CN112646793B - Inulase mutant MutS120D with improved low-temperature adaptability and salt adaptability and application thereof - Google Patents

Abstract

The invention relates to the technical field of genetic engineering and protein modification, and discloses an inulase mutant MutS120D with improved low-temperature adaptability and salt adaptability and application thereof, wherein the amino acid sequence of the mutant MutS120D is obtained by mutating 120 th amino acid (serine) of wild exoinulase InuAMN8 into aspartic acid, and the sequence of the MutS120D is shown as SEQIDNO.1. Compared with the wild enzyme InuAMN8, the mutant enzyme MutS120D has improved low-temperature activity and activity in sodium chloride, and is favorable for the application of the enzyme in the biotechnology fields of low-temperature environment and high-salt environment. The inulase mutant MutS120D with improved low temperature and salt adaptability can be applied to the industries of food, wine brewing, washing and the like.

Description

Inulase mutant MutS120D with improved low-temperature adaptability and salt adaptability and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, relates to a protein modification technology, and particularly relates to an inulase mutant MutS120D with improved low-temperature adaptability and salt adaptability and application thereof.

Background

Inulin is mainly present in roots or stems of plants such as jerusalem artichoke, chicory, dandelion, burdock, artichoke and the like, and is a renewable resource with rich sources. The jerusalem artichoke is low in price and high in yield, more importantly, the jerusalem artichoke belongs to non-grain crops, and the characteristics enable the effective utilization of the jerusalem artichoke to be the focus of attention.

Inulin is hydrolyzed by exoinulase to obtain fructose syrup with sugar content up to 95%. The sweetness of the fructose is 1.5-2.0 times that of the sucrose, and the fructose has low calorie and good flavor and can be used as a natural sweetener to replace the sucrose; the fructose metabolism is not restricted by insulin, and can be eaten by diabetic patients; the fructose can be used for producing bioethanol, 2,3-butanediol and the like after being fermented by yeast and the like. Therefore, the inulinase can be applied to industries such as food, wine and bioenergy (Singh RS et al. International Journal of Biological Macromolecules,2017, 96.

The low-temperature enzyme has high catalytic activity at low temperature, and can be applied to the field of biotechnology under the requirement of low-temperature environment, such as fermentation temperature of sake and wine is generally less than 25 ℃, and aquaculture environment, washing and sewage treatment are generally carried out at low temperature. In addition, treatment at low temperatures (if the juice is clear) can prevent microbial contamination, nutrient loss and food quality degradation, and conversion of the medium-temperature or high-temperature treatment mode to the low-temperature treatment mode can also serve to reduce energy consumption (cavcc hiei et al. Microbiological Biotechnology,2011,4 (4): 449-460.).

The halophilic enzyme still has catalytic activity and stability under high-concentration NaCl, can be applied to the biotechnology field of high-salt food and marine product processing and other high-salt environments, can prevent the pollution of microorganisms when the food is processed under the high-salt environment, and can save energy consumed by sterilization and the like (Margesin et al. Extreme microorganisms, 2001,5

In conclusion, the mutant enzyme with improved low-temperature activity and improved activity in sodium chloride is obtained, and is beneficial to the application of the enzyme in the industries of food, wine brewing, washing and the like.

Disclosure of Invention

The invention aims to provide an inulase mutant MutS120D with improved low-temperature adaptability and salt adaptability, which can be applied to the industries of food, wine brewing, washing and the like.

In order to achieve the technical aim, the invention is specifically realized by the following technical scheme:

an inulase mutant MutS120D with improved low-temperature adaptability and salt adaptability, wherein the amino acid sequence of the mutant MutS120D is shown as SEQ ID NO. 1. In contrast to the sequence of exoinulinase AGC01505 (SEQ ID NO. 3) recorded in GenBank, the 120 th amino acid of MutS120D is aspartic acid, while the 120 th amino acid of AGC01505 is serine.

The mutant MutS120D has an optimum temperature of 30 ℃ and has activities of 16%, 32%, 62%, 86% and 79% at 0 ℃, 10 ℃,20 ℃, 25 ℃ and 40 ℃ respectively; after the treatment for 60min at 50 ℃, 75% of enzyme activity of MutS120D remains; adding 5.0-30.0% (w/v) NaCl into the enzymatic reaction system, and reducing the activity of MutS120D from 95% to 8%; after the MutS120D is treated by 5.0-30.0% (w/v) NaCl for 60min, the enzyme activity of the MutS120D is hardly lost; mutS120D can hydrolyze inulin to produce fructose.

The invention provides a coding gene mutS120D of the inulase mutant mutS120D, and the nucleotide sequence of the coding gene mutS120D is shown in SEQ ID NO. 2.

Another object of the present invention is to provide a recombinant vector comprising the inulase mutant-encoding gene mutS120D.

Another object of the invention is to provide a recombinant bacterium containing the inulase mutant encoding gene mutS120D.

In addition, the application of the inulase mutant MutS120D in the preparation of food, wine and washing products is also within the protection scope of the invention.

The preparation method of the inulase mutant MutS120D provided by the invention specifically comprises the following steps of:

1) Connecting a wild exoinulase gene inuAMN8 (SEQ ID NO. 4) with an expression vector pEasy-E1 to obtain a recombinant expression plasmid pEasy-E1-inuAMN8 containing the inuAMN8;

2) Designing mutation primers of 5 'ACCAGTGCCTACGACGCCGCCGCTTCCG 3' and 5 'TCGTCGTAGGCACTGTGTAAATGGCCACCAG 3' by taking the plasmid pEasy-E1-inuAMN8 as a template, and obtaining a recombinant expression plasmid pEasy-E1-mutS120D containing mutS120D through PCR amplification;

3) Transforming the recombinant expression plasmid pEasy-E1-mutS120D into escherichia coli BL21 (DE 3) to obtain a recombinant strain containing mutS120D;

4) Culturing the recombinant strain, and inducing the expression of the recombinant inulase mutant MutS120D;

5) Recovering and purifying the expressed recombinant inulase mutant MutS120D;

6) And (4) measuring the activity.

The beneficial effects of the invention are as follows:

the mutant enzyme MutS120D has an increased activity at low temperatures and an increased activity in sodium chloride compared to the wild enzyme InuAMN8. The wild enzyme InuAMN8 has an optimum temperature of 35 ℃ and has activity of 74% and 94% at 25 ℃ and 40 ℃ respectively; the mutant enzyme MutS120D has an optimum temperature of 30 ℃ and has 86% and 79% activity at 25 ℃ and 40 ℃, respectively; 5.0-30.0% (w/v) NaCl is added into an enzymatic reaction system, the activity of a wild enzyme InuAMN8 is reduced from 79% to 8%, and the activity of a mutant enzyme MutS120D is reduced from 95% to 8%. The low-temperature exoinulase mutant MutS120D can be applied to the industries of food, wine brewing, washing and the like.

Drawings

FIG. 1 is an SDS-PAGE analysis of the wild-type enzyme InuAMN8 and the mutant enzyme MutS120D, where M: a protein Marker;

FIG. 2 shows the thermal activity of the purified wild enzyme InuAMN8 and the mutant enzyme MutS120D;

FIG. 3 shows the stability of the purified wild-type enzyme InuAMN8 and the mutant enzyme MutS120D at 50 ℃;

FIG. 4 shows the activity of the purified wild enzyme InuAMN8 and the mutant enzyme MutS120D in NaCl;

FIG. 5 shows the stability in NaCl of the purified wild-type enzyme InuAMN8 and the mutant enzyme MutS120D;

FIG. 6 is the product analysis of the hydrolysis of inulin by the purified wild enzyme InuAMN8 and the mutant enzyme MutS120D, wherein W: the product of the hydrolysis of inulin by the wild enzyme InuAMN8; CK: control group, containing inulin and inactivated wild enzyme InuAMN8 (boiled for 10 min); f: fructose; g: glucose; mut: the mutant enzyme MutS120D hydrolyzes the product of inulin.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Experimental materials and reagents in the following examples of the invention:

1. bacterial strain and carrier: escherichia coli BL21 (DE 3) and expression vector pEasy-E1 are available from Beijing Quanyujin Biotechnology, inc.; arthrobacter (Arthrobacter sp.) is supplied by university of faculty in Yunnan.

2. Enzymes and other biochemical reagents: nickel-NTAAgarose was purchased from QIAGEN, DNA polymerase, dNTP and Mut

II Fast Mutagenesis Kit is purchased from Nanjing Novovisan, inulin is purchased from Alfaaesar, bacterial genome DNA extraction Kit is purchased from Tiangen Biochemical technology (Beijing) Co., ltd, and other kits are made in China (all can be purchased from common biochemical reagent company).

3. Culture medium

LB culture medium: peptone 10g, yeast extract 5g, naCl 10g, distilled water was added to 1000mL, and the pH was natural (about 7). On the basis of the solid medium, 2.0% (w/v) agar was added.

Description of the drawings: the molecular biology experiments, which are not specifically described in the following examples, were carried out according to the specific methods listed in molecular cloning, A laboratory Manual (third edition) J. Sambuchok, supra, or according to the kit and product instructions.

EXAMPLE 1 construction and transformation of expression vector for wild enzyme InuAMN8

1) Extracting Arthrobacter genome DNA: centrifuging the liquid culture for 2d to obtain thallus, adding 1mL of lysozyme, treating at 37 deg.C for 60min, extracting Arthrobacter genome DNA according to the instruction of bacterial genome DNA extraction kit (Tiangen Biochemical technology (Beijing) Co., ltd.), and standing at-20 deg.C for use.

2) Based on the nucleotide sequence JQ863111 (SEQ ID NO. 4) of exoinulase recorded in GenBank, primers 5'ATGAATTCATTGACGACGGC 3' and 5'TCAACGGCCGACGACGTCGA 3' were designed, PCR amplification was carried out using Arthrobacter genome DNA as a template, and the PCR reaction parameters were: denaturation at 95 deg.C for 5min; then, denaturation at 95 ℃ for 30sec, annealing at 58 ℃ for 30sec, elongation at 72 ℃ for 1min for 30sec, and heat preservation at 72 ℃ for 5min after 30 cycles. The PCR result obtains the coding gene inuAMN8 of the wild exoinulase inuAMN8. inuAMN8 can also be obtained by gene synthesis according to the inulase exonuclease nucleotide sequence JQ 863111.

3) The exoinulase gene inuAMN8 and an expression vector pEasy-E1 are connected to obtain a recombinant expression plasmid pEasy-E1-inuAMN8 containing the inuAMN8.

4) pEasy-E1-inuAMN8 was transformed into E.coli BL21 (DE 3) by heat shock to obtain a recombinant E.coli strain BL21 (DE 3)/inuAMN 8 comprising inuAMN8.

Example 2 construction and transformation of the expression vector for the mutant enzyme MutS120D

1) Designing primers of 5 'ACCAGTGCCTACGACGCCGCCGCTTCCG 3' and 5 'TCGTCGTAGGCACTTGGTAAATGGCCACCAG 3', and carrying out PCR amplification by using a plasmid pEasy-E1-inuAMN8 as a template, wherein the PCR reaction parameters are as follows: denaturation at 95 ℃ for 30sec; then denaturation at 95 ℃ for 15sec, annealing at 70 ℃ for 15sec, extension at 72 ℃ for 3min for 30sec, and heat preservation at 72 ℃ for 5min after 30 cycles. As a result of PCR, a recombinant expression linearized plasmid pEasy-E1-mutS120D containing mutS120D was obtained. mutS120D and pEasy-E1-mutS120D can also be obtained by gene synthesis.

2) mu.L of DpnI enzyme was added to 50. Mu.L of the PCR product of linearized plasmid pEasy-E1-mutS120D and digested at 37 ℃ for 1h.

3) Using Mut

II Fast Mutagenesis Kit, the digestion product in (2) was ligated for 30min at 37 ℃.

4) The ligation product in (3) was transformed into E.coli BL21 (DE 3) by heat shock to obtain recombinant strain BL21 (DE 3)/mutS 120D comprising mutS120D.

Example 3 preparation of the recombinant wild enzyme InuAMN8 and the mutant enzyme MutS120D

Recombinant strains BL21 (DE 3)/inuAMN 8 and BL21 (DE 3)/mutS 120D were inoculated to LB (containing 100. Mu.g mL) at an inoculum size of 0.1% respectively ^-1 Amp) in the culture medium, the mixture was rapidly shaken at 37 ℃ for 16 hours.

Then, the activated bacterial suspension was inoculated into fresh LB (containing 100. Mu.g mL) in an amount of 1% of the inoculum size ^-1 Amp) culture solution, rapidly shaking and culturing for about 2-3 h (OD 600 reaches 0.6-1.0), adding IPTG with final concentration of 0.7mM for induction, and continuing shaking and culturing for about 20h at 20 ℃. Centrifugation was carried out at 12000rpm for 5min to collect the cells. After the cells were suspended in an appropriate amount of pH =7.0 McIlv air buffer, the cells were disrupted by ultrasonic waves in a low-temperature water bath. After the crude enzyme solution concentrated in the above cells was centrifuged at 13,000rpm for 10min, the supernatant was aspirated and the target protein was respectively subjected to affinity and purification using Nickel-NTA Agarose and 0 to 500mM imidazole.

SDS-PAGE results (FIG. 1) showed that both recombinant InuAMN8 and MutS120D were purified and the product was a single band.

EXAMPLE 4 determination of the Properties of the purified recombinant wild-type enzyme InuAMN8 and the mutant enzyme MutS120D

1) Activity analysis of purified recombinant wild enzyme InuAMN8 and mutant enzyme MutS120D

The activity determination method adopts a 3,5-dinitrosalicylic acid (DNS) method: dissolving the substrate inulin in a buffer solution to make the final concentration of the inulin be 0.5% (w/v); the reaction system contains 50 mu L of proper enzyme solution and 450 mu L of substrate; preheating a substrate at a reaction temperature for 5min, adding an enzyme solution, reacting for 10min, adding 750 mu L DNS to terminate the reaction, boiling in boiling water for 5min, cooling to room temperature, and measuring an OD value at a wavelength of 540 nm; 1 enzyme activity unit (U) is defined as the amount of enzyme required to break down the substrate to produce 1. Mu. Mol reducing sugars (calculated as fructose) per minute under the given conditions.

2) Determination of the thermal Activity of the purified recombinant wild enzyme InuAMN8 and the mutant enzyme MutS120D

The enzymatic reaction was performed at 0 to 60 ℃ in a buffer of pH = 7.0. Reacting for 10min by taking inulin as a substrate, and determining the enzymological properties of the recombinant wild enzyme InuAMN8 and the mutant enzyme MutS120D.

The results show that: the wild enzyme InuAMN8 has an optimum temperature of 35 ℃ and has activities of 15%, 32%, 58%, 74% and 94% at 0 ℃, 10 ℃,20 ℃, 25 ℃ and 40 ℃ respectively; the mutant enzyme MutS120D has an optimum temperature of 30 ℃ and an activity of 16%, 32%, 62%, 86% and 79% at 0 ℃, 10 ℃,20 ℃, 25 ℃ and 40 ℃ respectively (FIG. 2).

3) Thermostability assay of purified recombinant wild enzyme InuAMN8 and mutant enzyme MutS120D

After treating the enzyme solution with the same amount of enzyme at 50 ℃ for 10 to 60min, the enzyme reaction was carried out at pH =7.0 and 37 ℃ with untreated enzyme solution as a control. Reacting for 10min by taking inulin as a substrate, and determining the enzymological properties of the recombinant wild enzyme InuAMN8 and the mutant enzyme MutS120D.

The results show that: after 60min of treatment at 50 ℃, 82% of the enzyme activity of the wild enzyme InuAMN8 is remained, and 75% of the enzyme activity of the mutant enzyme MutS120D is remained (figure 3).

4) Activity assay of the purified recombinant wild enzyme InuAMN8 and the mutant enzyme MutS120D in NaCl

5.0-30.0% (w/v) NaCl is added into the enzymatic reaction system, and the enzymatic reaction is carried out at pH7.0 and 37 ℃. Reacting for 10min by taking inulin as a substrate, and determining the enzymological properties of the recombinant wild enzyme InuAMN8 and the mutant enzyme MutS120D.

The results show that: when NaCl was added in an amount of 5.0-30.0% (w/v) to the enzymatic reaction system, the activity of the wild enzyme InuAMN8 was decreased from 79% to 8%, and the activity of the mutant enzyme MutS120D was decreased from 95% to 8% (FIG. 4).

5) Stability assay of the purified recombinant wild enzyme InuAMN8 and the mutant enzyme MutS120D in NaCl

The purified enzyme solution was placed in an aqueous NaCl solution of 5.0 to 30.0% (w/v), treated at 37 ℃ for 60min, and then subjected to enzymatic reaction at pH7.0 and 37 ℃ with the untreated enzyme solution as a control. Reacting for 10min by taking inulin as a substrate, and determining the enzymological properties of the recombinant wild enzyme InuAMN8 and the mutant enzyme MutS120D.

The results show that: after the mixture is treated by NaCl of 5.0-30.0% (w/v) for 60min, the enzyme activities of the wild enzyme InuAMN8 and the mutant enzyme MutS120D are almost not lost (figure 5).

6) Analysis of the products of hydrolysis of inulin by the purified recombinant wild enzyme InuAMN8 and the mutant enzyme MutS120D

The product analysis reaction system contained 450. Mu.L of 0.5% (w/v) inulin, 50. Mu.L of an appropriate dilution of the enzyme solution (total 0.1U of the enzyme solution). The reaction was terminated after 4h of enzymatic reaction at pH7.0 and 37 ℃. The product analysis was carried out by thin layer chromatography (using high performance thin layer chromatography silica gel plate type G available from Qingdao ocean chemical Co., ltd.).

The thin layer chromatography procedure is as follows:

(1) preparing a developing solvent (20 mL of glacial acetic acid, 20mL of double distilled water and 40mL of n-butanol, uniformly mixing), pouring a proper amount of the developing solvent into a developing tank, and standing for about 30 min;

(2) activating the silica gel plate in a 110 deg.C oven for 30min, cooling, scribing, and spotting (0.5 μ L each time, blow drying, and spotting for 3 times);

(3) placing the silica gel plate at one end of the sample application downwards into an expansion tank, wherein the sample application point does not immerse a developing agent;

(4) when the developing agent is 1.5cm away from the upper edge of the silica gel plate, taking out the silica gel plate, drying and developing again;

(5) after the second unfolding is finished, directly immersing the silica gel plate into a proper amount of color developing agent (1 g of diphenylamine is dissolved in 50mL of acetone, 1mL of aniline and 5mL of 85% phosphoric acid are added after the solution is dissolved, and the mixture is uniformly mixed and prepared on site;

(6) after a few seconds, the silica gel plate was immediately removed and placed in an oven at 90 ℃ for 10-15min to develop the spots.

The results show that: the products of hydrolysis of inulin by the wild enzyme InuAMN8 and the mutant enzyme MutS120D were almost all fructose (FIG. 6).

It will be understood by those skilled in the art that, unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. It will be further understood that terms, such as those defined in commonly used dictionaries, should be interpreted as having a meaning that is consistent with their meaning in the context of the prior art and will not be interpreted in an idealized or overly formal sense unless expressly so defined herein.

Finally, it should be noted that: although the present invention has been described in detail with reference to the above embodiments, it should be understood by those skilled in the art that: modifications and equivalents may be made thereto without departing from the spirit and scope of the invention and it is intended to cover in the claims the invention as defined in the appended claims.

Sequence listing

<110> university of Yunnan

<120> inulase mutant MutS120D with improved low-temperature adaptability and salt adaptability and application thereof

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 505

<212> PRT

<213> mutant enzyme (MutS 120D)

<400> 1

Met Asn Ser Leu Thr Thr Ala Ala Gly Ala Thr Leu Ala Ala Thr Asp

1 5 10 15

Gln Tyr Arg Pro Ala Phe His Tyr Thr Ala Glu Arg Asn Trp Leu Asn

20 25 30

Asp Pro Asn Gly Leu Val Tyr Leu Asn Gly Thr Tyr His Leu Phe Tyr

35 40 45

Gln His Asn Pro Phe Gly Ala Asp Trp Gly Asn Met Ser Trp Gly His

50 55 60

Ala Thr Ser Arg Asp Leu Leu His Trp Asp Glu Gln Pro Val Ala Ile

65 70 75 80

Pro Cys Asp Glu His Glu Ala Ile Phe Ser Gly Ser Ala Val Phe Asp

85 90 95

Gln His Asn Thr Ser Gly Leu Gly Thr Ala Ala Asn Pro Pro Leu Val

100 105 110

Ala Ile Tyr Thr Ser Ala Tyr Asp Asp Ala Ala Pro Leu Pro Gly Arg

115 120 125

Gln Ala Gln Ser Leu Ala Tyr Ser Leu Asp Glu Gly Arg Thr Trp Thr

130 135 140

Lys Tyr His Gly Asn Pro Val Leu Asp Arg Ala Ser Ala Asp Phe Arg

145 150 155 160

Asp Pro Lys Val Phe Trp Tyr Asp Gly Gly Ala Gly Ser Tyr Trp Val

165 170 175

Met Val Ala Val Glu Ala Val Gln Arg Gln Val Val Leu Tyr Lys Ser

180 185 190

Ala Asp Leu Lys Ala Trp Glu His Leu Ser Thr Phe Gly Pro Ala Asn

195 200 205

Ala Thr Gly Gly Val Trp Glu Cys Pro Asp Leu Phe Glu Leu Pro Val

210 215 220

Asp Gly Asn Pro Glu Asp Asn Arg Trp Val Leu Ile Val Asn Ile Asn

225 230 235 240

Pro Gly Gly Ile Ala Gly Gly Ser Ala Gly Gln Tyr Phe Val Gly Glu

245 250 255

Phe Asp Gly Val Ala Phe His Ser Gly Ser Thr Val Thr Glu Gly Leu

260 265 270

Gln Lys Asp Ser Ser Arg Met Arg Glu Tyr Gly Trp Leu Asp Trp Gly

275 280 285

Arg Asp Tyr Tyr Ala Ala Val Ser Phe Ser Asn Val Pro Asp Gly Arg

290 295 300

Arg Ile Met Ile Gly Trp Met Asn Asn Trp Asp Tyr Ala Arg Glu Thr

305 310 315 320

Pro Thr Gly Gly Trp Arg Ser Ala Met Ser Leu Pro Arg Glu Val Ser

325 330 335

Leu Thr Arg Val Asp Gly Lys Val Met Leu Arg Gln Gln Ala Ile Asp

340 345 350

Pro Leu Pro Glu Arg Glu Thr Gly His Val Arg Leu Gly Pro Gln Pro

355 360 365

Leu Ala Ser Gly Val Leu Asp Val Pro Ala Ala Ala Ser Val Ala Arg

370 375 380

Ile Asp Val Glu Leu Glu Pro Gly Ala Ala Ala Gly Val Gly Leu Val

385 390 395 400

Leu Arg Ala Gly Asp Asp Glu Arg Thr Val Leu Arg Tyr Asp Thr Ser

405 410 415

Asp Gly Met Leu Arg Leu Asp Arg Arg Glu Ser Gly Gln Val Ala Phe

420 425 430

His Glu Thr Phe Pro Ser Ile Glu Ala Met Ala Val Pro Leu Gln Gly

435 440 445

Gly Arg Leu Arg Leu Arg Val Tyr Leu Asp Arg Cys Ser Val Glu Val

450 455 460

Phe Ala Gln Asp Gly Leu Ala Thr Leu Thr Asp Leu Val Phe Pro Gly

465 470 475 480

Glu Ala Ser Thr Gly Leu Ala Ile Phe Ala Glu Gly Glu Gly Ala His

485 490 495

Leu Val Val Leu Asp Val Val Gly Arg

500 505

<210> 2

<211> 1518

<212> DNA

<213> mutant enzyme Gene (mutS 120D)

<400> 2

atgaattcat tgacgacggc ggcgggcgcc acgttggctg ccaccgacca gtaccggccc 60

gcgttccact acaccgccga acggaactgg ttgaacgatc cgaacgggct ggtgtacctc 120

aacggcacct accacctctt ctaccagcac aacccgttcg gcgctgactg gggcaacatg 180

tcctgggggc acgccacctc gcgggacctg ctgcactggg acgagcagcc cgtggccatt 240

ccgtgcgacg aacacgaggc catcttctcc ggctcggcgg tattcgatca gcacaacacc 300

agcggcctcg gcacagcggc caatcccccg ctggtggcca tttacaccag tgcctacgac 360

gacgccgcgc cgcttccggg ccggcaggcg cagtcgctcg cctacagcct cgacgaaggc 420

cggacctgga ccaagtacca cggcaatccc gtgctggacc gcgcgtccgc tgacttccgc 480

gatccaaagg ttttttggta cgacggcggc gccggaagtt actgggtgat ggtcgccgtc 540

gaggcggtgc agcgccaggt agtgctgtac aagtcggccg acctgaaggc gtgggaacac 600

ctgagcacct ttggccctgc caacgccacc ggcggcgtct gggaatgccc ggacctgttt 660

gagctgcccg tggacgggaa tccggaggac aaccggtggg tcctcattgt gaacatcaac 720

ccgggcggca ttgccggcgg ctccgcggga cagtacttcg tgggagagtt cgacggcgtg 780

gcgttccatt ccggatcgac tgtcaccgag ggcctccaga aggacagcag ccggatgcgg 840

gagtacggct ggctggactg ggggcgggac tactacgccg ccgtttcgtt cagcaacgtg 900

ccggacgggc gccggatcat gatcggctgg atgaacaact gggactacgc ccgcgagacg 960

cccaccggcg gctggcgcag cgccatgtcc ctgccgcggg aggtgtcgct gacccgggta 1020

gacgggaaag tgatgcttcg gcagcaagcc attgatccgt tgccggagcg ggaaacaggg 1080

cacgtccggc tggggccgca gcccttggcg tccggcgttc tggacgttcc ggccgccgca 1140

tccgtggcgc ggatcgacgt tgagctggag ccgggcgctg ccgcgggagt gggactggtg 1200

cttcgggcgg gggacgatga gcggacggtc ctccgctacg acacttcgga cgggatgctg 1260

cggctggacc gccgcgaatc cgggcaggtt gccttccacg aaaccttccc gtcgatcgaa 1320

gccatggccg tgcccttgca gggaggccgg ctgcgcctgc gggtctacct ggaccgctgc 1380

tcggtggagg ttttcgccca ggacgggctc gccacgctca ctgacctggt gttccccggg 1440

gaggcgagca cgggcctggc catcttcgcc gaaggtgagg gggcgcacct cgtggtgctc 1500

gacgtcgtcg gccgttga 1518

<210> 3

<211> 505

<212> PRT

<213> wild enzyme (InuAMN 8)

<400> 3

Met Asn Ser Leu Thr Thr Ala Ala Gly Ala Thr Leu Ala Ala Thr Asp

1 5 10 15

Gln Tyr Arg Pro Ala Phe His Tyr Thr Ala Glu Arg Asn Trp Leu Asn

20 25 30

Asp Pro Asn Gly Leu Val Tyr Leu Asn Gly Thr Tyr His Leu Phe Tyr

35 40 45

Gln His Asn Pro Phe Gly Ala Asp Trp Gly Asn Met Ser Trp Gly His

50 55 60

Ala Thr Ser Arg Asp Leu Leu His Trp Asp Glu Gln Pro Val Ala Ile

65 70 75 80

Pro Cys Asp Glu His Glu Ala Ile Phe Ser Gly Ser Ala Val Phe Asp

85 90 95

Gln His Asn Thr Ser Gly Leu Gly Thr Ala Ala Asn Pro Pro Leu Val

100 105 110

Ala Ile Tyr Thr Ser Ala Tyr Ser Asp Ala Ala Pro Leu Pro Gly Arg

115 120 125

Gln Ala Gln Ser Leu Ala Tyr Ser Leu Asp Glu Gly Arg Thr Trp Thr

130 135 140

Lys Tyr His Gly Asn Pro Val Leu Asp Arg Ala Ser Ala Asp Phe Arg

145 150 155 160

Asp Pro Lys Val Phe Trp Tyr Asp Gly Gly Ala Gly Ser Tyr Trp Val

165 170 175

Met Val Ala Val Glu Ala Val Gln Arg Gln Val Val Leu Tyr Lys Ser

180 185 190

Ala Asp Leu Lys Ala Trp Glu His Leu Ser Thr Phe Gly Pro Ala Asn

195 200 205

Ala Thr Gly Gly Val Trp Glu Cys Pro Asp Leu Phe Glu Leu Pro Val

210 215 220

Asp Gly Asn Pro Glu Asp Asn Arg Trp Val Leu Ile Val Asn Ile Asn

225 230 235 240

Pro Gly Gly Ile Ala Gly Gly Ser Ala Gly Gln Tyr Phe Val Gly Glu

245 250 255

Phe Asp Gly Val Ala Phe His Ser Gly Ser Thr Val Thr Glu Gly Leu

260 265 270

Gln Lys Asp Ser Ser Arg Met Arg Glu Tyr Gly Trp Leu Asp Trp Gly

275 280 285

Arg Asp Tyr Tyr Ala Ala Val Ser Phe Ser Asn Val Pro Asp Gly Arg

290 295 300

Arg Ile Met Ile Gly Trp Met Asn Asn Trp Asp Tyr Ala Arg Glu Thr

305 310 315 320

Pro Thr Gly Gly Trp Arg Ser Ala Met Ser Leu Pro Arg Glu Val Ser

325 330 335

Leu Thr Arg Val Asp Gly Lys Val Met Leu Arg Gln Gln Ala Ile Asp

340 345 350

Pro Leu Pro Glu Arg Glu Thr Gly His Val Arg Leu Gly Pro Gln Pro

355 360 365

Leu Ala Ser Gly Val Leu Asp Val Pro Ala Ala Ala Ser Val Ala Arg

370 375 380

Ile Asp Val Glu Leu Glu Pro Gly Ala Ala Ala Gly Val Gly Leu Val

385 390 395 400

Leu Arg Ala Gly Asp Asp Glu Arg Thr Val Leu Arg Tyr Asp Thr Ser

405 410 415

Asp Gly Met Leu Arg Leu Asp Arg Arg Glu Ser Gly Gln Val Ala Phe

420 425 430

His Glu Thr Phe Pro Ser Ile Glu Ala Met Ala Val Pro Leu Gln Gly

435 440 445

Gly Arg Leu Arg Leu Arg Val Tyr Leu Asp Arg Cys Ser Val Glu Val

450 455 460

Phe Ala Gln Asp Gly Leu Ala Thr Leu Thr Asp Leu Val Phe Pro Gly

465 470 475 480

Glu Ala Ser Thr Gly Leu Ala Ile Phe Ala Glu Gly Glu Gly Ala His

485 490 495

Leu Val Val Leu Asp Val Val Gly Arg

500 505

<210> 4

<211> 1518

<212> DNA

<213> wild enzyme Gene (inuAMN 8)

<400> 4

atgaattcat tgacgacggc ggcgggcgcc acgttggctg ccaccgacca gtaccggccc 60

gcgttccact acaccgccga acggaactgg ttgaacgatc cgaacgggct ggtgtacctc 120

aacggcacct accacctctt ctaccagcac aacccgttcg gcgctgactg gggcaacatg 180

tcctgggggc acgccacctc gcgggacctg ctgcactggg acgagcagcc cgtggccatt 240

ccgtgcgacg aacacgaggc catcttctcc ggctcggcgg tattcgatca gcacaacacc 300

agcggcctcg gcacagcggc caatcccccg ctggtggcca tttacaccag tgcctacagt 360

gacgccgcgc cgcttccggg ccggcaggcg cagtcgctcg cctacagcct cgacgaaggc 420

cggacctgga ccaagtacca cggcaatccc gtgctggacc gcgcgtccgc tgacttccgc 480

gatccaaagg ttttttggta cgacggcggc gccggaagtt actgggtgat ggtcgccgtc 540

gaggcggtgc agcgccaggt agtgctgtac aagtcggccg acctgaaggc gtgggaacac 600

ctgagcacct ttggccctgc caacgccacc ggcggcgtct gggaatgccc ggacctgttt 660

gagctgcccg tggacgggaa tccggaggac aaccggtggg tcctcattgt gaacatcaac 720

ccgggcggca ttgccggcgg ctccgcggga cagtacttcg tgggagagtt cgacggcgtg 780

gcgttccatt ccggatcgac tgtcaccgag ggcctccaga aggacagcag ccggatgcgg 840

gagtacggct ggctggactg ggggcgggac tactacgccg ccgtttcgtt cagcaacgtg 900

ccggacgggc gccggatcat gatcggctgg atgaacaact gggactacgc ccgcgagacg 960

cccaccggcg gctggcgcag cgccatgtcc ctgccgcggg aggtgtcgct gacccgggta 1020

gacgggaaag tgatgcttcg gcagcaagcc attgatccgt tgccggagcg ggaaacaggg 1080

cacgtccggc tggggccgca gcccttggcg tccggcgttc tggacgttcc ggccgccgca 1140

tccgtggcgc ggatcgacgt tgagctggag ccgggcgctg ccgcgggagt gggactggtg 1200

cttcgggcgg gggacgatga gcggacggtc ctccgctacg acacttcgga cgggatgctg 1260

cggctggacc gccgcgaatc cgggcaggtt gccttccacg aaaccttccc gtcgatcgaa 1320

gccatggccg tgcccttgca gggaggccgg ctgcgcctgc gggtctacct ggaccgctgc 1380

tcggtggagg ttttcgccca ggacgggctc gccacgctca ctgacctggt gttccccggg 1440

gaggcgagca cgggcctggc catcttcgcc gaaggtgagg gggcgcacct cgtggtgctc 1500

gacgtcgtcg gccgttga 1518

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atgaattcat tgacgacggc 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tcaacggccg acgacgtcga 20

<210> 7

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

accagtgcct acgacgacgc cgcgccgctt ccg 33

<210> 8

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

tcgtcgtagg cactggtgta aatggccacc ag 32

Claims (6)

1. An inulase mutant MutS120D with improved low-temperature adaptability and salt adaptability, which is characterized in that the amino acid sequence of the mutant MutS120D is shown as SEQ ID NO. 1.

2. The mutant MutS120D according to claim 1, wherein the nucleotide sequence of the gene mutS120D is as shown in SEQ ID NO. 2.

3. A recombinant vector comprising the gene mutS120D according to claim 2.

4. A recombinant bacterium comprising the gene mutS120D according to claim 2.

5. A process for the preparation of an inulase mutant MutS120D as claimed in claim 1, comprising the steps of:

1) Connecting a wild exoinulase gene inuAMN8 with an expression vector pEasy-E1 to obtain a recombinant expression plasmid pEasy-E1-inuAMN8 containing the inuAMN8;

2) Designing mutation primers of 5 'ACCAGTGCCTACGACGCCGCCGCTTCCG 3' and 5 'TCGTCGTAGGCACTGTGTAAATGGCCACCAG 3' by taking the plasmid pEasy-E1-inuAMN8 as a template, and obtaining a recombinant expression plasmid pEasy-E1-mutS120D containing mutS120D through PCR amplification;

3) Transforming the recombinant expression plasmid pEasy-E1-mutS120D into escherichia coli to obtain a recombinant strain containing mutS120D;

4) Culturing the recombinant strain, and inducing the expression of the recombinant inulase mutant MutS120D;

5) Recovering and purifying the expressed recombinant inulase mutant MutS120D;

6) And (4) measuring the activity.

6. Use of the mutant MutS120D according to claim 1 for the preparation of s.cerevisiae.

Images