IL100623A - PROCESS FOR THE PRODUCTION OF RECOMBINANT IgA PROTEASE AND THE IgA PROTEASE PRODUCED THEREBY - Google Patents

PROCESS FOR THE PRODUCTION OF RECOMBINANT IgA PROTEASE AND THE IgA PROTEASE PRODUCED THEREBY

Info

Publication number
IL100623A
IL100623A IL10062392A IL10062392A IL100623A IL 100623 A IL100623 A IL 100623A IL 10062392 A IL10062392 A IL 10062392A IL 10062392 A IL10062392 A IL 10062392A IL 100623 A IL100623 A IL 100623A
Authority
IL
Israel
Prior art keywords
iga protease
modified
gene
iga
recombinant
Prior art date
Application number
IL10062392A
Other versions
IL100623A0 (en
Original Assignee
Roche Diagnostics Gmbh
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Roche Diagnostics Gmbh filed Critical Roche Diagnostics Gmbh
Publication of IL100623A0 publication Critical patent/IL100623A0/en
Publication of IL100623A publication Critical patent/IL100623A/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/52Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Detergent Compositions (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Process for the production of recombinant IgA protease, wherein (1) an IgA protease gene is modified in such a way that the DNA region of the IgA protease gene coding for the C-terminal helper sequence is no longer functionally active, (2) a host cell is transformed with the IgA protease gene modified according to step (1) or with a vector containing this modified gene, (3) the modified IgA protease gene is expressed in the transformed host cell, (4) the IgA protease which forms as inactive inclusion bodies is isolated from the host cell and (5) the IgA protease is converted into active protein by in vitro activation.

Description

Ref: 7076/99 100623/4 πτκΰ"Π9 IgA -m rrcirnmpn mauns IgA "w1? τ?ηη A PROCESS FOR THE PRODUCTION OF RECOMBINANT IgA PROTEASE AND THE IgA PROTEASE PRODUCED THEREBY D e s c r i p t i o n The present invention concerns a process for the production of recombi ant IgA protease and its expression in a transformed host ceil.
Various pathogenic bacterial species (e.g. of the genus Neisseria, such as for example Neisseria gonorrhoeae and Neisseria meningitidis or the genus Haemophilus such as for example Haemophilus influenzae) which grow on human mucous membranes secrete proteases which are specific for human Ig Al and which are denoted IgA proteases. The immunoglobulin Ig Al is an important component of the secretory immune response that is intended to protect against infections by such pathogenic organisms (review: Kornfeld and Plaut, Ref . Infec . Dis . 3 (1981), 521-534). These proteolytic enzymes, which are denoted IgA proteases, for example cleave the following recognition sequences as described for example by Pohlner et al., (Nature 325 (1987), 458-462): 1. ?ro-Aia-Pro - Ser-Pro 2. Pro-Pro - Ser-Pro 3. . Pro-Pro - Ala-Pro 4. Pro-Pro - Thr-Pro In this case in each case denotes the cleavage site of the IgA protease.
The IgA proteases mentioned above are secretory proteins which have an N-terir.inal signal sequence for the transport into the periplas a and a C-terminal helper protein sequence which subsequently allows secretion from the periplasma into the medium.
The cloning and expression of an IgA protease from Neisseria in E- coli is described for example in PNAS USA 79 (1932) 7381-7385 and EMBO J. 3 (1984) 1595-1601.
Grundy et ai., J. of Bact . 159 ( 10 ) : 4 42-445C ( 1987 ) describes the preparation of IgAl protease in E. Coli. An IgAl. protease is prepared which is not secreted in the medium, but which is localized in the peripiasmic space in the active form.
Kcronakis et al., EMBOJ 8 (2 ) : 595-605 { 1989) describes C-terminal sequences of hemolysin, which make possible the transport of che protein across the membrane.
Claassen et al., J. 3iol. Che.m 266 ( 17 ) : 11380-11387 ( 1991) describes the purification of deletion mutants of the UvrA protein from inclusion bodies after espression in E. Coli. Meyer (EP-A-0 254 090) describes a process for the production of proteins in E. coli using a vector containing the coding foreign gene within the sequence of the IgA protease precursor gene.
A disadvantage of the isolation of IgA protease according to the known methods is, however, the low productivity and vitality of the E. coli cells which have been transformed with an IgA protease gene which only results in a very low volume yield of IgA protease.
Since IgA protease is very important as .a proteolytic enzyme for the cleavage of fusion proteins produced by genetic engineering (cf. WO91/11520) there is a great need for a method of isolating IgA protease which overcomes at least some of the drawbacks of the state of the art. 100623/2 - 2a - The object according to the present invention is to provide a process for the production of recombinant IgA protease which is characterized in that (1) an IgA protease gene is modified in such a way that the DNA region of the IgA protease gene coding for the C-terminal helper sequence is no longer functionally active, (2) a host cell is transformed with the IgA protease gene modified according to step (1) or with a vector containing this modified gene, (3) the modified IgA protease gene is expressed in the transformed host cell, (4) the IgA protease which forms as inactive inclusion bodies is isolated from the host cell and - 3 - (5) the IgA protease is converted into active protein by in vitro activation.
It was surprisingly found 'that an IgA protease which no longer has a functionally active helper sequence (and thus can no longer be secreted from the host cell into the medium) is formed as inactive inclusion bodies within the host cell and that after activation of these inactive inclusion bodies very high volume yields of IgA protease are achieved. These inactive inclusion bodies can be isolated according to the usual methods from the cells and subsequently converted into the active form by means of in vitro activation.
It is essential for the process according to the present invention that the DNA region coding for the C-terminal helper sequence of the IgA protease is no longer functionally active. This can for example be achieved by partial or complete deletion of the DNA region coding for the helper, sequence. The deletion of DNA fragments can be carried out in a manner familiar to one skilled in the art, as for example by in vitro mutagenesis on double-stranded or single-stranded DNA or by cleavage with suitable restriction enzymes and removal of restriction fragments from the region of the helper sequence. A further possibility for such a modification of the IgA protease gene is to carry out an in vitro mutagenesis in the DNA region coding for the helper sequence by means of which one or several translation stop codons are introduced into this region which then prevent a complete translation of the helper sequence when the IgA protease gene is expressed.
It is preferred in the process according to the present invention that the IgA protease gene is modified in such - 4 - a way that the helper sequence of the IgA protease coded by this modified gene is completely deleted. This can for example be achieved by introducing one or several translation stop codons into the IgA protease gene directly at the beginning of the C-terminal helper sequence. A further possibility for the deletion of the helper sequence is a PCR reaction on IgA protease cDNA using suitable primers as described in example 1.
In the process according to the present invention it is also preferred that the IgA protease gene is in addition modified in such a way that the DNA region coding for the N-terminal signal sequence of the IgA protease is no longer functionally active. In this way the transport of the IgA protease into the periplasma is also blocked so that the inactive inclusion bodies are formed in the cytosol of the transformed host cell.
It is preferred that the inactivation of the signal sequence is carried out by completely deleting, the corresponding DNA region according to the usual techniques. Subsequently DNA sequences from the DNA regions coding for the mature protein which may have been lost can be filled in again by introducing a synthetic oligonucleotide by genetic engineering. The signal sequence can, however, also be deleted by a PCR reaction using suitable primers as described in example 1.
A prokaryotic cell, especially an E. coli cell, is preferably used as the host cell for the process according to the present invention. In addition it is preferred that the host cell is transformed with a DNA sequence coding for an IgA protease which is under the control of an inducible promoter. Examples of suitable - 5 - inducible promoters are for example the tac, lac or trp promoter or other similar promoters which are known to one skilled in the area of molecular biology.
The IgA protease produced- in the process according to the present invention is formed in the host cell as inclusion bodies. The isolation of inclusion bodies and their conversion into active protein by in vitro activation can be carried out in any manner known to one skilled in the art. Examples of such methods are described for example in EP-A 0 361 475, DE-A 36 11 817, DE-A 35 37 708, WO 87/02673; Jaenicke, R. & Rudolph, R. (1989) Protein structure - a practical approach, Ed.: Creighton T.E. Oxford University Press, 191; Rudolph, R. (1990) Modern methods in protein and nucleic acid analysis, Ed.: Tschesche, published by H. Walter deGruyter, 149-171; Jaenicke, R. (1987) Prog. Biophys. Molec. Biol. 49, 117.
The in vitro activation, of the IgA protease preferably includes a solubilization step and a renaturation step. The renaturation step in this process can be carried out by feeding the denatured protein continuously or discontinuously into the renaturation buffer. In this process it is preferred that the renaturation step is carried out in the form of a discontinuous pulse renaturation.
It is particularly preferred that the renaturation step for the activation of the IgA protease is carried out in the presence of 0.2 to 1 mol/1 arginine and most preferably of 0.4 to 0.8 mol/1 arginine. In addition it is preferred that the reactivation is carried out at a pH of 5 to 9, particularly preferably at a pH of 6 to 8. - 6 - When the IgA protease is renatured from inactive inclusion bodies active soluble protein is formed in a yield which ranges from about 10 % to over 30 %, depending on the starting material and renaturation method. Although the renaturation yield is not quantitative, nevertheless a substantially higher yield of active IgA protease is obtained with the process according to the present invention compared to conventional methods.
The present invention also concerns an IgA protease which has been produced by a process according to the present invention i.e. by activation from inclusion bodies.
In addition the invention concerns a recombinant DNA which codes for an IgA protease and is modified in such a way that on expression . of the recombinant DNA an, IgA protease results whose C-terminal helper .sequence is no. longer functionally . active and is preferably even completely deleted. The recombinant DNA according to the present invention is preferably additionally modified in such a way that on expression of the recombinant DNA an IgA protease is formed whose N-terminal signal sequence is no longer functionally active and especially preferably is completely deleted. Genetic engineering methods for the modification or deletion of DNA regions which lead to the desired results have already been mentioned or are so familiar to one skilled in the area of molecular biology that they do not have to be explicitly elucidated.
The present invention also concerns a recombinant vector which contains at least one copy of a recombinant DNA according to the present invention. The recombinant DNA - 7 - according to the present invention in this vector is preferably under the control of an inducible promoter. The vector according to the present invention can be present outside the chromosome of the host cell (e.g. a plasmid) or integrated in the genome of the host cell (e.g. bacteriophage . in an E. coli cell) . The vector is preferably a plasmid.
The invention in addition concerns a cell which is transformed with a recombinant DNA according to the present invention or with a recombinant vector according to the present invention. This cell is preferably a prokaryotic cell and particularly preferably an E. coli cell.
The invention is further elucidated in the following by the present examples in conjunction with the sequence protocols .
SEQ. ID. NO. 1 shows the primer A used example 1 SEQ. ID. NO. 2 shows the primer B SEQ. ID. NO. 3 shows the primer C SEQ. ID. NO. 4 shows the primer D The plasmid pMAC 1 was deposited at the German Collection for Microorganisms (DSM) , GriesebachstraBe 8, D-3400 Gottingen and assigned the number DSM 6261. - 8 - E x a m p l e 1 Preparation of plasmid constructs for the expression of IgA protease in the form of inclusion bodies In order to express IgA protease as inclusion bodies, the region coding for the protein without signal sequence and helper sequence is cloned downstream of a strong promoter as described in the following (amino acid position + 1 to position 959, Pohlner J., Halter R. , Beyreuther K., Meyer T.F., Nature 325, (1987), 458-462) .
For this chromosomal DNA is isolated from N. gonorrhoeae (e.g. MS 11) and used to carrying out a polymerase chain reaction (PCR, method cf. EP-A 0 200 362, EP-A 0 201 184) . The following primers are used for the PCR.
Primer A (SEP. ID. NO. 1) : 5 ' GAAGAATTCGGAGGAAAAATTAATGGCACTGGTACGTGATGATGTCGATTATCAAA 3 ' Primer B (SEP. ID. NP. 2): 5' TTTTTGTAATAAAGATCTTTGCCTTG 3' The first 5 codons of the IgA protease were optimized for an efficient expression in E. coli without changing the amino acid sequence and used for primer A, which includes the ATG start codon as well as an ECo RI recognition sequence (GAATTC) . - 9 - Primer B contains sequences adjacent to the Bgl II recognition sequence of the IgA protease (ca. amino acid positions 553-561) . The PCR fragment (A/B = ca. 1650 bp, 5' terminal region of the IgA protease gene) obtained in this way is purified and recleaved with the enzymes ECo RI/Bgl..II.
In order to prepare the 3 ' region of the IgA protease gene a second PCR reaction is carried out with the following primers: Primer C (SEP. ID. NO. 3) : 5 ' CAAGGCAAAGATCTTTATTACAAAAA 3 ' Primer D (SEP. ID. NO. 4): 5 ' TTCAGCTGGTCGACTTATCACGGGGCCGGCTTGACTGGGCGGCC 3 ' ' Primer C corresponds to the coding region of primer B (Bgl II cleavage site) and primer D contains sequences of amino acid positions 952-959 with an adjacent stop codon and a Sal I recognition sequence. The PCR fragment (C/D = 1200 bp) obtained in this way is isolated and recleaved with the enzymes Bgl II/Sal I.
Subsequently a three fragment ligation is carried out: with the fragments A/B, the fragment C/D and the vector pK 223-3 (DSM 3694P) which was previously digested with the enzymes Eco RI and Sal I and purified. The vector obtained in this way is denoted IgA-Prot III and is transformed in E. coli 12. - 10 - Example 2 (comparative example) Isolation of soluble IgA protease according to the conventional method. a) Isolation from 1 1 shaking culture E. coli K12 cells transformed with the plasmid p ACl (8878 bp) were used as the starting material. The complete coding region for IgA protease is located on this plasmid and is under the control of the lambda promoter. The plasmid carries an ampicillin resistance.
The cells were cultured in LB medium overnight at 28 °C and subsequently diluted 1:100 with LB medium. The culture was then incubated for a further 4 hours at 37 °C. The cells were separated by a centrifugation step. The culture supernatant was sterile-filtered over a cellulose-acetate filter, dialysed against 20 mmol/1 Tris/HCl, pH 7.5, 10 mmol/1 EDTA, 10 % glycerol (buffer A) and concentrated to 1/10 its volume with the aid of a SALVIA capillary dialyser E-15U.
A negative elution on DEAE-Sephadex A-50 in 20 mmol/1 Tris/HCl, pH 7.5, 10 mmol/1 EDTA and 10 % glycerol was carried out as the first purification step. The column was loaded with 0.5 mg protein per 1 ml gel matrix. In this separation the IgA protease is in the eluant and most of the E. coli proteins are bound to the carrier.
Washing the column matrix again with buffer A plus 1 mol/1 NaCl showed that less than 10 % of the IgA protease binds' to the column material. - 11 - Finally it is purified on a cation exchanger (FractogelR-EMD-S03" -650M) . The protein binds in 20 mmol/1 Tris/HCl, 10 mmol/1 EDTA, 10 % glycerol pH 7.0. Then the buffer can be changed to pH 8.0. The elution is carried out with a linearly increasing NaCl gradient whereby the IgA protease is eluted with a buffer of pH 8.0 at a salt concentration of 0.1 mol/l NaCl and with a buffer of pH 7.0 at 0.2 mol/l NaCl.
Result: Concentrate before DEAE-Sephadex 3.5 mg protease (70 % pure) Eluate after DEAE-Sephadex 2.4 mg protease (90 % pure) Eluate after FractogelR-EMD-S03" -650M 1 mg protease (> 95 % purity) b) Isolation of IgA protease from a 10 1 fermenter The starting material and purification were carried out analogous to example 2a) .
Result: Concentrate before DEAE-Sephadex: 50 mg IgA protease (50 % purity) Eluate after DEAE-Sephadex: 30 mg IgA protease (60 % purity) Eluate after FractogelR-EMD-S03' -650M: 12 mg IgA protease (> 95 % purity) - 12 - Example 3 Isolation of IgA protease from inclusion bodies (process according to the present invention) The starting material was the construct IgA-Prot III (example 1) in E. coli cells (DSM 3689) which additionally contain a lacl^ plasmid for the expression of the lac repressor. 500 ml LB medium containing 50 ^g/ml kanamycin and 50 μg/ml ampicillin was prepared for the 1 1 fermentation culture. This medium was inoculated with 7.5 ml of an overnight culture which resulted in an OD550 of ca' °·1· Tnen a 3 to 4 hour incubation at 37 °C was carried out while shaking (150 rpm) . The cells were induced with 5 mmol/1 IPTG at an OD55Q of ca. 0.8. The cells were harvested after a 4 hour incubation at 37°C while shaking (150 rpm) .
IB preparation: The cells are harvested by centrifugation, taken up in 10 ml Tris-magnesium buffer (10 mmol/1 Tris, pH 8.0, 1 mmol/1 gCl2) and lysed with lysozyme (0.3 mg/ml) .
They are incubated for 15 minutes at 37 °C and subjected to one passage of a French press (1200 psi) .
Subsequently a DNAse digestion (1 mg DNAse I) is carried out for 30 minutes at 37 °C. - 13 - 20 ml 0.5 mol/1 NaCl, 20 mmol/1 EDTA, pH 8.0 and 3 ml 20 % Triton X 100 is added and incubated for 10 minutes at room temperature.
The suspension is centrifuged for 10 minutes at 15000 rpm and 4°C. The pellet is taken up in 30 ml 50 mmol/1 T is, pH 8.0, 50 mmol/1 EDTA and 0.5 % Triton X 100 and treated with ultrasound. It is centrifuged again, resuspended and treated with ultrasound. This procedure is repeated for a further two times. Subsequently it is centrifuged and the pellets obtained in this way are used as IBs in example 3.
Table 1 shows the results for the fermentation in a 1 1 shaking culture and in a 10 1 fermenter.
Table 1 Fermentation E. coli Total protein IgA protease strain from IB material (%) (9) (g) 1 1 HB 101 0.125 50-70 0.06-0.09 10 1 K12 C600 20.8 30-50 6.2-10.4 It can be seen from Table 1 that 60-90 mg protease is obtained as inclusion body (IB) material from the 1 1 shaking culture. At a renaturation yield of ca. 10 % this would yield 6 to 9 mg active IgA protease (compared to 3.5 mg by the conventional method). 6.2 to 10.4 g protease is obtained as IB material from the 10 1 fermenter. This would yield 620 to 1040 mg IgA - 14 - protease if 10 % is renatured (compared to 50 mg protease by the conventional method) .
It can be clearly seen from these results that the process according to the present invention results. in an increase in the yield of at least 2 to 3-fold (1 1 culture) or 20 to 30-fold (10 1 fermenter) .
Example 4 Renaturation of the IgA protease from inclusion bodies (1 1 fermentation) The inclusion bodies were first solubilized, then dialyzed and then renatured in the respective buffers.
Solublization of the IB material: 6 mol/1 guanidine/HCl, pH 8.5 0.1 mol/1 Tris 1 mmol/1 EDTA 0.1 mol/1 dithioerythreitol (DTE) Incubation: 2 h at room temperature Vol: 10 ml, protein concentration: 10 mg/ml Dialysis of the solubilisate: 6 mol/1 guanidine/HCl, pH 3 1 mmol/1 EDTA Duration: 12 h at room temperature against 10 1 buffer - 15 - Renaturation buffer: 1) 100 mmol/1 Tris, 1 mmol/1 EDTA, 1 mmol/1 DTE, pH 8.5 2) 100 mmol/1 Tris, 1 mmol/1 EDTA, 1 mmol/1 DTE, pH 7.5 3) 20 mmol/1 Tris, 1 mmol/1 EDTA, 1 mmol/1 DTE, pH 8.0 4) 0.6 mol/1 Arg/HCl, 1 mmol/1 EDTA, 1 mmol/1 DTE, pH 8.0 5) 0.6 mol/1 Arg/HCl, 1 mmol/1 EDTA, 5 mmol/1 reduced glutathione (GSH)/0.5 mmol/1 oxidized glutathione (GSSG) , pH 8 Pulse renaturation: The denatured protein is added in 5 portions to the renaturation buffer; the time interval between the individual additions was 30 minutes and the protein concentration in the preparation increased by 20 μg/ml per pulse. The final protein concentration was eventually 100 g/ml.
In order to determine the activity of the renatured IgA protease a dialysis is carried out in cleavage buffer (50 mmol/1 Tris/HCl pH 8, 1 mmol/1 CaCl2) . Human IgA was used as the cleavage substrate. Table 2 shows the results of the cleavage experiments (incubation: 6 h at 37 °C) on the renaturates obtained by using the above renaturation buffers (1-5) . - 16 - Table 2 Cleavage of human IgA with IgA protease isolated according to the present example (incubation: 6 h at 37 °C) . The isolate obtained after the dialysis contains about 50 % IgA protease.
Renaturate Ratio Cleavage protease/substrate (%) 1 1:20 10 2 1:20 30 3 1:20 10 4/5 1:100 100 1:500 50 1: 1000 30 1:2000 10 1:5000 5 soluble protease (100 % pure) It can be seen in Table 2 that IgA protease can be renatured in all buffers. The yields in an arginine (Arg) buffer are, however, 10 to 100-fold higher than without arginine. As a comparison the substrate was cleaved by 100 % with soluble purified IgA protease (according to example 1) at a protease: substrate ratio of 1:500. From this a renaturation yield of ca. 50 % can be determined for buffer 4) and 5) . - 17 - Example 5 Dependence of the optimization of the renaturation of IgA protease from inclusion bodies on the pH and arginine concentration Solubilization and dialysis are analogous to example 4.
Pulse renaturation: protein addition was carried out as described in example 4. 1) Determination of the renaturation yield while varying the pH value. 0.6 mol/1 Arg/HCl 1 mmol/1 EDTA pH 4, 6, 8 2) Renaturation while varying the arginine concentration 1 mmol/1 EDTA, pH 3 1 mmol/1 DTE Arg/HCl: 0.2; 0.4; 0.6 and 0.8 mol/1 Subsequently a dialysis was carried out at room temperature against a 100-fold volume of the cleavage buffer (50 mmol/1 Tris/HCl, pH 8, 1 mmol/1 CaCl2) . - 18 - Table 3 Cleavage of human IgA with the aid of the IgA protease isolated according to the present example. The dialysate contains about 50 to 70 % IgA protease. In the cleavage preparation 50 μg substrate was incubated with 1 μ<¾ renatured IgA protease for 6 h at 37°C. pH % Cleavage Arginine (mol/1) % Cleavage 4 10 0.2 85 6 95 0.4 90 8 100 0.6 95 0.8 95 The optimal reactivation of the IgA protease is at a pH of 6 to 8 and at an arginine concentration of 0.6 to 0.8 mol/1.

Claims (22)

100623/2 - 19 - C l a i m s
1. Process for the production of recombinant IgA protease, w h e r e i n (1) an IgA protease gene is modified in such a way that the DNA region of the IgA protease gene coding for the C-terminal helper sequence is no longer functionally active, (2) a host cell is transformed with the IgA protease gene modified according to step (1) or with a vector containing this modified gene, (3) the modified IgA protease gene is expressed in the transformed host cell, (4) the IgA protease which forms as inactive inclusion bodies is isolated from the host cell and (5) the IgA protease is converted into active protein by in vitro activation.
2. Process as claimed in claim 1, w h e r e i n the IgA protease gene is modified in such a way that the C-terminal helper sequence of the IgA protease resulting from the expression of the modified gene is completely deleted.
3. Process as claimed in claim 1 or 2, w h e r e i n one or several translation stop codons are introduced into the DNA region coding for the helper sequence or the DNA region coding for the helper sequence is partially or completely deleted. -_,20 -
4. Process as claimed in one of the claims 1 to 3, w h e r e i n the IgA protease gene is additionally modified in such a way that the DNA region of the IgA protease gene coding for the N-terminal signal sequence is no longer functionally active.
5. Process as claimed in claim 4, w h e r e i n the IgA protease gene is modified in such a way that the N-terminal signal sequence of the IgA protease resulting from the expression of the modified gene is completely deleted.
6. Process as claimed in one of the previous claims, w h e r e i n a prokaryotic cell is used as the host cell.
7. Process as claimed in claim 6, w h e r e i n an E. coli cell is used as the host cell.
8. Process as claimed in one of the previous claims, w h e r e i n the host cell is transformed with an IgA protease gene which is under the control of an inducible promoter.
9. Process as claimed in one of the previous claims, w h e r e i n the in vitro activation of the IgA protease includes a solubilization step and a renaturation step.
10. Process as claimed in claim 9, w h e r e i n the renaturation step is carried out as a pulse renaturation. -21-
11. Process as claimed in claim 9 or 10, wherein the renaturation step is carried out in the presence of 0.2 to 1 mol/1 arginine.
12. Process as claimed in claim 11, wherein a concentration of 0.4 to 0.8 mol/1 arginine is used.
13. Process as claimed in one of the claims 9 to 12, wherein the renaturation step is carried out at a pH of about 6 to 8.
14. Recombinant IgA protease produced by a process as claimed in one of the claims 1 to 13.
15. Recombinant DNA, which codes for an IgA protease according to claim 14, said DNA being modified in such a way that when the recombinant DNA is expressed an IgA protease is formed whose C-terminal helper sequence and whose N-terminal signal sequence within the IgA protease encoded thereby are no longer functionally active.
16. Recombinant DNA as claimed in claim 15, wherein on expression of the recombinant DNA an IgA protease is formed whose helper sequence is completely deleted.
17. Recombinant DNA as claimed in claim 16, wherein on expression of the recombinant DNA an IgA protease is formed whose signal sequence is completely deleted.
18. Recombinant vector, wherein it contains at least one copy of a recombinant DNA as claimed in one of the claims 15 to 17.
19. Recombinant vector, wherein the recombinant DNA is under the control of an inducible promoter.
20. Cell, wherein it is transformed with a recombinant DNA as claimed in one of the claims 15 to 17 or with a recombinant vector as claimed in claim 18 or 19.
21. Cell as claimed in claim 20, wherein it is a prokaryotic cell. 100623/3 -22-
22. Cell as claimed in claim 21, wherein it is an E. coli cell. Use of the recombinant IgA protease as claimed in claim 14 for the cleavage of fusion proteins produced by genetic engineering, substantially as described in the specification. LUZZATTO & LUZZATTO
IL10062392A 1991-01-11 1992-01-09 PROCESS FOR THE PRODUCTION OF RECOMBINANT IgA PROTEASE AND THE IgA PROTEASE PRODUCED THEREBY IL100623A (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE4100704 1991-01-11
DE4140699A DE4140699A1 (en) 1991-01-11 1991-12-10 RECOMBINANT IGA PROTEASE

Publications (2)

Publication Number Publication Date
IL100623A0 IL100623A0 (en) 1992-09-06
IL100623A true IL100623A (en) 2002-07-25

Family

ID=25900194

Family Applications (1)

Application Number Title Priority Date Filing Date
IL10062392A IL100623A (en) 1991-01-11 1992-01-09 PROCESS FOR THE PRODUCTION OF RECOMBINANT IgA PROTEASE AND THE IgA PROTEASE PRODUCED THEREBY

Country Status (14)

Country Link
EP (1) EP0495398B1 (en)
JP (1) JP2509410B2 (en)
AT (1) ATE174627T1 (en)
AU (1) AU636261B2 (en)
CA (1) CA2058872C (en)
DE (2) DE4140699A1 (en)
DK (1) DK0495398T3 (en)
ES (1) ES2127732T3 (en)
FI (1) FI103132B (en)
HU (1) HU215188B (en)
IE (1) IE914559A1 (en)
IL (1) IL100623A (en)
NZ (1) NZ241280A (en)
TW (1) TW197470B (en)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996009395A2 (en) * 1994-09-21 1996-03-28 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Drug for the prevention and treatment of auto-immune and viral diseases, and diagnostic agents for detecting said diseases
GB9618960D0 (en) 1996-09-11 1996-10-23 Medical Science Sys Inc Proteases
AU9341398A (en) * 1997-08-22 1999-03-16 Boehringer Mannheim Gmbh Protease precursors that can be autocatalytically activated and their use
CA2301698A1 (en) * 1997-08-22 1999-03-04 Roche Diagnostics Gmbh Zymogenic protease precursors that can be autocatalytically activated and their use
AU7053500A (en) * 1999-09-15 2001-04-17 Eli Lilly And Company Chymotrypsin-free trypsin
WO2010118337A2 (en) * 2009-04-10 2010-10-14 Biomarin Pharmaceutical Inc. Methods of enhancing yield of active iga protease
AU2024292159A1 (en) 2023-07-19 2026-01-22 F. Hoffmann-La Roche Ag Dsfv as an igg fragment format and methods of production and labelling thereof

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE3622221A1 (en) * 1986-07-02 1988-01-14 Max Planck Gesellschaft METHOD FOR THE GENE-TECHNOLOGICAL EXTRACTION OF PROTEINS USING GRAM-NEGATIVE HOST CELLS
DE3832898A1 (en) * 1988-09-28 1990-04-12 Boehringer Mannheim Gmbh PRAEPARATE OF EXPRESSED PLASMINOGEN ACTIVATOR IN PROKARYONS
DK130889A (en) * 1989-03-17 1990-09-18 Mogens Kilian IMMUNOGLOBULIN A1 PROTEASES (IGA1 PROTASES), PROCEDURES FOR GENTECHNOLOGICAL PREPARATION OF SUCH ENZYMES, AND VACCINE-CONTAINING ENZYMES AND SYMBOLS OF PROMISTS OF BACKGROUND IMMUNISTRY AND BIT

Also Published As

Publication number Publication date
HUT63654A (en) 1993-09-28
IE914559A1 (en) 1992-07-15
DE4140699A1 (en) 1992-07-16
CA2058872C (en) 1999-12-21
DE59209590D1 (en) 1999-01-28
JP2509410B2 (en) 1996-06-19
EP0495398A1 (en) 1992-07-22
FI920117A0 (en) 1992-01-10
NZ241280A (en) 1993-10-26
CA2058872A1 (en) 1992-07-12
ES2127732T3 (en) 1999-05-01
AU9011691A (en) 1992-09-10
TW197470B (en) 1993-01-01
HU215188B (en) 1998-10-28
ATE174627T1 (en) 1999-01-15
FI103132B1 (en) 1999-04-30
IL100623A0 (en) 1992-09-06
EP0495398B1 (en) 1998-12-16
FI103132B (en) 1999-04-30
DK0495398T3 (en) 1999-08-23
AU636261B2 (en) 1993-04-22
HU9200092D0 (en) 1992-03-30
FI920117L (en) 1992-07-12
JPH05168478A (en) 1993-07-02

Similar Documents

Publication Publication Date Title
US5427927A (en) Process for the enzymatic cleavage of recombinant proteins using IgA proteases
EP0230869B1 (en) Construction of an igg binding protein to facilitate downstream processing using protein engineering
WO1984003103A1 (en) Method of producing and selectively isolating proteins and polypeptides, recombinant and expression vector therefor and fusion protein able to bind to the constant region of immunoglobulins
JP2004520049A (en) Method for producing recombinant trypsin
CA2058872C (en) Recombinant iga protease
CN115867661A (en) Production of soluble recombinant proteins
US5965424A (en) Methods for making neisseria or hemophilus IgA protease and DNA encoding the proteases
US5082775A (en) Efficient process for isolating insoluble heterologous protein using non-ionic detergents
US6955910B2 (en) Method for large scale production of recombinant DNA-derived TPA or K2S molecules
JP2003512050A (en) Expression of recombinant mature lysostaphin
KR102643064B1 (en) Human enterokinase fusion protein with improved expression level and solubility and a preparing method thereof
EP0312346B1 (en) E. coli sequence specific acid protease
JP2711148B2 (en) Gene expression method from Streptomyces
EP1981978A2 (en) Affinity polypeptide for purification of recombinant proteins
KR100206731B1 (en) Process for purifying serine protease using recombinant inhibitor from erythrina caffra
JP4651203B2 (en) Novel glutaminase and method for producing the same
CA2185436C (en) Use of a recombinant inhibitor from erythrina caffra for purifying serine proteases
JP2003038195A (en) Method of obtaining useful protein from fusion protein
CN114480353A (en) Method for preparing recombinant human akkerplasmin
JPH03219892A (en) Method for preparing protein
JPH0588110B2 (en)
JPH02186988A (en) Production of antiviral protein
MXPA01009979A (en) Production of pancreatic procarboxy-peptidase b, isoforms and muteins thereof, and their use
JPS60145090A (en) DΝA
JP2000083694A (en) Purification of polypeptide and kit reagent

Legal Events

Date Code Title Description
FF Patent granted
KB Patent renewed
KB Patent renewed
MM9K Patent not in force due to non-payment of renewal fees