MXPA01009979A - Production of pancreatic procarboxy-peptidase b, isoforms and muteins thereof, and their use - Google Patents

Abstract

The invention relates to a method for producing pancreatic carboxy-peptidase B or an isoform or a mutein of carboxy-peptidase B, whereby:(a) a natural or unnatural precursor form of carboxy-peptidase B is expressed in a secretory manner in a microorganism;(b) the precursor form expressed in a secretory manner is purified, and;(c) the purified precursor form is converted into the active carboxy-peptidase B or into the isoform or the mutein thereof by means of an enzymatic treatment. The invention also relates to a nucleic acid construct, to its use in the aforementioned method, and to the production thereof, as well as to a host cell, the production thereof and its use in the method for producing pancreatic procarboxy-peptidase B or an isoform or a mutein thereof.

Description

PRODUCTION OF PROCARBOXI-PEPTIDASE B PANCREATIC, ISOFORMES AND MUTEINS OF THE SAME AND ITS USE The present invention relates to the preparation of carboxypeptidase B and procarboxypeptidase B and to the use of procarboxypeptidase B for the preparation of carbcxypepticase B which is active in bioenvironmental processes. The carbcxipspüidases are a group of enzymes that contain zinc proteases) that unfold proteins and peptides, by means of which the individual amino acids are eliminated r.idrolicicamenoe by passes to parnir of the term carbox lo of proteins or peptides that are going to be degraded. Carboxypeptides = s therefore belong to the exopeptidases. The animals are formed in the precursor pancreas chorus (procarboxypeptiase) and converted into the active forms by the trypsin in the moestin, where the primary cesto-isolate products of the proteins are of great importance for the digestion of peptides. According to the substrate specificity, differentiation between carboxypeptidases is carried out. Carboxypepprase B is, for example, exclusively basic amino acids such as arginine, l-star and ornithine. Carboxypeptidases are auxiliaries in the depletion of peptide and protein sequences, although amino acids at the carboxyl termini can be synthesized with their aid. In addition, proteins can be measured by the use of carboxypeptidase B. An industrial example of the use of carboxypeptidase B is the preparation of the important insulin pharmaceutical product. The preparation of this peptide hormone is described, inter alia, in European Patent Application EP-A 0 489 780. In this application, carboxypeptidase B is used in an important step in the conversion to insulins of proinsulin structures that have been opened with trypsin. The carboxypeptidase (B) which is used in industrial processes of this type, as a rule originates from preparations of carboxypeptidase (B), which are commercially obtainable. These are preferably obtained from porcine pancreases (Folk, J.E., Meth. Enzym .: 19, 504, 1970). Enzymes of animal origin, however, have the disadvantage that they can be affected by the risk of contamination with animal viruses. The detection of virus immunity becomes complicated and enters as an essential factor in the calculation of preparation costs. If the enzyme is used in large industrial processes, such as the industrial production of insulin, an additional disadvantage lies in the high logistic costs for obtaining and storing the frozen pancreas.

The biotechnological preparation offers itself as an alternative to the production of carboxypeptidase B through the extraction of tissue from the pancreas. In this process, there are a number of known preparation routes, such as direct intracellular expression or expression by means of a fusion protein in bacteria, for example in the form of a β-galactosidase-carboxypeptidase B fusion protein (J. Biol. Chem., 267: 2575-2581, 1992) or corresponding expression in yeast. A further alternative to this is the expression of a carboxypeptidase B precursor, procarboxypeptidase B, which consists of the amino acid sequence of carboxypeptidase B plus a signal sequence that leads to the secretion of the expression product. Suitable expression systems have been described for Bacill us subtilis, Streptomyces, E. col i and the yeasts Sa ccharomices, Candida, Hansenula polymorphus and Pichia pas toris and in some cases are commercially available. The prerequisite for the use of expression systems for the preparation of carboxypeptidase B is that the growth of the host strain selected in each case is not inhibited by the presence of active carboxypeptidase B, such that the expression is actually possible during the first time. Host strains that have this property are usually difficult to ferment, in such a way that a relatively poor performance in space and time emerges. A problem in the intracellular expression of carboxypeptidase B (direct expression or as a fusion protein) lies in the fact that the protein is not initially present in the correct spatial structure and is thus inactive. Then it must be doubled in vi tro during purification and processing. In this process, defective folding can occur, which has an adverse effect on the activity and specificity of the enzyme and makes it difficult to use in the pharmaceutical preparation. The preparation of carboxypeptidase B by secretion of the mature, active form of the enzyme also shows disadvantages. During fermentation, carboxypeptidase B is constantly inactivated by reaction with peptide-like fragments of cellular constituents or constituents of the nutrient medium that are recognized as a substrate, so that yield losses occur. One way out of this dilemma is the expression and secretion of a form of inactive carboxypeptidase B in spatially correct form. By reaction with an enzyme, active carboxypeptidase B can be prepared from this precursor in vi tro. "Active carboxypeptidase B" in this context means a carboxypeptidase B that is found in nature, for example human carboxypeptidase B or naturally occurring isoforms thereof. "Active Carboxypeptidase B" may also mean a mutein of naturally occurring carboxypeptidase B, in which deletions, additions or substitutions of the amino acid sequence occur, but the enzymatic activity of the mutein corresponds qualitatively to the. Enzymatic activity of carboxypeptidase B that occurs naturally. The aforementioned precursor can be natural procarboxypeptidase B or a derivative thereof, for example an isoform or a mutein or carboxypeptidase B which has been inactivated by the addition of a peptide sequence. The nature of the aggregated protein sequence is described in greater detail below. Procarboxypeptidase B or a derivative thereof is preferred, since active carboxypeptidase B can be prepared from this protein in a surprising and easily controllable form. In addition, procarboxypeptidase B and the aforementioned derivatives thereof can be stored for relatively long periods of time, while a loss of storage activity of carboxypeptidase B is observed. The aforementioned procarboxypeptidase B derivatives contain the. amino acid sequence of carboxypeptidase B plus an N-terminally linked peptide having the amino acid sequence of the signal peptide for the exclusion of the derivative from the host organism used for expression, optionally any desired amino acid sequence up to 100 amino acids in length and an endopeptidase recognition sequence that enables the enzymatic removal of the N-terminally linked peptide additionally from the carboxypeptidase B portion of the derivative. Examples of endopeptidase recognition sequences of this type are the corresponding known recognition sequences of trypsin, factor Xa, elastase, chymotrypsin and collagenase. Surprisingly, it has further been found that procarboxypeptidase B can react with proinsulin and trypsin in a pot reaction, such that the recently formed active carboxypeptidase B immediately recognizes and hydrolyzes the resulting carboxy terminal arginines of the insulin B chain. The carboxypeptidase B that results during the process is more active than the carboxypeptidase B that was previously stored and then added to the reaction with proinsulin. The trypsin present in the reaction mixture serves not only for the activation of procarboxypeptidase B, but also unfolds proinsulin specifically and thus contributes to the release of mature insulin. The kinetics of trypsin activation is surprisingly not adversely affected by the addition of a tetra-His sequence in the N-terminus of procarboxypeptidase B or the aforementioned derivatives. The advantage of such addition lies in the fact that the protein can thus be easily purified by affinity chromatography by means of the formation of the nickel-chelate complex. The use of such modified procarboxypeptidase B is in the same way an object of the invention. By way of example of the invention, the human pancreatic procarboxypeptidase B cDNA sequence is expressed. However, it is clear that because of the higher sequence homology in the DNA and the plane of the protein, between the human enzyme and the corresponding enzymes, for example from cattle, rats, pigs or other species, which form tissue of pancreas, the DNA sequence of such species could also be used in place of the human DNA sequence. The corresponding DNA coding for carboxypeptidase B muteins can also be used. Likewise, DNA sequences encoding isoforms naturally or artificially produced from carboxypeptidase B or from procarboxypeptidase B can be used. Furthermore, of course, all those DNA sequences that do not occur naturally can be used which, due to the degeneracy of the genetic code, can replace the aforementioned DNA sequences encoding a carboxypeptidase B or procarboxypeptidase B or in each case a mutein of them The Pichia pas tops system obtainable commercially through Invitrogen is also used as an example for the secretion of heterologous proteins for the production of human procarboxypeptidase B. It is clear to the person skilled in the art that bacterial systems, for example secretory mutants of E. col i, such as those described in European Patent Application EP-A-0 448 093, can also be used if the hirudin sequence described there is replaced by the sequence of procarboxypeptidase. A further alternative would be the expression of human procarboxypeptidase B in Streptomycetes, such as, for example, that described in European Patent Application EP-A 0 504 798 in the case of glutarilamidase expression. It is equally clear that in the broad industrial use of the process for the isolation of relatively large amounts of enzymes other protein purification steps than those described in the examples, such as those of the prior art, can be used. Accordingly, an object of the invention is a process for the preparation of pancreatic carboxypeptides B or an isoform or a mutein of carboxypeptidase B, wherein. (a) a natural or unnatural precursor form of carboxypeptidase B or an isoform or a mutein of carboxypeptidase B is expressed in a microorganism by secretion, (b) the precursor form expressed by secretion is purified and (c) the precursor form purified is converted to active carboxypeptidase B or an isoform or a mutation of carboxypeptidase B by means of an enzymatic treatment; in particular a process of the type in which pancreatic carboxypeptidase B or an isoform thereof originates from man, preferably a process of the type in which the natural precursor form corresponds to procarboxypeptidase B or an isoform thereof. Subsequently, in the case of reference to the process described, as a rule the expression "a process of this type" is used if there is no express reference to another process. The "natural" and "unnatural" precursor forms of carboxypeptidase B are molecules of the type occurring in nature ("natural precursor forms") or which have arisen from such natural precursor forms by substitution, addition or amino acid suppression ("non-natural precursor forms"), wherein, however, the unnatural precursor forms can be converted to active pancreatic carboxypeptidase B or isoforms or muteins thereof by an enzymatic treatment.A particularly preferred process is one of the type in the wherein the non-natural precursor form has the following structure: S- (As) xE-CB, (I) wherein S is a signal peptide which effects the secretion, from the respective microorganism, of the fusion protein formed during the expression As is any desired genetically encodable amino acid, E is a peptide linker consisting of an endopeptidase recognition sequence; amino acid origin of carboxypeptidase B or an isoform or a mutein of carboxypeptidase B; and x is an integer from 0-100. Furthermore, the invention relates to a process of the type in which a peptide sequence binds to the natural or unnatural precursor form which makes possible the purification of the precursor form by affinity chromatography, preferably particularly a process of the type in the which the linked sequence for purification by affinity chromatography is from 1 to 6, preferably 4, histidine residues.

The invention also relates to a process of the type wherein the yeast Pichia pastoris is used as a microorganism for expression. A further object of the invention is a process of the type in which the enzymes trypsin, elastase, factor Xa, chymotrypsin or collagenase, preferably trypsin, are used for enzymatic treatment. Furthermore, the invention relates to a process of the type in which step (c) proceeds under suitable reaction conditions in the presence of an insulin precursor form comprising the B, C and A chains of isulin or a derivative of insulin and in this process mature insulin or a mature insulin derivative is formed, which is isolated from the reaction mixture. A further object of the invention is the use of procarboxypeptidase B and carboxypeptidase B in a process of this type. In addition, the invention relates to a nucleic acid construct for use in such a process, comprising a DNA sequence encoding a natural or unnatural precursor form of carboxypeptidase B or an isoform or a mutein of carboxypeptidase B, wherein the aforementioned coding sequence is operably linked to the promoter that makes possible the expression of the precursor form in a suitable microorganism; preferably the invention relates to a nucleic acid construct in which the DNA sequence encodes a protein of the formula I; In addition, the invention relates to a nucleic acid construct in which a DNA sequence encoding 1 to 6, preferably 4, histidine residues is additionally bound to the DNA sequences encoding a natural or unnatural precursor form. of the carboxypeptidase B or an isoform or a mutein of carboxypeptidase B. Subsequently, in the case of reference to the nucleic acid construct described, as a rule the expression "such a nucleic acid construct" is used if not there is express reference to another nucleic acid construct. The invention also relates to a process for the preparation of such a nucleic acid construct, wherein (a) the DNA sequences mentioned are isolated or prepared, and (b) they are inserted into a vector in a suitable form. In addition, the invention relates to the use of a nucleic acid construct of this type in a aforementioned process for the preparation of pancreatic carboxypeptidase B.

The invention also relates to a host cell, comprising a nucleic acid construct mentioned above and a process for the preparation of a host cell of this type, in which a nucleic acid construct mentioned above is included in a suitable microorganism. The invention also relates to the use of a host cell of this type in a aforementioned process for the preparation of pancreatic carboxypeptidase B. The present examples are intended to illustrate how procarboxypeptidase B and (His) 4-procarboxypeptidase B could be expressed and purified. Furthermore, it is explained how procarboxypeptidase B could be activated with trypsin, mainly in isolated form and in the combined use of trypsin and procarboxypeptidase B for the preparation of insulin. Example 1 The example describes the preparation of a recombinant P. pasto strain for the secretion of human procarboxypeptidase B. The initial material used is a cDNA preparation as prepared according to known methods from RNA that was isolated from human pancreatic tissue .. cDNA preparations of this type are commercially available, for example from Clotech ( Catalog No. 7410-1). For amplification of the desired cDNA target sequence, two primers are synthesized. The sequences for this are taken from the database of the gene bank. The cDNA sequence for human pancreatic carboxypeptidase B is accessible there under accession number M81057. The forward primer sequence P-CPBI22 corresponds to the region 22bp-32bp and the backward primer sequence P-CPBrevl271 corresponds to the region 1271bp-1250bp. For amplification, a standard polymerase chain reaction (PCR) is carried out. The reaction products of the PCR are separated by gel electrophoresis and the resulting DNA band of the expected length of approximately 1250 bp is eluted and reacted in a ligation reaction with the vector pCR0! >; of the Original TA Cloning® equipment from Invitrogen. The competent cells of strains E. coli INVa F 'additionally supplied as a constituent of the equipment are transformed with the ligation mixture and seeded and incubated at 37 ° on NA plates containing 25 mg / liter of ampicillin. The cells taken from the cultured colonies are resuspended the next morning in 20 μl of sterile water and incubated at 94 ° C for 10 minutes. The PCR reaction regulator that in each case contains 0.2 μg of the two primers; P-CPBI22 and P-CPBrevl271 described, is then added to the suspension in such a way that a standard PCR can be carried out in a reaction volume of 100 μl. The reaction products are then analyzed by gel electrophoresis. Transformants containing DNA that can be amplified to give a fragment of approximately 1250 bp are recognized as correct. Plasmid DNA is isolated from one of the clones defined in this form and the inserted cDNA sequence is completely characterized by sequence analysis. It is seen that the determined sequence is completely identical to the sequence published by Aloy et al. (Biol. Chem., 379: 149-155, 1998). According to the publication, the codons encoding amino acids -95 to 307 of procarboxypeptidase are used for expression. The expression vector used is plasmid pPIC9, which was described by Cregg, J.M. et al. (Bio / Technologie, 11: 905-910, 1993) and Scorer, C.A. et al. (Bio / Technologie, 12: 181-184, 1994). For this, the plasmid pPCIC9 is opened using the restriction enzymes Xhol and EcoRI. For the insertion of the cDNA sequence into the vector, two primers are synthesized. The PPICCPBf forward primer has the sequence Xhol Procarboxypeptidase-> 5 'TTTTTTCTCGAGAAAAGACATCATGGTGGTGAGCAC 3' (SEQ ID NO: 1) and the forward primer PPICCPBrev has the sequence EcoRI Procarboxypeptidase 5 'TTTTTTGAATTCCTTACTACTAGTACAGGTGTTCCAGGAC 3' (SEQ ID NO: 2) In a standard PCR reaction, the cDNA is amplified using the two primers and the resulting fragment is digested with the Xhol and EcoRI enzymes after purification. The fragment made to be measured in this form is precipitated from the reaction mixture, taken up in water and reacted with the open vector fragment in a ligase reaction. Competent INVaF 'cells are transformed using the ligation mixture and seeded on selection plates. Colonies containing the desired expression plasmid are identified by PCR technology as described. Plasmid DNA is obtained from a clone recognized as correct. This DNA is introduced as described by Cregg J.M. et al. within the GS115 strain of P. pastoris that is auxotrophic for histidine (Scorer C.A. et al., Biotechnology, 12: 181-184, 1994). The colonies that, after transformation, become prototrophic for histidine and are investigated for the expression of the procarboxypeptidase protein. For this, 50 clones are expressed, such as those described by Clare, J.J. et al. (Gene, 105: 205-212, 1991). At the end of the expression, 1 ml of the culture medium is removed, the cells are removed by centrifugation and the clear supernatant is lyophilized. The aliquots of the supernatant are analyzed by means of SDS polyacrylamide gel electrophoresis. After staining by Coomassie Blue, it is seen that samples of some of the supernatants are visible in a transparent band in the range of 45,000 dt molecular weight, which is not observed in the supernatants samples of non-induced cultures. This band is clearly recognized in Western blot analysis of carboxypeptidase B antiphorbin antibody from Chemicon (order No. AB1801). A 100 ml culture, which expresses procarboxypeptidase B and which is isolated according to Example 2, of the clone that produces the best yield in this experiment is cultured in a stirred flask of two-liter crossed deviation. Example 2 The example describes the purification of human procarboxypeptidase B from supernatants of culture broth according to Example 1. Firstly, the cells are removed by centrifugation. The clear supernatant is then treated with ammonium sulfate until an approximate saturation of 55% concentration is achieved. The precipitated protein is removed by centrifugation and the pellet is dissolved in 5 ml of a 50 mM Tris HCl solution (pH 7.5) comprising 1 mM EDTA. The protein suspension is then separated by means of DEAE cellulose chromatography. The elution chromatogram is drawn on a gradient of NaCl from 0 to 0.5 M. The fractions containing the desired protein are identified by Western blot analysis. The fractions are combined and concentrated by means of ultra filtration. The concentration of the protein in the retained is determined by determination of proteins according to Bradford. The procarboxypeptidase enriched in this way is lyophilized for storage or activated directly according to Example 4 by means of trypsin treatment. The Coomassie Blue staining of the material separated by gel electrophoresis shows that approximately 60% of the material is in a protein band of approximately 45,000 dt molecular weight. The band corresponds to the region identified by Western staining. Example 3 The example describes the preparation of the expression vector for the synthesis of (His) / ¡-procarboxypeptidase B. The construction is carried out according to the route described in Example 1. The primer PPICCPBrev is used (see Example 1). The forward primer is modified such that it contains four additional codons for histidine. The primer sequence PCPBHisf accordingly reads: Xhol Procarboxypeptidase- >; 'TTTTTTCTCGAGAAAAGACACCATCACCACCATCATGGTGGTGAGCAC 3'. (His) 4 (SEQ ID NO: 3) The P. pastoris strain constructed in this form is used for expression and the HIS-procarboxypeptidase B protein is purified directly by a step of affinity chromatography of nickel after precipitation with ammonium sulfate in solution. The chromatographic support material used is "ProBond ™ NICKEL Chelating Resin" (Invitrogen Catalog No. R801-01) which corresponds to the manufacturer's details. After Coomassie Blue staining, gel electrophoresis analysis shows virtually only one visible band, which has a molecular weight of approximately 45,000 dt. This band is recognized by the antibody used in the Western dyeing experiment. The material purified in this way is ultrafiltered and, after determination of protein according to the Bradford method, lyophilized for storage or activated directly according to Example 4. Example 4 The example describes the activation of procarboxypeptidase B by reaction with trypsin . For this, 22 mg of lyophilized material is dissolved from Example 2 in 14 ml of a 0.1 molar tris HCl solution (pH 7.8), heated at 26 ° C and mixed with 15 μl of a trypsin solution (0.1 U / ml) and incubated with shaking for 3 hours. The solution is then mixed with a soybean trypsin inhibitor and the trypsin, the inhibitor, the propeptide fragments removed from the carboxypeptidase B and other constituents are separated from the carboxypeptidase B by microfiltration by means of a Centriprep® filter unit ( Amicon) which has a molecular weight exclusion limit of 30,000 dt. Active carboxypeptidase B is stored frozen in a 5 mM tris regulator (pH 7.5). The specific activity is determined after the determination of the protein concentration according to the procedure of Folk, J.E. (Meth. Enzym., 19: 504-508, 1970). If starting material that has been prepared according to Example 3 is used, only 15 mg of the initial material for activation is used. Example 5 The example describes the combined use of trypsin and procarboxypeptidase B for the preparation of insulin from mono-Arg insulin. Example 6 of European Patent Application EP-A 0 347 781 describes the reaction of mono-Arg insulin with trypsin and carboxypeptidase B in one and the same reaction vessel. In the present example, the carboxypeptidase B of Example 6 of European Patent Application EP-A 0 347 781 is now replaced by 15 μg of procarboxypeptidase B from Example 2 of this application or by 10 μg of procarboxypeptidase B of Example 3 of this request. In both reactions, the trypsin concentration is increased using 3 μl of trypsin instead of 2.5 μl of the stock solution (according to Example 6 of European Patent Application EP-A 0347 781).

Claims (18)

1. CLAIMS 1. A process for the preparation of pancreatic carboxypeptidase B or isoforms or mutein of carboxypeptidase B where (a) a natural or unnatural precursor form of carboxypeptidase B or an isoform or a mutein of carboxypeptidase B is expressed in a microorganism by secretion, (b) the expressed precursor form by secretion is purified and (c) the purified precursor form is converted to the active carboxypeptidase B or an isoform or a mutein of carboxypeptidase B by means of an enzymatic treatment.
2. 2. The process as claimed in claim 1, wherein the pancreatic carboxypeptidase B or an isoform thereof originates from man.
3. 3. The process as claimed in claim 1 or 2, wherein the natural precursor form corresponds to procarboxypeptidase B or an isoform of procarboxypeptidase B.
4. 4. The process as claimed in claim 1 or 2, wherein the precursor form unnatural has the following structure: S- (As) xE-CB, (I) wherein S is a signal peptide that effects the secretion, from the respective microorganism, of the fusion protein formed during expression; Ace is any desired genetically encodable amino acid; E is a peptide linker consisting of an endopeptidase recognition sequence; CB is the amino acid sequence of carboxypeptidase B or an isoform or a mutein of carboxypeptidase B; and x is an integer from 0-100.
5. The process as claimed in one of claims 1 to 4, wherein a peptide sequence is bound to the natural or unnatural precursor form that makes possible the purification of the precursor form by affinity chromatography.
6. 6. The process as claimed in claim 5, wherein the linked sequence for purification by affinity chromatography is 1 to 6, preferably 4, histidine residues.
7. The process as claimed in one of claims 1 to 6, wherein the microorganism used for expression is the yeast Pichia pas toris.
8. The process as claimed in one of claims 1 to 7, wherein the enzymes trypsin, elastase, factor Xa, chymotrypsin or collagenase, preferably trypsin, are used for enzymatic treatment.
9. The process as claimed in one of claims 1 to 8, wherein step (c) proceeds under suitable reaction conditions in the presence of an insulin precursor form comprising the B, C and A chains of insulin or a insulin derivative and in this process mature insulin or a mature insulin derivative is formed, which is isolated from the reaction mixture.
10. 10. The use of procarboxypeptidase B and carboxypeptidase B or of an isoform or of a mutein thereof in a process as claimed in claim 9.
11. 11. The construction of nucleic acid for use in a process as claimed in one of claims 1 to 9, comprising a DNA sequence encoding a natural or unnatural precursor form of carboxypeptidase B or an isoform or a mutein of carboxypeptidase B, wherein said coding sequence is operably linked to a promoter that it makes possible the expression of the precursor form in a suitable microorganism.
12. 12. The construction of a nucleic acid as claimed in claim 11, wherein the DNA sequence encodes a protein of formula I.
13. 13. The nucleic acid construct as claimed in one of claims 11 or 12 , wherein the DNA sequence encoding 1 to 6, preferably 4, histidine residues is additionally bound to the DNA sequences encoding a natural or unnatural precursor form of carboxypeptidase B.
14. 14. The process for the preparation of a nucleic acid construct as claimed in one of claims 11 to 13, wherein (a) the said DNA sequences are isolated or prepared, and (b) inserted into a vector in a suitable form.
15. 15. The use of a nucleic acid construct as claimed in one of claims 11 to 13, in a process as claimed in one of claims 1 to 9.
16. 16. The host cell comprising a nucleic acid construct as claimed in one of claims 11 to 13.
17. 17. The process for the preparation of a cell host as claimed in claim 16, wherein a nucleic acid construct as claimed in one of claims 1 to 9 is included in a suitable microorganism.
18. 18. The use of a host cell as claimed in claim 16, in a process as claimed in one of claims 1 to 9.