.001% of the antibody concentration. Often an inert filler or diluent is added to dilute the active ingredients. In these cases, the diluent content may be from 1 to 99% of the total weight of the composition.

15S 684

When a second antibody having binding capacity for a monoclonal antibody is used, it is generally placed in a separate vial. The second antibody is typically bound to a labeling agent and formulated into a pharmaceutical form in a manner analogous to the antibody forms described above.

Detection of gpl10 or p25 antigens or whole viruses in various biological samples can be used to diagnose current HIV infections. Such biological samples may include blood serum, saliva, semen, tissue bips samples (brain, skin, lymph nodes, spleen), cell culture supernatants, disrupted eukaryotic and bacterial expression systems, and the like. Virus testing is performed by incubating the monoclonal antibody with a biological sample under conditions that lead to the formation of an immune complex, and then the formation of such a complex is detected.

One method of detecting the formation of a complex is to use a second antibody capable of binding to a monoclonal antibody that is conjugated to a labeling agent and formulated as described above for the antibody forms. In another method, the monoclonal antibody is embedded in a solid support which is contacted with the sample of biological material. After the incubation step, a labeled monoclonal antibody is added to detect the bound antigen. The antibodies produced by the cell lines of the invention have the ability to recognize peptides which peptides, inter alia, immunologically mimic epitopes encoded by the HIV retrovirus, especially epitopes encoded in the env or gag regions of the viral genome, encoding gpl10 and p25, respectively. In order to compensate for differences between strains derived from different isolates, adjustment of conserved substances and selection of those with non-conservative substitutions can be performed. These peptides can be used as immunogens to inhibit or eliminate the production of HIV antigen in vitro or in vivo, to detect viruses or antibodies against these viruses in samples of biological material.

Depending on the procedure, the peptides are to be conjugated to the support or other compounds, labeled or unlabelled, or attached to a solid surface. These peptides are derived from the gpl10 region of the virus, in particular the open reading frame of the eav region, ranging from 6688 bp to 6750 bp and from 7246 bp to 7317 bp. These peptides, including the blocking peptides, contain at least 5, sometimes 6, sometimes 8, sometimes 12, sometimes 21, generally less than 50, usually less than 35 and preferably less than 25 amino acids in the HIV retrovirus code sequence. It is preferred that these peptides are as small as possible while retaining substantially complete immunological or antiviral reactivity of the larger peptide. In some cases, it is preferable to combine two or more non-overlapping oligopeptides to form a single peptide structure, or to use them as separate peptides. Together or separately, they constitute the immune equivalent of the parent peptide.

These peptides can be modified with conservative or non-conservative substitutions, generally less than 20% and usually less than 10% of the number of amino acids exchanged. In those cases where the regions show polymorphism, it is preferable to exchange one or more amino acids in order to more effectively mimic the variable epitopes of the different retrovirus strains. In many cases, for chemical stability, methionine is replaced with norleucine (NOR).

It is noted that the peptides used need not be identical to any HIV polypeptide sequence as long as the compound in question can compete immunologically with at least one HIV strain.

Thus, these peptides may be subject to various changes, such as insertions, deletions, and substitutions, whether conservative or non-conservative, when these changes provide advantages in their use. Conservative substitutions are considered to be substitutions within groups such as gly, ala; val, ile, leu; asp, glu; asn, gin; cheese, thr; lys, arg; phe, tyr; and burrows, met. The altered sequence should not differ by more than 20% from that of at least one HIV retrovirus strain, unless additional amino acids have been donated at either end serving as the "arm by which the peptide is immobilized on the support. Such an arm may consist of 1 to 50 or even more amino acids, most often arms of 1 to 10 amino acids in length are constructed.

15S®84

A peptide in which the amino acid sequence has been modified by substituting, adding or deleting amino acid residues should retain substantially complete immunological or antiviral reactivity of the unmodified peptide, which can be readily determined using the assay techniques disclosed herein. One or more amino acids in D-isomeric form can also be used to modify biological properties such as activity, rate of disintegration and the like.

In addition, to modify the physical or chemical properties of a peptide or oligopeptide, one, two, or more amino acids may be added to the ends of the peptide or oligopeptide for the purposes discussed below, which facilitates the binding of the peptides to each other and binding to a carrier or to a larger peptide .

In order to obtain functional groups needed for linkage, an amino acid such as tyrosine, cysteine, lysine, glutamic or aspartic acid is placed at the carboxyl or amino terminus of a peptide or oligopeptide. Cysteine is especially preferred to facilitate covalent bonding to other peptides or to make polymers by oxidation.

The peptide or oligopeptide sequences may also differ from the sequences of natural origin in that they have modified sequences, for example by acylation of the amino terminal group, or amylation of thioglycolic acid, ammonia or methylamine terminal blocking with ammonia or methylamine, thus obtaining stability and increased hydrophobicity - features needed for bonding to a carrier or to another molecule, or for polymerization. Thus, in the disclosed peptides I-VIII and IX-XV, when Y and Y 'are present, they generally denote one or more cysteine residues or a combination of one or more cysteine groups with an amino acid residue as an arm for further processes.

An especially good amino acid as a shoulder is glycine. Preferred peptides for use in oxidative polymerization are those wherein Y and Y 'are at least two cysteine residues. When two cysteine residues are present at the same end of the peptide, it is preferred that they are separated by one to three shoulder amino acid residues, preferably glycine. The presence of cysteine residues allows the formation of dimers of a given peptide and / or increases the hydrophobicity of the resulting peptide, which facilitates its immobilization in a solid phase or facilitates immobilization tests.

Of particular importance is the use of the mercaptan group of cysteine or glycolic acid used to acylate amine or similar end groups to link two peptides or oligopeptides or combinations thereof with disulfide or longer bonds to form polymers having multiple epitopes. Such polymers are characterized by increased immunological reactivity. When different peptides are used to make the polymer, they have the additional ability to induce antibodies that react immunologically with several antigens and determinants of different HIV isolates.

For the preparation of antigenic polymers (synthetic multimers), compounds having bis-haloacetyl groups, nitroaryl halides and the like are used where the reagents are thiol-specific. Thus, the combination of two mercaptan groups belonging to different peptides or oligopeptides can be a single bond or a bridging group of at least 2, generally at least 4, but not more than 16, usually not more than 14 carbon atoms.

These peptides may be used bound to a soluble macromolecular carrier (not less than 5 kilodaltons). Such a carrier may be a naturally occurring poly (amino acid) or a synthetic carrier in which no antibodies are present in human serum.

Examples of such carriers are poly-L-lysine, leech haemocyanin, thyroglobulin, albumin such as bovine serum albumin, tetanus toxoid and the like. The choice of carrier primarily depends on the intended use of the antigen and the ease of surgery and availability of that carrier.

Such conjugates should contain at least one peptide molecule in the macromolecule but no more than one in 0.5 kilodalton. Typically no more than 1 in 2 kilodaltons of the macromolecule can be attached to one or more different peptides.

155 084

A conventional bonding method is used, using such reagents as p-methyldithiobenzoic acid, p-methyldithiobenzoic acid, maleic anhydride, succinic anhydride, glutaraldehyde and the like. The linkage may be at the amino terminus, carboxyl terminus, or intermediate to the ends of the molecule. The peptide can be derivatized by binding, it can also be coupled in a carrier-bound state.

Various tests, similar to the known ones, are used to detect the presence of antibodies to the retroviral proteins or the retroviral proteins themselves. It is especially useful to use a peptide as a labeled reagent in which the labeling produces a detectable signal or the binding of the peptide directly or indirectly on the surface, whereby the antibody against the peptide in the test sample will be with the peptide on that surface. The presence of the peptide-bound human antibody is then detected using a xenogeneic anti-human immunoglobulin antibody, generally both human IgM and IgG, or a labeled protein specific for immune complexes, for example protein A from Rf.

S. aureus.

An illustration of the testing technique is the use of a sample container, that is, cavities in a microtest plastic plate in which cavities the polypeptide or its conjugates adsorb to the bottom and / or walls of the well covalently or non-covalently. Human blood or serum, diluted with an appropriate buffer, is then added to the wells and allowed to complex until a complex is formed between the polypeptide and related antibodies in the sample. The supernatant is then removed; the wells are washed to remove unspecifically bound proteins. For detection, a labeled, specific binding protein that binds to the complex formed, such as an anti-human immunoglobulin xenogeneic antiserum, is used.

These peptides are produced using various synthetic routes. As the peptides are relatively short, they are synthesized in solution or on a solid support in accordance with the techniques currently used. Various automatic synthesizers currently commercially available can be used in this work. See Stewart and Young, "Slid Phase Peptide Synthesis, 2nd ed., Pierce Chemical Co., 1984 and Tam et al., J. Am. Chem. Soc. 105, 6442 (1983).

Alternatively, hybrid DNA technology can be used. In this technology, a synthetic gene is prepared using single strands encoding that polypeptide or complementary strands overlapping the single strands and joined together in an appropriate hybridization solution. The hybridized strands are ligated to form the complete gene by selecting the appropriate ends. Such a gene is inserted into expression vectors which are readily available today. (Maniatis, Molecular Cloning, A Laboratory Manual, CSH. Cold Sprong Harbor Laboratory, 1982).

Another technique is to clone the region of the viral genome encoding the peptide by known recombinant DNA methods (see Maniatis, supra). For the expression of the peptides, DNA coding sequences from the HIV LAVbru and ARV-2 isolators of the following structure can be used:

LAVbru TGT ACA AGA CCC AAC AAC AAT ACA AGA AAA AGT ATC CGT ATC CAG AGG GGA CCA GGG AGA GCA TTT GTT ACA ATA GGA AAA ATA GGA AAT ATG AGA CAA GCA CAT TGT.

ARV-2 TGT ACA AGA CCC AAC AAC AAT ACA AGA AAA AGT ATC ATA ATA GGA CCA GGG AGA GLA TTT CAT ACA ACA GGA AGA ATA ATA GGA GAT ATA AGA AAA GCA CAT TGT.

Fragments of these sequences are used to express peptide fragments. Conservative base changes may also be made where the modified codon encodes the same amino acid, or non-conservative changes in the coding sequence, whereby the resulting amino acid may be a conservative or non-conservative change in the amino acid sequence, as discussed above.

The coding sequence can be extended at the 5 'or 3' end, or both ends, thereby extending the produced peptide and preserving its epitope site. To extend it, add a "binding arm, for example to a labeling agent such as an enzyme, link two or all of the peptides into one chain to obtain antigenic activity, or obtain convenient restriction sites for cloning.

155 084

As such, fragments or larger sequences of these DNA sequences of at least 15 bases, preferably at least 18 bases, are used as nucleotide probes for the detection of retroviral RNA or proviral DNA, or for the identification of homologous regions for cloning or sequencing. Various techniques are used for this purpose, such as the Grunstein-Hogness technique, the Southern technique, the Northern technique, the dot-blot technique and improvements thereof, and other methodologies, such as that disclosed in US Patent No. 4,358,535.

These peptides are used in vaccines as such or in combinations. Anti-idiotypic antibodies, that is, reactive with the itiotypes of antibodies produced by the cell lines of the invention, and thus having epitopes mimicking HIV neutralizing regions, can also be used as vaccines. These peptides and anti-idiotypic antibodies are formulated into pharmaceutical forms in a known manner, generally in doses from 1 µg to 20 mg / kg of host weight. As carriers, physiologically acceptable agents such as sterilized water, body fluid, phosphate buffered body fluid, and the like are used. Adjuvants such as aluminum hydroxide gel, surface-active substances such as isolecithin, pluoron polyols, polyamines, peptides, proteins (for example diphtheria or cholera toxins) and oil emulsions can also be used. These peptides can also be incorporated into liposomes or conjugated to polysaccharides, polypeptides or polymers and used in vaccines. These vaccines are administered parenterally, that is, intramuscularly, intraperitoneally, subcutaneously and intravenously. The immunogenically effective dose is administered one or more times, generally at intervals of one to 4 weeks. "An immunogenically effective dose is the amount of vaccine needed to elicit an immune response in the host with evidence of increased infection.

The invention will be explained in more detail in working examples which illustrate the invention.

Example I. Production and characterization of monoclonal antibodies.

This example describes a method of producing hybrid cell lines producing monoclonal antibodies specific for HIV coat glycoproteins. In this method, lectin-purified LAVbru extracts attached to lentil lentin lectin are used as immunogen. Subsequently, monoclonal antibodies generated by the hybrid cell lines are characterized by an "immunoblot" assay and for the ability to radioimmunologically precipitate gpl10 from purified LAV, and as a recombinant fusion protein produced by biological expression. Monoclonal antibodies that bind to epitopes on gpl10 are also reactive in whole virus disrupted ELISAs, with fusion proteins and synthetic peptides, and react with whole virus in indirect fluorescence assays.

The method of producing hybrid monoclonal antibody producing cell lines and characterizing these antibodies is as follows:

LAV virus isolated from infected CEM cells (ATCC No.GRL8904) is disrupted in a solution composed of: 50 M Tris (pH7.4), 0.15 M NaCl, 1.0% aprotinin, 2.0% of the "Nonidet 2-40" reagent ^{/ R /} / NP-40, octylphenoxypolyethoxyethanol /. The extract is clarified twice by centrifugation and brought to a concentration of 0.5% NP-40 by adding three volumes of the above buffer but without NP-40. Lentil Lectin Agarose / Pharmacia, Piscataway. NJ / is pre-washed with disruption buffer without NP-40 and equilibrated in the adsorption buffer with the following composition: 50 mM Tris (pH 7.3), = 15 M NaCl, 1.0% aprotinin, 0.5% NP- 40. The clarified viral extract is adsorbed to lentil lectin agarose for 42 hours at 4 ° C. Unadsorbed material is removed by washing with an excess of adsorption buffer. The adsorbed material is eluted with a 0.2 M solution of? -Methylmannoside in an adsorption buffer. The eluent is dialyzed against PBS to remove the sugar and the resulting material is re-adsorbed onto the lectin sepharose.

Complex: glycoprotein - lentin - lentil sepharose, is used to immunize BALB / o mice by giving three intraperitoneal injections without adjuvant at 2-3 week intervals. Spleens are collected from mice that show the presence of circulating antibodies to HIV glycoproteins in the "immuboblot, RIP and / or ELISA assays."

The generation of the cell lines is carried out essentially as described by Kohler and Milstein (Nature, 256, 495 (1985) with modifications by Goldstein L.C. et al. (Infect.

155 084 immunol. 38, 273 (1982)). B cells from the spleen of immunized mice are fused to NS-1 myeloma cells against 40% (w / v) polyethylene glycol. After fusion cell mixture was resuspended in HAT medium (medium ROMI-1640 supplemented with 15% fetal raw ^and c ^y c ^and e ^{le Further,} one X HRM hypoxanthine, 4 ^χ K) ^{'7 I} have no ^p ter ^y n ^{y 1 6} X Μ ⁵ m t ^y m ^ides n ^{y), L} and form the conditions of selection allowing the growth of only the hybrid cells, and then the mixture is poured into depressions in the plates rnikrohodowli 96 well, at a concentration of 1 to 3 x 10 "cells / ml and incubated at 37 ° C in a humidified atmosphere with 6% CO2. The cultures are fed by replacing half of the supernatant with fresh HAT medium. The wells are observed with an inversion microscope for signs of cell proliferation, and when a sufficient cell density is reached, the supernatants are tested for anti-LAV antibodies.

The wells containing the LAV antibody-producing hybrid cells are identified by ELISA for binding to either the whole purified, disrupted virus or to fusion proteins produced by biological expression. The disrupted virus ELISA sample is run on LAV EIA plates (Genetic Systems, Seattle, Washington). The cell culture fluid plates are incubated at 37 ° C for 45 minutes and then washed three times with a solution of 0.05% Tween 20 in phosphate buffered saline (PBS-Tween).

Peroxidase - goat anti-mouse IgG (1: 2000 dilution in PBS-Tween, Tymed Laboratories, Inc., South San Francisco, California / at 100 µl per well) is added and the plates are incubated for 45 minutes at 37 ° C and washed as above. Subsequently, the substrate (0.025 M citric acid, 0.05 M dibasic sodium phosphate (pH 5.0) and 14 mg o-phenyldiamine and 10 μΐ 30% hydrogen peroxide in 50 ml was added and the plates were incubated for 30 minutes. , at room temperature, in the dark, the reaction is stopped with 3N sulfuric acid and the colorimetric reaction is read on an automatic microplate reader. Positive wells are further subcloned using limiting dilutions, specificity determined again and multiplied.

Monoclonal antibodies secreted by the resulting hybrid cell lines are then characterized by determining their specificity and reactivity in "immunoblot, immunoprecipitation, and ELISA assays using disrupted LAV viruses, recombinant LAV fusion proteins, and synthetic LAV peptides." The determinations show that all the antibodies are of the IgG1 isotype. Prior to this application, the HIV-gpl 10-1, HIV-gpl 10-2, and HlV-gplO-3 cell lines were deposited with the American Type Culture Collection under ATCC Nos. HB9175, HB9176 and HB9177, respectively.

Recombinant fusion proteins tested for reactivity were previously designated ENV2, ENV3, ENV4 and ENV5. The ENV2 protein is derived from the pENV2 resection (ATCC 53071) which is the LAV region from 6598 bp to 7178 bp (base pair numbering according to Wain. Hobson et al., Cell, 44, 9/1985 //, ENV3 is derived from the expression of pENV3 (ATCC 53072) ) containing the LAV region from 7178 bp to 7698 bp, eNv4 is derived from the expression of pENV4 (ATCC No. 53073) containing the sequence from 7698 to 8572 bp, and ENV5 is derived from the expression of PENV5 (ATCC 53074) which contains the LAV region from 5889 to 7698 bp. The production of recombinant fusion proteins is described in detail in pending United States Patent Application No. 721,237.

Preparation of synthetic peptides. Peptidyl (29) and VIII (110-2-2) are synthesized from benzhydrylamine (polystyrene) divinylbenzene resin (Applied Biosystems, Inc., Foster City, California). Peptide V (177) is synthesized on t-butyloxycarbonyl (Boc) ethylbentylcysteine-phenylacetamidomethyl (PAM) -polystyrene (divinylbenzene resin). Symmetric anhydride coupling is performed in an Applied Biosystems 430A synthesizer. Both peptides use cysteine as the first amino acid residue.

For asparagine and glutamine, dicyclohexylcarbodiimide coupling is used in the presence of hydroxybenzotriazole. Side chain benzylation and BOC blocking of the σ-amino group are used. In addition, the following side chain reactive group blockage is routinely used: Boc / formyl / tryptophan, Boc methionine sulfoxide, Boc / toluene sulfonyl / arginine, Boc / methylbenzyl / cysteine. Boc / toluene-sulfanyl / histidine, Boc / chlorobenzyloxycarbonyl / lysine and Boc / bromobenzyloxycarbonyl / tyrosine.

155 ®Μ 19

Labeling of peptides with the radioactive element is carried out by acetylating the amino terminus of ³ H-acetic acid using an excess of dicyclohexylcarbodiimide.

The deblocking and cleavage of the peptide from the resin was performed by Tam's "low-high" method using HF (Tam et al., Supra). The peptide is extradited from the resin with 5% acetic acid and the extract is subjected to gel filtration chromatography in 5% acetic acid. Synthetic HIV peptides tested for reactivity with monoclonal antibodies include peptides; 29, 36 and 39. Peptide 29 is encoded by the LAVbru genomic region from 6688 bp to 6750 bp, peptide 36 is encoded by a region extending from 7246 bp to 7317 bp, and peptide 39 is encoded by a region from 7516 bp to 7593 bp. Peptides 36 and 39 are disclosed in U.S. Patent No. 4,629,783.

Blocking peptides IX through XV are constructed as described above on a methylbenzhydralanine (polystyrene / divinylbenzene) resin (Applied Biosystems Inc., Foster City, California). Symmetric anhydride coupling is performed in an Applied Biosystems 430A synthesizer. For asparagine, a dicyclohexyiocarbodimide coupling is used in the presence of hydroxybenzotriazole. Side chain benzylation and BOC (amine) blocking are used, while Boc / bromobenzyloxycarbonyl blocking is used for tyrosine side chains. Acetylation, if required, is carried out with acetic anhydride or glacial acetic acid in dicyclohexylcarbodiimide. Deblocking and cleavage of the peptide from the resin was carried out by the standard "high" technique using HF (Stewart et al., Supra). The peptide is extracted from the resin with 50% acetic acid and the extract is subjected to gel filtration chromatography in 20% acetic acid. Where necessary, purification is performed by high performance liquid chromatography on a Vydac 08 column (Rainin Instrument Co., Emiryville, CA) using a gradient of 0.1% trifluoroacetic acid in acetonitrile.

Colored immune reaction ("Immunoblotting") in this assay, the characterization is performed on the supernatants of the clones or on the exudate using purified LAV virus and recombinant fusion proteins as antigens. Antigens are separated by gradient electrophoresis of polyacrylamide gel (7.0-15.0%) and transferred to a nitrocellulose (NMC) membrane by electrophoresis for 4 hours at 25 V in 25 mM sodium phosphate (pH 7.0). After transfer, the nitrocellulose membranes are blocked to avoid non-specific reactions by incubation in PBS-Tween or Blotto (5% skim milk powder in PBS) for one hour at room temperature. Then these nitrocellulose membranes are incubated with cell culture supernatant or with the effusion fluid diluted in PBS-Tween for one hour at room temperature and washed with PBS-Tween three times. In the next step, nitrocellulose membranes are incubated for one hour at room temperature with a solution of goat IgG anti-mouse horseradish peroxidase diluted in PBS-Tween. After incubation, washing is carried out with PBS-Tween solution and the membranes are immersed for 20 minutes in a solution giving a colored reaction with horseradish peroxidase (bio-Rad Laboratories, Richmond, California). The reaction is stopped by immersion in deionized water. The reactivity of the monoclonal antibodies is compared to a positive control serum reactive with the purified disrupted virus or expression fusion protein. The results of the assay indicate that all antibodies bind to gpl10 and its precursor molecule gpl50 when using the disrupted virus preparations. Antibodies 110-1 and 110-2 also recognize the ENV3 fusion protein, while antibodies 110-3,110-4,110-5 and 110-6 immunocomplex ENV2.

Immunoprecipitation. Viral extracts for radioimmune precipitation are prepared from CEM cells infected with HIV LAVbru isolate adapted to lytic growth by continuous passaging. When early cytopathic changes are observed, cells are transferred to a labeling fluid containing ³⁵ / S / -methiomin (0.05 mCi / ml) or ³ / H / -glucosamine (0.025 mCi / ml), then incubated for 24 hours. During this time, most cells are lysed and the virus is released into the culture supernatant. The virus is centrifuged from the cell-free supernatant (centrifugation for one hour at 100,000 g), after which detergent extracts are prepared in P-RIPA buffer (phosphate buffered saline containing: 1.0% Triton Χ-100, 1.0% deoxycholate, 0.1% SDS and 1% aprotinin). Similar extracts are prepared from the supernatants of uninfected CEM cells.

For immunoprecipitation assays, 100 µl of viral extract are incubated with 100 µl of the supernatant of the hydride cell line culture for one hour on ice. To each sample

155,084 are each added 4 µl anti-mouse rabbit Ig (Zymed Laboratories, S. San Francisco, California) and incubated for 30 minutes. Immunoprecipitin (100 / d), Bethesda Research Laboratory, Bethesda, Maryland) suspended in P-RIPA buffer containing 1.0% ovalbumin is then added to each sample and incubated for an additional 30 minutes. The bound complexes are washed and separated by SDS polyacrylamide gel electrophoresis (15.0% acrylamide: DATD gel). After electrophoresis, the gels are fixed, immersed in an Enbance bath (New England Nuclear, Bosto, MA), dried and fully fulminated on Kodak XR-5 membrane. Serum is used as comparative positive and negative controls, which immunoprecipitates all HIV proteins by reacting with supernants of virus-infected and mock-infected CEM cells. The results of the assay show that all 6 monoclonal antibodies are specifically precipitated by gpl10 and gpl50.

Solid phase enzyme immunoassay. To determine the gp110 epitopes recognized by the monoclonal antibodies of the invention, culture supernatants from hybrid cell lines or from the exudate fluid are characterized by determining their reactivity with biologically expressed fusion proteins and synthetic peptides in ELISA assays. The procedure is the same as described above except that fusion proteins or synthetic peptides are used instead of the virus as the antigen adsorbed on the surface of a well in a microtiter plate.

When using peptides as an antigen, the procedure is as follows: A lyophilized peptide is dissolved in 6M guanidine HCl. Immediately prior to pouring into the wells of 96-well plates, the guanidine solution is diluted with 0.05M carbonate / bicarbonate buffer (pH 9.6) to a final peptide concentration to ΚΚμ / ml. 50 µl of the diluted peptide is placed in each well and the plates are incubated overnight at 4 ° C. Excess peptide solution is "shaken", the plates are blocked with "Blotto" solution and the procedure is continued as described above for the ELISA assay. Similarly, the recombinant protein is diluted to a final concentration of 2 μΐ / ml with 0.05M carbonate / bicarbonate buffer (pH 9.6) and the same procedure is followed.

The results are presented in Table II. Monoclonal antibodies produced by the HIV gpl 10-1 and HIV gpl 10-2 cell lines react with ENV3, ENV5, peptide36 and disrupted virus. Antibodies from the HIV-gp-110-3, HIV-gp-11-4, HIV-gp-110-5 and HIVgp-110-6 cell lines react with ENY2 and peptide 29 and with disrupted virus.

Table II

Results of the ELISA test demonstrating the reactivity of monoclonal antibodies against the reactive proteins and synthetic peptides

Recombinant fusion protein Synthetic peptide , LAV virus control CEM control cells ENV2 ENV3 ENV4 ENV5 29 26 39 110-1 0.077 3,000 0.113 3,000 ND 2.421 0.054 0.908 0.125 110-2 -0.003 3,000 0,000 3,000 ND 2.305 -0.005 1,214 0.009 110-3 3,000 0.011 ND ND 3,000 ND 0.017 0.363 0.046 and 10-4 3,000 0.020 ND ND 3,000 ND 0.016 0.383 0.067 110-5 3,000 0.014 ND ND 3,000 ND 0.016 0.368 0.025 110-6 3,000 0.033 ND ND 1.937 ND 0.017 0.486 0.032

The results presented in Table II show that monoclonal antibodies 110-1 and 110-2 recognize an antigenic determinant encoded by a DNA sequence in the pENV3 region, in particular by the region of the HIV genome defined by the amino acid sequence of peptide 36. Thus, monoclonal antibodies gpl 10-1 and 110-2 bind to the gpl10 peptide region encoded in the 7246 bp to 7317 bp segment, as evidenced by the formation of immune complexes with peptide 36 and ENV3. This region of the HIV genome was previously identified as a conserved region, that is, there were only minor changes in the DNA sequence of the peptide 36-defined region derived from different virus isolates from different geographic regions. See Stercich et al., Cell, 46, 637 (1986). In contrast, monoclonal antibodies gpl 10-3, -4, -5, and -6 bind to HIV peptides as defined by a peptide29 coding region ranging from 6688 bp to 6750 bp. This region in gpl 10,

However, as defined by peptide29, 155 084 contains a number of nucleotide substances in different viral isolates. Monoclonal antibodies that selectively bind to gp 110 polypeptides containing conserved epitopes, such as antibodies 110-1 and 110-2, have greater utility in many circumstances, for example in affinity chromatography. Also in the ELISA assay, peptide 110-2-2 reacts with the serum of the individual from which LAV-2 was isolated.

Indirect immunofluorescence test. Indirect immunofluorescence assays with monoclonal antibodies directed against the HIV gpl antigen are performed on acetone-fixed and live cells. Acetone-fixed samples prepared from LAV-infected CEM cells are incubated with diluted culture supernatant or with effusion fluid for one hour at 37 ° C, while viable cells are incubated with culture supernatant or effusion fluid for one hour at 4 ° C. whereby cell preparations fixed with acetone are prepared. In both methods, fluorescein isothiocyanate-labeled anti-mouse IgG is used to detect cells containing reactive gpl10 antigen. HIV-gpl10-1 monoclonal antibody gives positive results with both live and acetone-fixed LAV infected cells.

An example. HIV contagiousness neutralization by monoclonal antibodies against gpl 10.

In this example, the neutralization of HIV infectivity by the use of monoclonal antibodies that bind to gpl10 and peptides within gpl10 is described and characterized. The results of the trials indicate that monoclonal antibodies gpl10-3, -4, -5 and -6 have the activity of and that gpl 10-3 and -4 have extremely high levels of neutralizing activity.

An attempt to neutralize. A sensitive neutralization assay has been developed to quantify the effect of monoclonal antibodies on HIV infectivity. CD4 + (CEM) cell line very sensitive to HIV infection was selected as the target cell for the infectivity comparisons. The exudate, prepared as described in Example 1, or its IgG fraction is purified by ammonium sulfate precipitation and inactivated by heating at 56 ° C for 30 minutes, then diluted in RPMI medium containing 10% fetal calf serum. HIV virus suspension, strain LAVbru, is harvested from a 4-day log-phase culture of CEM, filtered through 0.2 or 0.45 μπι filters, aliquoted and frozen at -70 ° C. One aliquot is thawed, titrated to determine TCID50, and subsequent trials are run with freshly thawed aliquots diluted 1: 500 in culture medium to a concentration approximately 10 times higher than is needed to infect 50% of the CEM cells in the culture (LOTCID50. The viral suspension is mixed). with an equal volume (25 µL) of five-fold dilutions of the monoclonal antibody preparation 1: 5 to 1: 9 765,625. The virus / antibody mixture is incubated for 45 minutes at 37 ° C and then diluted 1: 5 to 1: 9, 765, 625. This virus / antibody mixture is incubated for 45 minutes at 37 ° C and then 200 µl aliquots of this mixture are used to inoculate wells containing 1.0 ml of a solution at approximately 2X 105 CEM cells / well. incubated at 37 ° C in a humidified atmosphere with 5% CO2 for 14 days.

Cells are then harvested, pelleted and lysed in 1% Triton Χ-100 in PBS for 10 minutes. The amount of virus (or viral antigen) present in lysed cells is quantified using the sensitive HIV antigen capture immunoassay of the Aandwich type described above. The titer of neutralizing activity is determined as the reciprocal of the dilution of the monoclonal antibody that inhibits antigen production by more than 50% relative to the control viral cultures incubated without the antibody or with a monoclonal antibody of the same isotype that has not shown neutralizing activity in previous studies.

In the above HIV antigen capture assay, two monoclonal antibodies directed against p25 antigens are used as capture (hood) reagents. These hybrid cell lines are generated as described above with minor modifications, which include the use of the purified recombinant gag protein as an immunogen and the characterization of the produced monoclonal antibodies for specificity and reactivity, using recombinant fusion proteins labeled GAG-1, GAG-2 and GAG-3 and synthetic peptide 141. GAG-I protein is the expression product of the pGAG-1 plasmid

155,084 (ATCC No. 53379), GAG-2 is the expression product of pGAG-2 (ATCC 53111) and the GAG-3 protein is the expression product of pGAG-3 (ATCC No. 53112). The production of recombinant fusion proteins is described in detail in US Patent Nos. 764,460 and 828,828. The synthetic peptide 141 is encoded by the genomic LAVbru region corresponding to amino acid residues 198-242. It turned out that the monoclonal antibody produced by the hybrid cell lines p25-2 and p-25-3 reacts with the recombinant GAG-I proteins. GAG-7 and GAG-3. and the monoclonal antibody from n25-3 reaeuie

155,084 cellular p25-6 and p25-7 react with the recombinant GAG-3 fusion protein p25-6 and react with synthetic peptides 147 and 148, and p25-7 react with synthetic peptides 15, 88 and 150.

The neutralization assays are carried out as described above, except that if the mixture (cocktail) is used, the individual monoclonal antibodies are first diluted 1: 5 in the culture medium and then equilibrated to give a final 1:10 dilution. The rest of the test is carried out as described above.

Monoclonal antibodies gpl 10-2, p25-6 and p25-7 show less than 50% neutralizing activity when used alone. When used in a mixture that contains the monoclonal gpl 10-2 antibodies together with p-25-6 or p25-7 at a 1:10 dilution, complete neutralization is achieved. The mixture containing monoclonal antibodies p25-6 in combination with p25-7 gives a neutralizing activity of 60 to 90%.

Example IV. The potency of the immune peptide 29.

The ability of peptide29 and homologous peptides including peptide 177 to stimulate an immune response against HIV was determined in two mouse strains.

The method of preparing the peptide immunogens, the method of immunizing and determining the immune response is given below.

Peptide 29 preparation for immunization purposes is prepared by conjugation with purified thyroglobulin. Tyroglobulin is derivatized with N-succinimidyl-4 (N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) in accordance with the disclosure in US Patent No. 4,529,783, column 10, lines 28-51. As the second immunogen, thyroglobulin derivatized with glutaraldehyde is prepared as follows: 27 mg of pork thyroglobulin is dissolved in 1 ml of 0.1 M sodium bicarbonate, to which 8.3 / t PLN 25% glutaraldehyde solution is added dropwise and the mixture is stirred for a day in room temperature. 1 ml of buffer: sodium carbonate / sodium bicarbonate, pH 9.3, was added to the solution and dialyzed for 8 hours against 2 liters of the same buffer at 4 ° C, with complete dialysate exchange after 4 hours. Peptide 29 is then added to the derivatized thyroglobulin in a 100 molar excess, and the mixture is stirred overnight at room temperature. The unreacted glutaraldehyde is blocked with 200 µl of 0.2 M lysine solution and the mixture is stirred for several hours (24 hours) at room temperature. The peptide-thyroglobulin conjugate is then dialyzed extensively against PBS at 4 ° C.

Peptides prepared by either of these conjugation methods are administered to two strains of mice (black C57 and BALB / c). All mice are 2-4 weeks old at the time of inoculation. The preparations were administered to the footpads, by sacrification of the tail, subcutaneously, intranasally or intraperitoneally. The inoculum contains 25 µg of conjugated peptide suspended in 0.5 ml of complete Freund's adjuvant. In addition, booster inoculations repeated at weeks 2, 3 and 5 with the same immunogen in incomplete Freund's adjuvant are used. Serum samples are collected from individual mice before immunization, 4 days after the boosted inoculation at week 3, and 4 days after the last inoculation at week 5. Antibodies to analogous peptides or to whole viruses are detected in serum samples by screening by ELISA. Sera showing antibody activity against LAV are further screened for neutralizing activity, then these sera are analyzed by colored immunoassays ("immunoblots) against disrupted LAV antigen and by radioimmunoprecipitation against labeled gpl 10".

The immunization results show that mice immunized with peptide 29 had antibodies reactive with peptide 29 and the disrupted LAV-1 virus by ELISA. Conjugation of peptide 29 with glutaraldehyde generally resulted in higher antibody titers against peptide 29 in BALB / c mice, although meleimide conjugation showed satisfactory results in the production of antibodies against peptide 29 in some BALB / c mice. Mice immunized with peptide 177 developed antibodies against this peptide and conjugation of this peptide with glutaraldehyde to a greater extent induced an immune response. C57 mice were more sensitive to immune stimulation with peptide 177 than BALB / c mice. As shown by ELISA assays, mice immunized with peptide 110-2-2 from LAV-2 possessed antibodies against 110-2-2 and against LAV-2 virus. Peptide 110-2-2 conjugated via glutaraldehyde was

155,084 immunogenic against both C57 and BALB / c mice, although the titers for peptide 110-2-2 were generally higher in BALB / c mice than in C57 mice, while titers against LAV-2 were generally higher higher in C57 mice than in BALB / c mice.

In summary, it can be concluded that the serum samples from immunized mice that / i / have antibodies against the solid virus particles, / ii / neutralize HIV, as shown in the tests described in Example 2, and / iii / react with peptide 29 in the ELISA assay, collectively demonstrate the efficacy of peptide 29 in vaccine formulations.

Example 5 Resolution of gpl10 by immunoaffinity method using monoclonal antibodies.

Monoclonal antibodies against the HIV gpl10 antigen can be used in the immunoaffinity separation process to completely purify the bacterially expressed recombinant fusion proteins. If the protein produced by the bacteria is secreted, this protein can be isolated from the culture supernatant. If, on the other hand, it is not secreted from the bacterial cell, it is necessary to break the cell. The construction of the plasmid pENV-5 (ATCC No. 53074) is given in pending United States Patent Application No. 721,237. The plasmid pENV-5 encodes most of the carboxyl terminus of gpl10 and the amino terminus portion of LAV gp41 which is an insertion into the expression vector trp. E. coli 0600 transformed with this vector produces the gpl10 fusion protein, but does not secrete it outside the cell.

E. coli COOO containing the pENV-5 plasmid is grown in tryptophan (20 µg / ml) and ampicillin (100 µg / ml) medium overnight at 37 ° C under aeration conditions. The one-day-old cultures are then inoculated at a 1: 100 ratio into fresh minimal medium containing ampicillin (100 µg / ml) but not tryptophan. These cultures are grown under aeration for 2-3 hours (to the early log phase of growth) at 37 ° C. Then the inducer, 3/3-indoleacrylic acid (Sigma Chemica Co., St. Louis, MO) is added as a freshly prepared solution at a concentration of 20 mg / ml in 95% ethanol (to the final concentration in the culture 20 µg / ml). Growth of induced colonies is carried out at 37 ° C with aeration for 4 to 5 hours, then pelletized and optionally frozen. The protein yield from pENV-5 is generally below 1 mg / liter .

The bacterial cell pellet is lysed with P-RIPA buffer (PBS containing: 1% Triton Χ-100, 1% deoxycholate, 0.1% sodium dodecyl sulfate and 1% aprotinin) inducing the lysis of E.coli cells. The suspension is sonicated to shear the DNA and RNA, then centrifuged to remove undissolved particles. A dilution or concentration step may be required to standardize the protein concentration.

HIV-gpl 10-1 monoclonal antibodies are initially precipitated from the exudate or from cell culture supernatants at room temperature or below, with / NH4 / 2SO4 or NaiSO4 buffered (pH 7.3) solutions added as needed to obtain the final concentrations of 33 and 18%. The precipitated proteins are centrifuged and redissolved in PBS and precipitated a second time with 33% / NH4 / 2SO4 or with 12-15% Na2SO4. This step may be repeated. The pellet formed is re-dissolved in PBS and excess salt removed by gel filtration through a desalting matrix or by exhaustive dialysis against PBS.

The purified monoclonal antibody 110-1 is coupled to cyanogen bromide sepharose. A suitable amount of gel swollen in a solution of 10- ³ MHC1 on a glass filter (g freeze-dried material gives a final gel volume approximately 3.5 ml), and washed for 15 minutes with the same solution, and immediately after this is added an antibody. In general, the coupling reaction is most effective at pH8-10, but lower pH can be used if needed to maintain the stability of the antibody. The antibody should be dissolved in PBS or in a high ionic strength carbonate / bicarbonate or borate buffer containing 150 mM NaCl. The activated Sepharose and antibody suspension is gently stirred for 2-4 hours at room temperature or overnight at 4 ° C, then on a sintered glass filter with a coupling buffer. All remaining active groups are blocked by treatment with 1.0M ethanolamine at pH 8 for 2 hours. The final product, the antibody-sepharose, is washed 4 to 5 times per shift with high and low pH buffer solutions (borate buffer, 0.1M,

155 084 25 ρΗ 8.5 IM NaCl and acetate buffer, O, IM, pH 4.0, IM NaCl). This washing removes residual covalently non-adsorbed materials. The resulting immunoaffinity separation matrix is stored below 8 ° C in the presence of a suitable bacteriostatic agent, such as 0.01% azide.

The addition of a suspension of the produced protein to such a matrix selectively removes the gpl 10 antigen. The mixture is allowed to stand for 2 to 24 hours, preferably 12-18 hours with slow stirring or shaking. A column may also be used, in which case the immunoaffinity matrix is loaded onto the column, equilibrated, and the protein suspension is slowly fed. After the protein suspension is administered, the flow through the column is stopped to obtain maximum immune complex formation.

Unbound material is either washed off or separated by exhaustive elution with an adsorption buffer. A sintered glass filter with a vacuum or column flow-through can be used. Unbound material is then eluted using low and high ρΗ / acetate buffer ph4.0 or borate buffer ph 8.5 µl or a chaotropic agent.

Example VI. Purification of recombinant gpl10 obtained from a mammalian expression system by immunoaffinity method.

The monoclonal antibodies produced by the cell lines of the invention find use in the purification of recombinant gpl 10 protein expressed from mammalian cells by immunoaffinity. Mammalian cells are infected with recombinant vaccinia (Mackett et al., J. Virol. 49, 857/1984, /, containing sequences encoding at least a portion of the gpl10 protein which is an antigen and causes the production of neutralizing antibodies.

Recombinant vaccinia is prepared as described in U.S. Patent Application No. 842,984. In this method, sequences encoding the HIV coat glycoprotein are inserted into a plasmid vector (pGS20) after the vaccinia transcription control element. This chimeric gene is flanked by sequences encoding the thymidine kinase (TK) gene.

Chimeric plasmid vectors containing the vaccinia virus promoter ligated to the LAV coat gene are used to transform E. coli strain M01000. The insertion of the chimeric LAV-env sequences into the vaccinia virus genome was accomplished by in vivo recombination made possible by the fact that the chimeric genes in the pv-env5 plasmids are flanked by vaccinia virus sequences encoding the genTK genome. The plasmid is then introduced into cells previously infected with wild type vaccinia virus, whereby recombination occurs between the TK sequences in the plasmid and the homologous sequences in the vaccinia viral genome, resulting in the insertion of the chimeric gene. African green monkey kidney cells (BSC-40 strain BSC-1 cell line, ATCC No.CCL26) were used as the host in the expression system.

BSC-40 cells are infected with a multiplicity of recombinant vaccinia virus. 12 hours after infection, cells are harvested, washed once in PBS and centrifuged. Cell pellets are resuspended in cell lysis buffer (1.0% NP 40, 2.5% sodium deoxycholate, 0.1M NaCl, 0.01M Tris-HCl (pH 7.4), 1mM EDTA) and the cell lysate is clarified by centrifugation. The immunoaffinity separation of the expressed recombinant fusion protein is performed as described above for a bacterial expression system using the gpl 10-1 monoclonal antibodies. Proteins produced in this expression system are more closely related to the natural production of HIV gpl10 proteins due to the fact that glycosylation processes take place in mammalian cells.

Example VII. Inhibition of HIV infection with blocking peptides.

The effectiveness of the blocking peptides in inhibiting infection of a tissue cell culture with the HIV strain LAVbru was tested using a modified T-peptide evaluation method published by Petr et al., Supra. A preferred attempt to inhibit HIV infection is to combine equal volumes of blocking peptide and CEM cells (2.5 X 10 ⁵ ) in a medium (RPMI, 10% FOS and 2mg / ml polybrene) and incubation for 45 minutes at 37 ° C. The virus is then added at various doses (10.50,300 TCID50), the mixture is incubated for 14 days at 37 ° C, and the supernatant is then analyzed for viral antigen production (e.g. core p25).

155 084

Pre-incubation of CEM cells with the peptides before adding the virus to the culture enhanced the inhibitory effect seen in the tests performed. This inhibition appears to be dose-dependent: high inhibitory activity is observed at low and medium doses, but less activity is observed at the highest virus doses.

In the T peptide assays, about 60 to 90% inhibition of the production of viral antigens was achieved at low viral doses. Additional experiments with X-XV peptides generally after amidating the free carboxyl terminus and acylating the free, terminal amino group gave similar results. On the other hand, peptide XI was particularly effective over a wide dose range. To achieve additional or synergistic inhibition of the production of viral antigens, neutralizing antibodies can be added either during preincubation or during virus addition.

From the above examples, it can be seen that the monoclonal antibodies produced by the cell lines of the invention together with peptides, including blocking peptides, enable improved methods of neutralizing and / or inhibiting HIV infection. They enable the development of prophylactic and therapeutic compositions effective against infections with most, if not all, strains of HIV. In addition, the new materials find use in diagnostic assays and other known procedures.

The present invention has been described in detail for illustration and the examples are given to aid understanding thereof, and it is obvious that some changes and modifications may be made to the deposit data of the microorganisms within the scope of the appended claims. The following microorganisms produced and used in the present invention are deposited at the American Type Culture Collection, 12301 Perklawn Drive, Rockwille, Maryland 20852, USA. Data on deposits are given below:

Scientific name Name given by the depositor ATCC number Date of deposit Hybrid mouse cells (Balbc / NJS-1) HIV-gp 110-1 HB 9175 August 30, 1986 HIV-gp 110-2 HB 9176 HIV-gp 110-3 HB9177 n HIV-gp 110-6 HB 9404 April 30, 1987 HIV-gp 110-4 HB 9405 HIV-gp 110-5 HB 9406 HIV-p 25-2 HB 9407 HIV-p 25-3 HB 9408 n HIV-p 25-6 HB9409 HIV-p 25-7 HB 9410

Hybrid HB 9175, HB9176 and HB9177 cells were tested and found viable on August 26, 1986. The remaining cells were tested and found viable on May 4, 1987.

Claims (6)

Patent claims A method of producing cell lines producing antibodies reactive with the antigenic determinant of HIVgpl10, characterized by introducing an immunogenic amount of the antigen preparation enriched in HIV protein into the host, monitoring the immunized host for the production of antibodies reactive with the antigenic determinant of gpl10, obtaining cells producing antibodies with host and immortalized cells, the immortalized cells producing anti-HIV gpl10 antibodies are selected and the immortalized cells are cloned to obtain cell lines. 2. The method according to p. The method of claim 1, wherein the cloning is performed "in vitro" in the medium, or the cell lines are injected endothelially into the host and the monoclonal antibodies are recovered. 155 084 3. The method according to p. The method of claim 1, wherein the biological sample taken from the host is inoculated "in vitro" with a protein from the neutralizing region of HIV, and the presence of immunocomplexes formed between the protein and antibodies in the sample is detected. 4. A method of producing cell lines producing antibodies reactive with the p25 antigenic determinant, characterized by introducing an immunogenic amount of an antigenic preparation enriched in HIV protein into the host, monitoring the immunized host for the production of antibodies reactive with the p25 antigenic determinant, obtaining cells producing antibodies with host and immortalized cells, immortalized cells producing anti-HIVp25 antibodies are selected and the immortalized cells are cloned to obtain cell lines. 5. The method according to p. The method of claim 4, wherein the cloning is performed "in vitro" in the medium, or the cell lines are injected endothelially into the host and the monoclonal antibodies are recovered. 6. The method according to p. The method of claim 4, wherein the biological sample taken from the host is inoculated "in vitro" with a protein from the neutralizing region of HIV, and the presence of immunocomplexes formed between the protein and antibodies in the sample is detected. 155 084 Department of Publishing of the UP RP. Circulation 100 copies. Price PLN 3,000