CN110551707A - Method for purifying neutral or alkaline protease - Google Patents
Method for purifying neutral or alkaline protease Download PDFInfo
- Publication number
- CN110551707A CN110551707A CN201910989473.1A CN201910989473A CN110551707A CN 110551707 A CN110551707 A CN 110551707A CN 201910989473 A CN201910989473 A CN 201910989473A CN 110551707 A CN110551707 A CN 110551707A
- Authority
- CN
- China
- Prior art keywords
- mutant
- eglin
- eglinc
- neutral
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Enzymes And Modification Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a method for purifying neutral or alkaline protease, which comprises the steps of constructing a recombinant expression vector of an eglin C mutant by chemically synthesizing a DNA sequence for coding the eglin C mutant, carrying out recombinant expression and purification on the eglin C mutant protein by using escherichia coli, coupling the protein to sepharose4B column material, and separating and purifying the neutral or alkaline protease expressed by bacteria by using the specific combination of the eglin C mutant and the protease. The affinity purification system constructed by the eglin C mutant has the advantages of simple method, few operation steps, low enzyme activity loss and high purification multiple.
Description
Technical Field
the invention relates to the field of biology, in particular to a method for purifying neutral or alkaline protease.
Background
protease is a proteolytic enzyme that catalyzes the hydrolysis of peptide bonds in proteins. The protease is divided into different types of protease according to different standards, and the protease can be divided into serine protease, thiol protease, metalloprotease and aspartic protease according to the active center and the optimal pH value; according to the optimum pH value of the reaction, the protease can be divided into acid protease, neutral protease and alkaline protease; of course, they can be classified according to their origin, such as papain, bromelain, etc. The protease is an important industrial enzyme and is widely applied to the industries of washing, food, medicine, leather making and the like. In particular, the method is mainly used for producing enzymatic washing powder and the like in the washing industry; the method is mainly used for preparing soybean hydrolyzed polypeptide, hydrolyzed yeast and processing leftovers of meat products in the food industry, and the protein utilization rate is improved; can be used in the leather industry to treat raw material for depilation and softening; can be used for extracting heparin, chondroitin sulfate and the like in the pharmaceutical industry. Neutral proteases and alkaline proteases are the first and the largest two types of proteases used industrially, and are mostly produced by microorganisms, most commonly by Bacillus and the like.
The natural eglinC is derived from leeches, belongs to chymotrypsin inhibitors and can inhibit activities of chymotrypsin, cathepsin, elastase and the like. eglin C has only one polypeptide chain containing 70 amino acids, has higher homology with trypsin inhibitor of potato type I, does not contain disulfide bonds, and has very good acid resistance and heat resistance.
At present, the separation and purification of neutral protease or alkaline protease generally needs ammonium sulfate precipitation, ion exchange chromatography or hydrophobic chromatography, and finally gel filtration to obtain the electrophoresis pure protease preparation. The method has the advantages of multiple purification steps, long time consumption, high cost and improved purification efficiency, thereby becoming an important factor for restricting the high-end protease preparation product.
Disclosure of Invention
in view of the above, the present invention aims to provide a method for purifying neutral or alkaline protease, which utilizes the specific binding between eglinC mutant and protease to separate and purify neutral or alkaline protease expressed by bacteria, and has the advantages of simple method, few operation steps, low enzyme activity loss, high purification fold and the like.
in order to achieve the purpose, the technical scheme is as follows:
in a first aspect, there is provided a method of purifying a neutral or alkaline protease, comprising the steps of:
1) Chemical synthesis of eglin c protein: chemically synthesizing an amino acid sequence encoding an eglin C mutant as shown in SEQ ID No: 1, wherein the eglinC mutant is a truncated eglinC protein, in particular to a residue sequence of Thr-Glu-Phe-Gly-Ser-Glu-Leu amino acids at positions 1-7 of the N end of the eglinC protein;
2) Gene optimization: according to SEQ ID No: 1, and chemically synthesizing a DNA sequence for coding an eglin C mutant after optimization, wherein the DNA sequence is shown as SEQ ID No: 2 is shown in the specification;
3) Constructing a recombinant vector: constructing a recombinant expression vector of the eglinC mutant and escherichia coli;
4) Recombinant expression: transferring the constructed recombinant expression vector into escherichia coli BL21, and performing induced expression by IPTG to obtain the recombinant protein of eglinC;
5) Separation and purification: preparing a purified recombinant protein of eglinC;
6) preparation of the mutant affinity column and its use in purification of neutral or alkaline protease: and (3) connecting the purified recombinant protein of the eglin C to sepharose4B column material to obtain an eglin C mutant affinity column, and purifying neutral protease or alkaline protease by using the eglin C mutant affinity column.
in a second aspect, according to the method for purifying a neutral or alkaline protease of the first aspect, the amino acid sequence of step 2) is codon-optimized, and then a DNA sequence suitable for expression in e.
In a third aspect, the method for purifying a neutral or alkaline protease according to the first aspect, wherein the recombinant expression vector in step 3) is: the DNA sequence of the synthesized eglinC mutant was digested with NdeI and BamHI, and ligated to pET3a vector digested with the same enzyme, to construct pET3a-eglinC recombinant expression vector.
In a fourth aspect, according to the method for purifying neutral or alkaline protease of the first aspect, the recombinant expression vector of step 3) is constructed by ligating the DNA sequence of the synthesized eglin C mutant to a vector with or containing 6 histidine-Tag His 6 -Tag.
In a fifth aspect, the vector with or containing 6 histidine tags is pQE30 vector, the DNA sequence of the synthesized eglinC mutant is digested with HindIII and BamHI, and is connected to the same digested pQE30 vector to construct pQE30-eglinC recombinant expression vector according to the fourth aspect.
In a sixth aspect, according to the method for purifying neutral or alkaline protease described in the first aspect, the constructed recombinant expression vector is transferred into escherichia coli BL21 in the step 4), the escherichia coli Ecoil.BL21 is transferred by CaCl 2 heat shock transfection method, an LB plate containing 100 mug/ml Amp is coated, a single colony is picked up in an LB culture medium containing 100 mug/ml Amp, seed liquid is cultured overnight, then LB is inoculated with 1% -5% inoculum size, when the thallus growth OD600nm reaches 0.8-1.0, IPTG is added for induction, the concentration of an inducer is 0.8-1mM, the induction temperature is 37 ℃, and after 5-7 hours of induction, the recombinant protein of eglin C is obtained.
In a seventh aspect, according to the method for purifying a neutral or alkaline protease of the third aspect, the recombinant protein of eglinC prepared by using the pET3a-eglinC recombinant expression vector is an eglinC mutant protein, and the amino acid sequence of the recombinant protein is the same as that of the eglinC mutant.
In an eighth aspect, the recombinant protein of eglinC prepared by using the recombinant expression vector of 6 histidine-tagged eglinC mutants is His 6 -Tag-eglinC mutant protein according to the method for purifying neutral or alkaline protease of the fourth aspect.
In a ninth aspect, according to the method for purifying neutral or alkaline protease of the third aspect, the Sepharose4B column material is CNBr-Sepharose4B column material.
In a tenth aspect, the sepharose4B column material is Ni 2+ -sepharose4B column material according to the method of the fourth aspect for purifying a neutral or alkaline protease.
Has the advantages that: the method has the advantages of simple method, few operation steps, low enzyme activity loss, high purification multiple and the like, and can obtain the protease with 85 percent electrophoretic purity in one step by recombining, expressing and purifying the truncated eglin C protein, coupling the truncated eglin C protein to an inert medium Sepharose4B to be used as an affinity ligand of the protease, utilizing the specific combination of the eglin C mutant and the protease to enrich the protease, and then increasing the salt ion concentration to 1M to elute the protease.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the description of the embodiments are briefly introduced below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings based on these drawings without creative efforts.
FIG. 1 is a diagram of the isolation and purification of the eglinC mutant protein of example 1
Wherein, lane 1: pET3a-Eglinc/BL21 whole bacterium; lane 2: ultrasonically crushing a supernatant by pET3 a-Eglinc; lane 3: DEAE-Sepharose Fast Flow chromatographic column binding sample; lane 4: DEAE-Sepharose Fast Flow layer column penetration sample; lane 5: superdex-75 eluate;
FIG. 2 is a chart showing the results of SDS-PAGE electrophoretic evaluation of the purification of neutral protease and alkaline protease in example 2
Wherein, lane 1: crude alkaline protease; lane 2: penetrating a sample; lane 3: 50mM Tris, 100mM NaCl (pH 7.5) eluate; lane 4: 20mM boric acid Buffer, 1M NaCl (pH 6.9) elute; lane 5: a crude product of neutral protease; lane 6: breakthrough sample lane 7: 50mM Tris, 100mM NaCl (pH 7.5) eluate; lane 8: 20mM boric acid Buffer, 1M NaCl (pH 6.9).
Detailed Description
It is to be understood that the scope of the invention is not to be limited to the specific embodiments described below; it is also to be understood that the terminology used in the examples is for the purpose of describing particular embodiments, and is not intended to limit the scope of the present invention; in the description and claims of the present application, the singular forms "a", "an" and "the" include plural references unless the context clearly dictates otherwise.
When numerical ranges are given in the examples, it is understood that both endpoints of each of the numerical ranges and any value therebetween can be selected unless the invention otherwise indicated. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition to the specific methods, devices, and materials used in the examples, any methods, devices, and materials similar or equivalent to those described in the examples may be used in the practice of the invention in addition to the specific methods, devices, and materials used in the examples, in keeping with the knowledge of one skilled in the art and with the description of the invention.
Unless otherwise indicated, the experimental methods, detection methods, and preparation methods disclosed herein all employ techniques conventional in the art of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related arts.
The first aspect of the present specification provides a method for purifying a neutral or alkaline protease, comprising the steps of:
1) Chemical synthesis of eglin c protein: chemically synthesizing an amino acid sequence encoding an eglin C mutant as shown in SEQ ID No: 1 (the specific sequence is Lys Ser Phe Pro Glu Val Val Gly Lys Thr Val Asp Gln AlaArg Glu Tyr Phe Thr Leu His Tyr Pro Gln Tyr Asp Val Tyr Phe Leu Pro Glu GlySer Pro Val Thr Leu Asp Leu Arg Tyr Asn Arg Val Arg Val Phe Tyr Asn Pro GlyThr Asn Val Val Asn His Val Pro His Val Gly), wherein the eglinC mutant is a truncated eglinC protein, and specifically is a residue sequence of Thr-Glu-Phe-Gly-Ser-Glu-Leu amino acid at the 1-7 position of the N end of the eglinC protein;
2) gene optimization: according to SEQ ID No: 1, and chemically synthesizing a DNA sequence for coding an eglin C mutant after optimization, wherein the DNA sequence is shown as SEQ ID No: 2 (specific sequence: aaatctttcc cagaagttgt tggtaaaactgttgaccagg ctcgtgaata cttcactctg cattacccgc agtacgacgt ttacttcctg ccggaaggttctcctgttac tctggacctg cgttacaacc gtgttcgt gttttctaca acccaggtac taacgttgttaaccatgttc cgcatgttggg);
3) Constructing a recombinant vector: constructing a recombinant expression vector of the eglinC mutant and escherichia coli;
4) Recombinant expression: transferring the constructed recombinant expression vector into escherichia coli BL21, and performing induced expression by IPTG to obtain the recombinant protein of eglinC;
5) separation and purification: preparing a purified recombinant protein of eglinC;
6) Preparation of the mutant affinity column and its use in purification of neutral or alkaline protease: and (3) connecting the purified recombinant protein of the eglin C to sepharose4B column material to obtain an eglin C mutant affinity column, and purifying neutral protease or alkaline protease by using the eglin C mutant affinity column.
In the second embodiment of the present specification, according to the method for purifying a neutral or alkaline protease of the first embodiment, the amino acid sequence in step 2) is codon-optimized and then a DNA sequence suitable for expression in e.
In a third embodiment of the present specification, the method for purifying a neutral or alkaline protease according to the first embodiment, wherein the recombinant expression vector in the step 3) is: the DNA sequence of the synthesized eglinC mutant was digested with NdeI and BamHI, and ligated to pET3a vector digested with the same enzyme, to construct pET3a-eglinC recombinant expression vector.
In a fourth embodiment of the present specification, the recombinant expression vector in step 3) is a recombinant expression vector constructed by ligating the DNA sequence of the synthesized eglinC mutant to a vector having or containing 6 histidine-Tag His 6 -Tag to construct a recombinant expression vector of 6 histidine-Tag-containing eglinC mutant according to the method of the first embodiment.
In the fifth embodiment of the present specification, the vector with or containing 6 histidine tags is pQE30 vector, the DNA sequence of the synthesized eglinC mutant is digested with HindIII and BamHI, and ligated to the same digested pQE30 vector to construct pQE30-eglinC recombinant expression vector.
In the sixth embodiment of the present specification, according to the method for purifying neutral or alkaline protease of the first embodiment, in the step 4), the constructed recombinant expression vector is transferred into escherichia coli BL21, the escherichia coli ecoil.bl21 is transferred by CaCl 2 heat shock transfection, an LB plate containing 100 μ g/ml Amp is coated, a single colony is selected in an LB medium containing 100 μ g/ml Amp, the seed solution is cultured overnight, then LB is inoculated with 1% -5% of inoculum size, when the bacterial growth OD600nm reaches 0.8-1.0, IPTG is added for induction, the inducer concentration is 0.8-1mM, the induction temperature is 37 ℃, and the induction time is 5-7 hours, so as to obtain the recombinant protein of egglin c.
According to the seventh scheme of the specification, the recombinant protein of eglin C prepared by using the pET3a-eglin C recombinant expression vector is an eglin C mutant protein, and the amino acid sequence of the recombinant protein is the same as that of the eglin C mutant according to the method for purifying the neutral or alkaline protease described in the third scheme.
in the eighth embodiment of the present specification, the recombinant protein of eglinC prepared by using the recombinant expression vector of 6 histidine-tagged eglinC mutants according to the method for purifying neutral or alkaline protease of the fourth embodiment is His 6 -Tag-eglinC mutant protein.
In the ninth embodiment of the present specification, the Sepharose4B column material is CNBr-Sepharose4B column material according to the method for purifying neutral or alkaline protease of the third embodiment.
Tenth aspect of the present specification, the sepharose4B column material is Ni 2+ -sepharose4B column material according to the method for purifying a neutral or alkaline protease of the fourth aspect.
The above technical solution of the present invention will be described in more detail with reference to specific examples.
Example 1: a method for purifying a neutral or alkaline protease, comprising the steps of:
1) Chemical synthesis of eglin C protein
According to the protein sequence of Hirudo aquaticum XD0802.1(Hirudo medicinalis) in GeneBank, simultaneously deleting Thr Glu Phe Gly Ser Glu Leu from the 1-7 position at the N end of the eglin C protein to obtain the amino acid sequence of the eglin C mutant;
2) Gene optimization
According to the amino acid sequence of the eglinC mutant, the https: jsp website, optimizing the DNA sequence of the eglinC mutant which is beneficial to the expression of the Escherichia coli, and adding NdeI and BamHI enzyme cutting sites at two ends of the DNA sequence of the eglinC mutant.
3) Recombinant vector construction
The DNA sequence of the synthesized eglin C mutant is cut by Nde I and BamHI, and is connected to pET3a vector cut by the same enzyme, and the pET3a-eglin C recombinant expression vector is obtained after the sequencing is correct.
4) Recombinant expression
Transferring a successfully constructed pET3a-eglin C recombinant expression vector into Escherichia coli Ecoil.BL21 by using a CaCl 2 heat shock transfection method, coating an LB plate containing 100 mu g/ml Amp, selecting a single colony to an LB culture medium containing 100 mu g/ml Amp, culturing a seed solution overnight, then inoculating LB with an inoculation amount of 1-5%, adding IPTG (isopropyl-beta-thiogalactoside) for induction when the OD 600nm of the thallus growth reaches 0.8-1.0, wherein the concentration of an inducer is 0.8-1mM, the induction temperature is 37 ℃, and the induction time is 5-7 hours to obtain the eglin C mutant protein.
5) Separating and purifying
Suspending the Escherichia coli containing the eglin C mutant protein obtained by culturing in the step 4) with 20ml of Tris-HCl buffer solution with pH 8.050mM per liter, carrying out ultrasonication according to the conventional operation, centrifuging at the high speed of 13000rpm at 4 ℃ for 30min, collecting supernatant, loading a DEAE-sephaseFF ion column balanced by the same buffer solution, collecting a penetrated protein sample, concentrating the protein, loading the protein on a Superdex75 gel column balanced by 100mM Na 2 HPO 4 -NaH 2 PO 4 and pH8.0 buffer solution, and collecting the eglin C mutant protein to obtain 80% electrophoretically pure eglin C mutant protein, wherein the EGlin C mutant protein is shown in figure 1.
6) Preparation of Sepharose4B-eglin C mutant affinity column and application thereof in purifying neutral or alkaline protease
CNBr-Sepharose-4B column material was first swollen with deionized water at 4 ℃ for 24 hours, degassed, packed in a column, washed 5 bed volumes with 1mM 4 ℃ pre-cooled HCl, the purified eglin C mutant protein was coupled to CNBr-Sepharose4B column material under pH 8.0100 mM NaHCO 3,500mM NaCl buffer, 100mM Tris-HCl blocked the excess coupling groups of the CNBr-Sepharose4 support, the Sepharose4B-eglin C mutant affinity column was then washed alternately with 100mM acetate buffer pH4 containing 500mM NaCl and 100mM phosphate buffer, and finally the column was equilibrated with pH8.0, 50mM Tris-HCl,500mM NaCl.
then, the bacterial alkaline protease or neutral protease solution and Sepharose4B-eglin C mutant affinity column, 4 degrees C standing, after 30 minutes incubation, discharging the unbound protein solution, using pH8.0, 50mM Tris-HCl,500mM NaCl buffer washing 1-2 column bed volume, then using pH8.0, 50mM Tris-HCl containing 1-1.5M NaCl buffer elution protease, protease purity analysis is shown in figure 2.
Example 2: a method for purifying a neutral or alkaline protease, comprising the steps of:
1) chemical synthesis of eglin C protein
According to the protein sequence of Hirudo aquaticum XD0802.1(Hirudo medicinalis) in GeneBank, simultaneously deleting Thr Glu Phe Gly Ser Glu Leu from the 1-7 position at the N end of the eglin C protein to obtain the amino acid sequence of the eglin C mutant;
2) gene optimization
At https: jsp website, optimizing the DNA sequence of the eglinC mutant which is beneficial to the expression of the Escherichia coli, and adding NdeI and BamHI enzyme cutting sites at two ends of the DNA sequence of the eglinC mutant.
3) Recombinant vector construction
The DNA sequence of the synthesized eglinC mutant is cut by HindIII and BamHI and is connected to pQE30 vector after the same enzyme cutting, so as to construct pQE30-eglinC recombinant expression vector and pQE30-eglinC recombinant expression vector.
4) Recombinant expression
Transferring a successfully constructed pQE30-eglinC recombinant expression vector into Escherichia coli Ecol.BL21 by using a CaCl 2 heat shock transfection method, coating an LB plate containing 100 mu g/ml Amp, selecting a single colony to an LB culture medium containing 100 mu g/ml Amp, culturing a seed solution overnight, then inoculating LB with an inoculation amount of 1-5%, adding IPTG (isopropyl-beta-thiogalactoside) for induction when the OD 600nm reaches 0.8-1.0, wherein the concentration of an inducer is 0.8-1mM, the induction temperature is 37 ℃, and the His 6 -Tag-eglinC mutant protein is obtained after the induction time is 5-7 hours.
5) Separating and purifying
Suspending the Escherichia coli thallus containing the His 6 -Tag-eglinC mutant protein cultured in the step 4) by using 20ml of Tris-HCl 500mM NaCl 5mM imidazole buffer solution with pH 8.050mM per liter of fermentation bacteria, carrying out ultrasonic disruption according to the conventional operation, centrifuging at the high speed of 13000rpm at 4 ℃ for 30min, collecting supernatant, loading the Escherichia coli thallus to an Ni 2+ -sepharose4B column affinity column balanced by the same buffer solution, collecting the final eluted protein, concentrating the eluted protein, loading the eluate to a Superdex75 gel column balanced by the same buffer solution, collecting the His 6 -Tag-eglinC mutant protein, and obtaining the electrophoretically pure His 6 -Tag-eglinC mutant protein.
6) Preparation of Sepharose4B-eglin C mutant affinity column and application thereof in purifying neutral or alkaline protease
firstly, purified His 6 -Tag-eglinC mutant protein is combined on Ni 2+ -sepharose4B column material under the conditions of pH8.050mM Tris-HCl and 500mM NaCl buffer solution to construct a Ni 2+ -sepharose4B-His 6 -Tag-eglinC mutant affinity column.
Then, a crude sample of neutral protease or a crude sample of alkaline protease is applied to the constructed Ni 2+ -sepharose4B-His 6 -Tag-eglin C mutant affinity column, left to stand at 4 ℃ and incubated for 30 minutes, and after discharging the unbound protein solution, the column is washed with a buffer solution of pH8.050mMTris-HCl and 500mMNaCl for 1-2 column volumes, and then the protease is eluted with a buffer solution of pH8.050mMTris-HCl containing 1-1.5M NaCl.
The results of comparison between example 1 and example 2 are shown in Table 1, in example 1, the eglin C mutant protein is linked to CNBr-Sepharose4B column material through covalent bond, and is more stable than the His 6 -Tag-eglin C mutant protein in example 2 is linked to Ni 2+ -Sepharose4B column material, therefore, the Sepharose4B-eglin C mutant affinity column prepared in example 1 is more stable than the Ni 2+ -Sepharose4B-His 6 -Tag-eglin C mutant affinity column prepared in example 2, and has better purification effect on protease.
TABLE 1 comparative results
The above examples are merely illustrative for clearly illustrating the present invention and are not intended to limit the present invention. Any person skilled in the art can modify or change the above-mentioned embodiments without departing from the spirit and scope of the present invention. Accordingly, it is intended that all equivalent modifications or changes which can be made by those skilled in the art without departing from the spirit and technical spirit of the present invention be covered by the claims of the present invention.
Claims (10)
1. A method for purifying a neutral or alkaline protease, comprising the steps of:
1) Chemical synthesis of eglin c protein: chemically synthesizing an amino acid sequence encoding an eglin C mutant as shown in SEQ ID No: 1, wherein the eglinC mutant is a truncated eglinC protein, in particular to a residue sequence of Thr-Glu-Phe-Gly-Ser-Glu-Leu amino acids at positions 1-7 of the N end of the eglinC protein;
2) Gene optimization: according to SEQ ID No: 1, and chemically synthesizing a DNA sequence for coding an eglin C mutant after optimization, wherein the DNA sequence is shown as SEQ ID No: 2 is shown in the specification;
3) Constructing a recombinant vector: constructing a recombinant expression vector of the eglinC mutant and escherichia coli;
4) Recombinant expression: transferring the constructed recombinant expression vector into escherichia coli BL21, and performing induced expression by IPTG to obtain the recombinant protein of eglinC;
5) separation and purification: preparing a purified recombinant protein of eglinC;
6) preparation of the mutant affinity column and its use in purification of neutral or alkaline protease: and (3) connecting the purified recombinant protein of the eglin C to sepharose4B column material to obtain an eglin C mutant affinity column, and purifying neutral protease or alkaline protease by using the eglin C mutant affinity column.
2. The method of claim 1, wherein the neutral or alkaline protease is selected from the group consisting of: and (3) chemically synthesizing a DNA sequence suitable for being expressed in escherichia coli after the amino acid sequence in the step 2) is subjected to codon optimization.
3. the method of claim 1, wherein the neutral or alkaline protease is selected from the group consisting of: the recombinant expression vector in the step 3) is as follows: the DNA sequence of the synthesized eglinC mutant was digested with NdeI and BamHI, and ligated to pET3a vector digested with the same enzyme, to construct pET3a-eglinC recombinant expression vector.
4. The method of claim 1, wherein the recombinant expression vector of step 3) is constructed by ligating the DNA sequence of the synthesized eglin C mutant to a vector containing or containing 6 histidine-Tag His 6 -Tag.
5. the method of claim 4, wherein the neutral or alkaline protease is selected from the group consisting of: the vector with or containing 6 histidine tags is a pQE30 vector, the DNA sequence of the synthesized eglinC mutant is subjected to HindIII and BamHI enzyme digestion and is connected to a pQE30 vector subjected to the same enzyme digestion, and a pQE30-eglinC recombinant expression vector is constructed.
6. the method for purifying neutral or alkaline protease as claimed in claim 1, wherein the recombinant expression vector constructed in step 4) is transferred into Escherichia coli BL21, transferred into Escherichia coli Ecoil.BL21 by CaCl 2 heat shock transfection method, coated with LB plate containing 100 μ g/ml Amp, picked into LB culture medium containing 100 μ g/ml Amp, cultured overnight to obtain seed solution, inoculated with LB in 1% -5% inoculum size, when the thallus growth OD600nm reaches 0.8-1.0, added with IPTG to induce inducer concentration of 0.8-1mM, induction temperature of 37 ℃, and induction time of 5-7 hours to obtain recombinant protein of eglin C.
7. a method of purifying a neutral or alkaline protease according to claim 3, characterized in that: the recombinant protein of eglin C prepared by adopting the pET3a-eglin C recombinant expression vector is eglin C mutant protein, and the amino acid sequence of the recombinant protein is the same as that of the eglin C mutant.
8. The method for purifying neutral or alkaline protease according to claim 4, wherein the recombinant protein of eglinC prepared by using the recombinant expression vector of 6 histidine-tagged eglinC mutants is His 6 -Tag-eglinC mutant protein.
9. a method of purifying a neutral or alkaline protease according to claim 3, characterized in that: the Sepharose4B column material is CNBr-Sepharose4B column material.
10. The method of claim 4, wherein the sepharose4B column material is Ni 2+ -sepharose4B column material.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910989473.1A CN110551707A (en) | 2019-10-17 | 2019-10-17 | Method for purifying neutral or alkaline protease |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910989473.1A CN110551707A (en) | 2019-10-17 | 2019-10-17 | Method for purifying neutral or alkaline protease |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110551707A true CN110551707A (en) | 2019-12-10 |
Family
ID=68743274
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910989473.1A Pending CN110551707A (en) | 2019-10-17 | 2019-10-17 | Method for purifying neutral or alkaline protease |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110551707A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111500561A (en) * | 2020-05-08 | 2020-08-07 | 江南大学 | Method for improving extraction efficiency of intracellular pullulanase |
| CN113999832A (en) * | 2021-11-30 | 2022-02-01 | 上海市农业科学院 | Neutral protease of straw mushroom fruiting body, extraction and purification method and application thereof |
| CN114292833A (en) * | 2021-11-30 | 2022-04-08 | 上海市农业科学院 | Method for extracting and purifying protease from straw mushroom fruiting body |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4636489A (en) * | 1983-07-07 | 1987-01-13 | Plantorganwerk Kg | Modified protease inhibitors, process for their preparation, and pharmaceutical compositions prepared therefrom |
| CN1802432A (en) * | 2003-04-23 | 2006-07-12 | 赫希玛有限公司 | Insect chymotrypsin and inhibitors thereof |
| CN109942700A (en) * | 2019-03-21 | 2019-06-28 | 山西大学 | A kind of recombinant type buckwheat trypsase inhibitor mutant and trypsase affinitive material |
-
2019
- 2019-10-17 CN CN201910989473.1A patent/CN110551707A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4636489A (en) * | 1983-07-07 | 1987-01-13 | Plantorganwerk Kg | Modified protease inhibitors, process for their preparation, and pharmaceutical compositions prepared therefrom |
| CN1802432A (en) * | 2003-04-23 | 2006-07-12 | 赫希玛有限公司 | Insect chymotrypsin and inhibitors thereof |
| CN109942700A (en) * | 2019-03-21 | 2019-06-28 | 山西大学 | A kind of recombinant type buckwheat trypsase inhibitor mutant and trypsase affinitive material |
Non-Patent Citations (3)
| Title |
|---|
| BATRA,J.等: "Chain B, Eglin C,登录号：PDB:4H4F_B", 《GENBANK》 * |
| DESILETS,A.等: "Inhibition of human matripatase by eglin c variants", 《FEBS LETTERS》 * |
| LU,W.Y.等: "Deciphering the role of the electrostatic interactions involving Gly70 in eglin C by total chemical protein systhesis", 《BIOCHEMISTRY》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111500561A (en) * | 2020-05-08 | 2020-08-07 | 江南大学 | Method for improving extraction efficiency of intracellular pullulanase |
| CN111500561B (en) * | 2020-05-08 | 2022-12-02 | 江南大学 | Method for improving extraction efficiency of intracellular pullulanase |
| CN113999832A (en) * | 2021-11-30 | 2022-02-01 | 上海市农业科学院 | Neutral protease of straw mushroom fruiting body, extraction and purification method and application thereof |
| CN114292833A (en) * | 2021-11-30 | 2022-04-08 | 上海市农业科学院 | Method for extracting and purifying protease from straw mushroom fruiting body |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Bressollier et al. | Purification and characterization of a keratinolytic serine proteinase from Streptomyces albidoflavus | |
| CN110551707A (en) | Method for purifying neutral or alkaline protease | |
| CN108118041B (en) | Phospholipase D mutant, recombinant genetic engineering bacterium, and preparation methods and applications thereof | |
| Ursinus et al. | Purification and properties of a membrane-bound lytic transglycosylase from Escherichia coli | |
| CN108410890A (en) | Xylanase gene, recombinant expression plasmid, recombinant strains, zytase and its preparation method and application | |
| Takeshita et al. | A small chimerically bifunctional monomeric protein: Tapes japonica lysozyme | |
| Sidhu et al. | Streptomyces griseus protease C. A novel enzyme of the chymotrypsin superfamily. | |
| Ding et al. | Over-expression of a proline specific aminopeptidase from Aspergillus oryzae JN-412 and its application in collagen degradation | |
| Lo et al. | Bacillus subtilis β-1, 4-endoglucanase products from intact and truncated genes are secreted into the extracellular medium by Escherichia coli | |
| CN107164349A (en) | A kind of thermophilic neutral protease gene, engineering bacteria, enzyme and its application | |
| CN110423787B (en) | Preparation method of uniform brown algae trisaccharide | |
| Suzuki et al. | Gene cloning, overproduction, and characterization of thermolabile alkaline phosphatase from a psychrotrophic bacterium | |
| US11739311B2 (en) | Gene recombinant vector, genetically engineered strain and preparation method of collagenase | |
| CN112852788B (en) | Subtilisin E mutant with improved alkaline substrate selectivity and application thereof | |
| JP7011132B2 (en) | New chitosanase CHI1, its coding gene and its use | |
| CA2058872C (en) | Recombinant iga protease | |
| CN111607580B (en) | Chitosanase CHI3, encoding gene thereof and preparation method thereof | |
| CN109251913B (en) | A kind of mannosan enzyme mutant DeP41P42 and its application | |
| Yao et al. | DNA shuffling of aprE genes to increase fibrinolytic activity and thermostability | |
| KR0180103B1 (en) | Thrombosis dissolution enzyme from bacillus subtilis | |
| Tamura et al. | Mass production of sphingomyelinase of Bacillus cereus by a protein-hyperproducing strain, Bacillus brevis 47, and its purification | |
| García-Orozco et al. | Recombinant bacterial expression of the lysozyme from the tobacco-hornworm Manduca sexta with activity at low temperatures | |
| CN1141395C (en) | Prepn of metallothionein | |
| CN116286755B (en) | Expression and purification method and application of batroxobin | |
| CN110066814B (en) | beta-D-glucosidase gene and encoding protein thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |