CN108707593A - A kind of low temperature exoinulinase mutant MutE137 Δs 5 and its application - Google Patents

Abstract

The present invention relates to genetic engineering and protein renovation technique field, a kind of low temperature exoinulinase mutant MutE137 Δs 5 and its application are disclosed, the amino acid sequence of mutant MutE137 Δs 5 is as shown in SEQ ID NO.1.The optimal pH of MutE137 Δs 5 is 6.0；Optimum temperature is 35 DEG C, and 15%, 25%, 47%, 86% and 42% enzyme activity is respectively provided at 0 DEG C, 10 DEG C, 20 DEG C, 30 DEG C and 50 DEG C；After 50 DEG C of processing 60min, the enzyme activity of 5 residue 42% of MutE137 Δs；The enzyme hydrolyzable inulin generates fructose.The low temperature exoinulinase mutant MutE137 Δs 5 of the present invention can be applied to the industries such as food, wine brewing and bioenergy.

Description

A kind of low temperature exoinulinase mutant MutE137 Δs 5 and its application

Technical field

The invention belongs to gene engineering technology fields, are related to protein renovation technique, specially a kind of circumscribed inulin of low temperature Enzyme mutant MutE137 Δs 5 and its application.

Background technology

Jerusalem artichoke popular name Jerusalem artichoke, belongs to non-grain crop, and cheap, yield is higher, impoverishment tolerant, cold-resistant, drought-enduring, saline-alkali tolerant Deng can plant in saline and alkaline, beach and desert.Inulin, also known as synanthrin, by fructose molecule by β -2,1 glycosidic bond is polymerized, End is connected with a molecule glucose residue, is widely present in the various plants such as jerusalem artichoke, burdock, witloof.Exoinulinase by A hydrolysis β -2,1 glycosidic bond generate the levulan of a molecule fructose and few fructose units, the final fructose and few of all generating Measure glucose.Fructose can be used for producing fructose syrup, bio-ethanol, 2,3- butanediols etc..Thus, exoinulinase can be applied to eat (Singh RS et al.International Journal of Biological in the industries such as product, wine brewing and bioenergy Macromolecules,2017,96:312–322.)。

Cold-adapted enzyme can be applied to the biotechnology under low temperature environment requirement, such as the fermentation temperature one of pure mellow wine and grape wine Ban <25℃.In addition, the processing (such as juice clarification) under low temperature can prevent pollution, nutritive loss and the food quality drop of microorganism It is low, medium temperature or high-temperature process mode are switched into the effect (Cavicchioli that low-temperature treatment mode may also function as reduction energy consumption et al.Microbial Biotechnology,2011,4(4):449–460.).Therefore, low temperature exoinulinase can be used for wine Fermentation, the marinated of food, decontamination, the inulin processing etc. under low temperature, there is important Development volue.However, most outer It is high temperature enzyme to cut inulinase.

Invention content

In view of the above technical problems, the purpose of the present invention is intended to provide a kind of exoinulinase mutation with low temperature active Body MutE137 Δs 5, can be applied to the industries such as food, wine brewing and bioenergy.

In order to reach above-mentioned technical purpose, the present invention is realized especially by following technical scheme：

A kind of low temperature exoinulinase mutant MutE137 Δs 5, the amino acid sequence of the mutant MutE137 Δs 5 As shown in SEQ ID NO.1, compared with the exoinulinase sequence AGC01503 (SEQ ID No.3) of GenBank records： MutE137 Δs 5 do not contain the signal peptide sequence " MIKLKKYGVLMLLLGVFGTSLA " of the N-terminal positioned at AGC01503；MutE137 137th to 141 totally 5 amino acid of the Δ 5 without containing AGC01503, i.e. MutE137 Δs 5 do not contain sequence " EEDRK "；At the ends N End, MutE137 Δs 5 amino acid " GP " more than AGC01503.

The optimal pH of the mutant MutE137 Δs 5 is 6.0；Optimum temperature be 35 DEG C, 0 DEG C, 10 DEG C, 20 DEG C, 30 DEG C and 50 DEG C of whens be respectively provided with 15%, 25%, 47%, 86% and 42% enzyme activity；After 50 DEG C of processing 60min, MutE137 Δs 5 The enzyme activity of residue 42%；The enzyme hydrolyzable inulin generates fructose.

The present invention provides the encoding gene of the exoinulinase mutant MutE137 Δs 5 with low temperature active, Its nucleotide sequence is as shown in SEQ ID NO.2.

Another object of the present invention is to provide a kind of comprising 5 encoding gene of exoinulinase mutant MutE137 Δs Recombinant vector.

Another object of the present invention is to provide a kind of comprising 5 encoding gene of exoinulinase mutant MutE137 Δs Recombinant bacterium.

In addition, application of the exoinulinase mutant MutE137 Δs 5 of the present invention in prepared by food and wine brewing Within the scope of the present invention.

The preparation method of low temperature exoinulinase mutant MutE137 Δs 5 of the present invention, specifically includes following step Suddenly：

1) coding gene sequence of synthesis mutant MutE137 Δs 5, in the 5&apos of encoding gene when synthesis;Add HRV 3C in end Protease cleavage site coded sequence and EcoRI restriction enzyme site sequences (5'GAATTCCTGGAAGTTCTGTTCCAG 3'), and in the 3&apos of 5 encoding gene of MutE137 Δs;Add XhoI restriction enzyme site sequences (5&apos in end;CTCGAG 3')；

2) 1) the middle sequence that synthesizes is connected by the sites EcoRI and XhoI with expression vector pET-28a (+), and will Connection product converts e. coli bl21 (DE3), obtains the recombinant bacterial strain for including 5 encoding gene of MutE137 Δs；

3) recombinant bacterial strain is cultivated, induction recombination exoinulinase mutant MutE137 Δs 5 are expressed；

4) it recycles and purifies expressed recombination exoinulinase mutant MutE137 Δs 5；

5) HRV HRV 3CP digestions recombination exoinulinase mutant MutE137 Δs 5 are used；

6) it recycles and purifies exoinulinase mutant MutE137 Δs 5；

7) determination of activity.

Beneficial effects of the present invention are：

Compared with wild enzyme InuAGN25DVS, the thermal activities and thermal stability of mutant enzyme MutE137 Δs 5 are changed, Activity under low temperature is improved.Purifying wild enzyme InuAGN25DVS optimum temperature be 45 DEG C, 0 DEG C, 10 DEG C, 20 DEG C, 30 DEG C and 50 DEG C of whens be respectively provided with 11%, 21%, 36%, 68% and 89% enzyme activity, and the mutant enzyme MutE137 purified The optimum temperature of Δ 5 is 35 DEG C, and 15%, 25%, 47%, 86% and is respectively provided at 0 DEG C, 10 DEG C, 20 DEG C, 30 DEG C and 50 DEG C 42% enzyme activity；After 50 DEG C of processing 60min, the enzyme activity of wild enzyme InuAGN25DVS residues 64%, and mutant enzyme MutE137 Δs 5 The enzyme activity of residue 42%.The low temperature exoinulinase mutant MutE137 Δs 5 of the present invention can be applied to food, wine brewing and biology The industries such as the energy.

Description of the drawings

Fig. 1：The SDS-PAGE of wild enzyme InuAGN25DVS and mutant enzyme MutE137 Δs 5 is analyzed, wherein M：Protein Marker；HRV 3CW：InuAGN25DVS；HisW：InuAGN25DVSHis；HisM：MutE137Δ5His；HRV 3CM： MutE137Δ5；

Fig. 2：The wild enzyme InuAGN25DVS of purifying and the pH activity of mutant enzyme MutE137 Δs 5；

Fig. 3：The pH stability of the wild enzyme InuAGN25DVS and mutant enzyme MutE137 Δs 5 of purifying；

Fig. 4：The thermal activities of the wild enzyme InuAGN25DVS and mutant enzyme MutE137 Δs 5 of purifying；

Fig. 5：The thermal stability of the wild enzyme InuAGN25DVS and mutant enzyme MutE137 Δs 5 of purifying；

Fig. 6：The product analysis of 5 hydrolytic inulin of wild enzyme InuAGN25DVS and mutant enzyme MutE137 Δs of purifying, wherein F：Fructose；G：Glucose；CK：Control group, the enzyme (boiling 10min) containing substrate and inactivation；S：Reaction group.

Specific implementation mode

Following will be combined with the drawings in the embodiments of the present invention, and technical solution in the embodiment of the present invention carries out clear, complete Site preparation describes, it is clear that described embodiments are only a part of the embodiments of the present invention, instead of all the embodiments.It is based on Embodiment in the present invention, those of ordinary skill in the art are obtained every other without creative efforts Embodiment shall fall within the protection scope of the present invention.

Experiment material in following embodiment of the present invention and reagent：

1, bacterial strain and carrier：Escherichia coli Escherichia coli BL21 (DE3) and expression vector pET-28a (+) can It is purchased from Novagen companies；Plasmid pEASY-E1-Z2-5 is provided by Yunnan Normal University.

2, enzyme and other biochemical reagents：HRV HRV 3CPs and restriction enzyme are purchased from TaKaRa companies, Nickel- NTA Agarose be purchased from QIAGEN companies, archaeal dna polymerase, dNTP andII kits are praised purchased from Nanjing Novi Company, inulin are purchased from Sigma companies, and other is all domestic reagent (can be commercially available from common biochemical Reagent Company).

3, culture medium

LB culture mediums：Peptone 10g, Yeast extract 5g, NaCl 10g add distilled water to 1000mL, and pH is certainly So (about 7).Solid medium adds 2.0% (w/v) agar on this basis.

Explanation：Do not make the experimental methods of molecular biology illustrated, equal reference in following embodiment《Molecular Cloning: A Laboratory Guide》Listed specific method carries out in one book of (third edition) J. Pehanorm Brookers, or according to kit and product description It carries out.

The structure of 1 wild enzyme InuAGN25DVS expression vectors of embodiment and conversion

1) the exoinulinase nucleotide sequence JQ863108 (SEQ ID No.4) recorded according to GenBank, design is drawn Object：5'TGGAAGTTCTGTTCCAGGGGCCCCAGACGGGACAGCATAAACAAG 3'And 5' GGTGGTGGTGTTATCTCTTAAATGCAGAAATACCGAT 3', PCR expansions are carried out by template of plasmid pEASY-E1-Z2-5 Increase, obtains exoinulinase mature polypeptide coding sequence Z2-5, and in the 5&apos of Z2-5;End adds HRV HRV 3CP restriction enzyme sites Coded sequence, while in the 5&apos of Z2-5;End and 3'End yet forms recombination region, the recombination region and the linearisation obtained in (2) The recombination region at carrier both ends matches.Z2-5 can also be obtained by gene chemical synthesis.

2) another design primer 5'AGAGATAACACCACCACCACCACCACTG 3'And 5' CCTGGAACAGAACTTCCAGGAATTCGGATCCGCGACC 3', PCR amplification is carried out by template of pET-28a (+) plasmid, is obtained PET-28a (+) carrier that must be linearized, while in the 5&apos of linearisation pET-28a (+) carrier;End and 3'End forms recombination zone Domain, the recombination region and the recombination region at the both ends Z2-5 match.

3) PCR response parameters are：95 DEG C of denaturation 30sec；Then 95 DEG C of denaturation 15sec, 60 DEG C of annealing 15sec, 72 DEG C are prolonged 3min 30sec are stretched, 5min are kept the temperature for 72 DEG C after 30 cycles.

4) in 50 μ L linearize the PCR product of pET-28a (+) carrier, 1 μ L DpnI are added, digest 1h in 37 DEG C.

5) basisThe specification of II kits, by digestion product and the Z2-5 weight at 37 DEG C in (4) Group connection 30min, you can obtain the expression vector of wild enzyme InuAGN25DVS.

6) wild expression of enzymes carrier is transformed by heat shock mode in e. coli bl21 (DE3), it includes Z2-5 to obtain Recombinant bacterial strain.

The structure of 2 mutant enzyme MutE137 Δs of embodiment, 5 expression vector and conversion

1) coding gene sequence of synthesis mutant MutE137 Δs 5, in the 5&apos of encoding gene when synthesis;Add HRV 3C in end Protease cleavage site coded sequence and EcoRI restriction enzyme site sequences (5'GAATTCCTGGAAGTTCTGTTCCAG 3'), and in the 3&apos of 5 encoding gene of MutE137 Δs;Add XhoI restriction enzyme site sequences (5&apos in end;CTCGAG 3')；

2) 1) the middle sequence that synthesizes is subjected to EcoRI and XhoI double digestions；Expression vector pET-28a (+) is carried out simultaneously EcoRI and XhoI double digestions；

3) digestion products in (2) are attached with DNA ligase, you can obtain the expression of mutant enzyme MutE137 Δs 5 Carrier；

4) by connection product conversion e. coli bl21 (DE3), the recombinant bacterium for including 5 encoding gene of MutE137 Δs is obtained Strain.

The preparation of embodiment 3 wild enzyme InuAGN25DVS and mutant enzyme MutE137 Δs 5

The recombinant bacterial strain of 5 encoding gene containing Z2-5 and MutE137 Δs is inoculated in LB respectively with 0.1% inoculum concentration (to contain 50μg mL^-1Kanamycins) in culture solution, 37 DEG C of quick oscillation 16h.

Then the bacterium solution of this activation is inoculated into fresh LB with 1% inoculum concentration and (contains 50 μ g mL^-1Kanamycins) culture solution In, about 2-3h (OD of quick oscillation culture₆₀₀Reach 0.6-1.0) after, the IPTG that final concentration 0.25mM is added is induced, in 20 DEG C continue shaken cultivation about 20h.12000rpm centrifuges 5min, collects thalline.With suitable pH=7.0 McIlvaine After buffer suspension thallines, the ultrasonic disruption thalline under low temperature water-bath.The crude enzyme liquid of above intracellular concentration through 13,000rpm from After heart 10min, draws supernatant and distinguish affine and purifying purpose egg with the imidazoles of Nickel-NTA A garose and 0-500mM In vain.Recombinant bacterial strain containing Z2-5 is expressed and the recombinant protein purified is named as InuAGN25DVSHis, MutE137 Δs 5 will be contained The recombinant bacterial strain of encoding gene is expressed and the recombinant protein purified is named as MutE137 Δs 5His.SDS-PAGE results (Fig. 1) table Bright, InuAGN25DVSHis and MutE137 Δs 5His is purified, and product is single band.InuAGN25DVSHis's Amino acid sequence is as shown in SEQ ID NO.5.The amino acid sequence of MutE137 Δs 5His is as shown in SEQ ID NO.6.

According to HRV HRV 3CP specifications, with the difference digestion of HRV HRV 3CPs InuAGN25DVSHis and MutE137 Δ 5His, histidine tag and pET-28a (+) carrier of the removal positioned at InuAGN25DVSHis and MutE137 Δ 5His N-terminals Included amino acid sequence, digestion products after purification, obtain InuAGN25DVS and MutE137 Δs through Nickel-NTA Agarose 5.SDS-PAGE results (Fig. 1) show that the histidine tag of N-terminal and pET-28a (+) carrier carry amino acid sequence and successfully cut It removes, also, InuAGN25DVS and MutE137 Δs 5 are all purified, product is single band.The amino of InuAGN25DVS Acid sequence is as shown in SEQ ID NO.7.

The property of wild enzyme InuAGN25DVS and mutant enzyme MutE137 Δs 5 that embodiment 4 purifies measure

1) activity analysis of the wild enzyme InuAGN25DVS and mutant enzyme MutE137 Δs 5 purified

Activity determination method uses 3,5- dinitrosalicylic acids (DNS) method：Substrate inulin is dissolved in buffer solution, it is made Final concentration of 0.5% (w/v)；Reaction system contains the 50 appropriate enzyme solutions of μ L, 450 μ L substrates；Substrate preheats 5min at the reaction temperatures Afterwards, react 10min again after enzyme solution being added, then plus 750 μ L DNS terminate reaction, boiling water boiling 5min, after being cooled to room temperature OD values are measured under 540nm wavelength；1 enzyme-activity unit (U) is defined as bottom exploded object per minute under given conditions and generates 1 μm of ol Enzyme amount needed for reduced sugar (in terms of fructose).

2) the pH activity and pH Stability Determinations of the wild enzyme InuAGN25DVS and mutant enzyme MutE137 Δs 5 purified

The pH determinations of activity of enzyme：Enzyme solution is placed at 37 DEG C and carries out enzymatic reaction in the buffer solution of pH=5.0-8.0.Enzyme PH Stability Determinations：Enzyme solution is placed in the buffer solution of pH=3.0-11.0,1h is handled at 20 DEG C, then in pH=6.0 And enzymatic reaction is carried out at 37 DEG C.Buffer solution is：McIlvaine buffer (pH=3.0-8.0) and 0.1M glycine- NaOH (pH=9.0-12.0).Using inulin as substrate, 10min is reacted, wild enzyme InuAGN25DVS and mutant enzyme are measured The zymologic property of MutE137 Δs 5.

The result shows that：The optimal pH of wild enzyme InuAGN25DVS and mutant enzyme MutE137 Δs 5 is all 6.0 (Fig. 2) respectively； The enzyme activity of buffer solution processing 1h, wild enzyme InuAGN25DVS and mutant enzyme MutE137 Δs 5 through pH4.0-10.0 remain in 70% or more (Fig. 3).

3) thermal activities and thermal stability determination of the wild enzyme InuAGN25DVS and mutant enzyme MutE137 Δs 5 purified

The thermal activities of enzyme measure：In the buffer solution of pH=6.0, enzymatic reaction is carried out at 0-60 DEG C.The thermostabilization of enzyme Property measure：After the enzyme solution of same enzyme amount is placed in 50 DEG C of 0-60min of processing, enzymatic reaction is carried out at pH=6.0 and 37 DEG C, with Untreated enzyme solution is as a contrast.Using inulin as substrate, 10min is reacted, wild enzyme InuAGN25DVS and mutant enzyme are measured The zymologic property of MutE137 Δs 5.

The result shows that：The optimum temperature of wild enzyme InuAGN25DVS is 45 DEG C, at 0 DEG C, 10 DEG C, 20 DEG C, 30 DEG C and 50 DEG C When be respectively provided with 11%, 21%, 36%, 68% and 89% enzyme activity, and the optimum temperature of mutant enzyme MutE137 Δs 5 be 35 DEG C, 15%, 25%, 47%, 86% and 42% enzyme activity (Fig. 4) is respectively provided at 0 DEG C, 10 DEG C, 20 DEG C, 30 DEG C and 50 DEG C；50℃ After handling 60min, the enzyme activity of wild enzyme InuAGN25DVS residues 64%, and the enzyme activity of 5 residue 42% of mutant enzyme MutE137 Δs (Fig. 5).

4) product analysis of 5 hydrolytic inulin of wild enzyme InuAGN25DVS and mutant enzyme MutE137 Δs purified

Product analysis reaction system contains the inulin of 450 μ L 0.5% (w/v), and 50 μ L suitably dilute enzyme solution (total 0.1U enzymes Liquid).At pH6.0 and 37 DEG C, reaction is terminated after enzymatic reaction 4h.Product analysis (uses Qingdao Haiyang using thin layer chromatography The High Performance Thin Layer Chromatography silica gel plate G types of Chemical Co., Ltd.).

Thin-layer chromatography is shown in steps are as follows：

1. preparing solvent (glacial acetic acid 20mL, distilled water 20mL, n-butanol 40mL, mixing), takes and pours into developing tank in right amount, Stand 30min or so；

2. silica gel plate is placed in 110 DEG C of baking ovens and activates 30min, cross after cooling, (0.5 μ L every time are dried up point sample, altogether Point 3 times)；

3. one end silica gel plate of point sample is put into developing tank downward, point of sample not submerge solvent；

4. to be deployed dose to away from silica gel plate upper edge 1.5cm when, take out silica gel plate, drying is reinflated primary；

After 5. second is unfolded, silica gel plate is directly immersed in appropriate color developing agent, and (1g diphenylamines is dissolved in 50mL acetone, molten 1mL aniline and the phosphoric acid of 5mL 85%, mixing, matching while using are added after solution)；

6. after several seconds, taking out silica gel plate immediately and being positioned over 10-15min in 90 DEG C of baking ovens, make spot development.

The result shows that：The product of 5 hydrolytic inulin of wild enzyme InuAGN25DVS and mutant enzyme MutE137 Δs is nearly all fruit Sugared (Fig. 6).

Those skilled in the art of the present technique are appreciated that unless otherwise defined, all terms used herein (including technology art Language and scientific terminology) there is meaning identical with the general understanding of the those of ordinary skill in fields of the present invention.Should also Understand, those terms such as defined in the general dictionary, which should be understood that, to be had and the meaning in the context of the prior art The consistent meaning of justice, and unless defined as here, will not be with idealizing or the meaning of too formal be explained.

It should be noted last that：The above embodiments are only used to illustrate and not limit the technical solutions of the present invention, although ginseng It is described the invention in detail according to above-described embodiment, it will be apparent to an ordinarily skilled person in the art that：It still can be to this Invention is modified or replaced equivalently, without departing from the spirit or scope of the invention, or any substitutions, It is intended to be within the scope of the claims of the invention.

Sequence table

<110>Yunnan Normal University

<120>A kind of low temperature exoinulinase mutant MutE137 Δs 5 and its application

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 476

<212> PRT

<213>Mutant enzyme (MutE137 Δs 5)

<400> 1

Gly Pro Gln Thr Gly Gln His Lys Gln Gly Asp Pro Glu Glu Lys Tyr

1 5 10 15

Arg Pro Leu Tyr His Phe Thr Pro Gln Gln Gly Trp Met Asn Asp Pro

20 25 30

Asn Gly Leu Val Tyr Leu Asp Gly Asn Tyr His Leu Phe Phe Gln His

35 40 45

Asn Pro Glu Lys Pro Val Trp Gly Pro Met His Trp Gly His Ala Ile

50 55 60

Ser Lys Asp Leu Ile His Trp Asp Glu Gln Lys Ile Ala Leu Tyr Pro

65 70 75 80

Asp Ser Leu Gly Thr Ile Phe Ser Gly Ser Ala Val Ile Asp Lys Asp

85 90 95

Asn Thr Ala Gly Phe Gly Lys Gly Ala Met Val Ala Ile Phe Thr His

100 105 110

His Asn His Gln Thr Gly Leu His Gln Asn Gln Ser Leu Ala Tyr Ser

115 120 125

Leu Asp Lys Gly Leu Thr Trp Thr Lys Tyr Lys Gly Asn Pro Val Leu

130 135 140

Pro Asn Pro Gly Ile Trp Asp Phe Arg Asp Pro Lys Val Met Trp His

145 150 155 160

Val His Ser Gln Arg Trp Ile Met Thr Leu Ala Thr Lys Asp Cys Ile

165 170 175

Thr Phe Tyr Ser Ser Lys Asp Leu Lys Thr Trp Gln Lys Glu Ser Glu

180 185 190

Phe Gly Lys Glu Val Gly Ala His Gly Gly Val Trp Glu Cys Pro Asp

195 200 205

Leu Ile Pro Met Asp Tyr Lys Gly Thr Thr Lys Trp Val Leu Leu Val

210 215 220

Ser Ile Asn Pro Gly Gly Pro Asn Gly Gly Ser Val Thr Gln Tyr Phe

225 230 235 240

Val Gly Asp Phe Asp Gly His Gln Phe Arg Thr Thr Asp Thr Lys Ile

245 250 255

Lys Trp Leu Asp Trp Gly Pro Asp Asn Tyr Ala Gly Val Thr Trp Ser

260 265 270

Asn Leu Gly Asp Arg Gln Leu Met Ile Gly Trp Met Ser Asn Trp Gln

275 280 285

Tyr Ala Asn Val Val Pro Thr Thr Lys Trp Arg Ser Ser Ser Thr Ile

290 295 300

Pro Arg Val Leu Ser Leu Gly Lys Val Gly Gln Ser Phe Tyr Val Ala

305 310 315 320

Ser Thr Val Pro Lys Glu Ile Glu Thr Ala Phe Arg Pro Leu Lys Lys

325 330 335

Tyr His Gly Gly Gly Thr Lys Glu Val Ser Phe Glu Gln His Leu Pro

340 345 350

Gln Ala Tyr Arg Leu Asp Leu Lys Asp Leu Lys Gln Gln Ala Phe Lys

355 360 365

Val Ile Leu Ser Asn Glu Ser Gly Asp Glu Leu Val Ile Gly Tyr Arg

370 375 380

Glu Asp Gln Asn Ala Tyr Tyr Ile Asp Arg Ser Lys Ser Gly Glu Val

385 390 395 400

Ser Phe Asn Gly Glu Phe Pro Lys Ile Ala Leu Ala Gln Arg Pro Leu

405 410 415

Asn Lys Gly Ala Leu Ser Phe Ser Leu Tyr Val Asp Val Ser Ser Val

420 425 430

Glu Leu Phe Ala Asp Glu Gly Leu Thr Val Met Thr Ser Leu Phe Phe

435 440 445

Pro Asn Lys Pro Ile Thr Lys Leu Arg Ile Val Gly Asp Lys Lys Leu

450 455 460

Glu Phe Gln Glu Ile Gly Ile Ser Ala Phe Lys Arg

465 470 475

<210> 2

<211> 1431

<212> DNA

<213>Encoding gene (MutE137 Δs 5)

<400> 2

gggccccaga cgggacagca taaacaagga gatcccgaag agaagtatcg cccactttac 60

cattttacac cacagcaggg ttggatgaac gatcccaatg gactggttta tctggacggt 120

aattatcatc ttttttttca gcataatccc gaaaaacccg tttgggggcc tatgcattgg 180

ggccatgcga tcagtaaaga tttaatccat tgggacgagc agaagatcgc attgtacccc 240

gatagtttgg ggactatttt ctccggtagt gctgtaatcg ataaagataa cacggcaggt 300

tttggaaaag gtgctatggt cgccattttt acccatcaca atcatcagac aggattgcat 360

caaaatcaaa gtttggctta tagtttggac aagggcctta cctggacaaa gtataaaggc 420

aatccggtat tgccaaaccc tggtatatgg gatttcagag atccaaaggt gatgtggcat 480

gtgcatagcc agcgttggat tatgaccttg gctacaaaag attgtattac tttctattct 540

tccaaagatt tgaaaacatg gcagaaggaa agtgagtttg gcaaagaggt gggggcccat 600

ggtggtgtct gggaatgccc tgatcttatc cccatggatt acaaaggaac tacaaaatgg 660

gttttgttgg tgagcatcaa tccaggtgga cccaacggtg gctcggtgac acaatatttt 720

gtgggtgact ttgatgggca tcagttccga acaacggata ctaaaataaa gtggttggat 780

tggggacccg ataactatgc cggcgtaacc tggagtaacc taggggatag gcaactgatg 840

attggctgga tgagcaactg gcaatatgcc aatgtggttc ctaccacaaa atggcgttcc 900

tcctcaacca tacctcgtgt tttatcttta ggaaaagttg gacagtcgtt ctacgttgcg 960

agtactgtgc ccaaagaaat tgaaaccgca tttcgtccac taaaaaaata ccatggcggt 1020

ggaacgaagg aagtttcgtt cgagcaacat ctcccacaag cgtaccgttt ggacctcaaa 1080

gatttgaagc agcaggcttt taaagtcatc ttatcgaatg aatctggcga cgagttggtt 1140

attggttatc gtgaagacca aaatgcctat tatattgatc gttctaagtc cggtgaagtg 1200

tcttttaatg gagaatttcc aaagatagcg ttggcccaac ggccgctaaa taagggagca 1260

ctttctttca gtttgtatgt tgatgtgagc tctgtggaac tttttgcaga cgaggggcta 1320

acggtaatga ccagtttatt ttttccgaac aagccgataa ccaagctgcg tatcgtggga 1380

gataaaaagt tggagtttca ggaaatcggt atttctgcat ttaagagata a 1431

<210> 3

<211> 501

<212> PRT

<213>Wild enzyme (AGC01503)

<400> 3

Met Ile Lys Leu Lys Lys Tyr Gly Val Leu Met Leu Leu Leu Gly Val

1 5 10 15

Phe Gly Thr Ser Leu Ala Gln Thr Gly Gln His Lys Gln Gly Asp Pro

20 25 30

Glu Glu Lys Tyr Arg Pro Leu Tyr His Phe Thr Pro Gln Gln Gly Trp

35 40 45

Met Asn Asp Pro Asn Gly Leu Val Tyr Leu Asp Gly Asn Tyr His Leu

50 55 60

Phe Phe Gln His Asn Pro Glu Lys Pro Val Trp Gly Pro Met His Trp

65 70 75 80

Gly His Ala Ile Ser Lys Asp Leu Ile His Trp Asp Glu Gln Lys Ile

85 90 95

Ala Leu Tyr Pro Asp Ser Leu Gly Thr Ile Phe Ser Gly Ser Ala Val

100 105 110

Ile Asp Lys Asp Asn Thr Ala Gly Phe Gly Lys Gly Ala Met Val Ala

115 120 125

Ile Phe Thr His His Asn His Gln Glu Glu Asp Arg Lys Thr Gly Leu

130 135 140

His Gln Asn Gln Ser Leu Ala Tyr Ser Leu Asp Lys Gly Leu Thr Trp

145 150 155 160

Thr Lys Tyr Lys Gly Asn Pro Val Leu Pro Asn Pro Gly Ile Trp Asp

165 170 175

Phe Arg Asp Pro Lys Val Met Trp His Val His Ser Gln Arg Trp Ile

180 185 190

Met Thr Leu Ala Thr Lys Asp Cys Ile Thr Phe Tyr Ser Ser Lys Asp

195 200 205

Leu Lys Thr Trp Gln Lys Glu Ser Glu Phe Gly Lys Glu Val Gly Ala

210 215 220

His Gly Gly Val Trp Glu Cys Pro Asp Leu Ile Pro Met Asp Tyr Lys

225 230 235 240

Gly Thr Thr Lys Trp Val Leu Leu Val Ser Ile Asn Pro Gly Gly Pro

245 250 255

Asn Gly Gly Ser Val Thr Gln Tyr Phe Val Gly Asp Phe Asp Gly His

260 265 270

Gln Phe Arg Thr Thr Asp Thr Lys Ile Lys Trp Leu Asp Trp Gly Pro

275 280 285

Asp Asn Tyr Ala Gly Val Thr Trp Ser Asn Leu Gly Asp Arg Gln Leu

290 295 300

Met Ile Gly Trp Met Ser Asn Trp Gln Tyr Ala Asn Val Val Pro Thr

305 310 315 320

Thr Lys Trp Arg Ser Ser Ser Thr Ile Pro Arg Val Leu Ser Leu Gly

325 330 335

Lys Val Gly Gln Ser Phe Tyr Val Ala Ser Thr Val Pro Lys Glu Ile

340 345 350

Glu Thr Ala Phe Arg Pro Leu Lys Lys Tyr His Gly Gly Gly Thr Lys

355 360 365

Glu Val Ser Phe Glu Gln His Leu Pro Gln Ala Tyr Arg Leu Asp Leu

370 375 380

Lys Asp Leu Lys Gln Gln Ala Phe Lys Val Ile Leu Ser Asn Glu Ser

385 390 395 400

Gly Asp Glu Leu Val Ile Gly Tyr Arg Glu Asp Gln Asn Ala Tyr Tyr

405 410 415

Ile Asp Arg Ser Lys Ser Gly Glu Val Ser Phe Asn Gly Glu Phe Pro

420 425 430

Lys Ile Ala Leu Ala Gln Arg Pro Leu Asn Lys Gly Ala Leu Ser Phe

435 440 445

Ser Leu Tyr Val Asp Val Ser Ser Val Glu Leu Phe Ala Asp Glu Gly

450 455 460

Leu Thr Val Met Thr Ser Leu Phe Phe Pro Asn Lys Pro Ile Thr Lys

465 470 475 480

Leu Arg Ile Val Gly Asp Lys Lys Leu Glu Phe Gln Glu Ile Gly Ile

485 490 495

Ser Ala Phe Lys Arg

500

<210> 4

<211> 1506

<212> DNA

<213>Wild enzyme gene (JQ863108)

<400> 4

atgataaaat taaagaaata cggtgtttta atgctcctgc taggtgtttt tggtacaagt 60

ctggcacaga cgggacagca taaacaagga gatcccgaag agaagtatcg cccactttac 120

cattttacac cacagcaggg ttggatgaac gatcccaatg gactggttta tctggacggt 180

aattatcatc ttttttttca gcataatccc gaaaaacccg tttgggggcc tatgcattgg 240

ggccatgcga tcagtaaaga tttaatccat tgggacgagc agaagatcgc attgtacccc 300

gatagtttgg ggactatttt ctccggtagt gctgtaatcg ataaagataa cacggcaggt 360

tttggaaaag gtgctatggt cgccattttt acccatcaca atcatcagga agaggatcga 420

aaaacaggat tgcatcaaaa tcaaagtttg gcttatagtt tggacaaggg ccttacctgg 480

acaaagtata aaggcaatcc ggtattgcca aaccctggta tatgggattt cagagatcca 540

aaggtgatgt ggcatgtgca tagccagcgt tggattatga ccttggctac aaaagattgt 600

attactttct attcttccaa agatttgaaa acatggcaga aggaaagtga gtttggcaaa 660

gaggtggggg cccatggtgg tgtctgggaa tgccctgatc ttatccccat ggattacaaa 720

ggaactacaa aatgggtttt gttggtgagc atcaatccag gtggacccaa cggtggctcg 780

gtgacacaat attttgtggg tgactttgat gggcatcagt tccgaacaac ggatactaaa 840

ataaagtggt tggattgggg acccgataac tatgccggcg taacctggag taacctaggg 900

gataggcaac tgatgattgg ctggatgagc aactggcaat atgccaatgt ggttcctacc 960

acaaaatggc gttcctcctc aaccatacct cgtgttttat ctttaggaaa agttggacag 1020

tcgttctacg ttgcgagtac tgtgcccaaa gaaattgaaa ccgcatttcg tccactaaaa 1080

aaataccatg gcggtggaac gaaggaagtt tcgttcgagc aacatctccc acaagcgtac 1140

cgtttggacc tcaaagattt gaagcagcag gcttttaaag tcatcttatc gaatgaatct 1200

ggcgacgagt tggttattgg ttatcgtgaa gaccaaaatg cctattatat tgatcgttct 1260

aagtccggtg aagtgtcttt taatggagaa tttccaaaga tagcgttggc ccaacggccg 1320

ctaaataagg gagcactttc tttcagtttg tatgttgatg tgagctctgt ggaacttttt 1380

gcagacgagg ggctaacggt aatgaccagt ttattttttc cgaacaagcc gataaccaag 1440

ctgcgtatcg tgggagataa aaagttggag tttcaggaaa tcggtatttc tgcatttaag 1500

agataa 1506

<210> 5

<211> 523

<212> PRT

<213>Recombinate wild enzyme (InuAGN25DVSHis)

<400> 5

Met Gly Ser Ser His His His His His His Ser Ser Gly Leu Val Pro

1 5 10 15

Arg Gly Ser His Met Ala Ser Met Thr Gly Gly Gln Gln Met Gly Arg

20 25 30

Gly Ser Glu Phe Leu Glu Val Leu Phe Gln Gly Pro Gln Thr Gly Gln

35 40 45

His Lys Gln Gly Asp Pro Glu Glu Lys Tyr Arg Pro Leu Tyr His Phe

50 55 60

Thr Pro Gln Gln Gly Trp Met Asn Asp Pro Asn Gly Leu Val Tyr Leu

65 70 75 80

Asp Gly Asn Tyr His Leu Phe Phe Gln His Asn Pro Glu Lys Pro Val

85 90 95

Trp Gly Pro Met His Trp Gly His Ala Ile Ser Lys Asp Leu Ile His

100 105 110

Trp Asp Glu Gln Lys Ile Ala Leu Tyr Pro Asp Ser Leu Gly Thr Ile

115 120 125

Phe Ser Gly Ser Ala Val Ile Asp Lys Asp Asn Thr Ala Gly Phe Gly

130 135 140

Lys Gly Ala Met Val Ala Ile Phe Thr His His Asn His Gln Glu Glu

145 150 155 160

Asp Arg Lys Thr Gly Leu His Gln Asn Gln Ser Leu Ala Tyr Ser Leu

165 170 175

Asp Lys Gly Leu Thr Trp Thr Lys Tyr Lys Gly Asn Pro Val Leu Pro

180 185 190

Asn Pro Gly Ile Trp Asp Phe Arg Asp Pro Lys Val Met Trp His Val

195 200 205

His Ser Gln Arg Trp Ile Met Thr Leu Ala Thr Lys Asp Cys Ile Thr

210 215 220

Phe Tyr Ser Ser Lys Asp Leu Lys Thr Trp Gln Lys Glu Ser Glu Phe

225 230 235 240

Gly Lys Glu Val Gly Ala His Gly Gly Val Trp Glu Cys Pro Asp Leu

245 250 255

Ile Pro Met Asp Tyr Lys Gly Thr Thr Lys Trp Val Leu Leu Val Ser

260 265 270

Ile Asn Pro Gly Gly Pro Asn Gly Gly Ser Val Thr Gln Tyr Phe Val

275 280 285

Gly Asp Phe Asp Gly His Gln Phe Arg Thr Thr Asp Thr Lys Ile Lys

290 295 300

Trp Leu Asp Trp Gly Pro Asp Asn Tyr Ala Gly Val Thr Trp Ser Asn

305 310 315 320

Leu Gly Asp Arg Gln Leu Met Ile Gly Trp Met Ser Asn Trp Gln Tyr

325 330 335

Ala Asn Val Val Pro Thr Thr Lys Trp Arg Ser Ser Ser Thr Ile Pro

340 345 350

Arg Val Leu Ser Leu Gly Lys Val Gly Gln Ser Phe Tyr Val Ala Ser

355 360 365

Thr Val Pro Lys Glu Ile Glu Thr Ala Phe Arg Pro Leu Lys Lys Tyr

370 375 380

His Gly Gly Gly Thr Lys Glu Val Ser Phe Glu Gln His Leu Pro Gln

385 390 395 400

Ala Tyr Arg Leu Asp Leu Lys Asp Leu Lys Gln Gln Ala Phe Lys Val

405 410 415

Ile Leu Ser Asn Glu Ser Gly Asp Glu Leu Val Ile Gly Tyr Arg Glu

420 425 430

Asp Gln Asn Ala Tyr Tyr Ile Asp Arg Ser Lys Ser Gly Glu Val Ser

435 440 445

Phe Asn Gly Glu Phe Pro Lys Ile Ala Leu Ala Gln Arg Pro Leu Asn

450 455 460

Lys Gly Ala Leu Ser Phe Ser Leu Tyr Val Asp Val Ser Ser Val Glu

465 470 475 480

Leu Phe Ala Asp Glu Gly Leu Thr Val Met Thr Ser Leu Phe Phe Pro

485 490 495

Asn Lys Pro Ile Thr Lys Leu Arg Ile Val Gly Asp Lys Lys Leu Glu

500 505 510

Phe Gln Glu Ile Gly Ile Ser Ala Phe Lys Arg

515 520

<210> 6

<211> 518

<212> PRT

<213>Recombination mutation enzyme (MutE137 Δ 5His)

<400> 6

Met Gly Ser Ser His His His His His His Ser Ser Gly Leu Val Pro

1 5 10 15

Arg Gly Ser His Met Ala Ser Met Thr Gly Gly Gln Gln Met Gly Arg

20 25 30

Gly Ser Glu Phe Leu Glu Val Leu Phe Gln Gly Pro Gln Thr Gly Gln

35 40 45

His Lys Gln Gly Asp Pro Glu Glu Lys Tyr Arg Pro Leu Tyr His Phe

50 55 60

Thr Pro Gln Gln Gly Trp Met Asn Asp Pro Asn Gly Leu Val Tyr Leu

65 70 75 80

Asp Gly Asn Tyr His Leu Phe Phe Gln His Asn Pro Glu Lys Pro Val

85 90 95

Trp Gly Pro Met His Trp Gly His Ala Ile Ser Lys Asp Leu Ile His

100 105 110

Trp Asp Glu Gln Lys Ile Ala Leu Tyr Pro Asp Ser Leu Gly Thr Ile

115 120 125

Phe Ser Gly Ser Ala Val Ile Asp Lys Asp Asn Thr Ala Gly Phe Gly

130 135 140

Lys Gly Ala Met Val Ala Ile Phe Thr His His Asn His Gln Thr Gly

145 150 155 160

Leu His Gln Asn Gln Ser Leu Ala Tyr Ser Leu Asp Lys Gly Leu Thr

165 170 175

Trp Thr Lys Tyr Lys Gly Asn Pro Val Leu Pro Asn Pro Gly Ile Trp

180 185 190

Asp Phe Arg Asp Pro Lys Val Met Trp His Val His Ser Gln Arg Trp

195 200 205

Ile Met Thr Leu Ala Thr Lys Asp Cys Ile Thr Phe Tyr Ser Ser Lys

210 215 220

Asp Leu Lys Thr Trp Gln Lys Glu Ser Glu Phe Gly Lys Glu Val Gly

225 230 235 240

Ala His Gly Gly Val Trp Glu Cys Pro Asp Leu Ile Pro Met Asp Tyr

245 250 255

Lys Gly Thr Thr Lys Trp Val Leu Leu Val Ser Ile Asn Pro Gly Gly

260 265 270

Pro Asn Gly Gly Ser Val Thr Gln Tyr Phe Val Gly Asp Phe Asp Gly

275 280 285

His Gln Phe Arg Thr Thr Asp Thr Lys Ile Lys Trp Leu Asp Trp Gly

290 295 300

Pro Asp Asn Tyr Ala Gly Val Thr Trp Ser Asn Leu Gly Asp Arg Gln

305 310 315 320

Leu Met Ile Gly Trp Met Ser Asn Trp Gln Tyr Ala Asn Val Val Pro

325 330 335

Thr Thr Lys Trp Arg Ser Ser Ser Thr Ile Pro Arg Val Leu Ser Leu

340 345 350

Gly Lys Val Gly Gln Ser Phe Tyr Val Ala Ser Thr Val Pro Lys Glu

355 360 365

Ile Glu Thr Ala Phe Arg Pro Leu Lys Lys Tyr His Gly Gly Gly Thr

370 375 380

Lys Glu Val Ser Phe Glu Gln His Leu Pro Gln Ala Tyr Arg Leu Asp

385 390 395 400

Leu Lys Asp Leu Lys Gln Gln Ala Phe Lys Val Ile Leu Ser Asn Glu

405 410 415

Ser Gly Asp Glu Leu Val Ile Gly Tyr Arg Glu Asp Gln Asn Ala Tyr

420 425 430

Tyr Ile Asp Arg Ser Lys Ser Gly Glu Val Ser Phe Asn Gly Glu Phe

435 440 445

Pro Lys Ile Ala Leu Ala Gln Arg Pro Leu Asn Lys Gly Ala Leu Ser

450 455 460

Phe Ser Leu Tyr Val Asp Val Ser Ser Val Glu Leu Phe Ala Asp Glu

465 470 475 480

Gly Leu Thr Val Met Thr Ser Leu Phe Phe Pro Asn Lys Pro Ile Thr

485 490 495

Lys Leu Arg Ile Val Gly Asp Lys Lys Leu Glu Phe Gln Glu Ile Gly

500 505 510

Ile Ser Ala Phe Lys Arg

515

<210> 7

<211> 481

<212> PRT

<213>HRV HRV 3CP digestions recombinate wild enzyme product (InuAGN25DVS)

<400> 7

Gly Pro Gln Thr Gly Gln His Lys Gln Gly Asp Pro Glu Glu Lys Tyr

1 5 10 15

Arg Pro Leu Tyr His Phe Thr Pro Gln Gln Gly Trp Met Asn Asp Pro

20 25 30

Asn Gly Leu Val Tyr Leu Asp Gly Asn Tyr His Leu Phe Phe Gln His

35 40 45

Asn Pro Glu Lys Pro Val Trp Gly Pro Met His Trp Gly His Ala Ile

50 55 60

Ser Lys Asp Leu Ile His Trp Asp Glu Gln Lys Ile Ala Leu Tyr Pro

65 70 75 80

Asp Ser Leu Gly Thr Ile Phe Ser Gly Ser Ala Val Ile Asp Lys Asp

85 90 95

Asn Thr Ala Gly Phe Gly Lys Gly Ala Met Val Ala Ile Phe Thr His

100 105 110

His Asn His Gln Glu Glu Asp Arg Lys Thr Gly Leu His Gln Asn Gln

115 120 125

Ser Leu Ala Tyr Ser Leu Asp Lys Gly Leu Thr Trp Thr Lys Tyr Lys

130 135 140

Gly Asn Pro Val Leu Pro Asn Pro Gly Ile Trp Asp Phe Arg Asp Pro

145 150 155 160

Lys Val Met Trp His Val His Ser Gln Arg Trp Ile Met Thr Leu Ala

165 170 175

Thr Lys Asp Cys Ile Thr Phe Tyr Ser Ser Lys Asp Leu Lys Thr Trp

180 185 190

Gln Lys Glu Ser Glu Phe Gly Lys Glu Val Gly Ala His Gly Gly Val

195 200 205

Trp Glu Cys Pro Asp Leu Ile Pro Met Asp Tyr Lys Gly Thr Thr Lys

210 215 220

Trp Val Leu Leu Val Ser Ile Asn Pro Gly Gly Pro Asn Gly Gly Ser

225 230 235 240

Val Thr Gln Tyr Phe Val Gly Asp Phe Asp Gly His Gln Phe Arg Thr

245 250 255

Thr Asp Thr Lys Ile Lys Trp Leu Asp Trp Gly Pro Asp Asn Tyr Ala

260 265 270

Gly Val Thr Trp Ser Asn Leu Gly Asp Arg Gln Leu Met Ile Gly Trp

275 280 285

Met Ser Asn Trp Gln Tyr Ala Asn Val Val Pro Thr Thr Lys Trp Arg

290 295 300

Ser Ser Ser Thr Ile Pro Arg Val Leu Ser Leu Gly Lys Val Gly Gln

305 310 315 320

Ser Phe Tyr Val Ala Ser Thr Val Pro Lys Glu Ile Glu Thr Ala Phe

325 330 335

Arg Pro Leu Lys Lys Tyr His Gly Gly Gly Thr Lys Glu Val Ser Phe

340 345 350

Glu Gln His Leu Pro Gln Ala Tyr Arg Leu Asp Leu Lys Asp Leu Lys

355 360 365

Gln Gln Ala Phe Lys Val Ile Leu Ser Asn Glu Ser Gly Asp Glu Leu

370 375 380

Val Ile Gly Tyr Arg Glu Asp Gln Asn Ala Tyr Tyr Ile Asp Arg Ser

385 390 395 400

Lys Ser Gly Glu Val Ser Phe Asn Gly Glu Phe Pro Lys Ile Ala Leu

405 410 415

Ala Gln Arg Pro Leu Asn Lys Gly Ala Leu Ser Phe Ser Leu Tyr Val

420 425 430

Asp Val Ser Ser Val Glu Leu Phe Ala Asp Glu Gly Leu Thr Val Met

435 440 445

Thr Ser Leu Phe Phe Pro Asn Lys Pro Ile Thr Lys Leu Arg Ile Val

450 455 460

Gly Asp Lys Lys Leu Glu Phe Gln Glu Ile Gly Ile Ser Ala Phe Lys

465 470 475 480

Arg

<210> 8

<211> 45

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 8

tggaagttct gttccagggg ccccagacgg gacagcataa acaag 45

<210> 9

<211> 37

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 9

ggtggtggtg ttatctctta aatgcagaaa taccgat 37

<210> 10

<211> 27

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 10

agagataaca ccaccaccac caccact 27

<210> 11

<211> 37

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 11

cctggaacag aacttccagg aattcggatc cgcgacc 37

Claims (6)

1. a kind of low temperature exoinulinase mutant MutE137 Δs 5, which is characterized in that the mutant MutE137 Δs 5 Amino acid sequence is as shown in SEQ ID NO.1.

2. the encoding gene of mutant MutE137 Δs 5 described in claim 1, which is characterized in that the core of the encoding gene Nucleotide sequence is as shown in SEQ ID NO.2.

3. including the recombinant vector of the encoding gene described in claim 2.

4. including the recombinant bacterium of the encoding gene described in claim 2.

5. the preparation method of low temperature exoinulinase mutant MutE137 Δs 5 described in claim 1, which is characterized in that including Following steps：

1) in the 5&apos of 5 encoding gene of MutE137 Δs;Add HRV HRV 3CP restriction enzyme site coded sequences in end；

2) 1) sequence in is connected with expression vector pET-28a (+), and connection product is converted into e. coli bl21 (DE3), the recombinant bacterial strain for including 5 encoding gene of MutE137 Δs is obtained；

3) recombinant bacterial strain is cultivated, induction recombination exoinulinase mutant MutE137 Δs 5 are expressed；

4) it recycles and purifies expressed recombination exoinulinase mutant MutE137 Δs 5；

5) HRV HRV 3CP digestions recombination exoinulinase mutant MutE137 Δs 5 are used；

6) it recycles and purifies exoinulinase mutant MutE137 Δs 5；

7) determination of activity.

6. application of the mutant MutE137 Δs 5 described in claim 1 in prepared by food or wine brewing.