CA2058872C - Recombinant iga protease - Google Patents
Recombinant iga proteaseInfo
- Publication number
- CA2058872C CA2058872C CA002058872A CA2058872A CA2058872C CA 2058872 C CA2058872 C CA 2058872C CA 002058872 A CA002058872 A CA 002058872A CA 2058872 A CA2058872 A CA 2058872A CA 2058872 C CA2058872 C CA 2058872C
- Authority
- CA
- Canada
- Prior art keywords
- iga protease
- renaturation
- modified
- gene
- host cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/52—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Detergent Compositions (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention concerns a process for the isolation of recombinant IgA protease from inclusion bodies. In addition a recombinant DNA is claimed which codes for an IgA protease whose C-terminal helper sequence and preferably also its N-terminal signal sequence is no longer active.
Description
D a s c r i p t i o n The present invention concerns a process for the production of IgA protease from E. coli inclusion bodies.
Various pathogenic bacterial species (e. g. of the genus Neisseria, such as for example Neisseria gonorrhoeae and Neisseria meningitidis or the genus Haemophilus such as for example Haemophilus influenzae) which grow on human mucous membranes secrete proteases which are specific for human Ig A1 and which are denoted IgA proteases. The immunoglobulin Ig A1 is an important component of the secretory immune response that is intended to protect against infections by such pathogenic organisms (review:
Kornfeld and Plaut, Ref. Infect.Dis. 3 (1981), 521-534).
These proteolytic enzymes, which are denoted IgA
proteases, for example cleave the following recognition sequences as described for example by Pohlner et al., (Nature 325 (1987), 458-462):
1. Pro-Ala-Pro -~ Ser-Pro 2. Pro-Pro -~ Ser-Pro 3. Pro-Pro -~ Ala-Pro 4. Pro-Pro -~ Thr-Pro In this case "-~" in each case denotes the cleavage site of the IgA protease.
The TgA proteases mentioned above are secretory proteins which have an N-terminal signal sequence for the transport into the periplasma and a C-terminal helper 20588'2 protein sequence which subsequently allows secretion from the periplasma into the medium.
The cloning and expression of an IgA protease from Neisseria in E. coli is described for example in PNAS
USA 79 (1982) 7881-7885 and EMBO J. 3 (1984) 1595-1601.
A disadvantage of the isolation of IgA protease according to the known methods is, however, the low productivity and vitality of the E. coli cells which have been transformed with an IgA protease gene which only results in a very low volume yield of IgA protease.
Since IgA protease is very important as a proteolytic enzyme for the cleavage of fusion proteins produced by genetic engineering (cf. W091/11520) there is a great need for a method of isolating IgA protease which overcomes at least some of the drawbacks of tha state of the art.
The object according to the present invention is achieved by a process for the production of recombinant IgA protease which is characterized in that (1) an IgA protease gene is modified in such a way that the DNA region of the IgA protease gene coding for the C-terminal helper sequence is no longer functionally active, (2) a host cell is transformed with the IgA protease gene modified according to step (1) or with a vector containing this modified gene, (3) the modified IgA protease gene is expressed in the transformed host cell, (4) the IgA protease which forms as inclusion bodies is isolated from the host cell and (5) the IgA protease is converted into active protein by in vitro activation.
It was surprisingly found that an IgA protease which no longer has a functionally active helper sequence (and thus can no longer be secreted from the host cell into the medium) is formed as inactive inclusion bodies within the host cell and that a~ter activation of these inactive inclusion bodies very high volume yields of IgA
protease are achieved. These inactive inclusion bodies can be isolated according to the usual methods from the cells and subsequently converted into the active form by means of in vitro activation.
It is essential for the process according to the present invention that the DNA region coding for the C-terminal helper sequence of the IgA protease is no longer functionally active. This can for example be achieved by partial or complete deletion of the DNA region coding for the helper sequence. The deletion of DNA fragments can be carried out in a manner familiar to one skilled in the art, as for example by in vitro mutagenesis on double-stranded or single-stranded DNA or by cleavage with suitable restriction enzymes and removal of restriction fragments from the region of the helper sequence. A further possibility for such a modification of the IgA protease gene is to carry out an in vitro mutagenesis in the DNA region coding for the helper sequence by means of which one or several translation stop codons are introduced into this region which then prevent a complete translation of the helper sequence when the IgA protease gene is expressed.
It is preferred in the process according to the present invention that the IgA protease gene is modified in such 2~588'~2 a way that the helper sequence of the IgA protease coded by this modified gene is completely deleted. This can for example be achieved by introducing one or several translation stop codons into the IgA protease gene directly at the beginning of the C-terminal helper sequence. A further possibility for the deletion of the helper sequence is a PCR reaction on IgA protease cDNA
using suitable primers as described in example 1.
In the process according to the present invention it is also preferred that the IgA protease gene is in addition modified in such a way that the DNA region coding for the N-terminal signal sequence of the IgA protease is no longer functionally active. In this way the transport of the IgA protease into the periplasma is also blocked so that the inactive inclusion bodies are formed in the cytosol of the transformed host cell.
It is preferred that the inactivation of the signal sequence is carried out by completely deleting the .
corresponding DNA region according to the usual techniques. Subsequently DNA sequences from the DNA
regions coding for the mature protein which may have been lost can be filled in again by introducing a synthetic oligonucleotide by genetic engineering. The signal sequence can, however, also be deleted by a PCR
reaction using suitable primers as described in example 1.
A prokaryotic cell, especially an E. coli cell, is preferably used as the host cell for the process according to the present invention. In addition it is preferred that the host cell is transformed with a DNA
sequence coding for an IgA protease which is under the control of an inducible promoter. Examples of suitable inducible promoters are for example the tac, lac or trp promoter or other similar promoters which are known to one skilled in the area of molecular biology.
The IgA protease produced in the process according to the present invention is formed in the host cell as inclusion bodies. The isolation of inclusion bodies and their conversion into active protein by in vitro activation can be carried out in any manner known to one skilled in the art. Examples of such methods are described for example in EP-A 0 361 475, DE-A 36 11 817, DE-A 35 37 708, WO 87/02673; Jaenicke, R. & Rudolph, R.
(1989) Protein structure - a practical approach, Ed.:
Creighton T.E. Oxford University Press, 191; Rudolph, R.
(1990) Modern methods in protein and nucleic acid analysis, Ed.: Tschesche, published by H. Walter deGruyter, 149-171; Jaenicke, R. (1987) Prog. Biophys.
Molec. Biol. 49, 117.
The in vitro activation of the IgA protease preferably includes a solubilization step and a renaturation step.
The renaturation step in this process can be carried out by feeding the denatured protein continuously or discontinuously into the renaturation buffer. In this process it is.preferred that the renaturation step is carried out in the form of a discontinuous pulse renaturation.
It is particularly preferred that the renaturation step for the activation of the IgA protease is carried out in the presence of 0.2 to 1 mol/1 arginine and most preferably of 0.4 to 0.8 mol/1 arginine. In addition it is preferred that the reactivation is carried out at a pH of 5 to 9, particularly preferably at a pH of 6 to 8.
_ 6 _ 20588'72 When the IgA protease is renatured from inactive inclusion bodies active soluble protein is formed in a yield which ranges from about 10 % to over 30 %, depending on the starting material and renaturation method. Although the renaturation yield is not quantitative, nevertheless a substantially higher yield of active IgA protease is obtained with the process according to the present invention compared to conventional methods.
The present invention also concerns an IgA protease which has been produced by a process according to the present invention i.e. by activation from inclusion bodies.
In addition the invention. concerns a recombinant DNA
which codes for an IgA protease and is modified in such a way that on expression of the recombinant DNA an IgA
protease results whose C-terminal helper sequence is no longer functionally active and is preferably even completely deleted. The recombinant DNA according to the present invention is preferably additionally modified in such a way that on expression of the recombinant DNA an IgA protease is formed whose N-terminal signal sequence is no longer functionally active and especially preferably is completely deleted. Genetic engineering methods for the modification or deletion of DNA regions which lead to the desired results have already been mentioned or are so familiar to one skilled in the area of molecular biology that they do not have to be explicitly elucidated.
The present invention also concerns a recombinant vector which contains at least one copy of a recombinant DNA
according to the present invention. The recombinant DNA
_ ~ _ 20~88'~2 according to the present invention in this vector is preferably under the control of an inducible promoter.
The vector according to the present invention can be present outside the chromosome of the host cell (e.g. a plasmid) or integrated in the genome of the host cell (e.g. bacteriophage in an E. coli cell). The vector is preferably a plasmid.
The invention in addition concerns a cell which is transformed with a recombinant DNA according to the present invention or with a recombinant vector according to the present invention. This cell is preferably a prokaryotic cell and particularly preferably an E. coli cell.
The invention is further elucidated in the following by the present examples in conjunction with the sequence protocols.
SEQ. ID. NO. 1 shows the primer A used in example 1 SEQ. ID. NO. 2 shows the primer B
SEQ. ID. NO. 3 shows the primer C
SEQ. ID. NO. 4 shows the primer D
The plasmid pMAC 1 was deposited at the German Collection for Microorganisms (DSM), Griesebachstral3e 8, D-3400 Gottingen and assigned the number DSM 6261.
2058'72 E x a m p 1 a 1 Preparation of plasmid constructs for the expression of IgA protease in the form of inclusion bodies In order to express IgA protease as inclusion bodies, the region coding for the protein without signal sequence and helper sequence is cloned downstream of a strong promoter as described in the following (amino acid position + 1 to position 959, Pohlner J., Halter R., Beyreuther K., Meyer T.F., Nature 325, (1987), 458-462) .
For this chromosomal DNA is isolated from N. gonorrhoeae (e. g. MS 11) and used to carrying out a polymerase chain reaction (PCR, method cf. EP-A 0 200 362, EP-A 0 201 184). The following primers are used for the PCR.
Primer A (SEQ. ID. NO. 1L
5' GAAGAATTCGGAGGAAAAATTAATGGCACTGGTACGTGATGATGTCGATTATCAAA 3' Primer B ~SEQ. ID. NO. 2):
5' TTTTTGTAATAAAGATCTTTGCCTTG 3' The first 5 codons of the IgA protease were optimized for an efficient expression in E. coli without changing the amino acid sequence and used for primer A, which includes the ATG start codon as well as an ECo RI
recognition sequence (GAATTC).
20588'2 _ g _ Primer B contains sequences adjacent to the Bgl II
recognition sequence of the IgA protease (ca. amino acid positions 553-561). The PCR fragment (A/B = ca. 1650 bp, 5' terminal region of the IgA protease gene) obtained in this way is purified and recleaved with the enzymes ECo RI/Bgl II.
In order to prepare the 3' region of the IgA protease gene a second PCR reaction is carried out with the following primers:
Primer C ~SEQ. ID. NO. 3):
5' CAAGGCAAAGATCTTTATTACAAAAA 3' Primer D (SEQ. ID. NO. 4):
5' TTCAGCTGGTCGACTTATCACGGGGCCGGCTTGACTGGGCGGCC 3' Primer C corresponds to the coding region of primer B
(Bgl II cleavage site) and primer D contains sequences of amino acid positions 952-959 with an adjacent stop codon and a Sal I recognition sequence. The PCR fragment (C/D = 1200 bp) obtained in this way is isolated and recleaved with the enzymes Bgl II/Sal I.
Subsequently a three fragment ligation is carried out:
with the fragments A/B, the fragment C/D and the vector pKK 223-3 (DSM 3694P) which was previously digested with the enzymes Eco RI and Sal I and purified. The vector obtained in this way is denoted IgA-Prot III and is transformed in E. coli K12.
-1°- 2058872 Example 2 (comparative example) Isolation of soluble IgA protease according to the conventional method.
a) Isolation from 1 1 shaking culture E. coli K12 cells transformed with the plasmid pMACl (8878 bp) were used as the starting material. The complete coding region for IgA protease is located on this plasmid and is under the control of the lambda promoter. The plasmid carries an ampicillin resistance.
The cells were cultured in LB medium overnight at 28°C
and subsequently diluted 1:100 with LB medium. The culture was then incubated for a further 4 hours at 37°C. The cells were separated by a centrifugation step.
The culture supernatant was sterile-filtered over a cellulcse-acetate filter, dialysed against 20 mmol/1 Tris/HC1, pH 7.5, 10 mmol/1 EDTA, 10 % glycerol (buffer A) and concentrated to 1/10 its volume with the aid of a SALVIA capillary dialyser E-15U t'1' A negative elution on DEAE-Sephadex A-50~min 20 mmol/1 Tris/HC1, pH 7.5, 10 mmol/1 EDTA and 10 % glycerol was carried out as the first purification step. The column was loaded with 0.5 mg protein per 1 ml gel matrix. In this separation the IgA protease is in the eluant and most of the E. coli proteins are bound to the carrier.
Washing the column matrix again with buffer A plus 1 mol/1 NaCl showed that less than 10 0 of the IgA
protease binds to the column material.
Finally it is purified on a cation exchanger (FractogelR-EMD-S03' -650M). The protein binds in 20 mmol/1 Tris/HC1, 10 mmol/1 EDTA, 10 % glycerol pH 7Ø Then the buffer can be changed to pH 8Ø The elution is carried out with a linearly increasing NaCl gradient whereby the IgA protease is eluted with a buffer of pH 8.0 at a salt concentration of 0.1 mol/1 NaCl and with a buffer of pH 7.0 at 0.2 mol/1 NaCl.
Result:
Concentrate before DEAE-Sephadex 3.5 mg protease (70 % pure) Eluate after DEAE-Sephadex 2.4 mg protease (90 % pure) Eluate after FractogelR-EMD-S03' -650M 1 mg protease (> 95 % purity) b) Isolation of IgA protease from a 10 1 fermenter The starting material and purification were carried out analogous to example 2a).
Result:
Concentrate before DEAE-Sephadex: 50 mg IgA protease (50 % purity) Eluate after DEAE-Sephadex: 30 mg IgA protease (60 % purity) Eluate after FractogelR-EMD-S03' -650M: 12 mg IgA protease (> 95 o purity) 20~88'~2 Example 3 Isolation of IgA protease from inclusion bodies (process according to the present invention) The starting material was the construct IgA-Prot III
(example 1) in E. coli cells (DSM 3689) which additionally contain a lacIq plasmid for the expression of the lac repressor.
500 ml LB medium containing 50 ~g/ml kanamycin and 50 ~.g/ml ampicillin was prepared for the 1 1 fermentation culture. This medium was inoculated with 7.5 ml of an overnight culture which resulted in an OD550 of ca. 0.1. Then a 3 to 4 hour incubation at 37°C
was carried out while shaking (150 rpm). The cells were induced with 5 mmol/1 IPTG at an OD550 of ca. 0.8. The cells were harvested after a 4 hour incubation at 37°C
while shaking (150 rpm).
IB preparation:
The cells are harvested by centrifugation, taken up in 10 ml Tris-magnesium buffer (10 mmol/1 Tris, pH 8.0, 1 mmol/1 MgCl2) and lysed with lysozyme (0.3 mg/ml).
They are incubated for 15 minutes at 37°C and subjected to one passage of a French press (1200 psi).
Subsequently a DNAse digestion (1 mg DNAse I) is carried out for 30 minutes at 37°C.
20 ml 0.5 mol/1 NaCl, 20 mmol/1 EDTA, pH 8.0 and 3 ml 20 % Triton X l0~is added and incubated for 10 minutes at room temperature.
The suspension is centrifuged for 10 minutes at 15000 rpm and 4°C. The pellet is taken up in 30 ml 50 mmol/1 Tris, pH 8.0, 50 mmol/1 EDTA and 0.5 Triton X 100~nd treated with ultrasound. It is centrifuged again, resuspended and treated with ultrasound. This procedure is repeated for a further two times. Subsequently it is centrifuged and the pellets obtained in this way are used as IBs in example 3.
Table 1 shows the results for the fermentation in a 1 1 shaking culture and in a 10 1 fermenter.
Table 1 Fermentation E. coli Total protein IgA protease strain from IB material (%) (g) (g) 1 1 HB 101 0.125 50-70 0.06-0.09 10 1 IK12 C600 I 20.8 I30-50 6.2-10.4 It can be seen from Table 1 that 60-90 mg protease is obtained as inclusion body (IB) material from the 1 1 shaking culture. At a renaturation yield of ca. 10 this would yield 6 to 9 mg active IgA protease (compared to 3.5 mg by the conventional method).
Various pathogenic bacterial species (e. g. of the genus Neisseria, such as for example Neisseria gonorrhoeae and Neisseria meningitidis or the genus Haemophilus such as for example Haemophilus influenzae) which grow on human mucous membranes secrete proteases which are specific for human Ig A1 and which are denoted IgA proteases. The immunoglobulin Ig A1 is an important component of the secretory immune response that is intended to protect against infections by such pathogenic organisms (review:
Kornfeld and Plaut, Ref. Infect.Dis. 3 (1981), 521-534).
These proteolytic enzymes, which are denoted IgA
proteases, for example cleave the following recognition sequences as described for example by Pohlner et al., (Nature 325 (1987), 458-462):
1. Pro-Ala-Pro -~ Ser-Pro 2. Pro-Pro -~ Ser-Pro 3. Pro-Pro -~ Ala-Pro 4. Pro-Pro -~ Thr-Pro In this case "-~" in each case denotes the cleavage site of the IgA protease.
The TgA proteases mentioned above are secretory proteins which have an N-terminal signal sequence for the transport into the periplasma and a C-terminal helper 20588'2 protein sequence which subsequently allows secretion from the periplasma into the medium.
The cloning and expression of an IgA protease from Neisseria in E. coli is described for example in PNAS
USA 79 (1982) 7881-7885 and EMBO J. 3 (1984) 1595-1601.
A disadvantage of the isolation of IgA protease according to the known methods is, however, the low productivity and vitality of the E. coli cells which have been transformed with an IgA protease gene which only results in a very low volume yield of IgA protease.
Since IgA protease is very important as a proteolytic enzyme for the cleavage of fusion proteins produced by genetic engineering (cf. W091/11520) there is a great need for a method of isolating IgA protease which overcomes at least some of the drawbacks of tha state of the art.
The object according to the present invention is achieved by a process for the production of recombinant IgA protease which is characterized in that (1) an IgA protease gene is modified in such a way that the DNA region of the IgA protease gene coding for the C-terminal helper sequence is no longer functionally active, (2) a host cell is transformed with the IgA protease gene modified according to step (1) or with a vector containing this modified gene, (3) the modified IgA protease gene is expressed in the transformed host cell, (4) the IgA protease which forms as inclusion bodies is isolated from the host cell and (5) the IgA protease is converted into active protein by in vitro activation.
It was surprisingly found that an IgA protease which no longer has a functionally active helper sequence (and thus can no longer be secreted from the host cell into the medium) is formed as inactive inclusion bodies within the host cell and that a~ter activation of these inactive inclusion bodies very high volume yields of IgA
protease are achieved. These inactive inclusion bodies can be isolated according to the usual methods from the cells and subsequently converted into the active form by means of in vitro activation.
It is essential for the process according to the present invention that the DNA region coding for the C-terminal helper sequence of the IgA protease is no longer functionally active. This can for example be achieved by partial or complete deletion of the DNA region coding for the helper sequence. The deletion of DNA fragments can be carried out in a manner familiar to one skilled in the art, as for example by in vitro mutagenesis on double-stranded or single-stranded DNA or by cleavage with suitable restriction enzymes and removal of restriction fragments from the region of the helper sequence. A further possibility for such a modification of the IgA protease gene is to carry out an in vitro mutagenesis in the DNA region coding for the helper sequence by means of which one or several translation stop codons are introduced into this region which then prevent a complete translation of the helper sequence when the IgA protease gene is expressed.
It is preferred in the process according to the present invention that the IgA protease gene is modified in such 2~588'~2 a way that the helper sequence of the IgA protease coded by this modified gene is completely deleted. This can for example be achieved by introducing one or several translation stop codons into the IgA protease gene directly at the beginning of the C-terminal helper sequence. A further possibility for the deletion of the helper sequence is a PCR reaction on IgA protease cDNA
using suitable primers as described in example 1.
In the process according to the present invention it is also preferred that the IgA protease gene is in addition modified in such a way that the DNA region coding for the N-terminal signal sequence of the IgA protease is no longer functionally active. In this way the transport of the IgA protease into the periplasma is also blocked so that the inactive inclusion bodies are formed in the cytosol of the transformed host cell.
It is preferred that the inactivation of the signal sequence is carried out by completely deleting the .
corresponding DNA region according to the usual techniques. Subsequently DNA sequences from the DNA
regions coding for the mature protein which may have been lost can be filled in again by introducing a synthetic oligonucleotide by genetic engineering. The signal sequence can, however, also be deleted by a PCR
reaction using suitable primers as described in example 1.
A prokaryotic cell, especially an E. coli cell, is preferably used as the host cell for the process according to the present invention. In addition it is preferred that the host cell is transformed with a DNA
sequence coding for an IgA protease which is under the control of an inducible promoter. Examples of suitable inducible promoters are for example the tac, lac or trp promoter or other similar promoters which are known to one skilled in the area of molecular biology.
The IgA protease produced in the process according to the present invention is formed in the host cell as inclusion bodies. The isolation of inclusion bodies and their conversion into active protein by in vitro activation can be carried out in any manner known to one skilled in the art. Examples of such methods are described for example in EP-A 0 361 475, DE-A 36 11 817, DE-A 35 37 708, WO 87/02673; Jaenicke, R. & Rudolph, R.
(1989) Protein structure - a practical approach, Ed.:
Creighton T.E. Oxford University Press, 191; Rudolph, R.
(1990) Modern methods in protein and nucleic acid analysis, Ed.: Tschesche, published by H. Walter deGruyter, 149-171; Jaenicke, R. (1987) Prog. Biophys.
Molec. Biol. 49, 117.
The in vitro activation of the IgA protease preferably includes a solubilization step and a renaturation step.
The renaturation step in this process can be carried out by feeding the denatured protein continuously or discontinuously into the renaturation buffer. In this process it is.preferred that the renaturation step is carried out in the form of a discontinuous pulse renaturation.
It is particularly preferred that the renaturation step for the activation of the IgA protease is carried out in the presence of 0.2 to 1 mol/1 arginine and most preferably of 0.4 to 0.8 mol/1 arginine. In addition it is preferred that the reactivation is carried out at a pH of 5 to 9, particularly preferably at a pH of 6 to 8.
_ 6 _ 20588'72 When the IgA protease is renatured from inactive inclusion bodies active soluble protein is formed in a yield which ranges from about 10 % to over 30 %, depending on the starting material and renaturation method. Although the renaturation yield is not quantitative, nevertheless a substantially higher yield of active IgA protease is obtained with the process according to the present invention compared to conventional methods.
The present invention also concerns an IgA protease which has been produced by a process according to the present invention i.e. by activation from inclusion bodies.
In addition the invention. concerns a recombinant DNA
which codes for an IgA protease and is modified in such a way that on expression of the recombinant DNA an IgA
protease results whose C-terminal helper sequence is no longer functionally active and is preferably even completely deleted. The recombinant DNA according to the present invention is preferably additionally modified in such a way that on expression of the recombinant DNA an IgA protease is formed whose N-terminal signal sequence is no longer functionally active and especially preferably is completely deleted. Genetic engineering methods for the modification or deletion of DNA regions which lead to the desired results have already been mentioned or are so familiar to one skilled in the area of molecular biology that they do not have to be explicitly elucidated.
The present invention also concerns a recombinant vector which contains at least one copy of a recombinant DNA
according to the present invention. The recombinant DNA
_ ~ _ 20~88'~2 according to the present invention in this vector is preferably under the control of an inducible promoter.
The vector according to the present invention can be present outside the chromosome of the host cell (e.g. a plasmid) or integrated in the genome of the host cell (e.g. bacteriophage in an E. coli cell). The vector is preferably a plasmid.
The invention in addition concerns a cell which is transformed with a recombinant DNA according to the present invention or with a recombinant vector according to the present invention. This cell is preferably a prokaryotic cell and particularly preferably an E. coli cell.
The invention is further elucidated in the following by the present examples in conjunction with the sequence protocols.
SEQ. ID. NO. 1 shows the primer A used in example 1 SEQ. ID. NO. 2 shows the primer B
SEQ. ID. NO. 3 shows the primer C
SEQ. ID. NO. 4 shows the primer D
The plasmid pMAC 1 was deposited at the German Collection for Microorganisms (DSM), Griesebachstral3e 8, D-3400 Gottingen and assigned the number DSM 6261.
2058'72 E x a m p 1 a 1 Preparation of plasmid constructs for the expression of IgA protease in the form of inclusion bodies In order to express IgA protease as inclusion bodies, the region coding for the protein without signal sequence and helper sequence is cloned downstream of a strong promoter as described in the following (amino acid position + 1 to position 959, Pohlner J., Halter R., Beyreuther K., Meyer T.F., Nature 325, (1987), 458-462) .
For this chromosomal DNA is isolated from N. gonorrhoeae (e. g. MS 11) and used to carrying out a polymerase chain reaction (PCR, method cf. EP-A 0 200 362, EP-A 0 201 184). The following primers are used for the PCR.
Primer A (SEQ. ID. NO. 1L
5' GAAGAATTCGGAGGAAAAATTAATGGCACTGGTACGTGATGATGTCGATTATCAAA 3' Primer B ~SEQ. ID. NO. 2):
5' TTTTTGTAATAAAGATCTTTGCCTTG 3' The first 5 codons of the IgA protease were optimized for an efficient expression in E. coli without changing the amino acid sequence and used for primer A, which includes the ATG start codon as well as an ECo RI
recognition sequence (GAATTC).
20588'2 _ g _ Primer B contains sequences adjacent to the Bgl II
recognition sequence of the IgA protease (ca. amino acid positions 553-561). The PCR fragment (A/B = ca. 1650 bp, 5' terminal region of the IgA protease gene) obtained in this way is purified and recleaved with the enzymes ECo RI/Bgl II.
In order to prepare the 3' region of the IgA protease gene a second PCR reaction is carried out with the following primers:
Primer C ~SEQ. ID. NO. 3):
5' CAAGGCAAAGATCTTTATTACAAAAA 3' Primer D (SEQ. ID. NO. 4):
5' TTCAGCTGGTCGACTTATCACGGGGCCGGCTTGACTGGGCGGCC 3' Primer C corresponds to the coding region of primer B
(Bgl II cleavage site) and primer D contains sequences of amino acid positions 952-959 with an adjacent stop codon and a Sal I recognition sequence. The PCR fragment (C/D = 1200 bp) obtained in this way is isolated and recleaved with the enzymes Bgl II/Sal I.
Subsequently a three fragment ligation is carried out:
with the fragments A/B, the fragment C/D and the vector pKK 223-3 (DSM 3694P) which was previously digested with the enzymes Eco RI and Sal I and purified. The vector obtained in this way is denoted IgA-Prot III and is transformed in E. coli K12.
-1°- 2058872 Example 2 (comparative example) Isolation of soluble IgA protease according to the conventional method.
a) Isolation from 1 1 shaking culture E. coli K12 cells transformed with the plasmid pMACl (8878 bp) were used as the starting material. The complete coding region for IgA protease is located on this plasmid and is under the control of the lambda promoter. The plasmid carries an ampicillin resistance.
The cells were cultured in LB medium overnight at 28°C
and subsequently diluted 1:100 with LB medium. The culture was then incubated for a further 4 hours at 37°C. The cells were separated by a centrifugation step.
The culture supernatant was sterile-filtered over a cellulcse-acetate filter, dialysed against 20 mmol/1 Tris/HC1, pH 7.5, 10 mmol/1 EDTA, 10 % glycerol (buffer A) and concentrated to 1/10 its volume with the aid of a SALVIA capillary dialyser E-15U t'1' A negative elution on DEAE-Sephadex A-50~min 20 mmol/1 Tris/HC1, pH 7.5, 10 mmol/1 EDTA and 10 % glycerol was carried out as the first purification step. The column was loaded with 0.5 mg protein per 1 ml gel matrix. In this separation the IgA protease is in the eluant and most of the E. coli proteins are bound to the carrier.
Washing the column matrix again with buffer A plus 1 mol/1 NaCl showed that less than 10 0 of the IgA
protease binds to the column material.
Finally it is purified on a cation exchanger (FractogelR-EMD-S03' -650M). The protein binds in 20 mmol/1 Tris/HC1, 10 mmol/1 EDTA, 10 % glycerol pH 7Ø Then the buffer can be changed to pH 8Ø The elution is carried out with a linearly increasing NaCl gradient whereby the IgA protease is eluted with a buffer of pH 8.0 at a salt concentration of 0.1 mol/1 NaCl and with a buffer of pH 7.0 at 0.2 mol/1 NaCl.
Result:
Concentrate before DEAE-Sephadex 3.5 mg protease (70 % pure) Eluate after DEAE-Sephadex 2.4 mg protease (90 % pure) Eluate after FractogelR-EMD-S03' -650M 1 mg protease (> 95 % purity) b) Isolation of IgA protease from a 10 1 fermenter The starting material and purification were carried out analogous to example 2a).
Result:
Concentrate before DEAE-Sephadex: 50 mg IgA protease (50 % purity) Eluate after DEAE-Sephadex: 30 mg IgA protease (60 % purity) Eluate after FractogelR-EMD-S03' -650M: 12 mg IgA protease (> 95 o purity) 20~88'~2 Example 3 Isolation of IgA protease from inclusion bodies (process according to the present invention) The starting material was the construct IgA-Prot III
(example 1) in E. coli cells (DSM 3689) which additionally contain a lacIq plasmid for the expression of the lac repressor.
500 ml LB medium containing 50 ~g/ml kanamycin and 50 ~.g/ml ampicillin was prepared for the 1 1 fermentation culture. This medium was inoculated with 7.5 ml of an overnight culture which resulted in an OD550 of ca. 0.1. Then a 3 to 4 hour incubation at 37°C
was carried out while shaking (150 rpm). The cells were induced with 5 mmol/1 IPTG at an OD550 of ca. 0.8. The cells were harvested after a 4 hour incubation at 37°C
while shaking (150 rpm).
IB preparation:
The cells are harvested by centrifugation, taken up in 10 ml Tris-magnesium buffer (10 mmol/1 Tris, pH 8.0, 1 mmol/1 MgCl2) and lysed with lysozyme (0.3 mg/ml).
They are incubated for 15 minutes at 37°C and subjected to one passage of a French press (1200 psi).
Subsequently a DNAse digestion (1 mg DNAse I) is carried out for 30 minutes at 37°C.
20 ml 0.5 mol/1 NaCl, 20 mmol/1 EDTA, pH 8.0 and 3 ml 20 % Triton X l0~is added and incubated for 10 minutes at room temperature.
The suspension is centrifuged for 10 minutes at 15000 rpm and 4°C. The pellet is taken up in 30 ml 50 mmol/1 Tris, pH 8.0, 50 mmol/1 EDTA and 0.5 Triton X 100~nd treated with ultrasound. It is centrifuged again, resuspended and treated with ultrasound. This procedure is repeated for a further two times. Subsequently it is centrifuged and the pellets obtained in this way are used as IBs in example 3.
Table 1 shows the results for the fermentation in a 1 1 shaking culture and in a 10 1 fermenter.
Table 1 Fermentation E. coli Total protein IgA protease strain from IB material (%) (g) (g) 1 1 HB 101 0.125 50-70 0.06-0.09 10 1 IK12 C600 I 20.8 I30-50 6.2-10.4 It can be seen from Table 1 that 60-90 mg protease is obtained as inclusion body (IB) material from the 1 1 shaking culture. At a renaturation yield of ca. 10 this would yield 6 to 9 mg active IgA protease (compared to 3.5 mg by the conventional method).
6.2 to 10.4 g protease is obtained as IB material from the 10 1 fermenter. This would yield 620 to 1040 mg IgA
protease if l0 % is renatured (compared to 50 mg protease by the conventional method).
It can be clearly seen from these results that the process according to the present invention results in an increase in the yield of at least 2 to 3-fold (1 1 culture) or 20 to 30-fold (10 1 fermenter).
Example 4 Renaturation of the IgA protease from inclusion bodies (1 1 fermentation) The inclusion bodies were first solubilized, then dialyzed and then renatured in the respective buffers.
Solublization of the IB material:
6 mol/1 guanidine/HC1, pH 8.5 0.1 mol/1 Tris 1 mmol/1 EDTA
0.1 mol/1 dithioerythreitol (DTE) Incubation: 2 h at room temperature Vol: 10 ml, protein concentration: l0 ma/ml Dialysis of the solubilisate:
6 mol/1 guanidine/HCl, pH 3 1 mmol/1 EDTA
Duration: 12 h at room temperature against 10 1 buffer Renaturation buffer:
1) 100 mmol/1 Tris, 1 mmol/1 EDTA, 1 mmol/1 DTE, pH 8.5 2) 100 mmol/1 Tris, 1 mmol/1 EDTA, 1 mmol/1 DTE, pH 7.5 3) 20 mmol/1 Tris, 1 mmol/1 EDTA, 1 mmol/1 DTE, pH 8.0 4) 0.6 mol/1 Arg/HC1, 1 mmol/1 EDTA, 1 mmol/1 DTE, pH 8.0 5) 0.6 mol/1 Arg/HC1, 1 mmol/1 EDTA, 5 mmol/1 reduced glutathione (GSH)/0.5 mmol/1 oxidized glutathione (GSSG), pH 8 Pulse renaturation:
The denatured protein is added in 5 portions to the renaturation buffer; the time interval between the individual additions was 30 minutes and the protein concentration in the preparation increased by 20 ~,g/ml per pulse. The final protein concentration was eventually 100 ug/ml.
In order to determine the activity of the renatured IgA
protease a dialysis is carried out in cleavage buffer (50 mmol/1 Tris/HC1 pH 8, 1 mmol/1 CaCl2). Human IgA was used as the cleavage substrate. Table 2 shows the results of the cleavage experiments (incubation: 6 h at 37°C) on the renaturates obtained by using the above renaturation buffers (1-5).
Table 2 Cleavage of human IgA with IgA protease isolated according to the present example (incubation: 6 h at 37°C). The isolate obtained after the dialysis contains about 50 % IgA protease.
Renaturate Ratio Cleavage protease/substrate (%) (ug) 1 1:20 10 2 1:20 30 3 1:20 10 4/5 1:100 100 1:500 50 1:1000 30 1:2000 10 1:5000 5 soluble protease1:500 100 (100 % pure) It can be seen in Table 2 that IgA protease can be renatured in all buffers. The yields in an arginine (Arg) buffer are, however, 10 to 100-fold higher than without arginine. As a comparison the substrate was - cleaved by 100 % with soluble purified IgA protease (according to example 1) at a protease: substrate ratio of 1:500. From this a renaturation yield of ca. 50 % can be determined for buffer 4) and 5).
Example 5 Dependence of the optimization of the renaturation of IgA protease from inclusion bodies on the pH and arginine concentration Solubilization and dialysis are analogous to example 4.
Pulse renaturation: protein addition was carried out as described in example 4.
1) Determination of the renaturation yield while varying the pH value.
0.6 mol/1 Arg/HC1 1 mmol/1 EDTA
pH 4, 6, 8 2) Renaturation while varying the arginine concentration 1 mmol/1 EDTA, pH 8 1 mmol/1 DTE
Arg/HCl: 0.2; 0.4; 0.6 and 0.8 mol/1 Subsequently a dialysis was carried out at room temperature against a 100-fold volume of the cleavage buffer (50 mmol/1 Tris/HC1, pH 8, 1 mmol/1 CaCl2).
20588'72 Table 3 Cleavage of human IgA with the aid of the IgA protease isolated according to the present example. The dialysate contains about 50 to 70 % IgA protease. In the cleavage preparation 50 ~,g substrate was incubated with 1 ~.g renatured IgA protease for 6 h at 37°C.
pH % Cleavage Arginine (mol/1) % Cleavage 4 10 0.2 85 6 95 0.4 90 8 100 0.6 95 0.8 95 The optimal reactivation of the IgA protease is at a pH
of 6 to 8 and at an arginine concentration of 0.6 to 0.8 mol/1.
SEQ. ID. NO.: 1 (Primer A) TYPE OF SEQUENCE: nucleic acid single strand LENGTH OF SEQUENCE: 56 nucleotides GAAGAATTCG GAGGAAA.AAT TAATGGCACT GGTACGTGAT GATGTCGATT
ATCAAA
r 2o~s~~z SEQ. ID. NO.: 2 (Primer B) TYPE OF SEQUENCE: nucleic acid single strand LENGTH OF SEQUENCE: 26 nucleotides TTTTTGTAAT AAAGATCTTT GCCTTG
SEQ. ID. NO.: 3 (Primer C) TYPE OF SEQUENCE: nucleic acid single strand LENGTH OF SEQUENCE: 26 nucleotides CAAGGCAAAG ATCTTTATTA CAAAAA
SEQ. ID. NO.: 4 (Primer D) TYPE OF SEQUENCE: nucleic acid single strand LENGTH OF SEQUENCE: 44 nucleotides TTCAGCTGGT CGACTTATCA CGGGGCCGGC TTGACTGGGC GGCC
protease if l0 % is renatured (compared to 50 mg protease by the conventional method).
It can be clearly seen from these results that the process according to the present invention results in an increase in the yield of at least 2 to 3-fold (1 1 culture) or 20 to 30-fold (10 1 fermenter).
Example 4 Renaturation of the IgA protease from inclusion bodies (1 1 fermentation) The inclusion bodies were first solubilized, then dialyzed and then renatured in the respective buffers.
Solublization of the IB material:
6 mol/1 guanidine/HC1, pH 8.5 0.1 mol/1 Tris 1 mmol/1 EDTA
0.1 mol/1 dithioerythreitol (DTE) Incubation: 2 h at room temperature Vol: 10 ml, protein concentration: l0 ma/ml Dialysis of the solubilisate:
6 mol/1 guanidine/HCl, pH 3 1 mmol/1 EDTA
Duration: 12 h at room temperature against 10 1 buffer Renaturation buffer:
1) 100 mmol/1 Tris, 1 mmol/1 EDTA, 1 mmol/1 DTE, pH 8.5 2) 100 mmol/1 Tris, 1 mmol/1 EDTA, 1 mmol/1 DTE, pH 7.5 3) 20 mmol/1 Tris, 1 mmol/1 EDTA, 1 mmol/1 DTE, pH 8.0 4) 0.6 mol/1 Arg/HC1, 1 mmol/1 EDTA, 1 mmol/1 DTE, pH 8.0 5) 0.6 mol/1 Arg/HC1, 1 mmol/1 EDTA, 5 mmol/1 reduced glutathione (GSH)/0.5 mmol/1 oxidized glutathione (GSSG), pH 8 Pulse renaturation:
The denatured protein is added in 5 portions to the renaturation buffer; the time interval between the individual additions was 30 minutes and the protein concentration in the preparation increased by 20 ~,g/ml per pulse. The final protein concentration was eventually 100 ug/ml.
In order to determine the activity of the renatured IgA
protease a dialysis is carried out in cleavage buffer (50 mmol/1 Tris/HC1 pH 8, 1 mmol/1 CaCl2). Human IgA was used as the cleavage substrate. Table 2 shows the results of the cleavage experiments (incubation: 6 h at 37°C) on the renaturates obtained by using the above renaturation buffers (1-5).
Table 2 Cleavage of human IgA with IgA protease isolated according to the present example (incubation: 6 h at 37°C). The isolate obtained after the dialysis contains about 50 % IgA protease.
Renaturate Ratio Cleavage protease/substrate (%) (ug) 1 1:20 10 2 1:20 30 3 1:20 10 4/5 1:100 100 1:500 50 1:1000 30 1:2000 10 1:5000 5 soluble protease1:500 100 (100 % pure) It can be seen in Table 2 that IgA protease can be renatured in all buffers. The yields in an arginine (Arg) buffer are, however, 10 to 100-fold higher than without arginine. As a comparison the substrate was - cleaved by 100 % with soluble purified IgA protease (according to example 1) at a protease: substrate ratio of 1:500. From this a renaturation yield of ca. 50 % can be determined for buffer 4) and 5).
Example 5 Dependence of the optimization of the renaturation of IgA protease from inclusion bodies on the pH and arginine concentration Solubilization and dialysis are analogous to example 4.
Pulse renaturation: protein addition was carried out as described in example 4.
1) Determination of the renaturation yield while varying the pH value.
0.6 mol/1 Arg/HC1 1 mmol/1 EDTA
pH 4, 6, 8 2) Renaturation while varying the arginine concentration 1 mmol/1 EDTA, pH 8 1 mmol/1 DTE
Arg/HCl: 0.2; 0.4; 0.6 and 0.8 mol/1 Subsequently a dialysis was carried out at room temperature against a 100-fold volume of the cleavage buffer (50 mmol/1 Tris/HC1, pH 8, 1 mmol/1 CaCl2).
20588'72 Table 3 Cleavage of human IgA with the aid of the IgA protease isolated according to the present example. The dialysate contains about 50 to 70 % IgA protease. In the cleavage preparation 50 ~,g substrate was incubated with 1 ~.g renatured IgA protease for 6 h at 37°C.
pH % Cleavage Arginine (mol/1) % Cleavage 4 10 0.2 85 6 95 0.4 90 8 100 0.6 95 0.8 95 The optimal reactivation of the IgA protease is at a pH
of 6 to 8 and at an arginine concentration of 0.6 to 0.8 mol/1.
SEQ. ID. NO.: 1 (Primer A) TYPE OF SEQUENCE: nucleic acid single strand LENGTH OF SEQUENCE: 56 nucleotides GAAGAATTCG GAGGAAA.AAT TAATGGCACT GGTACGTGAT GATGTCGATT
ATCAAA
r 2o~s~~z SEQ. ID. NO.: 2 (Primer B) TYPE OF SEQUENCE: nucleic acid single strand LENGTH OF SEQUENCE: 26 nucleotides TTTTTGTAAT AAAGATCTTT GCCTTG
SEQ. ID. NO.: 3 (Primer C) TYPE OF SEQUENCE: nucleic acid single strand LENGTH OF SEQUENCE: 26 nucleotides CAAGGCAAAG ATCTTTATTA CAAAAA
SEQ. ID. NO.: 4 (Primer D) TYPE OF SEQUENCE: nucleic acid single strand LENGTH OF SEQUENCE: 44 nucleotides TTCAGCTGGT CGACTTATCA CGGGGCCGGC TTGACTGGGC GGCC
Claims (43)
1. Process for the production of recombinant IgA
protease, wherein (1) an IgA protease gene is modified in such a way that the DNA region of the IgA protease gent coding for the C-terminal helper sequence is no longer functionally active, (2) a host cell is transformed with the IgA
protease gene modified according to step (1) or with a vector containing this modified gene, (3) the modified IgA protease gene is expressed in the transformed host cell, (4) the IgA protease which forms as inclusion bodies is isolated from the host cell and (5) the IgA protease is converted into active protein by in vitro activation, said in vitro activation having a solubilization step and a renaturation step, said renaturation step being carried out in the presence of 0.2 to 1 mol/l arginine.
protease, wherein (1) an IgA protease gene is modified in such a way that the DNA region of the IgA protease gent coding for the C-terminal helper sequence is no longer functionally active, (2) a host cell is transformed with the IgA
protease gene modified according to step (1) or with a vector containing this modified gene, (3) the modified IgA protease gene is expressed in the transformed host cell, (4) the IgA protease which forms as inclusion bodies is isolated from the host cell and (5) the IgA protease is converted into active protein by in vitro activation, said in vitro activation having a solubilization step and a renaturation step, said renaturation step being carried out in the presence of 0.2 to 1 mol/l arginine.
2. Process as claimed in claim 1, wherein the IgA protease gene is modified in such a way that the C-terminal helper sequence of the IgA
protease resulting from the expression of the modified gene is completely deleted.
protease resulting from the expression of the modified gene is completely deleted.
3. Process as claimed in claim 1 or 2, wherein one or several translation stop codons are introduced into the DNA region coding for the helper sequence or the DNA region coding for the helper sequence is partially or completely deleted.
4. Process as claimed in claim 1 or 2, wherein the IgA protease gene is additionally modified in such a way that the DNA region of the IgA
protease gene coding for the N-terminal signal sequence is no longer functionally active.
protease gene coding for the N-terminal signal sequence is no longer functionally active.
5. Process as claimed in claim 3, wherein the Iga protease gene is additionally modified in such a way that the DNA region of the IgA protease gene coding for the N-terminal signal sequence is no longer functionally active.
6. Process as claimed in claim 4, wherein the IgA
protease gene is modified in such a way that the N-terminal signal sequence of the IgA
protease resulting from the expression of the modified gene is completely deleted.
protease gene is modified in such a way that the N-terminal signal sequence of the IgA
protease resulting from the expression of the modified gene is completely deleted.
7. Process as claimed in claim 5, wherein the IgA
protease gene is modified in such a way that the N-terminal signal sequence of the IgA
protease resulting from the expression of the modified gene is completely deleted.
protease gene is modified in such a way that the N-terminal signal sequence of the IgA
protease resulting from the expression of the modified gene is completely deleted.
8. Process as claimed in claim 1, 2, 5, 6 or 7, wherein a prokaryotic cell is used as the host cell.
9. Process as claimed in claim 3, wherein a prokaryotic cell is used as the host cell.
10. Process as claimed in claim 4, wherein a prokaryotic cell is used as the host cell.
11. Process as claimed in claim 8, wherein an E.
coli cell is used as the host cell.
coli cell is used as the host cell.
12. Process as claimed in claim 9, wherein an E.
coli cell is used as the host cell.
coli cell is used as the host cell.
13. Process as claimed in claim 10, wherein an E.
coli cell is used as the host cell.
coli cell is used as the host cell.
14. Process as claimed in claim 1, 2, 5, 6, 7, 9, 10, 11, 12 or 13, wherein the host cell is transformed with an IgA protease gene which is under the control of an inducible promoter.
15. Process as claimed in claim 3, wherein the host cell is transformed with an IgA protease gene which is under the control of an inducible promoter.
16. Process as claimed in claim 4, wherein the host cell is transformed with an IgA protease gene which is under the control of an inducible promoter.
17. Process as claimed in claim 8, wherein the host cell is transformed with an IgA protease gene which is under the control of an inducible promoter.
18. Process as claimed in claim 1, 2, 5, 6, 7, 9, 10, 11, 12, 13, 15, 16 or 17, wherein the in vitro activation of the Iga protease includes a solubilization step and a renaturation step.
19. Process as claimed in claim 3, wherein the in vitro activation of the Iga protease includes a solubilization step and a renaturation step.
20. Process as claimed in claim 4, wherein the in vitro activation of the Iga protease includes a solubilization step and a renaturation step.
21. Process as claimed in claim 8, wherein the in vitro activation of the Iga protease includes a solubilization step and a renaturation step.
22. Process as claimed in claim 14, wherein the in vitro activation of the Iga protease includes a solubilization step and a renaturation step.
23. Process as claimed in claim 18, wherein the renaturation step is carried out as a pulse renaturation.
24. Process as claimed in claim 19, wherein the renaturation step is carried out as a pulse renaturation.
25. Process as claimed in claim 20, wherein the renaturation step is carried out as a pulse renaturation.
26. Process as claimed in claim 21, wherein the renaturation step is carried out as a pulse renaturation.
27. Process as claimed in claim 22, wherein the renaturation step is carried out as a pulse renaturation.
28. Process as claimed in claim 18, wherein the renaturation step is carried out in the presence of 0.2 to 1 mol/l arginine.
29. Process as claimed in claim 19, 20, 21, 22, 23, 24, 25, 26 or 27, wherein the renaturation step is carried out in the presence of 0.2 to 1 mol/l arginine.
30. Process as claimed in claim 28, wherein a concentration of 0.4 to 0.8 mol/l arginine is used.
31. Process as claimed in claim 29, wherein a concentration of 0.4 to 0.8 mol/l arginine is used.
32. Process as claimed in claim 18, wherein the renaturation step is carried out at a pH of about 6 to 8.
33. Process as claimed in claim 29, wherein the renaturation step is carried out at a pH of about 6 to 8.
34. Process as claimed in claim 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 30 or 31, wherein the renaturation step is carried out at a pH of about 6 to 8.
35. Recombinant DNA which codes for an IgA
protease, wherein it is modified in such a way that when the recombinant DNA is expressed an IgA protease is formed whose C-terminal helper sequence is no longer functionally active, said recombinant DNA exhibiting deletions in the signal and helper regions.
protease, wherein it is modified in such a way that when the recombinant DNA is expressed an IgA protease is formed whose C-terminal helper sequence is no longer functionally active, said recombinant DNA exhibiting deletions in the signal and helper regions.
36. Recombinant DNA as claimed in claim 35, wherein on expression of the recombinant DNA an IgA
protease is formed whose helper sequence is completely deleted.
protease is formed whose helper sequence is completely deleted.
37. Recombinant DNA as claimed in claim 35 or 36, wherein it is additionally modified in such a way that on expression of the recombinant DNA
an IgA protease is formed whose N-terminal signal sequence is no longer functionally active.
an IgA protease is formed whose N-terminal signal sequence is no longer functionally active.
38. Recombinant DNA as claimed in claim 37, wherein on expression of the recombinant DNA an IgA
protease is formed whose signal sequence is completely deleted.
protease is formed whose signal sequence is completely deleted.
39. Recombinant vector, wherein it contains at least one copy of a recombinant DNA as claimed in claim 35, 36, 37 or 38.
40. Recombinant vector according to claim 39, wherein the recombinant DNA is under the control of an inducible promoter.
41. Cell, wherein it is transformed with a recombinant DNA as claimed in claim 35, 36, 37, 38 or with a recombinant vector wherein it contains at least one copy of a recombinant DNA which codes for an IgA protease, wherein it is modified in such a way that when the recombinant DNA is expressed an IgA protease is formed whose C-terminal helper sequence is no longer functionally active.
42. Cell as claimed in claim 41, wherein it is a prokaryotic cell.
43. Cell as claimed in claim 42, wherein it is an E. coli cell.
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DEP4100704.2 | 1991-01-11 | ||
| DE4100704 | 1991-01-11 | ||
| DE4140699A DE4140699A1 (en) | 1991-01-11 | 1991-12-10 | RECOMBINANT IGA PROTEASE |
| DEP4140699.0 | 1991-12-10 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CA2058872A1 CA2058872A1 (en) | 1992-07-12 |
| CA2058872C true CA2058872C (en) | 1999-12-21 |
Family
ID=25900194
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA002058872A Expired - Lifetime CA2058872C (en) | 1991-01-11 | 1992-01-07 | Recombinant iga protease |
Country Status (14)
| Country | Link |
|---|---|
| EP (1) | EP0495398B1 (en) |
| JP (1) | JP2509410B2 (en) |
| AT (1) | ATE174627T1 (en) |
| AU (1) | AU636261B2 (en) |
| CA (1) | CA2058872C (en) |
| DE (2) | DE4140699A1 (en) |
| DK (1) | DK0495398T3 (en) |
| ES (1) | ES2127732T3 (en) |
| FI (1) | FI103132B1 (en) |
| HU (1) | HU215188B (en) |
| IE (1) | IE914559A1 (en) |
| IL (1) | IL100623A (en) |
| NZ (1) | NZ241280A (en) |
| TW (1) | TW197470B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU3651595A (en) * | 1994-09-21 | 1996-04-09 | Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. | Drug for the prevention and treatment of auto-immune and viral diseases, and diagnostic agents for detecting said diseases |
| GB9618960D0 (en) | 1996-09-11 | 1996-10-23 | Medical Science Sys Inc | Proteases |
| JP3947653B2 (en) * | 1997-08-22 | 2007-07-25 | ロシュ ダイアグノスティックス ゲーエムベーハー | Proteolytically activatable zymogen precursors of proteases and their use |
| WO1999010483A2 (en) * | 1997-08-22 | 1999-03-04 | Roche Diagnostics Gmbh | Protease precursors that can be autocatalytically activated and their use |
| WO2001019970A2 (en) * | 1999-09-15 | 2001-03-22 | Eli Lilly And Company | Chymotrypsin-free trypsin |
| US20100261252A1 (en) * | 2009-04-10 | 2010-10-14 | Biomarin Pharmaceutical Inc. | Methods of enhancing yield of active iga protease |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE3622221A1 (en) * | 1986-07-02 | 1988-01-14 | Max Planck Gesellschaft | METHOD FOR THE GENE-TECHNOLOGICAL EXTRACTION OF PROTEINS USING GRAM-NEGATIVE HOST CELLS |
| DE3832898A1 (en) * | 1988-09-28 | 1990-04-12 | Boehringer Mannheim Gmbh | PRAEPARATE OF EXPRESSED PLASMINOGEN ACTIVATOR IN PROKARYONS |
| DK130889A (en) * | 1989-03-17 | 1990-09-18 | Mogens Kilian | IMMUNOGLOBULIN A1 PROTEASES (IGA1 PROTASES), PROCEDURES FOR GENTECHNOLOGICAL PREPARATION OF SUCH ENZYMES, AND VACCINE-CONTAINING ENZYMES AND SYMBOLS OF PROMISTS OF BACKGROUND IMMUNISTRY AND BIT |
-
1991
- 1991-12-10 DE DE4140699A patent/DE4140699A1/en not_active Withdrawn
- 1991-12-23 IE IE455991A patent/IE914559A1/en not_active IP Right Cessation
- 1991-12-31 AU AU90116/91A patent/AU636261B2/en not_active Ceased
- 1991-12-31 TW TW080110300A patent/TW197470B/zh active
-
1992
- 1992-01-07 CA CA002058872A patent/CA2058872C/en not_active Expired - Lifetime
- 1992-01-09 DK DK92100288T patent/DK0495398T3/en active
- 1992-01-09 AT AT92100288T patent/ATE174627T1/en not_active IP Right Cessation
- 1992-01-09 IL IL10062392A patent/IL100623A/en not_active IP Right Cessation
- 1992-01-09 DE DE59209590T patent/DE59209590D1/en not_active Expired - Lifetime
- 1992-01-09 ES ES92100288T patent/ES2127732T3/en not_active Expired - Lifetime
- 1992-01-09 EP EP92100288A patent/EP0495398B1/en not_active Expired - Lifetime
- 1992-01-10 JP JP4002851A patent/JP2509410B2/en not_active Expired - Lifetime
- 1992-01-10 FI FI920117A patent/FI103132B1/en active
- 1992-01-10 NZ NZ241280A patent/NZ241280A/en not_active IP Right Cessation
- 1992-01-10 HU HU9200092A patent/HU215188B/en not_active IP Right Cessation
Also Published As
| Publication number | Publication date |
|---|---|
| IE914559A1 (en) | 1992-07-15 |
| DE59209590D1 (en) | 1999-01-28 |
| JP2509410B2 (en) | 1996-06-19 |
| NZ241280A (en) | 1993-10-26 |
| JPH05168478A (en) | 1993-07-02 |
| IL100623A0 (en) | 1992-09-06 |
| ES2127732T3 (en) | 1999-05-01 |
| CA2058872A1 (en) | 1992-07-12 |
| HU215188B (en) | 1998-10-28 |
| DK0495398T3 (en) | 1999-08-23 |
| FI920117A (en) | 1992-07-12 |
| EP0495398A1 (en) | 1992-07-22 |
| FI103132B (en) | 1999-04-30 |
| TW197470B (en) | 1993-01-01 |
| FI920117A0 (en) | 1992-01-10 |
| AU9011691A (en) | 1992-09-10 |
| HU9200092D0 (en) | 1992-03-30 |
| EP0495398B1 (en) | 1998-12-16 |
| IL100623A (en) | 2002-07-25 |
| DE4140699A1 (en) | 1992-07-16 |
| HUT63654A (en) | 1993-09-28 |
| ATE174627T1 (en) | 1999-01-15 |
| FI103132B1 (en) | 1999-04-30 |
| AU636261B2 (en) | 1993-04-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US5427927A (en) | Process for the enzymatic cleavage of recombinant proteins using IgA proteases | |
| TWI773716B (en) | Mutant nitrile hydratase, nucleic acid encoding the mutant nitrile hydratase, expression vector and transformant containing the nucleic acid, production method for muntant nitrile hydratase, and production method for amide compound | |
| CA2058872C (en) | Recombinant iga protease | |
| JP7449000B2 (en) | Production of soluble recombinant proteins | |
| CN110551707A (en) | Method for purifying neutral or alkaline protease | |
| CN114107353A (en) | Plasmid for efficiently expressing polypeptide toxin and preparation method and application thereof | |
| US5965424A (en) | Methods for making neisseria or hemophilus IgA protease and DNA encoding the proteases | |
| RU2388826C2 (en) | RECOMBINANT DNA, WHICH CODES FUNCTIONALLY ACTIVE HYBRID PROTEIN GL7ACA-ACYLASE WITH CHITIN-BINDING DOMAIN (BrdGL7ACA-cbd) AND RECOMBINANT PLASMID pSVH0108, PROVIDING FOR ITS SYNTHESIS IN CELLS Escherichia coli, RECOMBINANT STRAIN Escherichia coli BL21(DE3)/pSVH0108-PRODUCER BrdGL7ACA-cbd | |
| KR910001811B1 (en) | Method for control of foreign gene expression by glucose | |
| RU2803949C1 (en) | Method for crm197 protein expression | |
| KR102613936B1 (en) | Kexin enzyme with reduced autolysis and production method thereof | |
| JP4651203B2 (en) | Novel glutaminase and method for producing the same | |
| KR100206731B1 (en) | Process for purifying serine protease using recombinant inhibitor from erythrina caffra | |
| RU2165455C1 (en) | Recombinant plasmid dna pss5 encoding synthesis of recombinant human alpha-2b interferon, strain of escherichia coli ss5 as producer of recombinant human alpha-2b interferon and method of alpha-2b interferon preparing | |
| WO2020026274A1 (en) | Process for producing mature serratiopeptidase | |
| CA2185436C (en) | Use of a recombinant inhibitor from erythrina caffra for purifying serine proteases | |
| HUT63880A (en) | Production of dna sequences encoding polygalacturonase enzyme, vectors and host cells comprising them and process for producing protein with the host cells | |
| JP2003038195A (en) | Method of obtaining useful protein from fusion protein | |
| JPH0588110B2 (en) | ||
| JPS60145090A (en) | Dna | |
| JP2003024095A (en) | Method for obtaining useful protein from fused protein | |
| JP2003024060A (en) | Method for obtaining useful protein from fusion protein | |
| MXPA01009979A (en) | Production of pancreatic procarboxy-peptidase b, isoforms and muteins thereof, and their use |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| EEER | Examination request | ||
| MKEX | Expiry |