CN112646792B - Low-temperature inulase exonuclease mutant MutA122 delta 5 with reduced thermal stability and application - Google Patents

Abstract

The invention relates to the technical field of genetic engineering and protein modification, in particular to a low-temperature exoinulase mutant MutA122 delta 5 with reduced thermal stability and application thereof, wherein the amino acid sequence of the mutant MutA122 delta 5 is obtained on the basis of removing 122 th to 126 th amino acids of wild exoinulase InuAMN8, namely 5 amino acids of AAPLP from 122 th to 126 th positions of InuAMN8 are removed, and the sequence of MutA122 delta 5 is shown as SEQ ID NO. 1. Compared with the wild enzyme InuAMN8, the mutant enzyme MutA122 delta 5 has improved activity at low temperature and reduced thermal stability, is beneficial to low-temperature production and controls the catalytic reaction of the enzyme through temperature change. The low-temperature exoinulase mutant MutA122 delta 5 can be applied to the industries of food, wine brewing, washing and the like.

Description

Low-temperature inulase exonuclease mutant MutA122 delta 5 with reduced thermal stability and application

Technical Field

The invention belongs to the technical field of genetic engineering, relates to a protein modification technology, and particularly relates to a low-temperature inulase exonuclease mutant MutA122 delta 5 with reduced thermal stability and application thereof.

Background

Inulin is fructan with a molecule of glucose residue at the terminal, is rich in various compositae plants such as jerusalem artichoke, chicory and the like, and is a renewable resource with rich sources. The jerusalem artichoke has very strong disease resistance and high yield, is suitable for being planted on barren slopes, arid saline-alkaline non-ploughed marginal lands, and does not compete with crops for farmland.

The inulase exonuclease can degrade inulin into fructose and a small amount of glucose, and produce fructose syrup with the sugar content of up to 95%. Fructose is widely used in the industries of food, medicine, washing and the like. Therefore, the inulinase can be applied to industries such as food, wine brewing, washing and medicine (Singh RS et al. International Journal of Biological Macromolecules,2017, 96.

In order to prevent microbial contamination, loss of nutrients and degradation of food quality, food can be processed and treated at low temperatures; fermentation can be carried out at low temperature for obtaining special flavor, such as sake and wine; aquaculture, home laundry and sewage treatment are usually carried out at low temperatures; furthermore, low temperature reactions save energy consumption compared to high temperature reactions (Cavicchi oligo et al. Microbiological Biotechnology,2011,4 (4): 449-460.). Therefore, low temperature enzymes have important development value.

The enzyme with poor thermal stability is easy to thermally denature, and the denatured enzyme is easy to degrade by protease, so that the catalytic reaction of the enzyme is easy to control, and the use of the enzyme is safer, thereby having application value in the industries of food, wine brewing, medicine and the like. Therefore, the mutant enzyme with reduced thermal stability is obtained, and the application of the mutant enzyme in the industries of food, wine brewing, medicine and the like is facilitated.

Disclosure of Invention

The invention aims to provide a low-temperature exoinulase mutant MutA122 delta 5 with reduced thermal stability, which can be applied to the industries of food, wine brewing, washing and the like.

In order to achieve the technical aim, the invention is specifically realized by the following technical scheme:

the amino acid sequence of the mutant MutA122 delta 5 is shown in SEQ ID NO. 1. Compared with the sequence AGC01505 (SEQ ID NO. 3) recorded in GenBank, the MutA122 delta 5 is reduced by 5 amino acids, namely, the 5 amino acids from the 122 th position to the 126 th position of AAPLP of the AGC01505 are reduced.

The optimal temperature of the mutant MutA122 delta 5 is 35 ℃, the temperature is increased from 0 ℃ to 25 ℃, and the activity of the MutA122 delta 5 is increased from 16% to 78%; after the treatment for 10-60 min at 50 ℃, more than 83% of enzyme activity of MutA122 delta 5 remains; after the treatment at 55 ℃ for 10-60 min, the enzyme activity of MutA122 delta 5 is reduced from 73% to complete inactivation; the enzyme can hydrolyze inulin to produce fructose.

The invention provides a coding gene mutA122 delta 5 of the low-temperature exoinulase mutant MutA122 delta 5, and the nucleotide sequence of the coding gene mutA122 delta 5 is shown as SEQ ID NO. 2.

Another object of the present invention is to provide a recombinant vector comprising the gene mutA 122. Delta.5 encoding a mutant of low-temperature inulinase.

Another object of the invention is to provide a recombinant bacterium containing a low-temperature inulase mutant encoding gene mutA122 delta 5.

In addition, the application of the low-temperature exoinulase mutant MutA122 delta 5 in the preparation of foods, wines and washing products is also within the protection scope of the invention.

The preparation method of the low-temperature exoinulase mutant MutA122 delta 5 specifically comprises the following steps:

1) Connecting a wild exoinulase gene inuAMN8 (SEQ ID NO. 4) with an expression vector pEasy-E1 to obtain a recombinant expression plasmid pEasy-E1-inuAMN8 containing the inuAMN8;

2) Designing mutation primers of 5 'ACCAGTGCCTACAGTGACCTACAGGCAGTCG 3' and 5 'GTCACTGTAGGCAGGTCGG 3' by taking the plasmid pEasy-E1-inuAMN8 as a template, and amplifying by PCR to obtain a recombinant expression plasmid pEasy-E1-mutA122 delta 5 containing mutA122 delta 5;

3) Transforming the recombinant expression plasmid pEasy-E1-mutA122 delta 5 into escherichia coli BL21 (DE 3) to obtain a recombinant strain containing mutA122 delta 5;

4) Culturing the recombinant strain, and inducing the expression of the recombinant exoinulase mutant MutA122 delta 5;

5) Recovering and purifying the expressed recombinant exoinulase mutant MutA122 delta 5;

6) And (4) measuring the activity.

The invention has the beneficial effects that:

compared to the wild enzyme InuAMN8, the mutant enzyme MutA122 Δ 5 has an increased activity at low temperatures and a reduced thermostability. The temperature is increased from 0 ℃ to 20 ℃, the activity of the wild enzyme InuAMN8 is increased from 15% to 58%, and the activity of the mutant enzyme MutA122 delta 5 is increased from 16% to 66%; after the treatment at 55 ℃ for 10-60 min, the enzyme activity of the wild enzyme InuAMN8 is reduced from 70% to 17%, and the enzyme activity of the mutant enzyme MutA122 delta 5 is reduced from 73% to complete inactivation. The low-temperature exoinulase mutant MutA122 delta 5 can be applied to the industries of food, wine brewing, washing and the like.

Drawings

Fig. 1 is an SDS-PAGE analysis of the wild enzyme InuAMN8 and the mutant enzyme MutA122 Δ 5, wherein M: protein Marker;

FIG. 2 is the thermal activity of the purified wild enzyme InuAMN8 and the mutant enzyme MutA 122. DELTA.5;

FIG. 3 shows the stability of the purified wild enzyme InuAMN8 and the mutant enzyme MutA 122. DELTA.5 at 50 ℃;

FIG. 4 shows the stability of the purified wild enzyme InuAMN8 and the mutant enzyme MutA 122. DELTA.5 at 55 ℃;

fig. 5 is a product analysis of the hydrolysis of inulin by the purified wild enzyme InuAMN8 and the mutant enzyme MutA122 Δ 5, wherein W: the wild enzyme InuAMN8 hydrolyzes the product of inulin; CK: control group, containing inulin and inactivated wild enzyme InuAMN8 (boiled for 10 min); f: fructose; g: glucose; mut: the mutant enzyme MutA122 Δ 5 hydrolyzes the product of inulin.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be obtained by a person skilled in the art without inventive step based on the embodiments of the present invention, are within the scope of protection of the present invention.

Experimental materials and reagents in the following examples of the invention:

1. bacterial strains and vectors: escherichia coli BL21 (DE 3) and expression vector pEasy-E1 are available from Beijing Quanyujin Biotechnology, inc.; arthrobacter (Arthrobacter sp.) is supplied by university of faculty in Yunnan.

2. Enzymes and other biochemical reagents: nickel-NTAAgarose was purchased from QIAGEN, DNA polymerase, dNTP and Mut

II Fast Mutagenesis Kit is purchased from Nanjing Novovisan, inulin is purchased from Alfaaesar, bacterial genome DNA extraction Kit is purchased from Tiangen Biochemical technology (Beijing) Co., ltd, and other kits are made in China (all can be purchased from common biochemical reagent company).

3. Culture medium

LB culture medium: peptone 10g, yeast extract 5g, naCl 10g, distilled water was added to 1000mL, and the pH was natural (about 7). On the basis of the solid medium, 2.0% (w/v) agar was added.

Description of the drawings: the molecular biological experiments, which are not specifically described in the following examples, were performed according to the methods listed in molecular cloning, a laboratory manual (third edition) J. SammBruker, or according to the kit and product instructions.

EXAMPLE 1 construction and transformation of expression vector for wild enzyme InuAMN8

1) Extracting Arthrobacter genome DNA: centrifuging the liquid culture for 2d to obtain thallus, adding 1mL of lysozyme, treating at 37 deg.C for 60min, extracting Arthrobacter genome DNA according to the instruction of bacterial genome DNA extraction kit (Tiangen Biochemical technology (Beijing) Co., ltd.), and standing at-20 deg.C for use.

2) Primers 5'ATGAATTCATTGACGACGGC 3' and 5'TCAACGGCCGACGACGTCGA 3' were designed according to the exonuclease nucleotide sequence JQ863111 (SEQ ID No. 4) recorded by GenBank, PCR amplification was performed by using Arthrobacter genome DNA as a template, and the PCR reaction parameters were: denaturation at 95 deg.C for 5min; then, denaturation at 95 ℃ for 30sec, annealing at 58 ℃ for 30sec, elongation at 72 ℃ for 1min for 30sec, and heat preservation at 72 ℃ for 5min after 30 cycles. The PCR result obtains the coding gene inuAMN8 of the wild exoinulase inuAMN8. inuAMN8 can also be obtained by gene synthesis based on the inulinase nucleotide sequence JQ 863111.

3) The wild exoinulase gene inuAMN8 and an expression vector pEasy-E1 are connected to obtain a recombinant expression plasmid pEasy-E1-inuAMN8 containing the inuAMN8.

4) pEasy-E1-inuAMN8 was transformed into E.coli BL21 (DE 3) by heat shock to obtain a recombinant E.coli strain BL21 (DE 3)/inuAMN 8 comprising inuAMN8.

Example 2 construction and transformation of the mutant enzyme MutA 122. DELTA.5 expression vector

1) Designing primers of 5 'ACCAGTGCCTACAGTGACGGCCGGCAGGCGGCCAGTCG 3' and 5 'GTCACTGTAGGCCAGTGTAGAAATGGCCACCA G3', and carrying out PCR amplification by using a plasmid pEasy-E1-inuAMN8 as a template, wherein the PCR reaction parameters are as follows: denaturation at 95 ℃ for 30sec; then, denaturation at 95 ℃ was carried out at 15sec, annealing at 69 ℃ was carried out at 15sec, elongation at 72 ℃ was carried out at 3min 30sec, and after 30 cycles, heat preservation at 72 ℃ was carried out for 5min. The PCR result yielded a recombinant expression linearized plasmid pEasy-E1-mutA 122. Delta.5 containing mutA 122. Delta.5. mutA 122. Delta.5 and pEasy-E1-mutA 122. Delta.5 can also be obtained by gene synthesis.

2) mu.L of DpnI enzyme was added to 50. Mu.L of the PCR product of linearized plasmid pEasy-E1-mutA 122. Delta.5 and digested at 37 ℃ for 1h.

3) Using Mut

II Fast Mutagenesis Kit, the digestion product in (2) was ligated for 30min at 37 ℃.

4) The ligation product in (3) was transformed into E.coli BL21 (DE 3) by heat shock to obtain recombinant strain BL21 (DE 3)/mutA 122 Δ 5 comprising mutA122 Δ 5.

Example 3 preparation of recombinant wild enzyme InuAMN8 and mutant enzyme MutA 122. Delta.5

The recombinant strains BL21 (DE 3)/inuAMN 8 and BL21 (DE 3)/mutA 122. Delta.5 were inoculated in LB (containing 100. Mu.g mL of each) at an inoculum size of 0.1% respectively ^-1 Amp) in the culture medium, the mixture was rapidly shaken at 37 ℃ for 16 hours.

The activated cell suspension was inoculated into fresh LB (100. Mu.g mL) at an inoculum size of 1% ^-1 Amp) culture solution, and performing rapid shaking cultureAfter culturing for about 2-3 h (OD 600 reaches 0.6-1.0), IPTG with a final concentration of 0.7mM is added for induction, and the shaking culture is continued for about 20h at 20 ℃. Centrifugation was carried out at 12000rpm for 5min to collect the cells. After the cells were suspended in an appropriate amount of pH =7.0McIlv air buffer, the cells were disrupted by ultrasonic waves in a low-temperature water bath. After the crude enzyme solution concentrated in the above cells was centrifuged at 13,000rpm for 10min, the supernatant was aspirated and the target protein was respectively subjected to affinity and purification using Nickel-NTA Agarose and 0 to 500mM imidazole.

SDS-PAGE results (FIG. 1) showed that both recombinant InuAMN8 and MutA 122. Delta.5 were purified and the product was a single band.

EXAMPLE 4 characterisation of the purified recombinant wild enzyme InuAMN8 and the mutant enzyme MutA 122. DELTA.5

1) Activity analysis of purified recombinant wild enzyme InuAMN8 and mutant enzyme MutA 122. DELTA.5

The activity determination method adopts a 3, 5-dinitrosalicylic acid (DNS) method: dissolving the substrate inulin in a buffer solution to make the final concentration of the inulin be 0.5% (w/v); the reaction system contains 50 mu L of proper enzyme solution and 450 mu L of substrate; preheating a substrate at a reaction temperature for 5min, adding an enzyme solution, reacting for 10min, adding 750 mu L DNS to terminate the reaction, boiling in boiling water for 5min, cooling to room temperature, and measuring an OD value at a wavelength of 540 nm; 1 enzyme activity unit (U) is defined as the amount of enzyme required to break down the substrate to produce 1. Mu. Mol reducing sugars (calculated as fructose) per minute under the given conditions.

2) Determination of the thermal Activity of the purified recombinant wild enzyme InuAMN8 and the mutant enzyme MutA 122. DELTA.5

The enzymatic reaction was performed at 0 to 60 ℃ in a buffer of pH = 7.0. Reacting for 10min by taking inulin as a substrate, and determining the enzymological properties of the recombinant wild enzyme InuAMN8 and the mutant enzyme MutA122 delta 5.

The results show that: the optimal temperature of the wild enzyme InuAMN8 is 35 ℃, the temperature is increased from 0 ℃ to 20 ℃, and the activity of the wild enzyme InuAMN8 is increased from 15% to 58%; the optimum temperature for the mutant enzyme MutA 122. DELTA.5 was 35 deg.C, the temperature increased from 0 deg.C to 20 deg.C, and the activity of MutA 122. DELTA.5 increased from 16% to 66% (FIG. 2).

3) Thermostability assay of purified recombinant wild enzyme InuAMN8 and mutant enzyme MutA 122. DELTA.5

After treating the enzyme solutions with the same amount of enzyme at 50 ℃ and 55 ℃ for 10 to 60min, respectively, enzymatic reactions were carried out at pH =7.0 and 37 ℃, and the untreated enzyme solution was used as a control. Reacting for 10min by taking inulin as a substrate, and determining the enzymological properties of the recombinant wild enzyme InuAMN8 and the mutant enzyme MutA122 delta 5.

The results show that: after the treatment for 10-60 min at 50 ℃, over 81% of the enzyme activity of the wild enzyme InuAMN8 is remained, and over 83% of the enzyme activity of the mutant enzyme MutA122 delta 5 is remained (figure 3); after the treatment at 55 ℃ for 10-60 min, the enzyme activity of the wild enzyme InuAMN8 is reduced from 70% to 17%, and the enzyme activity of the mutant enzyme MutA122 delta 5 is reduced from 73% to complete inactivation. (FIG. 4).

4) Product analysis of inulin hydrolysis by purified recombinant wild enzyme InuAMN8 and mutant enzyme MutA 122. DELTA.5

Product analysis the reaction system contained 450. Mu.L of 0.5% (w/v) inulin, 50. Mu.L of an appropriate dilution of the enzyme solution (total 0.1U enzyme solution). The reaction was terminated after 4h of enzymatic reaction at pH7.0 and 37 ℃. The product analysis was carried out by thin layer chromatography (using high performance thin layer chromatography silica gel plate type G available from Qingdao ocean chemical Co., ltd.).

The thin layer chromatography procedure is as follows:

(1) preparing a developing solvent (20 mL of glacial acetic acid, 20mL of double distilled water and 40mL of n-butyl alcohol, uniformly mixing), pouring a proper amount into a developing tank, and standing for about 30 min;

(2) activating the silica gel plate in a 110 deg.C oven for 30min, cooling, scribing, and spotting (0.5 μ L each time, blow drying, and spotting for 3 times);

(3) placing a silica gel plate at one end of the sample application into an expansion tank downwards, wherein the sample application point does not immerse a developing agent;

(4) when the developing agent is 1.5cm away from the upper edge of the silica gel plate, taking out the silica gel plate, drying and developing again;

(5) after the second unfolding, directly immersing the silica gel plate into a proper amount of color developing agent (1 g of diphenylamine is dissolved in 50mL of acetone, 1mL of aniline and 5mL of 85% phosphoric acid are added after the dissolution, and the mixture is uniformly mixed and prepared as it is);

(6) after a few seconds, the silica gel plate was immediately removed and placed in an oven at 90 ℃ for 10-15min to develop the spots.

The results show that: the products of hydrolysis of inulin by the wild enzyme InuAMN8 and the mutant enzyme MutA122 Δ 5 are almost all fructose (fig. 5).

It will be understood by those skilled in the art that, unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. It will be further understood that terms, such as those defined in commonly used dictionaries, should be interpreted as having a meaning that is consistent with their meaning in the context of the prior art and will not be interpreted in an idealized or overly formal sense unless expressly so defined herein.

Finally, it should be noted that: although the present invention has been described in detail with reference to the above embodiments, it should be understood by those skilled in the art that: modifications and equivalents may be made thereto without departing from the spirit and scope of the invention and it is intended to cover in the claims the invention as defined in the appended claims.

Sequence listing

<110> university of Yunnan

<120> low-temperature inulase exonuclease mutant MutA122 delta 5 with reduced thermal stability and application

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 500

<212> PRT

<213> mutant enzyme (MutA 122. DELTA.5)

<400> 1

Met Asn Ser Leu Thr Thr Ala Ala Gly Ala Thr Leu Ala Ala Thr Asp

1 5 10 15

Gln Tyr Arg Pro Ala Phe His Tyr Thr Ala Glu Arg Asn Trp Leu Asn

20 25 30

Asp Pro Asn Gly Leu Val Tyr Leu Asn Gly Thr Tyr His Leu Phe Tyr

35 40 45

Gln His Asn Pro Phe Gly Ala Asp Trp Gly Asn Met Ser Trp Gly His

50 55 60

Ala Thr Ser Arg Asp Leu Leu His Trp Asp Glu Gln Pro Val Ala Ile

65 70 75 80

Pro Cys Asp Glu His Glu Ala Ile Phe Ser Gly Ser Ala Val Phe Asp

85 90 95

Gln His Asn Thr Ser Gly Leu Gly Thr Ala Ala Asn Pro Pro Leu Val

100 105 110

Ala Ile Tyr Thr Ser Ala Tyr Ser Asp Gly Arg Gln Ala Gln Ser Leu

115 120 125

Ala Tyr Ser Leu Asp Glu Gly Arg Thr Trp Thr Lys Tyr His Gly Asn

130 135 140

Pro Val Leu Asp Arg Ala Ser Ala Asp Phe Arg Asp Pro Lys Val Phe

145 150 155 160

Trp Tyr Asp Gly Gly Ala Gly Ser Tyr Trp Val Met Val Ala Val Glu

165 170 175

Ala Val Gln Arg Gln Val Val Leu Tyr Lys Ser Ala Asp Leu Lys Ala

180 185 190

Trp Glu His Leu Ser Thr Phe Gly Pro Ala Asn Ala Thr Gly Gly Val

195 200 205

Trp Glu Cys Pro Asp Leu Phe Glu Leu Pro Val Asp Gly Asn Pro Glu

210 215 220

Asp Asn Arg Trp Val Leu Ile Val Asn Ile Asn Pro Gly Gly Ile Ala

225 230 235 240

Gly Gly Ser Ala Gly Gln Tyr Phe Val Gly Glu Phe Asp Gly Val Ala

245 250 255

Phe His Ser Gly Ser Thr Val Thr Glu Gly Leu Gln Lys Asp Ser Ser

260 265 270

Arg Met Arg Glu Tyr Gly Trp Leu Asp Trp Gly Arg Asp Tyr Tyr Ala

275 280 285

Ala Val Ser Phe Ser Asn Val Pro Asp Gly Arg Arg Ile Met Ile Gly

290 295 300

Trp Met Asn Asn Trp Asp Tyr Ala Arg Glu Thr Pro Thr Gly Gly Trp

305 310 315 320

Arg Ser Ala Met Ser Leu Pro Arg Glu Val Ser Leu Thr Arg Val Asp

325 330 335

Gly Lys Val Met Leu Arg Gln Gln Ala Ile Asp Pro Leu Pro Glu Arg

340 345 350

Glu Thr Gly His Val Arg Leu Gly Pro Gln Pro Leu Ala Ser Gly Val

355 360 365

Leu Asp Val Pro Ala Ala Ala Ser Val Ala Arg Ile Asp Val Glu Leu

370 375 380

Glu Pro Gly Ala Ala Ala Gly Val Gly Leu Val Leu Arg Ala Gly Asp

385 390 395 400

Asp Glu Arg Thr Val Leu Arg Tyr Asp Thr Ser Asp Gly Met Leu Arg

405 410 415

Leu Asp Arg Arg Glu Ser Gly Gln Val Ala Phe His Glu Thr Phe Pro

420 425 430

Ser Ile Glu Ala Met Ala Val Pro Leu Gln Gly Gly Arg Leu Arg Leu

435 440 445

Arg Val Tyr Leu Asp Arg Cys Ser Val Glu Val Phe Ala Gln Asp Gly

450 455 460

Leu Ala Thr Leu Thr Asp Leu Val Phe Pro Gly Glu Ala Ser Thr Gly

465 470 475 480

Leu Ala Ile Phe Ala Glu Gly Glu Gly Ala His Leu Val Val Leu Asp

485 490 495

Val Val Gly Arg

500

<210> 2

<211> 1503

<212> DNA

<213> mutant enzyme Gene (mutA 122. DELTA.5)

<400> 2

atgaattcat tgacgacggc ggcgggcgcc acgttggctg ccaccgacca gtaccggccc 60

gcgttccact acaccgccga acggaactgg ttgaacgatc cgaacgggct ggtgtacctc 120

aacggcacct accacctctt ctaccagcac aacccgttcg gcgctgactg gggcaacatg 180

tcctgggggc acgccacctc gcgggacctg ctgcactggg acgagcagcc cgtggccatt 240

ccgtgcgacg aacacgaggc catcttctcc ggctcggcgg tattcgatca gcacaacacc 300

agcggcctcg gcacagcggc caatcccccg ctggtggcca tttacaccag tgcctacagt 360

gacggccggc aggcgcagtc gctcgcctac agcctcgacg aaggccggac ctggaccaag 420

taccacggca atcccgtgct ggaccgcgcg tccgctgact tccgcgatcc aaaggttttt 480

tggtacgacg gcggcgccgg aagttactgg gtgatggtcg ccgtcgaggc ggtgcagcgc 540

caggtagtgc tgtacaagtc ggccgacctg aaggcgtggg aacacctgag cacctttggc 600

cctgccaacg ccaccggcgg cgtctgggaa tgcccggacc tgtttgagct gcccgtggac 660

gggaatccgg aggacaaccg gtgggtcctc attgtgaaca tcaacccggg cggcattgcc 720

ggcggctccg cgggacagta cttcgtggga gagttcgacg gcgtggcgtt ccattccgga 780

tcgactgtca ccgagggcct ccagaaggac agcagccgga tgcgggagta cggctggctg 840

gactgggggc gggactacta cgccgccgtt tcgttcagca acgtgccgga cgggcgccgg 900

atcatgatcg gctggatgaa caactgggac tacgcccgcg agacgcccac cggcggctgg 960

cgcagcgcca tgtccctgcc gcgggaggtg tcgctgaccc gggtagacgg gaaagtgatg 1020

cttcggcagc aagccattga tccgttgccg gagcgggaaa cagggcacgt ccggctgggg 1080

ccgcagccct tggcgtccgg cgttctggac gttccggccg ccgcatccgt ggcgcggatc 1140

gacgttgagc tggagccggg cgctgccgcg ggagtgggac tggtgcttcg ggcgggggac 1200

gatgagcgga cggtcctccg ctacgacact tcggacggga tgctgcggct ggaccgccgc 1260

gaatccgggc aggttgcctt ccacgaaacc ttcccgtcga tcgaagccat ggccgtgccc 1320

ttgcagggag gccggctgcg cctgcgggtc tacctggacc gctgctcggt ggaggttttc 1380

gcccaggacg ggctcgccac gctcactgac ctggtgttcc ccggggaggc gagcacgggc 1440

ctggccatct tcgccgaagg tgagggggcg cacctcgtgg tgctcgacgt cgtcggccgt 1500

tga 1503

<210> 3

<211> 505

<212> PRT

<213> wild enzyme (InuAMN 8)

<400> 3

Met Asn Ser Leu Thr Thr Ala Ala Gly Ala Thr Leu Ala Ala Thr Asp

1 5 10 15

Gln Tyr Arg Pro Ala Phe His Tyr Thr Ala Glu Arg Asn Trp Leu Asn

20 25 30

Asp Pro Asn Gly Leu Val Tyr Leu Asn Gly Thr Tyr His Leu Phe Tyr

35 40 45

Gln His Asn Pro Phe Gly Ala Asp Trp Gly Asn Met Ser Trp Gly His

50 55 60

Ala Thr Ser Arg Asp Leu Leu His Trp Asp Glu Gln Pro Val Ala Ile

65 70 75 80

Pro Cys Asp Glu His Glu Ala Ile Phe Ser Gly Ser Ala Val Phe Asp

85 90 95

Gln His Asn Thr Ser Gly Leu Gly Thr Ala Ala Asn Pro Pro Leu Val

100 105 110

Ala Ile Tyr Thr Ser Ala Tyr Ser Asp Ala Ala Pro Leu Pro Gly Arg

115 120 125

Gln Ala Gln Ser Leu Ala Tyr Ser Leu Asp Glu Gly Arg Thr Trp Thr

130 135 140

Lys Tyr His Gly Asn Pro Val Leu Asp Arg Ala Ser Ala Asp Phe Arg

145 150 155 160

Asp Pro Lys Val Phe Trp Tyr Asp Gly Gly Ala Gly Ser Tyr Trp Val

165 170 175

Met Val Ala Val Glu Ala Val Gln Arg Gln Val Val Leu Tyr Lys Ser

180 185 190

Ala Asp Leu Lys Ala Trp Glu His Leu Ser Thr Phe Gly Pro Ala Asn

195 200 205

Ala Thr Gly Gly Val Trp Glu Cys Pro Asp Leu Phe Glu Leu Pro Val

210 215 220

Asp Gly Asn Pro Glu Asp Asn Arg Trp Val Leu Ile Val Asn Ile Asn

225 230 235 240

Pro Gly Gly Ile Ala Gly Gly Ser Ala Gly Gln Tyr Phe Val Gly Glu

245 250 255

Phe Asp Gly Val Ala Phe His Ser Gly Ser Thr Val Thr Glu Gly Leu

260 265 270

Gln Lys Asp Ser Ser Arg Met Arg Glu Tyr Gly Trp Leu Asp Trp Gly

275 280 285

Arg Asp Tyr Tyr Ala Ala Val Ser Phe Ser Asn Val Pro Asp Gly Arg

290 295 300

Arg Ile Met Ile Gly Trp Met Asn Asn Trp Asp Tyr Ala Arg Glu Thr

305 310 315 320

Pro Thr Gly Gly Trp Arg Ser Ala Met Ser Leu Pro Arg Glu Val Ser

325 330 335

Leu Thr Arg Val Asp Gly Lys Val Met Leu Arg Gln Gln Ala Ile Asp

340 345 350

Pro Leu Pro Glu Arg Glu Thr Gly His Val Arg Leu Gly Pro Gln Pro

355 360 365

Leu Ala Ser Gly Val Leu Asp Val Pro Ala Ala Ala Ser Val Ala Arg

370 375 380

Ile Asp Val Glu Leu Glu Pro Gly Ala Ala Ala Gly Val Gly Leu Val

385 390 395 400

Leu Arg Ala Gly Asp Asp Glu Arg Thr Val Leu Arg Tyr Asp Thr Ser

405 410 415

Asp Gly Met Leu Arg Leu Asp Arg Arg Glu Ser Gly Gln Val Ala Phe

420 425 430

His Glu Thr Phe Pro Ser Ile Glu Ala Met Ala Val Pro Leu Gln Gly

435 440 445

Gly Arg Leu Arg Leu Arg Val Tyr Leu Asp Arg Cys Ser Val Glu Val

450 455 460

Phe Ala Gln Asp Gly Leu Ala Thr Leu Thr Asp Leu Val Phe Pro Gly

465 470 475 480

Glu Ala Ser Thr Gly Leu Ala Ile Phe Ala Glu Gly Glu Gly Ala His

485 490 495

Leu Val Val Leu Asp Val Val Gly Arg

500 505

<210> 4

<211> 1518

<212> DNA

<213> wild enzyme Gene (inuAMN 8)

<400> 4

atgaattcat tgacgacggc ggcgggcgcc acgttggctg ccaccgacca gtaccggccc 60

gcgttccact acaccgccga acggaactgg ttgaacgatc cgaacgggct ggtgtacctc 120

aacggcacct accacctctt ctaccagcac aacccgttcg gcgctgactg gggcaacatg 180

tcctgggggc acgccacctc gcgggacctg ctgcactggg acgagcagcc cgtggccatt 240

ccgtgcgacg aacacgaggc catcttctcc ggctcggcgg tattcgatca gcacaacacc 300

agcggcctcg gcacagcggc caatcccccg ctggtggcca tttacaccag tgcctacagt 360

gacgccgcgc cgcttccggg ccggcaggcg cagtcgctcg cctacagcct cgacgaaggc 420

cggacctgga ccaagtacca cggcaatccc gtgctggacc gcgcgtccgc tgacttccgc 480

gatccaaagg ttttttggta cgacggcggc gccggaagtt actgggtgat ggtcgccgtc 540

gaggcggtgc agcgccaggt agtgctgtac aagtcggccg acctgaaggc gtgggaacac 600

ctgagcacct ttggccctgc caacgccacc ggcggcgtct gggaatgccc ggacctgttt 660

gagctgcccg tggacgggaa tccggaggac aaccggtggg tcctcattgt gaacatcaac 720

ccgggcggca ttgccggcgg ctccgcggga cagtacttcg tgggagagtt cgacggcgtg 780

gcgttccatt ccggatcgac tgtcaccgag ggcctccaga aggacagcag ccggatgcgg 840

gagtacggct ggctggactg ggggcgggac tactacgccg ccgtttcgtt cagcaacgtg 900

ccggacgggc gccggatcat gatcggctgg atgaacaact gggactacgc ccgcgagacg 960

cccaccggcg gctggcgcag cgccatgtcc ctgccgcggg aggtgtcgct gacccgggta 1020

gacgggaaag tgatgcttcg gcagcaagcc attgatccgt tgccggagcg ggaaacaggg 1080

cacgtccggc tggggccgca gcccttggcg tccggcgttc tggacgttcc ggccgccgca 1140

tccgtggcgc ggatcgacgt tgagctggag ccgggcgctg ccgcgggagt gggactggtg 1200

cttcgggcgg gggacgatga gcggacggtc ctccgctacg acacttcgga cgggatgctg 1260

cggctggacc gccgcgaatc cgggcaggtt gccttccacg aaaccttccc gtcgatcgaa 1320

gccatggccg tgcccttgca gggaggccgg ctgcgcctgc gggtctacct ggaccgctgc 1380

tcggtggagg ttttcgccca ggacgggctc gccacgctca ctgacctggt gttccccggg 1440

gaggcgagca cgggcctggc catcttcgcc gaaggtgagg gggcgcacct cgtggtgctc 1500

gacgtcgtcg gccgttga 1518

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atgaattcat tgacgacggc 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tcaacggccg acgacgtcga 20

<210> 7

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

accagtgcct acagtgacgg ccggcaggcg cagtcg 36

<210> 8

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gtcactgtag gcactggtgt aaatggccac cag 33

Claims (6)

1. The low-temperature exoinulase mutant MutA122 delta 5 with reduced thermal stability is characterized in that the amino acid sequence of the mutant MutA122 delta 5 is shown as SEQ ID No. 1.

2. The gene MutA122 Δ 5 encoding a mutant MutA122 Δ 5 according to claim 1, characterized in that the nucleotide sequence encoding the gene MutA122 Δ 5 is as shown in SEQ ID No. 2.

3. A recombinant vector comprising the encoding gene mutA122 Δ 5 as claimed in claim 2.

4. A recombinant bacterium comprising the encoding gene mutA122 Δ 5 according to claim 2.

5. The method for preparing a low-temperature inulinase mutant MutA122 Delta 5 as claimed in claim 1, characterized by comprising the steps of:

1) Connecting a wild exoinulase gene inuAMN8 with an expression vector pEasy-E1 to obtain a recombinant expression plasmid pEasy-E1-inuAMN8 containing the inuAMN8;

2) With plasmid pEasy-E1-inuAMN8 as a template, designing mutation primers of 5 'ACCAGTGCCTACAGTGCGCAGGCGCAGGCGAGTCG 3' and 5 'GTCACTGTAGGCAGGTCAATGGCCACCAG 3', and obtaining a recombinant expression plasmid pEasy-E1-mutA122 delta 5 containing mutA122 delta 5 through PCR amplification;

3) Transforming the recombinant expression plasmid pEasy-E1-mutA122 delta 5 into escherichia coli BL21 (DE 3) to obtain a recombinant strain containing mutA122 delta 5;

4) Culturing the recombinant strain, and inducing the expression of the recombinant exoinulase mutant MutA122 delta 5;

5) Recovering and purifying the expressed recombinant exoinulase mutant MutA122 delta 5;

6) And (4) measuring the activity.

6. Use of the mutant MutA122 Δ 5 according to claim 1 for the preparation of saccharomyces cerevisiae.

Images