WO2024071491A1 - Micro-organisme présentant une capacité de production d'acides aminés de type mycosporine et procédé de production d'acides aminés de type mycosporine utilisant ce micro-organisme - Google Patents

Micro-organisme présentant une capacité de production d'acides aminés de type mycosporine et procédé de production d'acides aminés de type mycosporine utilisant ce micro-organisme Download PDF

Info

Publication number
WO2024071491A1
WO2024071491A1 PCT/KR2022/014844 KR2022014844W WO2024071491A1 WO 2024071491 A1 WO2024071491 A1 WO 2024071491A1 KR 2022014844 W KR2022014844 W KR 2022014844W WO 2024071491 A1 WO2024071491 A1 WO 2024071491A1
Authority
WO
WIPO (PCT)
Prior art keywords
mycosporine
microorganism
amino acids
amino acid
gene
Prior art date
Application number
PCT/KR2022/014844
Other languages
English (en)
Korean (ko)
Inventor
배상정
한지숙
최원우
Original Assignee
큐티스바이오 주식회사
서울대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 큐티스바이오 주식회사, 서울대학교산학협력단 filed Critical 큐티스바이오 주식회사
Publication of WO2024071491A1 publication Critical patent/WO2024071491A1/fr

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds

Definitions

  • the present invention relates to a microorganism having the ability to produce mycosporine-like amino acids and a method for producing mycosporine-like amino acids using the same.
  • UV blocking materials are used to protect the skin from UV rays.
  • oxybenzone, zinc oxide (ZnO), and titanium dioxide (TiO2) are UV blocking substances that are widely used as cosmetic additives, but due to their negative effects such as causing dermatitis or environmental pollution problems, safer bio-based UV rays are used. Development of barrier materials is required.
  • Mycosporine-like amino acids are natural UV-blocking materials produced by marine microorganisms or algae exposed to strong light.
  • 4-Deoxygadusol (4-DG) is a common precursor of MAA, and single and double substitution of amino acids has aminocyclohexenone and aminocycloheximine structures, respectively. Additionally, there are more than 30 different mycosporin-like amino acids depending on the type of amino acid combined and additional modifications.
  • These different types of MAAs can have different absorption spectra including both UV-A (315-400 nm) and UV-B (310-360 nm).
  • Mycosporine-like amino acids are naturally produced in microorganisms such as microalgae, but the amount is extremely small and the conditions for culturing and extraction/purification are complicated, making mass production difficult. Therefore, there is a need to develop new microorganisms with excellent production efficiency of mycosporin-like amino acids.
  • the present invention provides a microorganism that produces a mycosporine-like amino acid in which the activity of 3-deoxy-7-phosphoheptulonate synthase is inactivated compared to unmodified microorganisms.
  • the present invention includes culturing the microorganism;
  • the present invention seeks to provide a method for producing mycosporine-like amino acids, comprising the step of recovering mycosporine-like amino acids from the cultured microorganism or medium.
  • the present invention seeks to provide a composition for producing mycosporin-like amino acids, comprising the above microorganisms.
  • One aspect of the present invention is a microorganism that produces a mycosporin-like amino acid in which the activity of 3-deoxy-7-phosphoheptulonate synthase is inactivated compared to unmodified microorganisms. provides.
  • 3-deoxy-7-phosphoheptulonate synthase refers to phosphoenolpyruvate (PEP) and D-erythrose 4-phosphate (E4P). It is an enzyme involved in converting 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP).
  • the shikimate pathway a sub-pathway of the pentose phosphate pathway, is used.
  • the first step of the shikimate pathway is the conversion of phosphoenolpyruvate (PEP) and D-erythrose 4-phosphate (E4P) to 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP).
  • 3-deoxy-7-phosphoheptulonate synthase (DAHPS) an enzyme involved in this process, was inactivated.
  • the term "inactivation” refers to a case where the activity of the enzyme protein of the original microorganism is weakened compared to the intrinsic activity or activity before modification; When the protein is not expressed at all; Or, even if expressed, it means that there is no activity.
  • the inactivation occurs when the activity of the enzyme itself is weakened or eliminated compared to the activity of the enzyme originally possessed by the microorganism due to mutation of the polynucleotide encoding the enzyme, etc.; When the overall level of enzyme activity within the cell is lowered or eliminated compared to natural microorganisms due to inhibition of expression or translation of genes encoding enzymes; When part or all of the gene encoding the enzyme is deleted; and combinations thereof, but is not limited thereto.
  • non-modified microorganism refers to a change in the characteristics of a microorganism due to a genetic mutation in a specific protein of the microorganism being compared due to natural or artificial factors, the activity of a specific protein originally possessed by the parent strain before the change in the characteristics. refers to the microorganisms it contains.
  • unmodified microorganism may be used interchangeably with “microorganism with intrinsic activity” in which no genetic mutation has occurred.
  • Inactivation of the enzyme activity can be achieved by applying various methods well known in the art.
  • Examples of the method include: 1) a method of deleting all or part of the gene on the chromosome encoding the enzyme; 2) Modification of the expression control sequence to reduce the expression of the gene on the chromosome encoding the protein, 3) Modification of the gene sequence on the chromosome encoding the protein to eliminate or weaken the activity of the protein, 4) Modification of the gene sequence encoding the protein Introduction of antisense oligonucleotides (eg, antisense RNA) that bind complementary to the transcript of a gene on a chromosome; 5) A secondary structure is formed by adding a sequence complementary to the Shine-Dalgarno sequence in front of the Shine-Dalgarno sequence of the gene on the chromosome encoding the protein, making attachment of ribosomes impossible.
  • antisense oligonucleotides eg, antisense RNA
  • the method of deleting part or all of the gene on the chromosome encoding the enzyme involves replacing the polynucleotide encoding the endogenous target protein in the chromosome with a polynucleotide or marker gene in which a portion of the nucleotide sequence has been deleted through a vector for insertion into the chromosome into a microorganism. It can be done by doing.
  • a method for deleting part or all of a polynucleotide a method for deleting a polynucleotide by homologous recombination may be used, but is not limited thereto.
  • the method of modifying the expression control sequence is carried out by inducing mutations in the expression control sequence by deletion, insertion, non-conservative or conservative substitution of the nucleic acid sequence, or a combination thereof to further weaken the activity of the expression control sequence. This can be accomplished by replacing the nucleic acid sequence with an active nucleic acid sequence.
  • the expression control sequence includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence that regulates the termination of transcription and translation.
  • the method of modifying the gene sequence on the chromosome is carried out by inducing a mutation in the gene sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof to further weaken the activity of the enzyme, or to have a weaker activity. This can be done by replacing with an improved gene sequence or a gene sequence modified to be inactive, but is not limited to this.
  • polynucleotide may be described as a gene if it is a collection of polynucleotides capable of functioning.
  • polynucleotide and gene may be used interchangeably, and polynucleotide sequence and nucleotide sequence may be used interchangeably.
  • “some” may vary depending on the type of polynucleotide, but may be specifically 1 to 300, more specifically 1 to 100, and even more specifically 1 to 50, but is not particularly limited thereto. no.
  • the microorganism of the present invention can produce mycosporine-like amino acids.
  • mycosporine-like amino acids refers to cyclic compounds that absorb ultraviolet rays.
  • the mycosporine-like amino acid is not limited as long as it can absorb ultraviolet rays, but specifically includes compounds having a central ring of cyclohexanone or cyclohexenimine; Alternatively, it may be a compound in which various substances such as amino acids are bound to the central ring.
  • mycosporine-like amino acids may be used interchangeably with MAAs and MAAs.
  • the term “microorganism producing mycosporine-like amino acid” may refer to a microorganism containing a gene for an enzyme involved in the biosynthesis of a mycosporine-like amino acid or a cluster of such genes.
  • the term “mycosporine-like amino acid biosynthesis gene” refers to a gene encoding an enzyme involved in the biosynthesis of mycosporine-like amino acid, and also includes clusters of the above genes.
  • the mycosporine-like amino acid biosynthetic gene includes both exogenous and/or endogenous genes of the microorganism, as long as the microorganism containing it can produce mycosporine-like amino acid.
  • the foreign gene may be homologous and/or heterologous.
  • the mycosporine-like amino acid biosynthesis genes are not limited to the microbial species from which the genes are derived, as long as the microorganism containing them can produce enzymes involved in mycosporine-like amino acid biosynthesis and consequently produce mycosporine-like amino acids.
  • cyanobacteria Anabaena variabilis Nostoc punctiforme , Nodularia spumigena , Cyanothes genus PCC 7424 ( Cyanothecesp . PCC 7424), Lyngbyasp . PCC 8106), Microcystis aeruginosa , Microcoleus chthonoplastes , Cyanothes ATCC 51142 ( Cyanothecesp .
  • Aspergillus clavatus Nectriahaematococca , Aspergillus nidulans, Gibberellazeae , Verticillium albo-atrum , Botrioti Botryotinia fuckeliana , Phaeosphaerianodorum , or Nematostellavectensis , Heterocapsa triquetra, Oxyrrhis marina, Calo It may be Karlodinium micrum, Actinosynnemamirum , etc., but is not limited thereto.
  • the microorganism may contain mycosporin-like amino acid biosynthetic genes.
  • the mycosporine-like amino acid biosynthetic gene is not limited to the name of the enzyme or the originating microorganism as long as the microorganism can produce mycosporine-like amino acid, but 2-dimethyl 4-deoxygadusol synthetase (2-demethyl 4-deoxygadusol) synthase: DDGS), O-methyltransferase (O-MT), ATP-grasp ligase, and D-alanine D-alanine ligase (D-Ala D-Ala) At least one, specifically, at least 1, at least 2, at least 3, or all enzyme proteins selected from the group consisting of ligase); Alternatively, it may include a gene encoding an enzyme protein with the same and/or similar activity.
  • a microorganism that produces a mycosporine-like amino acid may contain a gene or a cluster of genes for an enzyme that has the activity of attaching additional amino acid residues to the mycosporine-like amino acid.
  • the gene or the cluster of genes is not limited to the name of the enzyme or the microorganism from which it is derived, as long as the microorganism that produces mycosporine-like amino acids can produce mycosporine-like amino acids with two or more amino acid residues attached, but is specifically non-ribosomal.
  • Peptide synthetase non-ribosomal peptide synthetase (NRPS), non-ribosomal peptide synthetase-like enzyme (NRPS-like enzyme) and D-alanine D-alanine ligase (D-Ala D) -Ala ligase: DDL), one or more selected from the group consisting of, specifically, 1 or more, 2 or more, 3 or more, or all enzyme proteins; Alternatively, it may include a gene encoding an enzyme protein with the same and/or similar activity.
  • Some mycosporine-like amino acids contain a second amino acid residue at mycosporine-glycine.
  • One or more enzymes selected from the group consisting of non-ribosomal peptide synthetase, non-ribosomal peptide synthetase-like enzyme and D-alanine D-alanine ligase are capable of attaching a second amino acid residue to mycosporine-glycine.
  • protein inactivation, protein activity enhancement, gene introduction, and/or gene deletion may be performed simultaneously, sequentially, or in reverse order, regardless of the order.
  • the microorganism may be a naturally occurring microorganism that originally possesses the mycosporin-like amino acid biosynthetic gene; and may be microorganisms into which heterologous and/or homologous mycosporin-like amino acid biosynthetic genes have been introduced, but are not limited thereto.
  • microorganism may be a microorganism with enhanced activity of an enzyme encoded by an endogenous and/or introduced gene related to mycosporine-like amino acid biosynthesis, but is not limited thereto.
  • microorganism may specifically be yeast, but is not limited thereto.
  • the yeast includes Saccharomyces , Candida , Debaryomyces , Hansenula , Kluyveromyces , Pichia , and Schizosaccharomyces ( It may be yeast of genera such as Schizosaccharomyces , Yarrowia , Schwanniomyces , Arxula , and Malassezia.
  • the yeast is Saccharomyces cerevisiae , Candida tropicalis, Candida utilis , Candida boidinii, Candida albicans , Cluyvero.
  • Myces lactis Kluyveromyceslactis
  • Pichia pastoris Pichiapastoris
  • Pichiastipitis Schizosaccharomycespombe , Hansenulapolymorpha , Yarrowia lipolytica
  • Schwanniomyces occidentalis Arxula adeninivorans , Malassezai restricta , Malassezai furfur , etc.
  • the microorganism has a mycosporin-like amino acid production ability of about 1% or more, specifically about 1% or more, about 2.5% or more, about 5% or more, about 6% or more, or about 7% compared to the mycosporine-like amino acid production ability of the parent strain or unmodified microorganism before mutation.
  • the recombinant strain with increased production capacity has a mycosporine-like amino acid production capacity of about 1.01 times or more, about 1.02 times or more, about 1.03 times or more, about 1.05 times or more, or about 1.05 times more than the parent strain or unmodified microorganism before mutation.
  • non-modified microorganism does not exclude hosts that contain mutations that may occur naturally in microorganisms, and are either wild-type hosts or natural hosts themselves, or are characterized by genetic mutations caused by natural or artificial factors. It may refer to the host before being changed.
  • the “non-transformed microorganism” refers to “pre-transformed host”, “pre-transformed strain”, “pre-transformed microorganism”, “non-mutated host”, “non-mutated strain”, “non-mutated microorganism”, “non-transformed host”, “ It can be used interchangeably with “unmodified strain” or “reference microorganism.”
  • the microorganism producing mycosporine-like amino acids includes 2-dimethyl 4-deoxygadusol synthase (DDGS), O-methyltransferase (O-MT), ATP-grasp ligase, and D -Alanine may include, but is not limited to, a gene encoding one or more proteins selected from the group consisting of D-alanine ligase.
  • DDGS 2-dimethyl 4-deoxygadusol synthase
  • O-MT O-methyltransferase
  • ATP-grasp ligase ATP-grasp ligase
  • D -Alanine may include, but is not limited to, a gene encoding one or more proteins selected from the group consisting of D-alanine ligase.
  • the 2-dimethyl 4-deoxygadusol synthase is, for example, as shown in Figure 1, 2-dimethyl-4-deoxygadusol (2-demethyl) from sedoheptulose 7-phosphate (S7P) 4-deoxygadusol: DDG) can be synthesized, but is not limited to this.
  • the O-methyltransferase can convert, for example, 2-dimethyl-4-deoxygadusol (DDG) into 4-deoxygadusol (4-DG), but is limited to this. It doesn't work.
  • DDG 2-dimethyl-4-deoxygadusol
  • 4-DG 4-deoxygadusol
  • the ATP-grasp ligase can, for example, catalyze glycine binding (glycylation) to convert 4-deoxygadusol (4-DG) into mycosporine-glycine (MG), but is limited thereto. no.
  • the D-alanine D-alanine ligase is formed by attaching L-serine or L-threonine to mycosporine-glycine (MG) to produce shinorine or Porphyra-334 ( porphyra-334) may be involved in the formation, but is not limited to this.
  • the 2-dimethyl 4-deoxygadusol synthase, O-methyl transferase, ATP-grasp ligase, and D-alanine D-alanine ligase are amino acids of proteins that are active depending on the species or microorganism of the microorganism. Since there may be differences in sequence, it is not limited to its origin or sequence.
  • the microorganism producing mycosporine-like amino acids includes glucose-6-phosphate 1-dehydrogenase and 6-phosphogluconate dehydrogenase.
  • the activity of one or more proteins selected from the group consisting of phosphogluconate dehydrogenase may be enhanced compared to unmodified microorganisms.
  • the glucose-6-phosphate 1-dehydrogenase converts glucose 6-phosphate (G6P), the first step of the pentose phosphate pathway, into 6-phospho-D-glucono-1,5-lactone (6) -phospho-D-glucono-1,5-lactone), but is not limited to this.
  • the 6-phosphogluconate dehydrogenase is an enzyme involved in converting D-gluconate 6-phosphate into D-ribulose 5-phosphate. , but is not limited to this.
  • glucose-6-phosphate 1-dehydrogenase and 6-phosphogluconate dehydrogenase origin I am not limited to rank.
  • the gene encoding glucose 6-phosphate 1-dehydrogenase is ZWF (YALI0E22649), and the gene encoding 6-phosphogluconate dehydrogenase is GND (YALI0B15598p), but these are limited. It doesn't work.
  • the term “enhancement of activity” means that the activity of an enzyme protein is introduced or the activity is improved compared to the intrinsic activity or activity before modification of the microorganism.
  • the “introduction” of the activity means that the activity of a specific protein that the microorganism did not originally possess is naturally or artificially revealed.
  • the activity enhancement can be achieved by introducing exogenous glucose-6-phosphate 1-dehydrogenase and/or 6-phosphogluconate dehydrogenase; or enhancing the activity of endogenous glucose-6-phosphate 1-dehydrogenase and/or 6-phosphogluconate dehydrogenase.
  • the method of enhancing activity herein includes 1) increasing the copy number of polynucleotides encoding the enzymes, 2) modifying the expression control sequence to increase expression of the polynucleotide, and 3) enhancing the activity of the enzymes.
  • this can be done by modifying the polynucleotide sequence on the chromosome, or 4) a combination thereof, but is not limited thereto.
  • Increasing the copy number of the polynucleotide is not particularly limited thereto, but may be performed by being operably linked to a vector or by inserting it into a chromosome in a host cell. Additionally, as an aspect of copy number increase, it can be performed by introducing a foreign polynucleotide showing enzyme activity or a codon-optimized variant polynucleotide of the polynucleotide into the host cell.
  • the foreign polynucleotide can be used without restrictions on its origin or sequence as long as it exhibits the same/similar activity as the enzyme.
  • the introduction can be performed by a person skilled in the art by appropriately selecting a known transformation method, and by expressing the introduced polynucleotide in the host cell, an enzyme can be produced and its activity can be increased.
  • the modification of the expression control sequence to increase the expression of the polynucleotide is not particularly limited, but includes deletion, insertion, non-conservative or conservative substitution of the nucleic acid sequence or these to further enhance the activity of the expression control sequence. It can be performed by inducing a mutation in the sequence through a combination of , or by replacing it with a nucleic acid sequence with stronger activity.
  • the expression control sequence is not particularly limited, but may include a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence that regulates the termination of transcription and translation.
  • a strong heterologous promoter may be connected to the upper part of the polynucleotide expression unit instead of the original promoter, and may be operably linked to the promoter to improve the expression rate of the polynucleotide encoding the enzyme, but is not limited to this. .
  • the modification of the polynucleotide sequence on the chromosome is not particularly limited, but may include deletion, insertion, non-conservative or conservative substitution of the nucleic acid sequence, or a combination thereof to further enhance the activity of the polynucleotide sequence. This can be done by inducing a mutation in the phase, or by replacing it with an improved polynucleotide sequence to have stronger activity.
  • the method of modification by a combination of 1) to 3) includes increasing the copy number of the polynucleotide encoding the enzyme, modifying the expression control sequence to increase its expression, and modifying the polynucleotide sequence on the chromosome. It can be performed by applying one or more of the following methods together: modification and modification of a foreign polynucleotide showing the activity of the enzyme or a codon-optimized variant polynucleotide thereof.
  • one or more genes selected from the group consisting of glucose-6-phosphate 1-dehydrogenase and 6-phosphogluconate dehydrogenase genes may be operably linked to the UAS1B8TEF promoter.
  • the UAS1B8TEF promoter may consist of SEQ ID NO: 18.
  • promoter refers to a nucleic acid sequence that controls the expression of a transcription unit.
  • Promoter region refers to a regulatory region capable of binding RNA polymerase within a cell and initiating transcription of the downstream (3'direction) coding region. Within the promoter region, protein binding regions (consensus sequences) responsible for binding RNA polymerase will be found, such as the putative -35th region and the Pribnow box (-10th region). Additionally, the promoter region may include a transcription initiation site and binding sites for regulatory proteins.
  • protein containing an amino acid sequence may be used interchangeably with the expressions “protein having an amino acid sequence” or “protein consisting of an amino acid sequence.”
  • the enzymes have the same or corresponding biological activity as each enzyme, not only the SEQ ID NOs, but also the amino acid sequences are 80% or more, specifically 90% or more, more specifically 95% or more, and more. More specifically, it may include proteins showing more than 99% homology.
  • the term “homology” refers to the degree of matching with a given amino acid sequence or nucleotide sequence and can be expressed as a percentage.
  • a given amino acid or nucleotide sequence and its homologous sequence that has the same or similar activity is expressed as “% homology”.
  • standard software for calculating parameters such as score, identity and similarity, specifically BLAST 2.0, or hybridization used under defined stringent conditions. It can be confirmed by comparing sequences experimentally, and appropriate hybridization conditions defined are within the scope of the relevant technology and methods well known to those skilled in the art (e.g., J.
  • stringent conditions refers to conditions that enable specific hybridization between polynucleotides. For example, these conditions are specifically described in the literature (e.g., J. Sambrook et al., supra).
  • the term “vector” refers to a DNA preparation containing the base sequence of a polynucleotide encoding the target protein operably linked to a suitable control sequence to enable expression of the target protein in a suitable host.
  • the regulatory sequences may include a promoter capable of initiating transcription, an optional operator sequence to regulate such transcription, a sequence encoding a suitable mRNA ribosome binding site, and sequences that regulate the termination of transcription and translation.
  • the vector After transformation into a suitable host cell, the vector can replicate or function independently of the host genome and can be integrated into the genome itself.
  • the vector used in one embodiment is not particularly limited as long as it can be expressed in a host cell, and any vector known in the art can be used.
  • Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state.
  • pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors
  • pBR, pUC, and pBluescriptII series can be used as plasmid vectors.
  • pGEM-based, pTZ-based, pCL-based, pCRE-based, pYL-based and pET-based, etc. can be used, but are not limited thereto.
  • the term “recombinant vector” refers to a recombinant carrier into which a heterologous DNA fragment is inserted, and generally refers to a double-stranded DNA fragment.
  • heterologous DNA refers to heterologous DNA, which is DNA not naturally found in host cells. Once within a host cell, the recombinant vector can replicate independently of the host chromosomal DNA and several copies of the vector and its inserted (heterologous) DNA can be produced.
  • the gene or the recombinant vector is transformed or transfected into a host cell.
  • exogenous nucleic acids DNA or RNA
  • electrophoresis calcium phosphate precipitation
  • DEAE-dextran transfection lipofection
  • the gene must be operably linked to transcriptional and translational expression control sequences that are functional within the selected expression host.
  • the expression control sequence and the corresponding gene are included in one recombinant vector that also contains a bacterial selection marker and a replication origin. If the host cell is a eukaryotic cell, the recombinant vector must further contain an expression marker useful in the eukaryotic expression host.
  • Host cells transformed by the above-described recombinant vector constitute another aspect of the present invention.
  • transformation means introducing DNA into a host so that the DNA can be replicated as an extrachromosomal factor or by completing chromosomal integration.
  • not all vectors function equally well in expressing the DNA sequence of the present invention.
  • not all hosts perform equally well for the same expression system.
  • a person skilled in the art can make an appropriate selection among various vectors, expression control sequences, and hosts without excessive experimental burden and without departing from the scope of the present invention. For example, when selecting a vector, the host must be considered, because the vector must replicate within it.
  • the copy number of the vector, the ability to control copy number and the expression of other proteins encoded by the vector, such as antibiotic markers, should also be considered.
  • operably linked means that the polynucleotide sequence is functionally linked to a promoter sequence that initiates and mediates transcription of the polynucleotide encoding the target protein of the present application.
  • Operable linkages can be prepared using genetic recombination techniques known in the art, and site-specific DNA cutting and linking can be made using cutting and linking enzymes known in the art, but are not limited thereto.
  • Another aspect of the present invention includes culturing the microorganism; and recovering the mycosporine-like amino acid from the cultured microorganism or medium.
  • microorganism and mycosporin-like amino acid are as described above.
  • the term “culture” means growing the microorganism under appropriately controlled environmental conditions.
  • the culture process can be carried out according to appropriate media and culture conditions known in the art. This culture process can be easily adjusted and used by a person skilled in the art depending on the selected microorganism. Specifically, the culture may be batch, continuous, and/or fed-batch, but is not limited thereto.
  • the term “medium” refers to a material that is mainly mixed with nutrients necessary for cultivating the microorganisms, and supplies nutrients and growth factors, including water, which are essential for survival and development.
  • the medium and other culture conditions used for cultivating the microorganisms can be any medium used for cultivating ordinary microorganisms without particular restrictions, but the microorganisms can be grown with appropriate carbon sources, nitrogen sources, personnel, inorganic compounds, amino acids, and /Or, it can be cultured under aerobic conditions in a normal medium containing vitamins, etc., while controlling temperature, pH, etc.
  • the carbon source includes carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; Sugar alcohols such as mannitol, sorbitol, etc., organic acids such as pyruvic acid, lactic acid, citric acid, etc.; Amino acids such as glutamic acid, methionine, lysine, etc. may be included. Additionally, natural organic nutrient sources such as starch hydrolyzate, molasses, blackstrap molasses, rice bran, cassava, bagasse and corn steep liquor can be used, specifically glucose and sterilized pre-treated molasses (i.e. converted to reducing sugars). Carbohydrates such as molasses) can be used, and various other carbon sources in an appropriate amount can be used without limitation. These carbon sources may be used alone or in combination of two or more types, but are not limited thereto.
  • the nitrogen source includes inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate; Organic nitrogen sources such as amino acids such as glutamic acid, methionine, and glutamine, peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolyzate, fish or its decomposition products, defatted soybean cake or its decomposition products, etc. can be used These nitrogen sources may be used individually or in combination of two or more types, but are not limited thereto.
  • inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate
  • Organic nitrogen sources such as amino acids such as glutamic acid, methionine, and glutamine, peptone, NZ-amine, meat extract, yeast
  • the agent may include monopotassium phosphate, dipotassium phosphate, or a corresponding sodium-containing salt.
  • Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, and calcium carbonate, and may also include amino acids, vitamins, and/or appropriate precursors. These components or precursors can be added to the medium batchwise or continuously. However, it is not limited to this.
  • compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. can be added to the medium in an appropriate manner to adjust the pH of the medium. Additionally, during culturing, foam generation can be suppressed by using an antifoaming agent such as fatty acid polyglycol ester.
  • an antifoaming agent such as fatty acid polyglycol ester.
  • oxygen or oxygen-containing gas can be injected into the medium, or to maintain the anaerobic and microaerobic state, nitrogen, hydrogen, or carbon dioxide gas can be injected without gas injection, and is limited thereto. That is not the case.
  • the culture temperature can be maintained at 20 to 45°C, specifically 25 to 40°C, and culture can be performed for about 10 to 160 hours, but is not limited thereto.
  • Mycosporin-like amino acids produced by the above culture may be secreted into the medium or remain within the cells.
  • the recovery is performed according to the culture method of the microorganism, for example, batch, continuous, or fed-batch culture method.
  • the desired mycosporine-like amino acid may be collected using a suitable method known in the art. For example, centrifugation, filtration, crystallization, treatment with protein precipitants (salting out), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity.
  • Various chromatography such as chromatography, HPLC, or a combination of these methods can be used, and the desired mycosporine-like amino acid can be recovered from the medium or microorganism using a suitable method known in the art.
  • the production method may additionally include a purification step.
  • the purification can be performed using a suitable method known in the art.
  • the recovery step and the purification step may be performed continuously or discontinuously regardless of the order, or may be performed simultaneously or integrated into one step. , but is not limited to this.
  • Another aspect of the present invention provides a composition for producing a mycosporin-like amino acid, comprising the microorganism.
  • microorganism and mycosporin-like amino acid are as described above.
  • the composition includes (i) a gene that inactivates the activity of 3-deoxy-7-phosphoheptulonate synthase or a recombinant vector containing the same; (ii) one or more selected from the group consisting of 2-dimethyl 4-deoxygadusol synthase, O-methyltransferase, ATP-grasp ligase, and D-alanine D-alanine ligase, or a gene encoding the same; Recombinant vector containing it; (iii) a recombinant vector engineered to delete the 3-deoxy-7-phosphoheptulonate synthase gene or to suppress or reduce the expression of the gene; (iv) at least one selected from the group consisting of glucose-6-phosphate 1-dehydrogenase and 6-phosphogluconate dehydrogenase, a gene encoding the same, or a recombinant vector containing the same; and/or (v) a mutant microorganism comprising (i
  • the production ability of mycosporine-like amino acids is improved when 3-deoxy-7-phosphoheptulonate synthase (DAHPS) involved in the shikimate pathway is inactivated, so the microorganism according to the present invention is It can be usefully used to produce mycosporine-like amino acids.
  • DHPS 3-deoxy-7-phosphoheptulonate synthase
  • Figure 1 is a schematic diagram of the mycosporine-like amino acid production pathway and competition pathway.
  • ZWF and GND green
  • ARO3 and ARO4 red
  • Figure 2 schematically illustrates a method for constructing a plasmid for gene insertion to construct a mycosporine-like amino acid biosynthetic pathway.
  • Figure 3 is a graph showing the growth and mycosporine-like amino acid production of CBEYL002, CBEYL002 aro3 ⁇ , CBEYL002 aro4 ⁇ , and CBEYL002 aro3 ⁇ aro4 ⁇ strains.
  • PO refers to Porphyra-334
  • SH refers to Shinorin.
  • Figure 4 shows CBEYL002 aro3 ⁇ aro4 ⁇ [EV], CBEYL002 aro3 ⁇ aro4 ⁇ [PEXP-ZWF], CBEYL002 aro3 ⁇ aro4 ⁇ [P UAS1B8TEF(136) -ZWF], CBEYL002 aro3 ⁇ aro4 ⁇ [P UAS1B8TEF(136) - GND]
  • PO refers to Porphyra-334
  • SH refers to Shinorin.
  • Example 1 Construction of vector for genomic insertion of mycosporin-like amino acid biosynthetic gene derived from microalgae
  • the yeast Yarrowia lipolytica does not have a mycosporine-like amino acid biosynthetic pathway, so a foreign gene must be introduced to construct a mycosporine-like amino acid biosynthetic pathway (see Figure 1).
  • Mycosporine-like amino acids shinorine and porphyra-334 are synthesized through a four-step enzymatic conversion reaction from sedoheptulose 7-phosphate (S7P), an intermediate in the pentose phosphate pathway. Sedoheptulose 7-phosphate is converted to 2-dimethyl-4-deoxygadusol (DDGS) by 2-demethyl 4-deoxygadusol synthase (DDGS).
  • the genes encoding DDGS (Ava3858), O-MT (Ava3857), and ATP-grasp ligase (Ava3856) were derived from Anabaena variabilis (ATCC 29413) and used after codon optimization, and D-Ala D
  • the gene encoding -Ala ligase (NpF5597) was derived from Nostoc punctiforme (ATCC29133) and was used after codon optimization.
  • UAS1B8TEF (136) promoter a UAS1B8TEF (136) promoter - gene - CYC1 terminator cassette was created.
  • the genome insertion location was selected as one with good gene expression, referring to the literature (Holkenbrink et al, Biotechnol. J. 2018, 13, 1700543).
  • a plasmid was constructed so that the sequence of the genomic insertion site (0.9 to 1.0 kb) was included at both ends of the selection marker (LoxP-URA3-LoxP).
  • the genomic insertion sites are named IntC3, IntD1, and IntE3, and the corresponding sequences can be confirmed in the sequence list.
  • the four gene cassettes were cloned in the order of NPF5597, Ava3856, Ava3857, and Ava3858, and the final gene insertion plasmids were named 'IntC3-NAAA', 'IntD1-NAAA', and 'IntE3-NAAA' ( Figure 2 and Table 1).
  • Example 2 Construction of a strain with an inserted mycosporin-like amino acid biosynthetic gene
  • the IntD1-NAAA plasmid prepared in Example 1 was treated with NdeI restriction enzyme to prepare a cassette for inserting a mycosporine-like amino acid biosynthetic gene.
  • the cassette was transformed into the Polg ku70 ⁇ ura3 ⁇ strain (see Beag et al., Metabolic Engineering of Yarrowia lipolytica for the production of carotenoids, ß-carotene, and crocetin) using the LiAc/SS carrier DNA/PEG method. Selection was performed on SC-Ura plates. The URA3 selection marker was removed using pCRE expressing Cre recombinase. Using the same method, IntC3-NAAA and IntE3-NAAA produced in Example 1 were sequentially inserted and named as 'CBEYL002' strain.
  • Example 3 Construction of a vector capable of inactivating 3-deoxy-7-phosphoheptulonate synthase (DAHP synthase)
  • DAHPS 3-deoxy-7-phosphoheptulonate synthase
  • a stop codon was attempted to be inserted into the target gene using base editing technology based on the CRISPR system (Bae et al., Biotechnol. J. 2020, 15, 1900238).
  • the gRNA sequence was designed as shown in Table 2 so that a stop codon can be inserted into the gene, and the plasmid into which the sequence is inserted was pCRISPRyl-P TEFin -nCas9-pmCDA1-UGI[W] Inverse PCR was performed using the plasmid as a template.
  • target gene gRNA sequence number ARO3 ACCGAAACCGGACCGAGGGAC 26 ARO4 GCTGCGATCCAAGTCCAAGG 27
  • the pCRISPRyl-P TEFin -nCas9-pmCDA1-UGI[ARO3] or pCRISPRyl-P TEFin -nCas9-pmCDA1-UGI[ARO4] plasmid produced in Example 3 was added to the CBEYL002 strain using the LiAc/SS carrier DNA/PEG method. transformed. The obtained transformed yeast strain was inoculated into SC-Leu medium and cultured for about 16 to 18 hours, then appropriately diluted and cultured on a YPD (yeast extract-peptone-dextrose) plate.
  • YPD yeast extract-peptone-dextrose
  • CBEYL002 aro3 ⁇ aro4 ⁇ was created by transforming the CBEYL002 aro4 ⁇ strain with pCRISPRyl-P TEFin -nCas9-pmCDA1-UGI[ARO3]. The produced strains are shown in Table 4.
  • Example 5 ARO3 and ARO4 Evaluation of the ability of inactivated strains to produce mycosporine-like amino acids
  • MAA mycosporine-like amino acids
  • 1 mL of culture medium was centrifuged to obtain the supernatant, which was filtered through a 0.22 ⁇ m filter and subjected to HPLC analysis.
  • the CBEYL002 aro3 ⁇ strain with the ARO3 gene inactivated increased the production of mycosporine-like amino acids by about 38%
  • the CBEYL002 aro4 ⁇ strain with the ARO4 gene inactivated increased mycosporine production.
  • the production of similar amino acids increased by about 88%
  • the CBEYL002 aro3 ⁇ aro4 ⁇ strain, in which both ARO3 and ARO4 genes were inactivated increased mycosporine-like amino acid production by about 74%.
  • genes ARO3 YALI0B20020
  • ARO4 It can be seen that when YALI0C06952) is inactivated, the production of mycosporin-like amino acids increases.
  • Example 6 For strengthening the pentose phosphate pathway GND and ZWF Construction of vector for overexpression of
  • glucose 6-phosphate (G6P) the first step in the pentose phosphate pathway, is converted into 6-phospho-D-glucono-1,5-lactone.
  • the gene ZWF YALI0E22649 encoding the enzyme glucose-6-phosphate 1-dehydrogenase, which is involved in the conversion to Additionally, the enzyme 6-phosphogluconate dehydrogenase (6) is involved in converting D-gluconate 6-phosphate to D-ribulose 5-phosphate.
  • GND YALI0B15598p
  • plasmids that individually expressed these genes were constructed. Fragments of each gene were obtained through PCR from the genomic DNA of CBEYL002, and each gene was expressed under the control of the EXP promoter or the UAS1B8TEF (136) promoter. Insert the promoter-gene-terminator ( PEX20 ) cassette into the pYL-LEU plasmid to produce pYL-LEU, pYL-P EXP -ZWF-LEU, pYL-P EXP -GND-LEU, pYL-P UAS1B8TEF(136) -ZWF-LEU. , or pYL-P UAS1B8TEF(136) -GND-LEU plasmid was constructed. The constructed plasmids are shown in Table 6.
  • the pYL-P UAS1B8TEF(136) -GND-LEU plasmid was transformed using the LiAc/SS carrier DNA/PEG method. Transformed yeast strains are shown in Table 4.
  • the concentration of mycosporine-like amino acids was measured as described in Example 5 and is shown in Figure 4 and Table 7.
  • a strain in which the gene encoding 3-deoxy-7-phosphoheptulonate synthase (DAHPS) involved in the shikimate pathway is inactivated according to the present invention. It can be seen that when GND or ZWF is overexpressed under the control of the UAS1B8TEF (136) promoter, the production of mycosporine-like amino acids is significantly increased. This suggests that the microorganism according to one embodiment of the present invention can be usefully used to produce mycosporine-like amino acids.
  • DHPS 3-deoxy-7-phosphoheptulonate synthase

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Mycology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

La présente invention concerne un micro-organisme présentant une capacité de production d'acides aminés du type mycosporine et un procédé de production d'acides aminés du type mycosporine utilisant ce micro-organisme. Selon un aspect de la présente invention, lorsque la 3-désoxy-7-phosphoheptulonate synthase (DAHPS) impliquée dans la voie shikimate est inactivée, la capacité de production d'acides aminés de type mycosporine est améliorée, et ainsi, le micro-organisme selon la présente invention peut être efficacement utilisé pour produire des acides aminés du type mycosporine.
PCT/KR2022/014844 2022-09-28 2022-09-30 Micro-organisme présentant une capacité de production d'acides aminés de type mycosporine et procédé de production d'acides aminés de type mycosporine utilisant ce micro-organisme WO2024071491A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2022-0123621 2022-09-28
KR1020220123621A KR102548752B1 (ko) 2022-09-28 2022-09-28 마이코스포린 유사 아미노산 생산능을 갖는 미생물 및 이를 이용한 마이코스포린 유사 아미노산의 생산 방법

Publications (1)

Publication Number Publication Date
WO2024071491A1 true WO2024071491A1 (fr) 2024-04-04

Family

ID=87157757

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/014844 WO2024071491A1 (fr) 2022-09-28 2022-09-30 Micro-organisme présentant une capacité de production d'acides aminés de type mycosporine et procédé de production d'acides aminés de type mycosporine utilisant ce micro-organisme

Country Status (2)

Country Link
KR (1) KR102548752B1 (fr)
WO (1) WO2024071491A1 (fr)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20170002587A (ko) * 2014-05-13 2017-01-06 각코우호우징 기타사토켄큐쇼 미생물을 사용한 미코스포린 유사 아미노산을 생산하는 방법
KR101911186B1 (ko) * 2017-08-16 2018-10-25 씨제이제일제당 (주) 마이코스포린 유사 아미노산을 생산하는 미생물 및 이를 이용한 마이코스포린 유사 아미노산의 생산방법
KR102003911B1 (ko) * 2018-02-23 2019-07-25 씨제이제일제당 주식회사 마이코스포린 유사 아미노산을 생산하는 미생물 및 이를 이용한 마이코스포린 유사 아미노산의 생산방법
KR20210082021A (ko) * 2019-12-24 2021-07-02 씨제이제일제당 (주) 마이코스포린 유사 아미노산을 생산하는 미생물 및 이를 이용한 마이코스포린 유사 아미노산의 생산방법

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20170002587A (ko) * 2014-05-13 2017-01-06 각코우호우징 기타사토켄큐쇼 미생물을 사용한 미코스포린 유사 아미노산을 생산하는 방법
KR101911186B1 (ko) * 2017-08-16 2018-10-25 씨제이제일제당 (주) 마이코스포린 유사 아미노산을 생산하는 미생물 및 이를 이용한 마이코스포린 유사 아미노산의 생산방법
KR102003911B1 (ko) * 2018-02-23 2019-07-25 씨제이제일제당 주식회사 마이코스포린 유사 아미노산을 생산하는 미생물 및 이를 이용한 마이코스포린 유사 아미노산의 생산방법
KR20210082021A (ko) * 2019-12-24 2021-07-02 씨제이제일제당 (주) 마이코스포린 유사 아미노산을 생산하는 미생물 및 이를 이용한 마이코스포린 유사 아미노산의 생산방법

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
SHICK J. M., ROMAINE-LIOUD S., FERRIER-PAGÈS C., GATTUSO J.-P.: "Ultraviolet‐B radiation stimulates shikimate pathway‐dependent accumulation of mycosporine‐like amino acids in the coral Stylophora pistillata despite decreases in its population of symbiotic dinoflagellates", LIMNOLOGY AND OCEANOGRAPHY., GRAFTON, WI., US, vol. 44, no. 7, 1 November 1999 (1999-11-01), US , pages 1667 - 1682, XP093151609, ISSN: 0024-3590, DOI: 10.4319/lo.1999.44.7.1667 *

Also Published As

Publication number Publication date
KR102548752B1 (ko) 2023-07-03

Similar Documents

Publication Publication Date Title
WO2013162274A1 (fr) Nouvelle souche produisant de l'acide d-lactique et son utilisation
WO2021162459A1 (fr) Micro-organisme comprenant un lyse variant et procédé de production d'acide l-aminé l'utilisant
EP1792975B1 (fr) Micro-organisme du genre Corynebacterium ayant une productivité augmentée de L-lysine et procédé de production de L-lysine en utilisant ledit micro-organisme
KR100838035B1 (ko) Ｌ-라이신 생산능이 향상된 코리네박테리움 속 미생물 및그를 이용한 ｌ-라이신 생산 방법
KR101592140B1 (ko) 자일로즈 이용능이 부여된 코리네박테리움 속 미생물 및 이를 이용한 ｌ-라이신의 생산방법
WO2020122505A1 (fr) Souche mutante à capacité de production d'acide l-glutamique améliorée et méthode de production d'acide l-glutamique l'utilisant
WO2019117398A1 (fr) Micro-organisme produisant du 5'-inosine monophosphate et méthode de production de 5'-inosine monophosphate à aide de celui-ci
WO2016200207A1 (fr) Micro-organisme produisant de l'acide lactique et procédé de production d'acide lactique à l'aide de celui-ci
CA3072748C (fr) Microorganisme pour la production d'un acide amine analogue de la mycosporine et methode de production dudit acide au moyen du microorganisme
KR20210128742A (ko) 글리세롤 생성이 억제된 재조합 내산성 효모 및 이를 이용한 젖산의 제조방법
DE60132277T2 (de) L-Glutaminsäure herstellendes Bacterium und Verfahren zur Herstellung von Glutaminsäure
CN112725210A (zh) 抑制乳酸代谢和乙醇产生的重组耐酸酵母及使用其生产乳酸的方法
WO2024071491A1 (fr) Micro-organisme présentant une capacité de production d'acides aminés de type mycosporine et procédé de production d'acides aminés de type mycosporine utilisant ce micro-organisme
KR102011394B1 (ko) 퓨트레신을 생산하는 미생물 및 이를 이용한 퓨트레신 생산방법
WO2022004953A1 (fr) Levure génétiquement modifiée ayant une capacité de production d'acétoïne et procédé de production d'acétoïne l'utilisant
WO2021125494A1 (fr) Variante de pompe d'efflux multimédicament, polynucléotide codant la variante, micro-organisme comprenant la variante et procédé de production de violacéine ou de désoxyviolacéine l'utilisant
KR101773123B1 (ko) 2,3-부탄다이올 생산능을 갖는 유전적으로 조작된 효모 세포 및 그를 사용하여 2,3-부탄다이올을 생산하는 방법
KR102303662B1 (ko) 화합물을 생산하는 미생물 및 이를 이용한 화합물의 생산 방법
WO2022225100A1 (fr) Nouveau variant bifonctionnel de méthylènetétrahydrofolate déshydrogénase/méthényltétrahydrofolate cyclohydrolase et procédé de production de xmp ou gmp l'utilisant
WO2022215800A1 (fr) Nouveau variant de perméase d'acide aminé à chaîne ramifiée et procédé de production de l-valine l'utilisant
JP4162383B2 (ja) ホモグルタミン酸の生産に関与する遺伝子およびその使用
KR102613937B1 (ko) 갈락토스 이용에 관여하는 모든 유전자가 결손된 효모 균주 및 이를 이용한 재조합 단백질 생산방법
WO2024128550A1 (fr) Procédé pour la production de protéines recombinées au moyen de pdi issu de la souche trichoderma sp.
WO2023063547A1 (fr) Variant de corynebacterium glutamicum ayant une capacité améliorée de production de l-lysine et procédé de production de l-lysine faisant appel à celui-ci
WO2021133030A1 (fr) Micro-organisme pour la production d'acide l-aminé ayant une activité de cytochrome c accrue, et procédé de production d'acide l-aminé l'utilisant

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22961091

Country of ref document: EP

Kind code of ref document: A1