RU2165455C1 - Recombinant plasmid dna pss5 encoding synthesis of recombinant human alpha-2b interferon, strain of escherichia coli ss5 as producer of recombinant human alpha-2b interferon and method of alpha-2b interferon preparing - Google Patents

Abstract

FIELD: biotechnology, molecular biology, genetic engineering. SUBSTANCE: cells of recipient strain E. coli BL 21 (DE3) is transformed by recombinant multicopy plasmid DNA pSS5 encoding synthesis of leukocyte human alpha-2b interferon. Expression of the latter is under control of lactose gene, phage T7 and tryptophan promoters and terminator of translation rrn B-T₁T₂ containing gene determining the resistance to kanamycin and containing DNA fragment from plasmid pUC19 that is responsible for replication of recombinant plasmid. Obtained strain E. coli SS5 has productivity 800 mg of alpha-2b interferon, not less, with total activity 1-2 x 10¹¹ IU/1 l of cultural medium or 15-20 g of wet biomass of strain cells. Method involves culturing on nutrient medium, freezing cultural liquid at -70 C, not above, its defrosting by temperature increase to 4 C followed by addition of lysozyme to cultural liquid, removal of DNA and RNA by treatment of lyzate with DNase, concentration of obtained product by protein washing off with solutions of nonionic detergents, centrifugation and dissolving formed precipitate in solution of guanidine hydrochloride followed by renaturation of interferon and its purification using ion-exchange chromatography on ion-exchange resins of type Whatman CM-52-cellulose. Invention can be used for preparing recombinant human leukocyte alpha-2b interferon for medicinal aims. EFFECT: increased yield of interferon producing. 7 cl, 4 dwg, 3 ex

Description

 The invention relates to biotechnology, and in particular to methods for producing recombinant human leukocyte interferon alpha-2b for medical purposes (hereinafter, INT), as well as to recombinant Escherichia coli strains (E. Coli) and plasmids for its production.

 Known methods for producing human leukocyte interferon from leukocytes of human donor blood induced by viruses, double-stranded RNA and other inducers (ed. St. and Pat. USSR N 297296, 1970; N 1366064, 1983, N 1713591, 1986 - class C 12 N 15 / 00; Pat. RF NN 1364343, 1984; 1709615, 1990; 2066188, 1993 - Cl. C 12 N 15/00).

 The disadvantages of these methods are, as a rule, the low yield of the product, the inability to scale this process, the likelihood of contamination of the final product by human viruses, such as hepatitis B and C virus, immunodeficiency virus, etc. Therefore, the way to obtain INT microbiological synthesis is recognized as more promising. which provides the ability to obtain the target product with a significantly higher yield from a relatively inexpensive starting material. The chemical approaches used in this process allow creating variants of the structural gene that are optimal for bacterial expression, as well as regulatory elements that control its expression.

 Currently, various artificially constructed strains of P. pastoris Ps are mainly used as initial microorganisms. putida and E. coli.

 The disadvantage of the strain P. Pastoris (JN Garcia, JA Aguiar et. Al. // High level expression of human IFN-2b in Pichia pastoris.// Biotecnologia Aplicada., 12 (3)., 152-155., 1995), is low yield of the target product per gram of biomass, and strain Ps. putida (Pat. USSR N 1640996, 1989, class C 12 N 15/00) - the difficulty of isolating the final product and, therefore, the complexity and high cost of the process with its participation.

 A significant number of plasmids and strains of E. coli created on their basis are known: strains of E. coli ATCC 31633 and 31644 with plasmids Z-pBR322 (Pst1) HclF-11-206 or Z-pBR 322 (Pstl) / HclN SN 35-AHL6 ( US Pat. UR N13380, 1997, C 12 N 15/21) E. coli HB 101 strain with plasmid pER 103 (US Pat. USSR N1417800, 1985, class C 12 N 15/00); E. coli strain SG 20050 with plasmid p280 / 21FN (Kravchenko V.V. et al. Bioorganic chemistry, 1987, v. 13, No. 9, pp. 1186-1193) and others.

 A disadvantage of technologies based on these strains is their instability, as well as the insufficient level of expression of interferon.

 The prototype of the claimed strain and plasmid is a strain of E. coli sg 20050 / pIF16, deposited under N VKPM b5809 and a recombinant plasmid pIF16 containing a tandem of two synthetic alpha-interferon genes, between which a synthetic cistron orf 69 with a length of 69 nucleotide residues is inserted (US Pat. RF N2054041 , 1996, CL C 12 N 15/21).

 The expression of alpha interferon by E. coli strain SG 20050 (plF16) containing this plasmid is controlled by the tandem of two mutant constitutive tryptophan promoters and the phage 1 transcription terminator. The plasmid contains a selectable marker, the ampicillin resistance gene and replicon of the pBR322 vector. The expression level of INT is 200-300 mg per liter of cell suspension.

 The disadvantages of this plasmid and strain based on it are the use of strong unregulated promoters in the plasmid, which leads to rapid dissociation of the plasmid; as well as the use of the beta-lactomase gene as a selective marker, because it is secreted from the bacterial cell and destroys the antibiotic, as a result of which the selection condition for plasmid-containing cells of the strain is constantly reduced during fermentation, the accumulation of non-plasmid cells and, as a result, interferon output.

 Along with the features of the strains used, the effectiveness of the process largely depends on the technology used for the isolation and purification of interferon.

 A known method of obtaining INT, including the cultivation of Ps cells. putida, biomass destruction, treatment with polyethyleneimine, ammonium sulfate fractionation, hydrophobic chromatography of naphenylsilochrome C-80, pH fractionation of the lysate, its concentration and diafiltration, DE-52 cellulose ion chromatography, pH elution, C-ion elution chromatography on eluent 52, concentration by passing through a filter cartridge and gel filtration on Sephadex G-100 (Aut. St. USSR N 1640996, 1995, class C 07 K 14/56).

 The disadvantage of this method is its low productivity when using technology based on Ps cells. Putida, as well as multi-stage and large losses of the final product.

 A known method of producing INT, which includes culturing the E. coli strain SG 20050 / pIF16, in LB broth in flasks on a rocking chair, centrifuging the biomass, washing it with a buffer solution and sonication to destroy cells. The resulting lysate is centrifuged, washed with 6M urea in PBS buffer containing sodium chloride, potassium phosphate and Na2EDTA, dissolved in a solution of guanidine chloride in PBS buffer and centrifuged ((US Pat. RF N 2054041, 1996, class C 12 N 15/21).

 The disadvantages of the method are its relatively low productivity, instability of the producer during the fermentation process and, as a consequence, the instability of the yield of interferon.

 The prototype of the proposed method for producing INT is a method for producing human leukocyte interferons (in particular, INT), which consists in cultivating E. coli strain 294 ATCC 31446, transformed by the introduction of plasmids, freezing the obtained cells, destroying them by mechanical methods, suspending in buffer solution and homogenizing. To remove DNA and RNA, polyethyleneimine is added to the homogenizate, and then solids are removed by filtration or centrifugation. The top layer was concentrated by ultrafiltration, and then subjected to first affinity chromatography, pH adjustment, and then subjected to ion exchange chromatography on CM52 cellulose or its equivalent using buffer solutions. (Pat. USSR N 1414319, 1981, class C 12 N 15/00).

 The disadvantage of this method is its multi-stage and low adaptability.

 The challenge facing the authors was to create a more productive plasmid DNA, producer strain and technology for obtaining INT.

 This problem was solved by the creation of recombinant plasmid DNA pSS5 and Escherichia coli SS5 strain.

Plasmid pSS5 has 3604 base pairs (bp) and is characterized by the presence of the following fragments:
DraI-HindIII DNA fragment of plasmid pUC19 of 1103 bp containing the sequence responsible for the replication of the plasmid and the sequence of the lactose promoter (P _lac );
A 226 bp HindIII-XbaI DNA fragment containing sequences of two promoters — a T7 phage promoter (P _T7 ) and a tryptophan promoter (P _trp ) _—and a Shine Dalgarno sequence responsible for translation initiation;
An 512 bp XbaI-BamHI DNA fragment containing a sequence of the semi-synthetic alpha interferon gene obtained using DNA amplification method (PCR);
A 529 bp BamHI-SspI DNA fragment of plasmid pKK233-3 in which the AAGCTT HindIII site is replaced by the AAGCTAGCTT sequence containing the rrnBT ₁ T ₂ sequence responsible for transcription termination,
PstI-PstI 1227 bp DNA fragment plasmids pUC4K, in which the HindIII AAGCTT site is replaced with the AAACTT sequence by directional mutagenesis using the PCR method encoding kanamycin resistance (kan).

 In the drawing, the nucleotide sequence of plasmid pSS5.

 The Escherichia coli SS5 strain was obtained by transforming Escherichia coli BL21 (DE 3) cells with the pSS5 plasmid using traditional genetic engineering technology.

The strain of E.coli SS5 is characterized by the following features:
Cultural and morphological characters.

 The cells are small, straight, thickened, rod-shaped, gram-negative, non-spore.

 Cells grow well on simple nutrient media. When growing on Difco agar, the colonies are round, smooth, convex, cloudy, shiny, gray, the edges are even. When growing in liquid media (on a minimal medium with glucose or LB broth) they form an intense smooth turbidity.

Physico-biological characteristics
Aerobe. The temperature range of growth of 4-42 ^o C at the optimum pH of 6.5-7.5.

 Mineral salts in ammonium and nitrate forms, as well as organic compounds in the form of amino acids, peptone, tryptone, yeast extract, etc., are used as a nitrogen source.

 Amino acids, glycerin, carbohydrates are used as a carbon source.

 Antibiotic resistance. Cells are resistant to kanamycin (up to 100 μg / ml).

Strain Escherichia coli SS5 - producer of alpha-interferon
The method, conditions and composition of the medium for storage of the strain:
L-agar with the addition of 20 μg / ml kanamycin under oil, L-broth with 15% glycerol and antibiotics at -20 ^o C in ampoules, in a lyophilized state in ampoules at -70 ^o C.

 The strain Escherichia coli SS5 was identified by the Bergi Identifier (1974) as a strain of the species Escherichia coli.

 A feature of the proposed method is the development of technology that allows you to allocate interferon in the form of an insoluble form (in the form of inclusion bodies (TV)), which can significantly simplify the process flow diagram and increase the yield of the target product.

The method consists in cultivating a strain of Escherichia coli SS5 in a nutrient medium, freezing biomass (BM) at a temperature not higher than -70 ^° C, thawing BM when the temperature rises to 4 ^° C, destroying microorganism cells by treating them with lysozyme, removing DNA and RNA by introducing into a lysate DNA basics and purification of TB by washing with detergents, centrifugation, dissolution of TB in a solution of guanidine hydrochloride and subsequent renaturation of INT, renaturation is carried out by diluting INT with a buffer solution containing non-ionic detergents. The obtained INT is subjected to purification using ion exchange chromatography on cellulose CM 52 cellulose.

The optimal conditions for the individual stages of obtaining interferon are as follows:
cell destruction is carried out by introducing lysozyme into the solution at a concentration of 0.1-0.2 wt.%;
DNA and RNA removal is carried out by incubating a suspension of interferon with excess DNAase at room temperature for at least 1 hour;
the purified INT precipitate is dissolved in a 6M guanidine hydrochloride buffer;
renaturation is carried out by diluting the INT solution with a buffer solution containing non-ionic detergents.

 The yield of INT as a result of applying the method in the optimal mode is at least 700 mg of purified INT from 1 liter of culture medium, the expression level of INT is not less than 800 mg from 1 liter of culture medium.

 Significant differences of the proposed method from the prototype are the use of a more productive new strain, which makes it possible to change the technological process and make enzymatic destruction more appropriate instead of the mechanical one and obtain an insoluble form of interferon, use DNA processing to remove DNA and RNA, translate INT into a soluble form and renature , replacement of three-stage purification of INT with one-stage.

 The essence and advantages of the claimed group of inventions is illustrated by the following examples.

 Example 1. Obtaining a recombinant plasmid.

The technology for plasmid pSS5 includes the following steps:
obtaining a semi-synthetic alpha interferon gene,
construction of the vector plasmid pSSI,
construction of the recombinant plasmid pSS5.

 Obtaining a semi-synthetic alpha interferon gene.

 For cloning the alpha interferon gene, the direct polymerase chain reaction (PCR) method was used to amplify a DNA fragment from total human genomic DNA encoding alpha interferon (SL Emanuel, S. Pestka. // Human interferon-aA, -a2, and a2 (Arg) genes in genomic DNA / The J.of Biol. Chem., V. 268., No.17, 12565-12569, 1993).

 For amplification, two primers were used: 1 and 2, the nucleotide sequence of which was based on the known primary structure of the human interferon alpha-2b gene.

 S1-5'-CTAGTCTAGATGTGTGATCTGCCTCAAA-3 'and S2-5'-CGCGGATCCTCATTCCTTACTTCTTAAACTTTC-3'.

This and subsequent PCR reactions were carried out under the following conditions: 10 mM Tis-HCl, pH 8.3, 50 mM KCI, 3 mM MgCl ₂ , 0.2 mM each dNTP, 1.25 units. Taq polymerase, 100 ng DNA.

The amplification process consisted of the following stages: heating at 94 ^o C for 3 min, 35 cycles of PCR (30 s 94 ^o C, 30 s 56 ^o C, 30 s 72 ^o C) and incubation at 2 min 72 ^o C. The resulting DNA fragment of size 539 bp treated with restriction enzymes XbaI, BamHI, cloned into pUC19 vector at the same restriction sites, the structure of the cloned fragment was confirmed by determination of the nucleotide sequence. As a result, the 32UC bp pUCAl plasmid was obtained. in which the DNA of the alpha interferon gene is flanked by the XbaI and BamHI restriction sites.

Mutagenesis of the alpha-interferon gene was the replacement of rarely occurring triplets in E. coli encoding the corresponding amino acids by frequently occurring triplets in E. coli encoding the same amino acids. Mutagenesis of the alpha interferon gene DNA is carried out by PCR. For amplification of the DNA used primers:
S3-5'-CTAGTCTAGATGTGTGATCTGCCGCAGACCCACTCCCTGGGTA GCCGTCGTACCCTGATGCTCCTGGCACAGATGCGTCGTATCTCTCTGTTCTCC-3 'and
S4-5 '-CGCGGATCCTCATTCCTTGGAACGCAGGGATTCCTGCAGGTT GGTGGACAGAGAAAAAGAACGCATGATTTCTGCACGAACAACCTC-3'
In the PCR reaction, pUCAl plasmid DNA was used as a template. The resulting DNA fragment size of 539 p. treated with restriction enzymes XbaI, BamHI, cloned into the pUC19 vector at the same restriction sites, the structure of the cloned fragment was confirmed by determination of the nucleotide sequence. As a result, a 3225 bp pUCA2 plasmid was obtained in which the DNA of the semisynthetic alpha-interferon gene is flanked by the XbaI and BamHI restriction sites.

 Construction of the vector plasmid pSS1.

 The pSS1 vector plasmid is the pUC19 vector in which the amp gene is replaced with the kan gene with the HindIII site removed, and a DNA fragment containing the transcription terminator from plasmid pKK223-3 is cloned at the BamHI-SspI restriction sites, in which the HindIII site has also been deleted.

The construction of the vector plasmid pSS1 is carried out in four stages:
- removal of the HindIII site in plasmid pKK223-3,
- obtaining plasmids pUC19T,
- kan gene mutagenesis (removal of the HindIII site in the kan gene),
- obtaining the vector plasmid pSS1
The plasmid pKK223-3 DNA is sequentially treated with the HindIII restriction enzyme, the Klenov fragment enzyme, and then the phage T4 ligase enzyme.

The ligated DNA is transformed into cells of the E. coli strain DH5 and plated on LB medium containing 100 μg / ml ampicillin. After incubation for 12 hours at 37 ^° C., the clones are plated, plasmid DNA is isolated and restriction analysis is performed. As a result, the plasmid pKK223-3H of 4588 bp was obtained.

Cloning of a 520 bp BamHI-Ssp1 DNA fragment encoding the rrn BT ₁ T ₂ transcription terminator from pKK223-3H plasmid to pUC19 plasmid at the same sites is carried out by treating these plasmids with BamHI and Ssp1 restriction enzymes, and then ligating with phage T4 ligase . The ligated DNA was transformed into cells of the E. coli strain DH5, plated on LB medium containing 100 μg / ml ampicillin and incubated for 12 hours at 37 ^° C. Clones were weeded out, plasmid DNA was isolated and restriction analysis was performed. As a result, a plasmid pUC19T of 2600 bp was obtained. In the third stage, the HindIII site was removed from the kan gene and the amp gene was replaced by the kan gene with the deleted HindIII site in plasmid pUC19T. For this, three rounds of DNA amplification by PCR were performed.

During the first round, using pUC4K plasmid DNA as a template, the 757 bp DNA fragment encoding the N-terminus of the kan gene is amplified using primers:
S5-5'-AGAATGGCAAAAGTTTATGCAATTT-3 '
24-mer rev Sequencing primer - 5'-AGCGGATAACAAТТТCACACAGGA-3 '
During the second round, using the DNA of plasmid pUC4K as a template, the 642 bp DNA fragment encoding the C-terminus of the kan gene is amplified using primers:
S6-5'-AAATGCATAAACTTTTGCCATTCT-3 '
24-mer Sequencing primer - 5'-CGCCAGGGTTTTCCCAGTCACGA-3 '
During the third round, using DNA fragments from the previous two PCR reactions (round 1 and round 2) as a template, an amplification of a 1376 bp DNA fragment encoding the complete kan gene with the deleted HindIII site is performed using primers:
24-mer rev Sequencing primer - 5'-AGCGGATAACAAТТТCACACAGG A-3 '
24-mer Sequencing primer - 5'-CGCCAGGGTTTTCCCAGTCACGA-3 '.

Next, get the vector plasmid pSS1. For this, a 1376 bp DNA fragment obtained in round 3 of amplification was sequentially treated with the PstI restriction enzyme and the Klenov fragment enzyme, and the DNA of the obtained plasmid pUC19T with SspI and DraI restriction enzymes. Further, the thus processed DNA fragment encoding the kan gene and the plasmid pUC19T DNA is ligated with the T4 phage ligase enzyme. The ligated DNA was transformed into cells of E. coli strain DH5 and plated on LB medium containing 20 μg / ml kanamycin. After culturing for 12 hours at 37 ^° C, the clones are screened, plasmid DNA is isolated, and restriction analysis is performed. The result is a vector plasmid pSS1 size of 2920 p.

Construction of the recombinant plasmid pSS5
The construction of recombinant plasmids pSS5 is carried out in two stages:
constructing a DNA fragment flanking the HindIII-XbaI restriction sites, encoding simultaneously the T7 phage promoter, tryptophan operon promoter and SD sequence (Schein-Delgarno);
construction of the recombinant plasmid pSS5.

The first stage is carried out by amplification of a 230 bp DNA fragment. using the PCR reaction, in which E. coli DNA and the following primers are used as template
S7 (in which there is a restriction site sequence for the Hindlll enzyme, a sequence encoding a T7 promoter, and a sequence encoding
5'-end tryptophone promoter):
5'-CCCAAGCTtaatacgactcactatagggagacccTATGGCTGTGCAGGTCGTA and
S8 (in which there is a restriction site sequence for the XbaI enzyme, an SD sequence and a sequence encoding the 3'-end of the tryptophan promoter):
5'-TGCTCTAGATTATCTCCTTGAATTCCTTTTTACGTGAACTTGCGTA-3 '.

 In the second stage, the amplified DNA fragment from S7-S8 primers was treated with HindIII-XbaI restriction enzymes, pUCA plasmid DNA was treated with XbaI-BamHI restriction enzymes, and pSSI plasmid DNA was treated with HindIII-BamHI restriction enzymes and the resulting DNA fragments were ligated.

The ligated DNA was transformed into cells of the E. coli strain DH5, plated on LB medium containing 20 μg / ml kanamycin and incubated for 12 hours at 37 ^° C. Clones were weeded out, plasmid DNA was isolated, restriction analysis was performed, and the nucleotide sequence was determined.

 As a result, a recombinant plasmid pSS5 of 3604 bp was obtained.

Example 2. Obtaining a strain of E. coli SS5 - producer of interferon
The E. coli SS5 alpha interferon producing strain was obtained by transforming E. coli BL21 strain cells with the recombinant plasmid pSS5, followed by selection of recombinant clones on a medium with kanamycin at 37 ^° C and determining the alpha interferon activity and determining the amount of alpha interferon in the extracts cells grown to an optical density of 15.0-16.0 about. e. in M9 medium containing 1% casein acid hydrolyzate (Difco), 1% glucose, 20 μg / ml kanamycin, at a temperature of 38-39 ^o C.

 Alpha interferon activity was determined by the inhibition of the cytopathic effect of the vesicular stomatitis virus on human diploid fibroblasts and by an enzyme immunoassay.

 The content of alpha-interferon in 15-20 g of biomass of cells obtained from 1 liter of culture, depending on the series, was 700-800 mg of alpha-interferon with a total activity of 1-2 x 10 ME.

 Example 3. Obtaining INT from strain E. coli SS5.

Obtaining alpha interferon was carried out in 4 stages:
Stage 1. Cultivation of E. coli SS5 strain
2 stage. Isolation and purification of an insoluble form of alpha interferon
3 stage. Dissolution and renaturation of alpha interferon
4th stage. Chromatographic purification of alpha interferon
Cultivation of the strain K. coli SS5.

The grown seed of E. coli SS5 strain in 750 ml of rich LB medium for 12 h at 26 ^° C was aseptically introduced into a laboratory fermenter containing 8.0 l of sterile medium containing 1 x M9, 1% casein acid hydrolyzate, 1% glucose, 1 mM MgCl ₂ , 0.1 mM CaCl ₂ , 20 mg / ml kanamycin. Cultivation in the fermenter was carried out at a temperature of 38-39 ^o C, maintaining a pH of 7 ± 0.15 by automatic subtitling with a 40% sodium hydroxide solution. The concentration of dissolved oxygen in the range (40 ± 10)% of saturation was maintained by changing the speed of the mixer from 100 to 400 rpm and air supply from 0.2 to 1.5 air volumes / min.

The accumulation of alpha-interferon in the form of an insoluble form - “inclusion bodies” was monitored by phase contrast microscopy. Fermentation was completed upon reaching the maximum optical density (15-16) p.u. and the emergence of mature “inclusion bodies”. At the end of cultivation, the biomass was separated from the medium by centrifugation at a rotation speed of 5000-10000 rpm. Biomass was packaged in plastic bags and frozen at a temperature of minus 70 ^o C.

 Isolation and purification of an insoluble form of alpha interferon.

20 g of frozen E. coli SS5 strain biomass was suspended in 200 ml of buffer 1 (10 mM Tris-HCl, pH 8.0, 10 mM EDTA, 0.1% Triton X100), 30 mg lysozyme was added and incubated with stirring at 4 ^° C for 30 minutes. The lysozyme-treated suspension was frozen at minus 20 ^° C. for 3 hours, and then the temperature was raised to room temperature. 5 mg DNase and 5 mM MgCl ₂ were added to the suspension, incubated for 1 hour at room temperature, and then an equal volume of buffer 2 (10 mM Tris-HCl pH 8.0, 1 mM EDTA, 0.1% Triton X100) was added, intensively mixed and centrifuged for 20 min in a Beckman J2-21 centrifuge at a speed of 9000 rpm on a JA-10 rotor. The resulting precipitate was washed one more time with buffer 2, buffer 3 (10 mM Tris-HCl pH 8.0, 1 mM EDTA, non-ionic detergent). The incubation time in this buffer was at least 12 hours at 4 ^o C. Further washing was carried out with buffer 2 with 3 M urea, buffer 2 without detergent Triton X100, a solution of 40% isopropanol and finally with water.

Dissolution and renaturation of alpha interferon
The precipitate obtained in the previous step was dissolved in 5-10 ml of a solution of 6 M guanidine hydrochloride containing 100 mM DTT, 20 mM Tris-HCl and kept at pH 8.0 and room temperature for 2 hours. Insoluble material was removed by centrifugation at 18,000 rpm on a Beckman J2-21 centrifuge in a JA-10 rotor.

Renaturation of alpha-interferon was carried out by slowly diluting the resulting solution in 250-500 ml of buffer 4 (20 mm Tris-HCl pH 8.0, 70 mm NaCl, a mixture of nonionic detergents) at a temperature of 4 ^o C. Then the solution was incubated with constant stirring for 24 hour. Next, the aggregated material was removed by centrifugation at 9,000 rpm in a JA-10 rotor on a Beckman J2-21 centrifuge.

 Chromatographic purification of alpha interferon.

Chromatographic purification of alpha interferon was performed on CM-52 cation exchanger (Watm). To a solution of renatured alpha-interferon was added a 1M solution of NH ₄ (CH ₃ COO) at a pH of 4.5 to a concentration of 25 mM and was applied to a CM-52 resin, previously equilibrated with buffer 5 (25 mM NH ₄ (CH ₃ COO), pH 4.5). Next, the resin was washed with buffer 6 (50 mm NH ₄ (CH ₃ COO) at pH 4.5), buffer 7 (50 mm NH ₄ (CH ₃ COO) at pH 5.0).

INT was eluted with buffer 7 containing 0.15 mM NaCl. The yield of interferon alpha-2b was not less than 800 mg from 20 g of biomass obtained from 1 l of culture medium with a specific activity of at least 2 · 10 ⁸ IU / mg.

 As follows from the above examples, the claimed group of inventions allows to obtain interferon alpha-2b in high yield with a relatively simple and reliable technology.

Claims (7)

1. Recombinant plasmid DNA pSS5, encoding the synthesis of recombinant alpha 2b human interferon, size 3604 bp, containing: Dral-HindSh DNA fragment of plasmid pUC19 1103 bp, HindSh-Xbal DNA fragment 226 bp, comprising the sequences of two promoters - the T7 phage promoter and the tryptophan promoter and the Shine Dalgarno sequence; A 512 bp Xbal-BamHl DNA fragment comprising a sequence of the semisynthetic human interferon alpha-2b gene obtained using the DNA amplification method; BamHl-Sshl DNA fragment of plasmid pKK 233-3 size 529 p. comprising the sequence AAGCTAGCTT and the sequence rrnBT ₁ T ₂ ; A Pstl-Pstl 1227 bp DNA fragment of the pUC4K plasmid containing the AAACTT sequence and having the nucleotide sequence shown in FIG.  2. The bacterial strain Escherichia coli SS5 - transformed with the recombinant plasmid according to claim 1 - producer of recombinant leukocyte alpha-2b human interferon. 3. A method for producing human interferon alpha-2b using Escherichia coli strain transformed by genetic engineering methods, including culturing it in a nutrient medium, freezing the biomass of the strain at a temperature not exceeding 70 ^° C, thawing it at a temperature of 4 ^° C, destruction of microorganism cells, removal of DNA and RNA, concentration of the obtained product and its purification using ion exchange chromatography on CM 52 cellulose, characterized in that the Escherichia coli SS5 strain according to claim 2, is cultured ix cells is carried out using lysozyme, DNA removal and RNA accomplished by treating DNAase, treatment of the insoluble form of interferon is performed by treating a solution of nonionic detergent followed by centrifugation, dissolution of the precipitate formed in the solution of guanidine hydrochloride, followed by renaturation interferon, after which it was subjected directly to ion exchange chromatography.  4. The method according to claim 3, characterized in that the destruction of the cells is carried out by introducing lysozyme into the solution at a concentration of 0.1-0.2 wt.%.  5. The method according to claim 3, characterized in that the removal of DNA and RNA is carried out by incubating a suspension of interferon with excess DNAase at room temperature for at least 1 hour  6. The method according to p. 3, characterized in that when concentrated, the precipitate formed is dissolved in a 6M guanidine hydrochloride buffer solution.  7. The method according to claim 3, characterized in that the renaturation is carried out by dissolving the precipitate in a buffer solution containing non-ionic detergents.

Images