CN109251913B - A kind of mannosan enzyme mutant DeP41P42 and its application - Google Patents

A kind of mannosan enzyme mutant DeP41P42 and its application Download PDF

Info

Publication number
CN109251913B
CN109251913B CN201811444527.8A CN201811444527A CN109251913B CN 109251913 B CN109251913 B CN 109251913B CN 201811444527 A CN201811444527 A CN 201811444527A CN 109251913 B CN109251913 B CN 109251913B
Authority
CN
China
Prior art keywords
ala
asp
gly
leu
arg
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201811444527.8A
Other languages
Chinese (zh)
Other versions
CN109251913A (en
Inventor
张蕊
黄遵锡
周峻沛
朱虹
韩楠玉
丁俊美
许波
唐湘华
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Yunnan Normal University
Original Assignee
Yunnan Normal University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yunnan Normal University filed Critical Yunnan Normal University
Priority to CN201811444527.8A priority Critical patent/CN109251913B/en
Publication of CN109251913A publication Critical patent/CN109251913A/en
Application granted granted Critical
Publication of CN109251913B publication Critical patent/CN109251913B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2477—Hemicellulases not provided in a preceding group
    • C12N9/2488—Mannanases
    • C12N9/2491—Beta-mannosidase (3.2.1.25), i.e. mannanase
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K20/00—Accessory food factors for animal feeding-stuffs
    • A23K20/10—Organic substances
    • A23K20/189—Enzymes
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L29/00—Foods or foodstuffs containing additives; Preparation or treatment thereof
    • A23L29/06—Enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01025—Beta-mannosidase (3.2.1.25), i.e. mannanase

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Polymers & Plastics (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Husbandry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Nutrition Science (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to genetic engineering and protein renovation technique field, a kind of mannosan enzyme mutant DeP41P42 and its application are disclosed, the amino acid sequence of mutant DeP41P42 is as shown in SEQ ID NO.1.The optimal pH of mutant DeP41P42 is 6.0；Optimum temperature is 45 DEG C；50 DEG C of half-life period is 60min；Compared with wild enzyme, mutant DeP41P42 optimum temperature improves 10 DEG C, and 50 DEG C of half-life period improves 4 times.Mannosan enzyme mutant of the invention is more advantageous to be promoted and applied in the industries such as aquatic feeds and food.

Description

A kind of mannosan enzyme mutant DeP41P42 and its application
Technical field
The invention belongs to gene engineering technology fields, are related to protein renovation technique, and specially a kind of mannase is prominent Modification D eP41P42 and its application.
Background technique
Mannosan is the second largest component of hemicellulose in nature, by mannopyranose with β-Isosorbide-5-Nitrae glucosides key connection It forms, is widely present in the cell wall of higher plant and some algaes.Mannosan is a kind of complicated glycan, thorough Bottom degradation needs the collaboration of mannonase mannosidase, glucuroide, galactosidase and deacetylated Esterified Enzyme to make With.Mannase is the key enzyme of mannosan degradation process.Mannase is that one kind is capable of the interior of hydrolyzing mannan Glycoside hydrolase is cut, catabolite is mostly manna oligosacchride.(Sri vastava PK et al.Biotechnology Advances,2017,35:1–19.)。
Enzyme preparation with low temperature active mannase can be used for aquaculture, food fermentation and manufacture field etc., tool There are important Development volue (Cavicchioli et al.Microbial Biotechnology, 2011,4 (4): 449- 460.).The active mannase of representative cryogenic, (general > 50 DEG C) the active very low or loss of activity, thermostabilization under high temperature Property is poor, greatly limits its application.Therefore, being improved using protein engineering has the resistance to of low temperature active mannase The hot application be conducive in the fields such as aquaculture and food processing.
The present invention (forms stabilization based on polypeptide chain using the difference and the prediction of intrinsic disordering protein domain of amino acid composition Engagement capacity calculation method), design and screened a kind of mannosan enzyme mutant, mannosan enzyme mutant obtained DeP41P42, Temperature Activity and heat resistance significantly improve.
Summary of the invention
In view of the above technical problems, the purpose of the present invention is intended to provide a kind of mannosan enzyme mutant and its application, mentions Height has the thermal activities and heat resistance of low temperature active mannase, can be applied to the fields such as aquatic feeds or food.
In order to reach above-mentioned technical purpose, the present invention is realized especially by following technical scheme:
A kind of mannosan the enzyme mutant DeP41P42, the mutant De of thermal activities and heat resistance raising Mannosan enzyme sequence AFE82293 (SEQ of the amino acid sequence of P41P42 as shown in SEQ ID NO.1, with GenBank record ID No.3) it compares: DeP41P42 does not contain the signal peptide sequence " MIARRFSNLPESCGAIRSS of the N-terminal positioned at AFE82293 FFCAIILLAGCGPLGRPNA"；DeP41P42 does not contain the 41st and the 42nd two proline (P) of AFE82293；In N End, amino acid " GP " more than DeP41P42 ratio AFE82293.
The optimal pH of the mutant DeP41P42 is 6.0；Optimum temperature is 45 DEG C；50 DEG C of half-life period is 60min； Compared with wild enzyme, mutant DeP41P42 optimum temperature is higher by 10 DEG C, and 50 DEG C of half-life period improves 4 times.
The present invention provides the codings for the mannosan enzyme mutant DeP41P42 that the thermal activities and heat resistance improve Gene, nucleotide sequence is as shown in SEQ ID NO.2.
Another object of the present invention is to provide a kind of weights comprising mannosan enzyme mutant DeP41P42 encoding gene Group carrier.
Another object of the present invention is to provide a kind of weights comprising mannosan enzyme mutant DeP41P42 encoding gene Group bacterium.
In addition, application of the mannosan enzyme mutant DeP41P42 of the present invention in aquatic feeds or field of food Within the scope of the present invention.
The preparation method of mannosan enzyme mutant DeP41P42 of the present invention, specifically includes the following steps:
1) coding gene sequence of synthesis mutant DeP41P42 adds E coRI limit at the end 5' of encoding gene when synthesis Property restriction enzyme site sequence processed and HRV HRV 3CP restriction enzyme site coded sequence (5'GAATTCCT GGAAGTTCTGTTCCAG 3'), and at the end 3' of DeP41P42 encoding gene XhoI restriction enzyme site sequence (5'CTCGAG 3') is added；
2) 1) the middle sequence that synthesizes is connected by the site EcoRI and XhoI with expression vector pET-28a (+), and will Connection product converts e. coli bl21 (DE3), obtains the recombinant bacterial strain comprising DeP41P42 encoding gene；
3) recombinant bacterial strain, induction recombination mannosan enzyme mutant DeP41P42 expression are cultivated；
4) it recycles and purifies expressed recombination mannosan enzyme mutant DeP41P42；
5) mannosan enzyme mutant DeP41P42 is recombinated with the digestion of HRV HRV 3CP；
6) recycling and purified mannanase mutant DeP41P42；
7) determination of activity.
The invention has the benefit that
Compared with wild enzyme ManAJB13, the thermal activities and heat resistance of mutant enzyme DeP41P42 are significantly improved.It is wild The optimum temperature of raw enzyme ManAJB13 is 35 DEG C, and 50 DEG C of half-life period is respectively 15min；And the most thermophilic of mutant DeP41P42 Degree is 45 DEG C, and 50 DEG C of half-life period is respectively 60min；Compared with wild enzyme, mutant DeP41P42 optimum temperature is higher by 10 DEG C, 50 DEG C of half-life period improves 4 times.Mannosan enzyme mutant of the invention is more advantageous in the industries such as aquatic feeds and food It promotes and applies.
Detailed description of the invention
The SDS-PAGE of Fig. 1: the wild enzyme ManAJB13 and mutant enzyme DeP41P42 of purifying are analyzed, wherein M: protein Marker；HisW:ManAJB13His；HRV 3CW:ManAJB13；HisD1:DeP41P42His；HRV 3CD1:DeP41P42；
The pH activity of Fig. 2: the wild enzyme ManAJB13 and mutant enzyme DeP41P42 of purifying；
Fig. 3: the thermal activities of wild the enzyme ManAJB13 and mutant enzyme DeP41P42 of purifying；
Fig. 4: the thermal stability of wild the enzyme ManAJB13 and mutant enzyme DeP41P42 of purifying.
Specific embodiment
Following will be combined with the drawings in the embodiments of the present invention, and technical solution in the embodiment of the present invention carries out clear, complete Site preparation description, it is clear that described embodiments are only a part of the embodiments of the present invention, instead of all the embodiments.It is based on Embodiment in the present invention, it is obtained by those of ordinary skill in the art without making creative efforts every other Embodiment shall fall within the protection scope of the present invention.
Experimental material and reagent in following embodiment of the present invention:
1, bacterial strain and carrier: Escherichia coli Escherichia coli BL21 (DE3) and expression vector pET-28a (+) can It is purchased from Novagen company；Plasmid pET-manAjb13 is provided by Yunnan Normal University.
2, enzyme and other biochemical reagents: HRV HRV 3CP and restriction enzyme are purchased from TaKaRa company, Nickel- NTA Agarose be purchased from QIAGEN company, archaeal dna polymerase, dNTP andII kit is purchased from Nanjing Novi Company is praised, carob is purchased from Sigma company, other all (to be commercially available from common biochemical Reagent Company) for domestic reagent.
3, culture medium
LB culture medium: peptone 10g, yeast extract 5g, sodium chloride 10g add distilled water to 1000mL, and pH is natural (about For 7).Solid medium adds 2.0% (w/v) agar on this basis.
Illustrate: not making the experimental methods of molecular biology illustrated in following embodiment, referring to " Molecular Cloning: A Laboratory Guide " specific method listed in book of (third edition) J. Pehanorm Brooker one carries out, or according to kit and product description It carries out.
The building and conversion of the wild enzyme ManAJB13 expression vector of embodiment 1
1) the mannase nucleotide sequence JF745875 (SEQ ID No.4) recorded according to GenBank, design is drawn Object: 5'TGGAAGTTCTGTTCCAGGGGCCCGCATCGCCGCCCGTCGCG 3' and 5' TGCTCGAGTCATCGCTGCCGAGCATAGAGA 3' carries out PCR amplification by template of plasmid pET-manAjb13, obtains sweet Reveal dextranase mature polypeptide coding sequence manAJB13, and joined HRV HRV 3CP restriction enzyme site at the end 5' of manAJ B13 Coded sequence, while recombination region is yet formed at the end 5' of manAJB13 and the end 3', the line obtained in the recombination region and (2) The recombination region at property carrier both ends matches.ManAJB13 can also be obtained by gene chemical synthesis.
2) another design primer 5'CAGCGATGACTCGAGCACCACCACCACC 3' and 5'CCT GGAACAGAACTTCCA GGAATTCGGATCCGCGACC 3' carries out PCR amplification by template of pET-28a (+) plasmid, obtains the pET-28a of linearisation (+) carrier, at the same linearisation pET-28a (+) carrier the end 5' and the end 3' form recombination region, the recombination region with The recombination region at the both ends manAJB13 matches.
3) PCR response parameter are as follows: 95 DEG C of denaturation 30sec；Then 95 DEG C of denaturation 15sec, 60 DEG C of annealing 15sec, 72 DEG C are prolonged Stretch 2min 30sec, 72 DEG C of heat preservation 5min after 30 circulations.
4) in the PCR product of 50 μ L line manAJB13,1 μ L DpnI is added, in 37 DEG C of digestion 1h.
5) in the PCR product of 50 μ L linearisation pET-28a (+) carrier, 1 μ L DpnI is added, in 37 DEG C of digestion 1h.
6) basisThe specification of II kit is heavy at 37 DEG C by the digestion product in (4) and (5) Group connection 30min, can be obtained the expression vector of wild enzyme ManAJB13.
7) wild expression of enzymes carrier is transformed into e. coli bl21 (DE3) by heat shock mode, is included The recombinant bacterial strain of manAJB13.
The building and conversion of 2 mutant enzyme DeP41P42 expression vector of embodiment
1) coding gene sequence of synthesis mutant DeP41P42 adds H RV 3C at the end 5' of encoding gene when synthesis Protease cleavage site coded sequence and EcoRI restriction enzyme site sequence (5'GAATTCCT GGAAGTTCTGTTCCAG 3'), and at the end 3' of DeP41P42 encoding gene XhoI restriction enzyme site sequence (5'CTCGAG 3') is added；
2) 1) the middle sequence that synthesizes is subjected to EcoRI and XhoI double digestion；Expression vector pET-28a (+) is carried out simultaneously EcoRI and XhoI double digestion；
3) digestion products in (2) are attached with DNA ligase, the expression that can be obtained mutant enzyme DeP41P42 carries Body；
4) connection product is converted into e. coli bl21 (DE3), obtains the recombinant bacterial strain comprising DeP41P42 encoding gene.
The preparation of embodiment 3 wild enzyme ManAJB13 and mutant enzyme DeP41P42
The recombinant bacterial strain of the encoding gene containing manAJB13 and DeP41P42 is inoculated in LB with 0.1% inoculum concentration respectively (contain 50 μ g mL-1Kanamycins) in culture solution, 37 DEG C of quick oscillation 16h.
Then the bacterium solution of this activation is inoculated into fresh LB (containing 50 μ g mL with 1% inoculum concentration-1Kanamycins) culture solution In, about 2-3h (OD of quick oscillation culture600Reach 0.6-1.0) after, the IPTG that final concentration 0.25mM is added is induced, in 20 DEG C continue shaken cultivation about 20h.12000rpm is centrifuged 5min, collects thallus.With suitable pH=6.0McIlvaine buffer After suspension thalline, the ultrasonic disruption thalline under low temperature water-bath.The crude enzyme liquid of the above concentration intracellular is centrifuged through 13,000rpm After 10min, draws supernatant and distinguish affine and purifying destination protein with the imidazoles of Nickel-NTA Agarose and 0-500mM. Recombinant bacterial strain containing manAJB13 is expressed and the recombinant protein purified is named as ManAJB13His, DeP41P42 coding will be contained The recombinant bacterial strain of gene is expressed and the recombinant protein purified is named as DeP41P42His.SDS-PAGE result (Fig. 1) shows ManAJB13His and DeP41P42His are purified, and product is single band.The amino acid sequence of Man AJB13His As shown in SEQ ID NO.5.The amino acid sequence of DeP41P42His is as shown in S EQ ID NO.6.
According to HRV HRV 3CP specification, with HRV HRV 3CP difference digestion ManAJB13His and DeP41P42His, removal are located at the histidine tag and pE T-28a (+) carrier of ManAJB13His and DeP41P42His N-terminal Included amino acid sequence, digestion products after purification, obtain ManAJB13 and DeP41P42 through Nickel-NTA Agarose.SDS- PAGE result (Fig. 1) shows that the histidine tag of N-terminal and p ET-28a (+) carrier carry amino acid sequence and successfully cut off, and And ManAJB13 and DeP41P42 are purified, product is single band.The amino acid sequence of ManAJB13 such as SEQ ID Shown in NO.7.
The property measurement for the wild enzyme ManAJB13 and mutant enzyme DeP41P42 that embodiment 4 purifies
1) activity analysis of wild the enzyme ManAJB13 and mutant enzyme DeP41P42 purified
Activity determination method uses 3,5- dinitrosalicylic acid (DNS) method: substrate carob being dissolved in buffer, is made Its final concentration of 0.5% (w/v)；Reaction system contains the 50 appropriate enzyme solutions of μ L, 450 μ L substrates；Substrate preheats at the reaction temperatures After 5min, 10min is reacted again after enzyme solution is added, and then plus 750 μ L DNS terminate reaction, boiling water boiling 5min, after being cooled to room temperature OD value is measured under 540nm wavelength；1 enzyme-activity unit (U) is defined as bottom exploded object per minute under given conditions and generates 1 μ Enzyme amount needed for mol reduced sugar (in terms of mannose).
2) the pH determination of activity of the wild enzyme ManAJB13 and mutant enzyme DeP41P42 that purify
Enzyme solution is placed at 37 DEG C and carries out enzymatic reaction in the buffer of pH=4.0-8.0.
The result shows that: the optimal pH of wild enzyme ManAJB13 and mutant enzyme DeP41P42 is 6.0 (Fig. 2).
3) thermal activities and thermal stability determination of the wild enzyme ManAJB13 and mutant enzyme DeP41P42 that purify
The thermal activities of enzyme measure: in the buffer of pH=6.0, carrying out enzymatic reaction at 0-55 DEG C.The thermostabilization of enzyme Property measurement: after the enzyme solution of same enzyme amount is placed in 50 DEG C of 0-60min of processing, enzymatic reaction is carried out at pH=6.0 and 37 DEG C, with Untreated enzyme solution is as control.Using carob as substrate, 10min is reacted, wild enzyme ManAJB13 and mutant enzyme are measured The zymologic property of DeP41P42.
The result shows that: the optimum temperature of wild enzyme ManAJB13 and mutant DeP41P42 is respectively 35 DEG C and 45 DEG C (figures 3)；Wild enzyme ManAJB13 and mutant DeP41P42 is respectively 15min and 60min (Fig. 4) in 50 DEG C of half-life period.
Those skilled in the art of the present technique are appreciated that unless otherwise defined, all terms used herein (including technology art Language and scientific term) there is meaning identical with the general understanding of those of ordinary skill in fields of the present invention.Should also Understand, those terms such as defined in the general dictionary, which should be understood that, to be had and the meaning in the context of the prior art The consistent meaning of justice, and unless defined as here, it will not be explained in an idealized or overly formal meaning.
It should be noted last that: the above embodiments are only used to illustrate and not limit the technical solutions of the present invention, although ginseng It is described the invention in detail according to above-described embodiment, it will be apparent to an ordinarily skilled person in the art that: it still can be to this Invention is modified or replaced equivalently, without departing from the spirit or scope of the invention, or any substitutions, It is intended to be within the scope of the claims of the invention.
Sequence table
<110>Yunnan Normal University
<120>a kind of mannosan enzyme mutant DeP41P42 and its application
<160> 11
<170> SIPOSequenceListing 1.0
<210> 1
<211> 358
<212> PRT
<213>mannosan enzyme mutant (DeP41P42)
<400> 1
Gly Pro Ala Ser Val Ala Pro Ala Pro Ile Asp Arg Leu Ala Thr Arg
1 5 10 15
Glu Thr Arg Ala Leu Phe Ala Ser Leu Arg Ala Leu Ala Pro Ala His
20 25 30
Thr Leu Phe Gly His Gln Asp Asp Leu Ala Tyr Gly Tyr Gly Trp Thr
35 40 45
Gly Asp Pro Gly Arg Ser Asp Val Lys Ser Val Ala Gly Ser Tyr Pro
50 55 60
Ala Val Tyr Gly Trp Asp Val Gly Asp Ile Phe Ala Ser Gly Lys Gly
65 70 75 80
Pro Leu Arg Tyr Asp Pro Leu Arg Ala Asp Lys Leu Arg Ala Trp Ile
85 90 95
Leu Ser Gly Tyr Arg Arg Gly Gly Val Ile Thr Met Ser Trp His Met
100 105 110
Pro Asn Pro Val Ala His Ser Asp Ala Trp Asp Val Ala Thr Pro Ala
115 120 125
Val Ala Arg Ile Leu Pro Gly Gly Asp His His Ala Ala Phe Leu Ala
130 135 140
Asp Leu Asp Ile Ala Ala Arg Phe Phe Arg Ser Leu Arg Ala Pro Asp
145 150 155 160
Gly Ser Leu Val Pro Val Ile Phe Arg Pro Trp His Glu Gln Thr Gly
165 170 175
Asp Trp Phe Trp Trp Gly Ala Ala His Cys Thr Ala Asp Gln Phe Asn
180 185 190
Ala Leu Trp Arg Met Thr Val Ala Arg Leu Arg Ala Asp Gly Val His
195 200 205
Asn Leu Leu Tyr Ala Tyr Ser Thr Asp Val Phe Asp Thr Pro Glu Asp
210 215 220
Tyr Leu Ala Arg Tyr Pro Gly Asp Asp Val Val Asp Ile Leu Gly Phe
225 230 235 240
Asp Asp Tyr His Gly Ile Ala Ser Arg Ala Thr Leu Pro Gln Phe Glu
245 250 255
Gln Arg Ile Arg Thr Val Val Thr Leu Ala Gly Ser Arg Gly Lys Ile
260 265 270
Ala Ala Val Thr Glu Thr Gly Leu Glu Ala Ile Pro Asp Ala Ile Trp
275 280 285
Trp Thr Asp Ile Leu Gly Arg Gly Leu Asp Asp Val Pro Gly Ala Ala
290 295 300
Trp Val Leu Val Trp Arg Asn Ala Asn Pro Ala Asn Asp Arg Lys Glu
305 310 315 320
His Phe Phe Ala Pro Tyr Pro Gly Gln Lys Ser Ala Ala Asp Phe Val
325 330 335
Gln Phe Thr Arg Asp Pro Arg Ile Leu Leu Glu Asp Glu Leu Pro Asp
340 345 350
Leu Tyr Ala Arg Gln Arg
355
<210> 2
<211> 1077
<212> DNA
<213>mannosan enzyme mutant (DeP41P42)
<400> 2
gggcccgcat cggtcgcgcc tgcaccaatc gatcgcctcg ctacgcgcga gacccgtgcg 60
ttgttcgcgt cgctgcgcgc gctggcacct gctcatacgc tgttcgggca tcaggacgac 120
ctcgcttatg gctatggctg gaccggcgac ccggggcggt ccgacgtgaa atcggtcgcc 180
ggcagttatc cggcggttta cggctgggac gtcggtgata tcttcgcctc tggcaagggg 240
ccgctgcgtt atgatccgct tcgggctgac aagttgcgtg cgtggatcct ttcaggctat 300
cgccgcggcg gcgtcatcac gatgagttgg cacatgccaa acccggttgc gcattccgat 360
gcctgggatg tagcgacgcc agcggtcgcg cggatcctgc cgggcggtga tcaccatgcc 420
gcctttctcg ccgatctcga tatcgctgcc cgcttcttcc gcagcctgcg cgcgcccgac 480
ggcagtctcg tccccgtcat cttccgccct tggcatgaac agaccggcga ctggttctgg 540
tggggagcgg cgcattgcac ggccgaccag ttcaacgcct tgtggcggat gacggtcgct 600
cgtctccgcg cggatggcgt ccacaacctg ctctacgctt attcgacgga cgtgttcgat 660
acgcccgagg actatctcgc gcgctatccg ggagatgatg tcgtcgatat attgggcttc 720
gacgattacc atggcatcgc aagccgagcg accttgcctc agtttgaaca gcggatcagg 780
acggtcgtga ctttggcggg cagccgcggc aagatcgcgg cggtgaccga aaccggactg 840
gaagcgattc ccgacgcgat ctggtggacc gacattctcg gtcgcggcct tgatgacgtt 900
cccggtgcgg catgggtgct ggtgtggcga aacgccaatc ctgccaacga tcgcaaggaa 960
catttcttcg cgccctatcc cggacagaag agcgccgctg acttcgtgca gttcacgcgt 1020
gaccctcgga tcctcttgga ggacgaactg cccgatctct atgctcggca gcgatga 1077
<210> 3
<211> 396
<212> PRT
<213>wild enzyme (AFE82293)
<400> 3
Met Ile Ala Arg Arg Phe Ser Asn Leu Pro Glu Ser Cys Gly Ala Ile
1 5 10 15
Arg Ser Ser Phe Phe Cys Ala Ile Ile Leu Leu Ala Gly Cys Gly Pro
20 25 30
Leu Gly Arg Pro Asn Ala Ala Ser Pro Pro Val Ala Pro Ala Pro Ile
35 40 45
Asp Arg Leu Ala Thr Arg Glu Thr Arg Ala Leu Phe Ala Ser Leu Arg
50 55 60
Ala Leu Ala Pro Ala His Thr Leu Phe Gly His Gln Asp Asp Leu Ala
65 70 75 80
Tyr Gly Tyr Gly Trp Thr Gly Asp Pro Gly Arg Ser Asp Val Lys Ser
85 90 95
Val Ala Gly Ser Tyr Pro Ala Val Tyr Gly Trp Asp Val Gly Asp Ile
100 105 110
Phe Ala Ser Gly Lys Gly Pro Leu Arg Tyr Asp Pro Leu Arg Ala Asp
115 120 125
Lys Leu Arg Ala Trp Ile Leu Ser Gly Tyr Arg Arg Gly Gly Val Ile
130 135 140
Thr Met Ser Trp His Met Pro Asn Pro Val Ala His Ser Asp Ala Trp
145 150 155 160
Asp Val Ala Thr Pro Ala Val Ala Arg Ile Leu Pro Gly Gly Asp His
165 170 175
His Ala Ala Phe Leu Ala Asp Leu Asp Ile Ala Ala Arg Phe Phe Arg
180 185 190
Ser Leu Arg Ala Pro Asp Gly Ser Leu Val Pro Val Ile Phe Arg Pro
195 200 205
Trp His Glu Gln Thr Gly Asp Trp Phe Trp Trp Gly Ala Ala His Cys
210 215 220
Thr Ala Asp Gln Phe Asn Ala Leu Trp Arg Met Thr Val Ala Arg Leu
225 230 235 240
Arg Ala Asp Gly Val His Asn Leu Leu Tyr Ala Tyr Ser Thr Asp Val
245 250 255
Phe Asp Thr Pro Glu Asp Tyr Leu Ala Arg Tyr Pro Gly Asp Asp Val
260 265 270
Val Asp Ile Leu Gly Phe Asp Asp Tyr His Gly Ile Ala Ser Arg Ala
275 280 285
Thr Leu Pro Gln Phe Glu Gln Arg Ile Arg Thr Val Val Thr Leu Ala
290 295 300
Gly Ser Arg Gly Lys Ile Ala Ala Val Thr Glu Thr Gly Leu Glu Ala
305 310 315 320
Ile Pro Asp Ala Ile Trp Trp Thr Asp Ile Leu Gly Arg Gly Leu Asp
325 330 335
Asp Val Pro Gly Ala Ala Trp Val Leu Val Trp Arg Asn Ala Asn Pro
340 345 350
Ala Asn Asp Arg Lys Glu His Phe Phe Ala Pro Tyr Pro Gly Gln Lys
355 360 365
Ser Ala Ala Asp Phe Val Gln Phe Thr Arg Asp Pro Arg Ile Leu Leu
370 375 380
Glu Asp Glu Leu Pro Asp Leu Tyr Ala Arg Gln Arg
385 390 395
<210> 4
<211> 1191
<212> DNA
<213>wild enzyme (JF745875)
<400> 4
atgattgcac gccggttcag taacctccct gagagctgcg gagcgatccg cagctcattt 60
ttttgcgcga ttatactgct tgcaggctgt gggccactcg gccgaccaaa cgcggcatcg 120
ccgcccgtcg cgcctgcacc aatcgatcgc ctcgctacgc gcgagacccg tgcgttgttc 180
gcgtcgctgc gcgcgctggc acctgctcat acgctgttcg ggcatcagga cgacctcgct 240
tatggctatg gctggaccgg cgacccgggg cggtccgacg tgaaatcggt cgccggcagt 300
tatccggcgg tttacggctg ggacgtcggt gatatcttcg cctctggcaa ggggccgctg 360
cgttatgatc cgcttcgggc tgacaagttg cgtgcgtgga tcctttcagg ctatcgccgc 420
ggcggcgtca tcacgatgag ttggcacatg ccaaacccgg ttgcgcattc cgatgcctgg 480
gatgtagcga cgccagcggt cgcgcggatc ctgccgggcg gtgatcacca tgccgccttt 540
ctcgccgatc tcgatatcgc tgcccgcttc ttccgcagcc tgcgcgcgcc cgacggcagt 600
ctcgtccccg tcatcttccg cccttggcat gaacagaccg gcgactggtt ctggtgggga 660
gcggcgcatt gcacggccga ccagttcaac gccttgtggc ggatgacggt cgctcgtctc 720
cgcgcggatg gcgtccacaa cctgctctac gcttattcga cggacgtgtt cgatacgccc 780
gaggactatc tcgcgcgcta tccgggagat gatgtcgtcg atatattggg cttcgacgat 840
taccatggca tcgcaagccg agcgaccttg cctcagtttg aacagcggat caggacggtc 900
gtgactttgg cgggcagccg cggcaagatc gcggcggtga ccgaaaccgg actggaagcg 960
attcccgacg cgatctggtg gaccgacatt ctcggtcgcg gccttgatga cgttcccggt 1020
gcggcatggg tgctggtgtg gcgaaacgcc aatcctgcca acgatcgcaa ggaacatttc 1080
ttcgcgccct atcccggaca gaagagcgcc gctgacttcg tgcagttcac gcgtgaccct 1140
cggatcctct tggaggacga actgcccgat ctctatgctc ggcagcgatg a 1191
<210> 5
<211> 402
<212> PRT
<213>wild enzyme (ManAJB13His) is recombinated
<400> 5
Met Gly Ser Ser His His His His His His Ser Ser Gly Leu Val Pro
1 5 10 15
Arg Gly Ser His Met Ala Ser Met Thr Gly Gly Gln Gln Met Gly Arg
20 25 30
Gly Ser Glu Phe Leu Glu Val Leu Phe Gln Gly Pro Ala Ser Pro Pro
35 40 45
Val Ala Pro Ala Pro Ile Asp Arg Leu Ala Thr Arg Glu Thr Arg Ala
50 55 60
Leu Phe Ala Ser Leu Arg Ala Leu Ala Pro Ala His Thr Leu Phe Gly
65 70 75 80
His Gln Asp Asp Leu Ala Tyr Gly Tyr Gly Trp Thr Gly Asp Pro Gly
85 90 95
Arg Ser Asp Val Lys Ser Val Ala Gly Ser Tyr Pro Ala Val Tyr Gly
100 105 110
Trp Asp Val Gly Asp Ile Phe Ala Ser Gly Lys Gly Pro Leu Arg Tyr
115 120 125
Asp Pro Leu Arg Ala Asp Lys Leu Arg Ala Trp Ile Leu Ser Gly Tyr
130 135 140
Arg Arg Gly Gly Val Ile Thr Met Ser Trp His Met Pro Asn Pro Val
145 150 155 160
Ala His Ser Asp Ala Trp Asp Val Ala Thr Pro Ala Val Ala Arg Ile
165 170 175
Leu Pro Gly Gly Asp His His Ala Ala Phe Leu Ala Asp Leu Asp Ile
180 185 190
Ala Ala Arg Phe Phe Arg Ser Leu Arg Ala Pro Asp Gly Ser Leu Val
195 200 205
Pro Val Ile Phe Arg Pro Trp His Glu Gln Thr Gly Asp Trp Phe Trp
210 215 220
Trp Gly Ala Ala His Cys Thr Ala Asp Gln Phe Asn Ala Leu Trp Arg
225 230 235 240
Met Thr Val Ala Arg Leu Arg Ala Asp Gly Val His Asn Leu Leu Tyr
245 250 255
Ala Tyr Ser Thr Asp Val Phe Asp Thr Pro Glu Asp Tyr Leu Ala Arg
260 265 270
Tyr Pro Gly Asp Asp Val Val Asp Ile Leu Gly Phe Asp Asp Tyr His
275 280 285
Gly Ile Ala Ser Arg Ala Thr Leu Pro Gln Phe Glu Gln Arg Ile Arg
290 295 300
Thr Val Val Thr Leu Ala Gly Ser Arg Gly Lys Ile Ala Ala Val Thr
305 310 315 320
Glu Thr Gly Leu Glu Ala Ile Pro Asp Ala Ile Trp Trp Thr Asp Ile
325 330 335
Leu Gly Arg Gly Leu Asp Asp Val Pro Gly Ala Ala Trp Val Leu Val
340 345 350
Trp Arg Asn Ala Asn Pro Ala Asn Asp Arg Lys Glu His Phe Phe Ala
355 360 365
Pro Tyr Pro Gly Gln Lys Ser Ala Ala Asp Phe Val Gln Phe Thr Arg
370 375 380
Asp Pro Arg Ile Leu Leu Glu Asp Glu Leu Pro Asp Leu Tyr Ala Arg
385 390 395 400
Gln Arg
<210> 6
<211> 400
<212> PRT
<213>recombinant mutant (DeP41P42His)
<400> 6
Met Gly Ser Ser His His His His His His Ser Ser Gly Leu Val Pro
1 5 10 15
Arg Gly Ser His Met Ala Ser Met Thr Gly Gly Gln Gln Met Gly Arg
20 25 30
Gly Ser Glu Phe Leu Glu Val Leu Phe Gln Gly Pro Ala Ser Val Ala
35 40 45
Pro Ala Pro Ile Asp Arg Leu Ala Thr Arg Glu Thr Arg Ala Leu Phe
50 55 60
Ala Ser Leu Arg Ala Leu Ala Pro Ala His Thr Leu Phe Gly His Gln
65 70 75 80
Asp Asp Leu Ala Tyr Gly Tyr Gly Trp Thr Gly Asp Pro Gly Arg Ser
85 90 95
Asp Val Lys Ser Val Ala Gly Ser Tyr Pro Ala Val Tyr Gly Trp Asp
100 105 110
Val Gly Asp Ile Phe Ala Ser Gly Lys Gly Pro Leu Arg Tyr Asp Pro
115 120 125
Leu Arg Ala Asp Lys Leu Arg Ala Trp Ile Leu Ser Gly Tyr Arg Arg
130 135 140
Gly Gly Val Ile Thr Met Ser Trp His Met Pro Asn Pro Val Ala His
145 150 155 160
Ser Asp Ala Trp Asp Val Ala Thr Pro Ala Val Ala Arg Ile Leu Pro
165 170 175
Gly Gly Asp His His Ala Ala Phe Leu Ala Asp Leu Asp Ile Ala Ala
180 185 190
Arg Phe Phe Arg Ser Leu Arg Ala Pro Asp Gly Ser Leu Val Pro Val
195 200 205
Ile Phe Arg Pro Trp His Glu Gln Thr Gly Asp Trp Phe Trp Trp Gly
210 215 220
Ala Ala His Cys Thr Ala Asp Gln Phe Asn Ala Leu Trp Arg Met Thr
225 230 235 240
Val Ala Arg Leu Arg Ala Asp Gly Val His Asn Leu Leu Tyr Ala Tyr
245 250 255
Ser Thr Asp Val Phe Asp Thr Pro Glu Asp Tyr Leu Ala Arg Tyr Pro
260 265 270
Gly Asp Asp Val Val Asp Ile Leu Gly Phe Asp Asp Tyr His Gly Ile
275 280 285
Ala Ser Arg Ala Thr Leu Pro Gln Phe Glu Gln Arg Ile Arg Thr Val
290 295 300
Val Thr Leu Ala Gly Ser Arg Gly Lys Ile Ala Ala Val Thr Glu Thr
305 310 315 320
Gly Leu Glu Ala Ile Pro Asp Ala Ile Trp Trp Thr Asp Ile Leu Gly
325 330 335
Arg Gly Leu Asp Asp Val Pro Gly Ala Ala Trp Val Leu Val Trp Arg
340 345 350
Asn Ala Asn Pro Ala Asn Asp Arg Lys Glu His Phe Phe Ala Pro Tyr
355 360 365
Pro Gly Gln Lys Ser Ala Ala Asp Phe Val Gln Phe Thr Arg Asp Pro
370 375 380
Arg Ile Leu Leu Glu Asp Glu Leu Pro Asp Leu Tyr Ala Arg Gln Arg
385 390 395 400
<210> 7
<211> 360
<212> PRT
<213>wild enzyme (ManAJB13) is recombinated
<400> 7
Gly Pro Ala Ser Pro Pro Val Ala Pro Ala Pro Ile Asp Arg Leu Ala
1 5 10 15
Thr Arg Glu Thr Arg Ala Leu Phe Ala Ser Leu Arg Ala Leu Ala Pro
20 25 30
Ala His Thr Leu Phe Gly His Gln Asp Asp Leu Ala Tyr Gly Tyr Gly
35 40 45
Trp Thr Gly Asp Pro Gly Arg Ser Asp Val Lys Ser Val Ala Gly Ser
50 55 60
Tyr Pro Ala Val Tyr Gly Trp Asp Val Gly Asp Ile Phe Ala Ser Gly
65 70 75 80
Lys Gly Pro Leu Arg Tyr Asp Pro Leu Arg Ala Asp Lys Leu Arg Ala
85 90 95
Trp Ile Leu Ser Gly Tyr Arg Arg Gly Gly Val Ile Thr Met Ser Trp
100 105 110
His Met Pro Asn Pro Val Ala His Ser Asp Ala Trp Asp Val Ala Thr
115 120 125
Pro Ala Val Ala Arg Ile Leu Pro Gly Gly Asp His His Ala Ala Phe
130 135 140
Leu Ala Asp Leu Asp Ile Ala Ala Arg Phe Phe Arg Ser Leu Arg Ala
145 150 155 160
Pro Asp Gly Ser Leu Val Pro Val Ile Phe Arg Pro Trp His Glu Gln
165 170 175
Thr Gly Asp Trp Phe Trp Trp Gly Ala Ala His Cys Thr Ala Asp Gln
180 185 190
Phe Asn Ala Leu Trp Arg Met Thr Val Ala Arg Leu Arg Ala Asp Gly
195 200 205
Val His Asn Leu Leu Tyr Ala Tyr Ser Thr Asp Val Phe Asp Thr Pro
210 215 220
Glu Asp Tyr Leu Ala Arg Tyr Pro Gly Asp Asp Val Val Asp Ile Leu
225 230 235 240
Gly Phe Asp Asp Tyr His Gly Ile Ala Ser Arg Ala Thr Leu Pro Gln
245 250 255
Phe Glu Gln Arg Ile Arg Thr Val Val Thr Leu Ala Gly Ser Arg Gly
260 265 270
Lys Ile Ala Ala Val Thr Glu Thr Gly Leu Glu Ala Ile Pro Asp Ala
275 280 285
Ile Trp Trp Thr Asp Ile Leu Gly Arg Gly Leu Asp Asp Val Pro Gly
290 295 300
Ala Ala Trp Val Leu Val Trp Arg Asn Ala Asn Pro Ala Asn Asp Arg
305 310 315 320
Lys Glu His Phe Phe Ala Pro Tyr Pro Gly Gln Lys Ser Ala Ala Asp
325 330 335
Phe Val Gln Phe Thr Arg Asp Pro Arg Ile Leu Leu Glu Asp Glu Leu
340 345 350
Pro Asp Leu Tyr Ala Arg Gln Arg
355 360
<210> 8
<211> 41
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
tggaagttct gttccagggg cccgcatcgc cgcccgtcgc g 41
<210> 9
<211> 30
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
tgctcgagtc atcgctgccg agcatagaga 30
<210> 10
<211> 28
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
cagcgatgac tcgagcacca ccaccacc 28
<210> 11
<211> 37
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 11
cctggaacag aacttccagg aattcggatc cgcgacc 37

Claims (6)

1. a kind of mannosan enzyme mutant DeP41P42, which is characterized in that the amino acid sequence of the mutant DeP41P42 Column are as shown in SEQ ID NO.1.
2. the encoding gene of mutant DeP41P42 described in claim 1, which is characterized in that the nucleosides of the encoding gene Acid sequence is as shown in SEQ ID NO.2.
3. including the recombinant vector of encoding gene as claimed in claim 2.
4. the recombinant bacterium comprising encoding gene as claimed in claim 2.
5. the preparation method of mannosan enzyme mutant DeP41P42 described in claim 1, which is characterized in that including following step It is rapid:
1) HRV HRV 3CP restriction enzyme site coded sequence is added at the end 5' of DeP41P42 encoding gene；
2) 1) sequence in is connected with expression vector pET-28a (+), and connection product is converted into e. coli bl21 (DE3), the recombinant bacterial strain comprising DeP41P42 encoding gene is obtained；
3) recombinant bacterial strain, induction mannosan enzyme mutant DeP41P42 expression are cultivated；
4) it recycles and purifies expressed mannosan enzyme mutant DeP41P42；
5) HRV HRV 3CP digestion mannosan enzyme mutant DeP41P42 is used；
6) recycling and purified mannanase mutant DeP41P42；
7) determination of activity.
6. application of the mutant DeP41P42 described in claim 1 in aquatic feeds or field of food.
CN201811444527.8A 2018-11-29 2018-11-29 A kind of mannosan enzyme mutant DeP41P42 and its application Active CN109251913B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811444527.8A CN109251913B (en) 2018-11-29 2018-11-29 A kind of mannosan enzyme mutant DeP41P42 and its application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811444527.8A CN109251913B (en) 2018-11-29 2018-11-29 A kind of mannosan enzyme mutant DeP41P42 and its application

Publications (2)

Publication Number Publication Date
CN109251913A CN109251913A (en) 2019-01-22
CN109251913B true CN109251913B (en) 2019-11-08

Family

ID=65042276

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811444527.8A Active CN109251913B (en) 2018-11-29 2018-11-29 A kind of mannosan enzyme mutant DeP41P42 and its application

Country Status (1)

Country Link
CN (1) CN109251913B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113512544B (en) * 2021-07-14 2023-08-08 江南大学 Mannose isomerase mutant with improved heat stability

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103525790B (en) * 2013-10-12 2015-01-21 青岛根源生物技术集团有限公司 Optimized high-temperature resistant mannanase MAN5gy, and preparation method and application thereof
CN103740682B (en) * 2014-01-17 2016-01-06 北京科为博生物科技有限公司 A kind of high temperature resistant acidic 'beta '-mannase Man-L30 and gene thereof and application
CN108559739B (en) * 2018-05-11 2021-03-26 中国农业科学院北京畜牧兽医研究所 Mannase PMan5A mutant with improved heat resistance, and gene and application thereof

Also Published As

Publication number Publication date
CN109251913A (en) 2019-01-22

Similar Documents

Publication Publication Date Title
CN108504644B (en) A kind of low temperature exoinulinase mutant Mut8S of thermal stability improvement
CN111647579B (en) Thermolabile exoinulase mutant MutQ23 delta 9 and preparation and application thereof
CN112646794B (en) Exoinulase mutant MutY119V with improved low-temperature activity
CN112813051B (en) Low Wen Waiqie inulase mutant MutP124G with improved thermal adaptability and application
CN112980813B (en) Low-temperature modified exoinulase mutant MutS117G
CN108715840B (en) A kind of low temperature exoinulinase mutant MutQ23 Δ 3 of heat resistance
CN112646793A (en) Inulase mutant MutS120D with improved low-temperature adaptability and salt adaptability and application thereof
CN112813054A (en) Inulase mutant MutS117N with changed low-temperature salt tolerance and application thereof
CN112980814B (en) Exoinulase mutant MutV268 delta 13 with improved low-temperature adaptability
CN116376875B (en) N-acetylglucosaminidase mutant with improved heat resistance and application thereof
CN113969290B (en) Deep sea bacteria-derived alpha-glucosidase QsGH97a and encoding gene and application thereof
CN112852782A (en) Low-temperature-adaptively-improved low-temperature inulinase mutant MutDL121EK5 and application thereof
CN116555229A (en) N-acetylglucosaminidase mutant, recombinant expression vector, bacterium and application
CN108707593A (en) A kind of low temperature exoinulinase mutant MutE137 Δs 5 and its application
CN111893125A (en) Chitosan enzyme gene, chitosanase, preparation method and application thereof
CN111876399B (en) Arctic-pole-derived beta-glucosidase gene, and encoded protein and application thereof
CN113774073A (en) Deep sea metagenome-derived beta-galactosidase, encoding gene and application
CN105062992B (en) A kind of endolysin and the polynucleotides for encoding this endolysin
Inamine et al. Purification, cDNA cloning, and characterization of LysM-containing plant chitinase from horsetail (Equisetum arvense)
CN116410960A (en) Beta-xylosidase mutant D41G with cold and pH adaptability improved halophilic suitability and application thereof
CN117737038B (en) N-acetylglucosaminidase mutant De254P delta 5 and preparation and application thereof
CN117737037B (en) N-acetylglucosaminidase mutant De266L delta 6 and preparation and application thereof
CN109251913B (en) A kind of mannosan enzyme mutant DeP41P42 and its application
Liang et al. Characterization and overexpression of a novel β‐agarase from Thalassomonas agarivorans
CN111621488A (en) Heat-adaptability-improved inulase exonuclease mutant MutQ23 delta 11

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
OL01 Intention to license declared