WO2024071491A1 - Microorganism having mycosporine-like amino acid producing ability, and method for producing mycosporine-like amino acids using same - Google Patents

Abstract

The present invention relates to a microorganism having a mycosporine-like amino acid producing ability and a method for producing mycosporine-like amino acids using same. According to one aspect of the present invention, when 3-deoxy-7-phosphoheptulonate synthase (DAHPS) involved in the shikimate pathway is inactivated, the mycosporine-like amino acid producing ability is improved, and thus, the microorganism according to the present invention can be effectively used to produce mycosporine-like amino acids.

Description

Microorganisms capable of producing mycosporine-like amino acids and method for producing mycosporine-like amino acids using the same

The present invention relates to a microorganism having the ability to produce mycosporine-like amino acids and a method for producing mycosporine-like amino acids using the same.

A variety of chemical and physical UV blocking materials are used to protect the skin from UV rays. In particular, oxybenzone, zinc oxide (ZnO), and titanium dioxide (TiO2) are UV blocking substances that are widely used as cosmetic additives, but due to their negative effects such as causing dermatitis or environmental pollution problems, safer bio-based UV rays are used. Development of barrier materials is required.

Mycosporine-like amino acids (MAAs) are natural UV-blocking materials produced by marine microorganisms or algae exposed to strong light. 4-Deoxygadusol (4-DG) is a common precursor of MAA, and single and double substitution of amino acids has aminocyclohexenone and aminocycloheximine structures, respectively. Additionally, there are more than 30 different mycosporin-like amino acids depending on the type of amino acid combined and additional modifications. These different types of MAAs can have different absorption spectra including both UV-A (315-400 nm) and UV-B (310-360 nm).

Mycosporine-like amino acids are naturally produced in microorganisms such as microalgae, but the amount is extremely small and the conditions for culturing and extraction/purification are complicated, making mass production difficult. Therefore, there is a need to develop new microorganisms with excellent production efficiency of mycosporin-like amino acids.

Accordingly, the present invention provides a microorganism that produces a mycosporine-like amino acid in which the activity of 3-deoxy-7-phosphoheptulonate synthase is inactivated compared to unmodified microorganisms. We would like to provide

In addition, the present invention includes culturing the microorganism; The present invention seeks to provide a method for producing mycosporine-like amino acids, comprising the step of recovering mycosporine-like amino acids from the cultured microorganism or medium.

In addition, the present invention seeks to provide a composition for producing mycosporin-like amino acids, comprising the above microorganisms.

One aspect of the present invention is a microorganism that produces a mycosporin-like amino acid in which the activity of 3-deoxy-7-phosphoheptulonate synthase is inactivated compared to unmodified microorganisms. provides.

As used herein, the term "3-deoxy-7-phosphoheptulonate synthase" refers to phosphoenolpyruvate (PEP) and D-erythrose 4-phosphate (E4P). It is an enzyme involved in converting 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP).

PED + E4P → DAHP

Since mycosporin-like amino acids are produced from sedoheptulose 7-phosphate (S7P), an intermediate of the pentose phosphate pathway (see FIG. 1), in the present invention, the shikimate pathway, a sub-pathway of the pentose phosphate pathway, is used. ) was intended to weaken. Therefore, the first step of the shikimate pathway is the conversion of phosphoenolpyruvate (PEP) and D-erythrose 4-phosphate (E4P) to 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP). 3-deoxy-7-phosphoheptulonate synthase (DAHPS), an enzyme involved in this process, was inactivated.

As used herein, the term "inactivation" refers to a case where the activity of the enzyme protein of the original microorganism is weakened compared to the intrinsic activity or activity before modification; When the protein is not expressed at all; Or, even if expressed, it means that there is no activity. The inactivation occurs when the activity of the enzyme itself is weakened or eliminated compared to the activity of the enzyme originally possessed by the microorganism due to mutation of the polynucleotide encoding the enzyme, etc.; When the overall level of enzyme activity within the cell is lowered or eliminated compared to natural microorganisms due to inhibition of expression or translation of genes encoding enzymes; When part or all of the gene encoding the enzyme is deleted; and combinations thereof, but is not limited thereto.

In this specification, the term "non-modified microorganism" refers to a change in the characteristics of a microorganism due to a genetic mutation in a specific protein of the microorganism being compared due to natural or artificial factors, the activity of a specific protein originally possessed by the parent strain before the change in the characteristics. refers to the microorganisms it contains. As used herein, “unmodified microorganism” may be used interchangeably with “microorganism with intrinsic activity” in which no genetic mutation has occurred.

Inactivation of the enzyme activity can be achieved by applying various methods well known in the art. Examples of the method include: 1) a method of deleting all or part of the gene on the chromosome encoding the enzyme; 2) Modification of the expression control sequence to reduce the expression of the gene on the chromosome encoding the protein, 3) Modification of the gene sequence on the chromosome encoding the protein to eliminate or weaken the activity of the protein, 4) Modification of the gene sequence encoding the protein Introduction of antisense oligonucleotides (eg, antisense RNA) that bind complementary to the transcript of a gene on a chromosome; 5) A secondary structure is formed by adding a sequence complementary to the Shine-Dalgarno sequence in front of the Shine-Dalgarno sequence of the gene on the chromosome encoding the protein, making attachment of ribosomes impossible. how to make; 6) There is a method of adding a promoter that is transcribed in the opposite direction to the 3' end of the ORF (open reading frame) of the polynucleotide sequence encoding the above protein (Reverse transcription engineering, RTE), which can also be achieved by a combination of these. However, this is not particularly limited.

The method of deleting part or all of the gene on the chromosome encoding the enzyme involves replacing the polynucleotide encoding the endogenous target protein in the chromosome with a polynucleotide or marker gene in which a portion of the nucleotide sequence has been deleted through a vector for insertion into the chromosome into a microorganism. It can be done by doing. As an example of a method for deleting part or all of a polynucleotide, a method for deleting a polynucleotide by homologous recombination may be used, but is not limited thereto.

The method of modifying the expression control sequence is carried out by inducing mutations in the expression control sequence by deletion, insertion, non-conservative or conservative substitution of the nucleic acid sequence, or a combination thereof to further weaken the activity of the expression control sequence. This can be accomplished by replacing the nucleic acid sequence with an active nucleic acid sequence. The expression control sequence includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence that regulates the termination of transcription and translation.

The method of modifying the gene sequence on the chromosome is carried out by inducing a mutation in the gene sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof to further weaken the activity of the enzyme, or to have a weaker activity. This can be done by replacing with an improved gene sequence or a gene sequence modified to be inactive, but is not limited to this.

The polynucleotide may be described as a gene if it is a collection of polynucleotides capable of functioning. As used herein, polynucleotide and gene may be used interchangeably, and polynucleotide sequence and nucleotide sequence may be used interchangeably.

In the above, “some” may vary depending on the type of polynucleotide, but may be specifically 1 to 300, more specifically 1 to 100, and even more specifically 1 to 50, but is not particularly limited thereto. no.

The microorganism of the present invention can produce mycosporine-like amino acids.

As used herein, the term “mycosporine-like amino acids (MAAs)” refers to cyclic compounds that absorb ultraviolet rays. The mycosporine-like amino acid is not limited as long as it can absorb ultraviolet rays, but specifically includes compounds having a central ring of cyclohexanone or cyclohexenimine; Alternatively, it may be a compound in which various substances such as amino acids are bound to the central ring. More specifically, mycosporine-2-glycine, palythinol, palythenic acid, deoxygadusol, mycosporine-methylamine-threonine -methylamine-threonine), mycosporine-glycine-valine, palythine, asterina-330, shinorine, porphyra -334), euhalothece-362, mycosporine-glycine, mycosporine-ornithine, mycosporine-lysine, mycosporine-glutamic acid -Glycine (mycosporine-glutamic acid-glycine), mycosporine-methylamine-serine, mycosporine-taurine, palythene, palythene -serine), palythine-serine-sulfate, palythinol, and usujirene, but is not limited thereto.

As used herein, mycosporine-like amino acids may be used interchangeably with MAAs and MAAs.

As used herein, the term “microorganism producing mycosporine-like amino acid” may refer to a microorganism containing a gene for an enzyme involved in the biosynthesis of a mycosporine-like amino acid or a cluster of such genes. Additionally, as used herein, the term “mycosporine-like amino acid biosynthesis gene” refers to a gene encoding an enzyme involved in the biosynthesis of mycosporine-like amino acid, and also includes clusters of the above genes. The mycosporine-like amino acid biosynthetic gene includes both exogenous and/or endogenous genes of the microorganism, as long as the microorganism containing it can produce mycosporine-like amino acid. The foreign gene may be homologous and/or heterologous.

The mycosporine-like amino acid biosynthesis genes are not limited to the microbial species from which the genes are derived, as long as the microorganism containing them can produce enzymes involved in mycosporine-like amino acid biosynthesis and consequently produce mycosporine-like amino acids. As, cyanobacteria Anabaena variabilis , Nostoc punctiforme , Nodularia spumigena , Cyanothes genus PCC 7424 ( Cyanothecesp . PCC 7424), Lyngbyasp . PCC 8106), Microcystis aeruginosa , Microcoleus chthonoplastes , Cyanothes ATCC 51142 ( Cyanothecesp . ATCC 51142) ), Crocosphaerawatsonii , Cyanothes genus CCY 0110 ( Cyanothecesp . CCY 0110), Cylindrospermum stagnale genus PCC 7417 ( cylindrospermum stagnale sp ,PCC 7417), Aphanotes halopitica ( Aphanothecehalophytica ) or Trichodesmiumerythraeum , or the fungi Magnaportheorzyae , Pyrenophora tritici-repentis , Aspergillus cla. Aspergillus clavatus , Nectriahaematococca , Aspergillus nidulans, Gibberellazeae , Verticillium albo-atrum , Botrioti Botryotinia fuckeliana , Phaeosphaerianodorum , or Nematostellavectensis , Heterocapsa triquetra, Oxyrrhis marina, Calo It may be Karlodinium micrum, Actinosynnemamirum , etc., but is not limited thereto.

According to one embodiment, the microorganism may contain mycosporin-like amino acid biosynthetic genes.

Specifically, the mycosporine-like amino acid biosynthetic gene is not limited to the name of the enzyme or the originating microorganism as long as the microorganism can produce mycosporine-like amino acid, but 2-dimethyl 4-deoxygadusol synthetase (2-demethyl 4-deoxygadusol) synthase: DDGS), O-methyltransferase (O-MT), ATP-grasp ligase, and D-alanine D-alanine ligase (D-Ala D-Ala) At least one, specifically, at least 1, at least 2, at least 3, or all enzyme proteins selected from the group consisting of ligase); Alternatively, it may include a gene encoding an enzyme protein with the same and/or similar activity.

Additionally, a microorganism that produces a mycosporine-like amino acid may contain a gene or a cluster of genes for an enzyme that has the activity of attaching additional amino acid residues to the mycosporine-like amino acid. The gene or the cluster of genes is not limited to the name of the enzyme or the microorganism from which it is derived, as long as the microorganism that produces mycosporine-like amino acids can produce mycosporine-like amino acids with two or more amino acid residues attached, but is specifically non-ribosomal. Peptide synthetase (non-ribosomal peptide synthetase (NRPS), non-ribosomal peptide synthetase-like enzyme (NRPS-like enzyme) and D-alanine D-alanine ligase (D-Ala D) -Ala ligase: DDL), one or more selected from the group consisting of, specifically, 1 or more, 2 or more, 3 or more, or all enzyme proteins; Alternatively, it may include a gene encoding an enzyme protein with the same and/or similar activity. Some mycosporine-like amino acids contain a second amino acid residue at mycosporine-glycine. One or more enzymes selected from the group consisting of non-ribosomal peptide synthetase, non-ribosomal peptide synthetase-like enzyme and D-alanine D-alanine ligase are capable of attaching a second amino acid residue to mycosporine-glycine.

In the present specification, protein inactivation, protein activity enhancement, gene introduction, and/or gene deletion may be performed simultaneously, sequentially, or in reverse order, regardless of the order.

In addition, the microorganism may be a naturally occurring microorganism that originally possesses the mycosporin-like amino acid biosynthetic gene; and may be microorganisms into which heterologous and/or homologous mycosporin-like amino acid biosynthetic genes have been introduced, but are not limited thereto.

In addition, the microorganism may be a microorganism with enhanced activity of an enzyme encoded by an endogenous and/or introduced gene related to mycosporine-like amino acid biosynthesis, but is not limited thereto.

Additionally, the microorganism may specifically be yeast, but is not limited thereto.

The yeast includes Saccharomyces , Candida , Debaryomyces , Hansenula , Kluyveromyces , Pichia , and Schizosaccharomyces ( It may be yeast of genera such as Schizosaccharomyces , Yarrowia , Schwanniomyces , Arxula , and Malassezia.

Specifically, the yeast is Saccharomyces cerevisiae , Candida tropicalis, Candida utilis , Candida boidinii, Candida albicans , Cluyvero. Myces lactis ( Kluyveromyceslactis ), Pichia pastoris ( Pichiapastoris ), Pichiastipitis , Schizosaccharomycespombe , Hansenulapolymorpha , Yarrowia lipolytica ), Schwanniomyces occidentalis, Arxula adeninivorans , Malassezai restricta , Malassezai furfur , etc.

The microorganism has a mycosporin-like amino acid production ability of about 1% or more, specifically about 1% or more, about 2.5% or more, about 5% or more, about 6% or more, or about 7% compared to the mycosporine-like amino acid production ability of the parent strain or unmodified microorganism before mutation. or more, about 8% or more, about 9% or more, about 10% or more, about 11% or more, about 11.5% or more, about 12% or more, about 12.5% or more, about 13% or more, about 13.5% or more, about 14% or more, about 14.5% or more, about 15% or more, about 15.5% or more, about 16% or more, about 16.5% or more, about 17% or more, about 17.5% or more, about 18% or more, about 18.5% or more, about 19% or more, about 19.5% or more, about 20% or more, about 20.5% or more, about 21% or more, about 21.5% or more, about 22% or more, about 22.5% or more, about 23% or more, about 23.5% or more, about 24% or more, about 24.5% or more, about 25% or more, about 26% or more, about 27% or more, about 27.5% or more, about 30% or more, about 35% or more, about 40% or more, about 45% or more, about 50% or more or more, about 55% or more, about 60% or more, about 65% or more, about 70% or more, about 75% or more, about 80% or more, or about 85% or more (the upper limit is not particularly limited, for example, about 200%) Hereinafter, it may be about 150% or less or about 100% or less), but it is not limited thereto as long as it has a positive increase compared to the production capacity of the parent strain or unmodified microorganism before mutation. In another example, the recombinant strain with increased production capacity has a mycosporine-like amino acid production capacity of about 1.01 times or more, about 1.02 times or more, about 1.03 times or more, about 1.05 times or more, or about 1.05 times more than the parent strain or unmodified microorganism before mutation. 1.06 times or more, approximately 1.07 times or more, approximately 1.08 times or more, approximately 1.09 times or more, approximately 1.10 times or more, approximately 1.11 times or more, approximately 1.12 times or more, approximately 1.13 times or more, approximately 1.14 times or more, approximately 1.15 times or more, approximately 1.16 times or more, approximately 1.17 times or more, approximately 1.18 times or more, approximately 1.19 times or more, approximately 1.20 times or more, approximately 1.5 times or more, approximately 2.0 times or more, approximately 2.5 times or more, approximately 3.0 times or more, approximately 4.0 times or more, approximately 5.0 times or more, approximately 10 times or more, approximately 15 times or more, approximately 20 times or more, approximately 25 times or more, approximately 30 times or more, approximately 35 times or more, approximately 40 times or more, approximately 45 times or more, approximately 50 times or more, approximately It may be increased by 55 times or more or about 60 times or more (the upper limit is not particularly limited, for example, it may be about 100 times or less or about 80 times or less), but is not limited thereto. The term "about" is a range that includes ±0.5, ±0.4, ±0.3, ±0.2, ±0.1, etc., and includes all values in a range that are equivalent or similar to the value that follows the term "about." Not limited. In addition, even if “about” is not written in front of the number in this specification, it is the same as “about” written in front of the number.

As used herein, the term “non-modified microorganism” does not exclude hosts that contain mutations that may occur naturally in microorganisms, and are either wild-type hosts or natural hosts themselves, or are characterized by genetic mutations caused by natural or artificial factors. It may refer to the host before being changed. The “non-transformed microorganism” refers to “pre-transformed host”, “pre-transformed strain”, “pre-transformed microorganism”, “non-mutated host”, “non-mutated strain”, “non-mutated microorganism”, “non-transformed host”, “ It can be used interchangeably with “unmodified strain” or “reference microorganism.”

In one embodiment, the microorganism producing mycosporine-like amino acids includes 2-dimethyl 4-deoxygadusol synthase (DDGS), O-methyltransferase (O-MT), ATP-grasp ligase, and D -Alanine may include, but is not limited to, a gene encoding one or more proteins selected from the group consisting of D-alanine ligase.

The 2-dimethyl 4-deoxygadusol synthase (DDGS) is, for example, as shown in Figure 1, 2-dimethyl-4-deoxygadusol (2-demethyl) from sedoheptulose 7-phosphate (S7P) 4-deoxygadusol: DDG) can be synthesized, but is not limited to this.

The O-methyltransferase (O-MT) can convert, for example, 2-dimethyl-4-deoxygadusol (DDG) into 4-deoxygadusol (4-DG), but is limited to this. It doesn't work.

The ATP-grasp ligase can, for example, catalyze glycine binding (glycylation) to convert 4-deoxygadusol (4-DG) into mycosporine-glycine (MG), but is limited thereto. no.

The D-alanine D-alanine ligase is formed by attaching L-serine or L-threonine to mycosporine-glycine (MG) to produce shinorine or Porphyra-334 ( porphyra-334) may be involved in the formation, but is not limited to this.

The 2-dimethyl 4-deoxygadusol synthase, O-methyl transferase, ATP-grasp ligase, and D-alanine D-alanine ligase are amino acids of proteins that are active depending on the species or microorganism of the microorganism. Since there may be differences in sequence, it is not limited to its origin or sequence.

In one embodiment, the microorganism producing mycosporine-like amino acids includes glucose-6-phosphate 1-dehydrogenase and 6-phosphogluconate dehydrogenase. The activity of one or more proteins selected from the group consisting of phosphogluconate dehydrogenase may be enhanced compared to unmodified microorganisms.

The glucose-6-phosphate 1-dehydrogenase converts glucose 6-phosphate (G6P), the first step of the pentose phosphate pathway, into 6-phospho-D-glucono-1,5-lactone (6) -phospho-D-glucono-1,5-lactone), but is not limited to this.

The 6-phosphogluconate dehydrogenase is an enzyme involved in converting D-gluconate 6-phosphate into D-ribulose 5-phosphate. , but is not limited to this.

Since there may be differences in the amino acid sequence of the active protein depending on the species or microorganism of the glucose-6-phosphate 1-dehydrogenase and 6-phosphogluconate dehydrogenase, their origin I am not limited to rank. For example, the gene encoding glucose 6-phosphate 1-dehydrogenase is ZWF (YALI0E22649), and the gene encoding 6-phosphogluconate dehydrogenase is GND (YALI0B15598p), but these are limited. It doesn't work.

As used herein, the term “enhancement of activity” means that the activity of an enzyme protein is introduced or the activity is improved compared to the intrinsic activity or activity before modification of the microorganism. The “introduction” of the activity means that the activity of a specific protein that the microorganism did not originally possess is naturally or artificially revealed. For example, the activity enhancement can be achieved by introducing exogenous glucose-6-phosphate 1-dehydrogenase and/or 6-phosphogluconate dehydrogenase; or enhancing the activity of endogenous glucose-6-phosphate 1-dehydrogenase and/or 6-phosphogluconate dehydrogenase.

Specifically, the method of enhancing activity herein includes 1) increasing the copy number of polynucleotides encoding the enzymes, 2) modifying the expression control sequence to increase expression of the polynucleotide, and 3) enhancing the activity of the enzymes. Preferably, this can be done by modifying the polynucleotide sequence on the chromosome, or 4) a combination thereof, but is not limited thereto.

1) Increasing the copy number of the polynucleotide is not particularly limited thereto, but may be performed by being operably linked to a vector or by inserting it into a chromosome in a host cell. Additionally, as an aspect of copy number increase, it can be performed by introducing a foreign polynucleotide showing enzyme activity or a codon-optimized variant polynucleotide of the polynucleotide into the host cell. The foreign polynucleotide can be used without restrictions on its origin or sequence as long as it exhibits the same/similar activity as the enzyme. The introduction can be performed by a person skilled in the art by appropriately selecting a known transformation method, and by expressing the introduced polynucleotide in the host cell, an enzyme can be produced and its activity can be increased.

Next, 2) the modification of the expression control sequence to increase the expression of the polynucleotide is not particularly limited, but includes deletion, insertion, non-conservative or conservative substitution of the nucleic acid sequence or these to further enhance the activity of the expression control sequence. It can be performed by inducing a mutation in the sequence through a combination of , or by replacing it with a nucleic acid sequence with stronger activity. The expression control sequence is not particularly limited, but may include a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence that regulates the termination of transcription and translation.

Specifically, a strong heterologous promoter may be connected to the upper part of the polynucleotide expression unit instead of the original promoter, and may be operably linked to the promoter to improve the expression rate of the polynucleotide encoding the enzyme, but is not limited to this. .

In addition, 3) the modification of the polynucleotide sequence on the chromosome is not particularly limited, but may include deletion, insertion, non-conservative or conservative substitution of the nucleic acid sequence, or a combination thereof to further enhance the activity of the polynucleotide sequence. This can be done by inducing a mutation in the phase, or by replacing it with an improved polynucleotide sequence to have stronger activity.

Finally, 4) the method of modification by a combination of 1) to 3) includes increasing the copy number of the polynucleotide encoding the enzyme, modifying the expression control sequence to increase its expression, and modifying the polynucleotide sequence on the chromosome. It can be performed by applying one or more of the following methods together: modification and modification of a foreign polynucleotide showing the activity of the enzyme or a codon-optimized variant polynucleotide thereof.

In one embodiment, one or more genes selected from the group consisting of glucose-6-phosphate 1-dehydrogenase and 6-phosphogluconate dehydrogenase genes may be operably linked to the UAS1B8TEF promoter.

In one embodiment, the UAS1B8TEF promoter may consist of SEQ ID NO: 18.

As used herein, the term “promoter” refers to a nucleic acid sequence that controls the expression of a transcription unit. “Promoter region” refers to a regulatory region capable of binding RNA polymerase within a cell and initiating transcription of the downstream (3'direction) coding region. Within the promoter region, protein binding regions (consensus sequences) responsible for binding RNA polymerase will be found, such as the putative -35th region and the Pribnow box (-10th region). Additionally, the promoter region may include a transcription initiation site and binding sites for regulatory proteins.

As used herein, “protein containing an amino acid sequence” may be used interchangeably with the expressions “protein having an amino acid sequence” or “protein consisting of an amino acid sequence.”

In this specification, as long as the enzymes have the same or corresponding biological activity as each enzyme, not only the SEQ ID NOs, but also the amino acid sequences are 80% or more, specifically 90% or more, more specifically 95% or more, and more. More specifically, it may include proteins showing more than 99% homology.

In addition, if it is an amino acid sequence that is identical to or has biological activity corresponding to the enzyme protein of the sequence number substantially described as a sequence having homology to the above sequence, this also applies if some of the sequences have amino acid sequences deleted, modified, substituted, or added. It is obvious that it is included in the scope of the application.

As used herein, the term “homology” refers to the degree of matching with a given amino acid sequence or nucleotide sequence and can be expressed as a percentage. In this specification, a given amino acid or nucleotide sequence and its homologous sequence that has the same or similar activity is expressed as “% homology”. For example, standard software for calculating parameters such as score, identity and similarity, specifically BLAST 2.0, or hybridization used under defined stringent conditions. It can be confirmed by comparing sequences experimentally, and appropriate hybridization conditions defined are within the scope of the relevant technology and methods well known to those skilled in the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York). As used herein, the term “stringent conditions” refers to conditions that enable specific hybridization between polynucleotides. For example, these conditions are specifically described in the literature (e.g., J. Sambrook et al., supra).

As used herein, the term “vector” refers to a DNA preparation containing the base sequence of a polynucleotide encoding the target protein operably linked to a suitable control sequence to enable expression of the target protein in a suitable host. The regulatory sequences may include a promoter capable of initiating transcription, an optional operator sequence to regulate such transcription, a sequence encoding a suitable mRNA ribosome binding site, and sequences that regulate the termination of transcription and translation. After transformation into a suitable host cell, the vector can replicate or function independently of the host genome and can be integrated into the genome itself.

The vector used in one embodiment is not particularly limited as long as it can be expressed in a host cell, and any vector known in the art can be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pBR, pUC, and pBluescriptII series can be used as plasmid vectors. , pGEM-based, pTZ-based, pCL-based, pCRE-based, pYL-based and pET-based, etc. can be used, but are not limited thereto.

As used herein, the term “recombinant vector” refers to a recombinant carrier into which a heterologous DNA fragment is inserted, and generally refers to a double-stranded DNA fragment. Here, heterologous DNA refers to heterologous DNA, which is DNA not naturally found in host cells. Once within a host cell, the recombinant vector can replicate independently of the host chromosomal DNA and several copies of the vector and its inserted (heterologous) DNA can be produced.

After ligation, the gene or the recombinant vector is transformed or transfected into a host cell. There are a variety of techniques commonly used to introduce exogenous nucleic acids (DNA or RNA) into prokaryotic or eukaryotic host cells to "transform" or "transfect" them, such as electrophoresis, calcium phosphate precipitation, DEAE-dextran transfection or lipofection can be used.

As is well known in the art, to increase the level of expression of a transgene in a host cell, the gene must be operably linked to transcriptional and translational expression control sequences that are functional within the selected expression host. Specifically, the expression control sequence and the corresponding gene are included in one recombinant vector that also contains a bacterial selection marker and a replication origin. If the host cell is a eukaryotic cell, the recombinant vector must further contain an expression marker useful in the eukaryotic expression host.

Host cells transformed by the above-described recombinant vector constitute another aspect of the present invention. The term “transformation” used herein means introducing DNA into a host so that the DNA can be replicated as an extrachromosomal factor or by completing chromosomal integration. Of course, it should be understood that not all vectors function equally well in expressing the DNA sequence of the present invention. Likewise, not all hosts perform equally well for the same expression system. However, a person skilled in the art can make an appropriate selection among various vectors, expression control sequences, and hosts without excessive experimental burden and without departing from the scope of the present invention. For example, when selecting a vector, the host must be considered, because the vector must replicate within it. The copy number of the vector, the ability to control copy number and the expression of other proteins encoded by the vector, such as antibiotic markers, should also be considered.

As used herein, the term “operably linked” means that the polynucleotide sequence is functionally linked to a promoter sequence that initiates and mediates transcription of the polynucleotide encoding the target protein of the present application. Operable linkages can be prepared using genetic recombination techniques known in the art, and site-specific DNA cutting and linking can be made using cutting and linking enzymes known in the art, but are not limited thereto.

Another aspect of the present invention includes culturing the microorganism; and recovering the mycosporine-like amino acid from the cultured microorganism or medium.

At this time, the microorganism and mycosporin-like amino acid are as described above.

As used herein, the term “culture” means growing the microorganism under appropriately controlled environmental conditions. The culture process can be carried out according to appropriate media and culture conditions known in the art. This culture process can be easily adjusted and used by a person skilled in the art depending on the selected microorganism. Specifically, the culture may be batch, continuous, and/or fed-batch, but is not limited thereto.

In this specification, the term "medium" refers to a material that is mainly mixed with nutrients necessary for cultivating the microorganisms, and supplies nutrients and growth factors, including water, which are essential for survival and development. Specifically, the medium and other culture conditions used for cultivating the microorganisms can be any medium used for cultivating ordinary microorganisms without particular restrictions, but the microorganisms can be grown with appropriate carbon sources, nitrogen sources, personnel, inorganic compounds, amino acids, and /Or, it can be cultured under aerobic conditions in a normal medium containing vitamins, etc., while controlling temperature, pH, etc.

The carbon source includes carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; Sugar alcohols such as mannitol, sorbitol, etc., organic acids such as pyruvic acid, lactic acid, citric acid, etc.; Amino acids such as glutamic acid, methionine, lysine, etc. may be included. Additionally, natural organic nutrient sources such as starch hydrolyzate, molasses, blackstrap molasses, rice bran, cassava, bagasse and corn steep liquor can be used, specifically glucose and sterilized pre-treated molasses (i.e. converted to reducing sugars). Carbohydrates such as molasses) can be used, and various other carbon sources in an appropriate amount can be used without limitation. These carbon sources may be used alone or in combination of two or more types, but are not limited thereto.

The nitrogen source includes inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate; Organic nitrogen sources such as amino acids such as glutamic acid, methionine, and glutamine, peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolyzate, fish or its decomposition products, defatted soybean cake or its decomposition products, etc. can be used These nitrogen sources may be used individually or in combination of two or more types, but are not limited thereto.

The agent may include monopotassium phosphate, dipotassium phosphate, or a corresponding sodium-containing salt. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, and calcium carbonate, and may also include amino acids, vitamins, and/or appropriate precursors. These components or precursors can be added to the medium batchwise or continuously. However, it is not limited to this.

Additionally, during the culture, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. can be added to the medium in an appropriate manner to adjust the pH of the medium. Additionally, during culturing, foam generation can be suppressed by using an antifoaming agent such as fatty acid polyglycol ester. In addition, to maintain the aerobic state of the medium, oxygen or oxygen-containing gas can be injected into the medium, or to maintain the anaerobic and microaerobic state, nitrogen, hydrogen, or carbon dioxide gas can be injected without gas injection, and is limited thereto. That is not the case.

In the above culture, the culture temperature can be maintained at 20 to 45°C, specifically 25 to 40°C, and culture can be performed for about 10 to 160 hours, but is not limited thereto.

Mycosporin-like amino acids produced by the above culture may be secreted into the medium or remain within the cells.

In the step of recovering the mycosporine-like amino acid from the culture medium (medium in which the culture was performed) or the microorganism, the recovery is performed according to the culture method of the microorganism, for example, batch, continuous, or fed-batch culture method. The desired mycosporine-like amino acid may be collected using a suitable method known in the art. For example, centrifugation, filtration, crystallization, treatment with protein precipitants (salting out), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity. Various chromatography such as chromatography, HPLC, or a combination of these methods can be used, and the desired mycosporine-like amino acid can be recovered from the medium or microorganism using a suitable method known in the art.

Additionally, the production method may additionally include a purification step. The purification can be performed using a suitable method known in the art. In one example, when the production method includes both a recovery step and a purification step, the recovery step and the purification step may be performed continuously or discontinuously regardless of the order, or may be performed simultaneously or integrated into one step. , but is not limited to this.

Another aspect of the present invention provides a composition for producing a mycosporin-like amino acid, comprising the microorganism.

At this time, the microorganism and mycosporin-like amino acid are as described above.

The composition includes (i) a gene that inactivates the activity of 3-deoxy-7-phosphoheptulonate synthase or a recombinant vector containing the same; (ii) one or more selected from the group consisting of 2-dimethyl 4-deoxygadusol synthase, O-methyltransferase, ATP-grasp ligase, and D-alanine D-alanine ligase, or a gene encoding the same; Recombinant vector containing it; (iii) a recombinant vector engineered to delete the 3-deoxy-7-phosphoheptulonate synthase gene or to suppress or reduce the expression of the gene; (iv) at least one selected from the group consisting of glucose-6-phosphate 1-dehydrogenase and 6-phosphogluconate dehydrogenase, a gene encoding the same, or a recombinant vector containing the same; and/or (v) a mutant microorganism comprising (i), (ii), (iii), (iv), or a combination thereof. The composition or the mutant microorganism included in the composition may further include ingredients for strengthening the pentose phosphate pathway.

According to one aspect of the present invention, the production ability of mycosporine-like amino acids is improved when 3-deoxy-7-phosphoheptulonate synthase (DAHPS) involved in the shikimate pathway is inactivated, so the microorganism according to the present invention is It can be usefully used to produce mycosporine-like amino acids.

Figure 1 is a schematic diagram of the mycosporine-like amino acid production pathway and competition pathway. Here, ZWF and GND (green) are overexpression targets and ARO3 and ARO4 (red) are inactivation targets.

Figure 2 schematically illustrates a method for constructing a plasmid for gene insertion to construct a mycosporine-like amino acid biosynthetic pathway.

Figure 3 is a graph showing the growth and mycosporine-like amino acid production of CBEYL002, CBEYL002 aro3△ , CBEYL002 aro4△ , and CBEYL002 aro3△aro4△ strains. Here, PO refers to Porphyra-334 and SH refers to Shinorin.

Figure 4 shows CBEYL002 aro3△aro4△ [EV], CBEYL002 aro3△aro4△ [PEXP-ZWF], CBEYL002 aro3△aro4△ [P _{UAS1B8TEF(136)} -ZWF], CBEYL002 aro3△aro4△ [P _{UAS1B8TEF(136)} - GND] This is a graph showing the production of mycosporine-like amino acids of the strain. Here, PO refers to Porphyra-334 and SH refers to Shinorin.

Hereinafter, the present invention will be described in more detail through examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited by these examples.

Example 1: Construction of vector for genomic insertion of mycosporin-like amino acid biosynthetic gene derived from microalgae

The yeast Yarrowia lipolytica does not have a mycosporine-like amino acid biosynthetic pathway, so a foreign gene must be introduced to construct a mycosporine-like amino acid biosynthetic pathway (see Figure 1). Mycosporine-like amino acids shinorine and porphyra-334 are synthesized through a four-step enzymatic conversion reaction from sedoheptulose 7-phosphate (S7P), an intermediate in the pentose phosphate pathway. Sedoheptulose 7-phosphate is converted to 2-dimethyl-4-deoxygadusol (DDGS) by 2-demethyl 4-deoxygadusol synthase (DDGS). ) and then converted to 4-deoxygadusol (4-DG) by O-methyltransferase (O-MT). Afterwards, the enzyme ATP-grasp ligase catalyzes glycylation, converting 4-DG into mycosporine-glycine (MG). Finally, L-serine or L-threonine is attached to mycosporine-glycine (MG) by the enzyme D-alanine D-alanine ligase. This forms shinorine or porphyra-334 (see Figure 1).

The genes encoding DDGS (Ava3858), O-MT (Ava3857), and ATP-grasp ligase (Ava3856) were derived from Anabaena variabilis (ATCC 29413) and used after codon optimization, and D-Ala D The gene encoding -Ala ligase (NpF5597) was derived from Nostoc punctiforme (ATCC29133) and was used after codon optimization. To express each gene using the UAS1B8TEF (136) promoter, a UAS1B8TEF (136) promoter - gene - CYC1 terminator cassette was created.

These four gene cassettes were inserted into the genome using the Cre-LoxP system. The genome insertion location was selected as one with good gene expression, referring to the literature (Holkenbrink et al, Biotechnol. J. 2018, 13, 1700543). First, a plasmid was constructed so that the sequence of the genomic insertion site (0.9 to 1.0 kb) was included at both ends of the selection marker (LoxP-URA3-LoxP). The genomic insertion sites are named IntC3, IntD1, and IntE3, and the corresponding sequences can be confirmed in the sequence list. The four gene cassettes were cloned in the order of NPF5597, Ava3856, Ava3857, and Ava3858, and the final gene insertion plasmids were named 'IntC3-NAAA', 'IntD1-NAAA', and 'IntE3-NAAA' (Figure 2 and Table 1).

Plasmid	Description
*For gene insertion
IntC3-NAAA	IntC3:: P UAS1B8-TEF(136) -NpF5597-T CYC1 , P UAS1B8-TEF(136) -Ava3856-T CYC1 , P UAS1B8-TEF(136) -Ava3857-T CYC1 , P UAS1B8-TEF(136) - Ava3858-T CYC1 , loxP-URA3-loxP, Amp R , ColE1
IntD1-NAAA	IntD1:: P UAS1B8-TEF(136) -NpF5597-T CYC1 , P UAS1B8-TEF(136) -Ava3856-T CYC1 , P UAS1B8-TEF(136) -Ava3857-T CYC1 , P UAS1B8-TEF(136) - Ava3858-T CYC1 , loxP-URA3-loxP, Amp R , ColE1
IntE3-NAAA	IntE3:: P UAS1B8-TEF(136) -NpF5597-T CYC1 , P UAS1B8-TEF(136) -Ava3856-T CYC1 , P UAS1B8-TEF(136) -Ava3857-T CYC1 , P UAS1B8-TEF(136) - Ava3858-T CYC1 , loxP-URA3-loxP, Amp R , ColE1
pCRE	P EXP1 -Cre-T CYC1 , LEU, ARS18, Amp R , ColE1

Example 2: Construction of a strain with an inserted mycosporin-like amino acid biosynthetic gene

The IntD1-NAAA plasmid prepared in Example 1 was treated with NdeI restriction enzyme to prepare a cassette for inserting a mycosporine-like amino acid biosynthetic gene. The cassette was transformed into the Polg ku70△ura3△ strain (see Beag et al., Metabolic Engineering of Yarrowia lipolytica for the production of carotenoids, ß-carotene, and crocetin) using the LiAc/SS carrier DNA/PEG method. Selection was performed on SC-Ura plates. The URA3 selection marker was removed using pCRE expressing Cre recombinase. Using the same method, IntC3-NAAA and IntE3-NAAA produced in Example 1 were sequentially inserted and named as 'CBEYL002' strain.

Example 3: Construction of a vector capable of inactivating 3-deoxy-7-phosphoheptulonate synthase (DAHP synthase)

Since mycosporin-like amino acids are produced from S7P, an intermediate of the pentose phosphate pathway (see Figure 1), the shikimate pathway, a downstream pathway of the pentose phosphate pathway, was weakened to allow the intermediate S7P to accumulate. Therefore, phosphoenolpyruvate (PEP) and D-erythrose 4-phosphate (E4P), which are the first steps in the shikimate pathway, are converted into 3-deoxy-D-arabino-heptulose. 3-deoxy-7-phosphoheptulonate synthase, an enzyme involved in the conversion to 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP) : DAHPS) was intended to be inactivated.

There are two or more DAHPS isoforms in the yeast Yarrowia lipolytica . Accordingly, we sought to determine whether there was an effect of increasing mycosporine-like amino acid production by inactivating the gene ARO3 (YALI0B20020) or ARO4 (YALI0C06952) encoding 3-deoxy-7-phosphoheptulonate synthase (DAHPS).

In order to inactivate ARO3 or ARO4 , a stop codon was attempted to be inserted into the target gene using base editing technology based on the CRISPR system (Bae et al., Biotechnol. J. 2020, 15, 1900238). The gRNA sequence was designed as shown in Table 2 so that a stop codon can be inserted into the gene, and the plasmid into which the sequence is inserted was pCRISPRyl-P _TEFin -nCas9-pmCDA1-UGI[W] Inverse PCR was performed using the plasmid as a template. -P _TEFin -nCas9-pmCDA1-UGI[ARO3], pCRISPRyl-P _TEFin -nCas9-pmCDA1-UGI[ARO4] plasmids were constructed. The produced plasmids are shown in Table 3.

target gene	gRNA	sequence number
ARO3	ACCGAAACCGGACCGAGGGAC	26
ARO4	GCTGCGATCCAAGTCCAAGG	27

Plasmid	Description
* For gene inactivation
pCRISPRyl-P TEFin -nCas9-pmCDA1-UGI[W]	P TEFin -nCAS9-T CYC1 , P SCR1\ ly -TRP1 gRNA, LEU, CEN, Ori1001, Amp R , ColE1
pCRISPRyl-P TEFin -nCas9-pmCDA1-UGI[ARO3]	pCRISPRyl-P TEFin -nCas9-pmCDA1-UGI[W] replacing TRP1 gRNA with ARO3 gRNA
pCRISPRyl-P TEFin -nCas9-pmCDA1-UGI[ARO4]	pCRISPRyl-P TEFin -nCas9-pmCDA1-UGI[W] replacing TRP1 gRNA with ARO3 gRNA

Example 4: ARO3 and ARO4 Production of inactivated strains

The pCRISPRyl-P _TEFin -nCas9-pmCDA1-UGI[ARO3] or pCRISPRyl-P _TEFin -nCas9-pmCDA1-UGI[ARO4] plasmid produced in Example 3 was added to the CBEYL002 strain using the LiAc/SS carrier DNA/PEG method. transformed. The obtained transformed yeast strain was inoculated into SC-Leu medium and cultured for about 16 to 18 hours, then appropriately diluted and cultured on a YPD (yeast extract-peptone-dextrose) plate. A single colony was selected, PCR performed on the ARO3 or ARO4 gene, and then sequenced to confirm whether a nonsense mutation had been inserted (Table 4). Using the same method, CBEYL002 aro3△aro4△ was created by transforming the CBEYL002 aro4 △ strain with pCRISPRyl-P _TEFin -nCas9-pmCDA1-UGI[ARO3]. The produced strains are shown in Table 4.

Strain	Description
CBEYL002	Polgku70△ura3△ IntC3:: P UAS1B8-TEF(136) -NpF5597-T CYC1 , P UAS1B8-TEF(136) -Ava3856-T CYC1 , P UAS1B8-TEF(136) -Ava3857-T CYC1 , P UAS1B8-TEF (136) -Ava3858-T CYC1 -loxP, IntD1::P UAS1B8-TEF(136) -NpF5597-T CYC1 , P UAS1B8-TEF(136) -Ava3856-T CYC1 , P UAS1B8-TEF(136) -Ava3857- T CYC1 , P UAS1B8-TEF(136) -Ava3858-T CYC1 -loxP, IntE3::P UAS1B8-TEF(136) -NpF5597-T CYC1 , P UAS1B8-TEF(136) -Ava3856-T CYC1 , P UAS1B8- TEF(136) -Ava3857-T CYC1 ,P UAS1B8-TEF(136) -Ava3858-T CYC1- loxP
CBEYL002 aro3△	CBEYL001, Aro3 14R->stop
CBEYL002 aro4△	CBEYL001, Aro4 40R->stop
CBEYL002 aro3△aro4△	CBEYL001, Aro3 14R->stop, Aro4 40R->stop
CBEYL002 aro3△aro4△ [EV]	CBEYL002 aro3△aro4△ harboring pYL-LEU
CBEYL002 aro3△aro4△ [P EXP -ZWF]	CBEYL002 aro3△aro4△ harboring pYL-P EXP -ZWF-LEU
CBEYL002 aro3△aro4△ [P EXP -GND]	CBEYL002 aro3△aro4△ harboring pYL-P EXP -GND-LEU
CBEYL002 aro3△aro4△ [P UAS1B8TEF(136) -ZWF]	CBEYL002 aro3△aro4△ harboring pYL-P UAS1B8TEF(136) -ZWF-LEU
CBEYL002 aro3△aro4△ [P UAS1B8TEF(136) -GND]	CBEYL002 aro3△aro4△ harboring pYL-P UAS1B8TEF(136) -GND-LEU

Example 5: ARO3 and ARO4 Evaluation of the ability of inactivated strains to produce mycosporine-like amino acids

To confirm the production effect of mycosporine-like amino acids by the strains CBEYL002, CBEYL002 aro3△ , CBEYL002 aro4△ , and CBEYL002 aro3△aro4△ produced in Examples 2 and 4, the following experiment was performed.

Specifically, first, YPD medium (20 g/L glucose, 10 g/L yeast extract, 20 /L bacto-peptone) was inoculated at OD ₆₀₀ = 0.2 and cultured for 148 hours at 30 ° C and 220 rpm. To quantify mycosporine-like amino acids (MAA) in the medium, 1 mL of culture medium was centrifuged to obtain the supernatant, which was filtered through a 0.22 ㎛ filter and subjected to HPLC analysis. A 1260 infinity HPLC system (Agilent) equipped with an Agilent Eclipse Water included: Acetonitrile containing 0.25% Trifluoroacetic acid = 97.5: 2.5) was flowed. Shinorine and Porphyra-334 were detected with a UV-vis detector at a wavelength of 334 nm. The results of quantifying mycosporine-like amino acids (shinorine and Porphyra-334) using HPLC as described above are shown in Figure 3 and Table 5.

As shown in Figure 3 and Table 5, compared to the CBEYL002 strain, the CBEYL002 aro3△ strain with the ARO3 gene inactivated increased the production of mycosporine-like amino acids by about 38%, and the CBEYL002 aro4△ strain with the ARO4 gene inactivated increased mycosporine production. The production of similar amino acids increased by about 88%. In addition, the CBEYL002 aro3△aro4△ strain, in which both ARO3 and ARO4 genes were inactivated, increased mycosporine-like amino acid production by about 74%.

148h	O.D600	Mycosporine-like amino acids (mg/L)
		Shinorin	Porphyra-334	Sum
CBEYL002	27.36±1.48	10.20	5.96	16.16
CBEYL002 aro3△	25.77±1.28	16.23	6.08	22.31
CBEYL002 aro4△	30.05±2.50	20.01	10.41	30.42
CBEYL002 aro3△aro4△	25.40±0.28	18.34	9.90	28.24

From the above experimental results, according to one embodiment of the present invention, genes ARO3 (YALI0B20020) and/or ARO4 ( It can be seen that when YALI0C06952) is inactivated, the production of mycosporin-like amino acids increases.

Example 6: For strengthening the pentose phosphate pathway GND and ZWF Construction of vector for overexpression of

Since mycosporine-like amino acids are produced from S7P, an intermediate in the pentose phosphate pathway (see Figure 1), we attempted to increase the production of mycosporine-like amino acids by strengthening the glycolytic pathway. Accordingly, glucose 6-phosphate (G6P), the first step in the pentose phosphate pathway, is converted into 6-phospho-D-glucono-1,5-lactone. ), the gene ZWF (YALI0E22649) encoding the enzyme glucose-6-phosphate 1-dehydrogenase, which is involved in the conversion to Additionally, the enzyme 6-phosphogluconate dehydrogenase (6) is involved in converting D-gluconate 6-phosphate to D-ribulose 5-phosphate. We sought to strengthen the gene GND (YALI0B15598p), which encodes -phosphogluconate dehydrogenase).

To confirm the effect of overexpression of GND and ZWF , plasmids that individually expressed these genes were constructed. Fragments of each gene were obtained through PCR from the genomic DNA of CBEYL002, and each gene was expressed under the control of the EXP promoter or the UAS1B8TEF (136) promoter. Insert the promoter-gene-terminator ( PEX20 ) cassette into the pYL-LEU plasmid to produce pYL-LEU, pYL-P _EXP -ZWF-LEU, pYL-P _EXP -GND-LEU, pYL-P _{UAS1B8TEF(136)} -ZWF-LEU. , or pYL-P _{UAS1B8TEF(136)} -GND-LEU plasmid was constructed. The constructed plasmids are shown in Table 6.

Plasmid	Description
*For gene expression
pYL-LEU	LEU, CEN, Ori1001, AmpR , ColE1
pYL-P EXP -ZWF-LEU	P EXP -ZWF-T PEX20 , LEU, CEN, Ori1001, Amp R , ColE1
pYL-P EXP -GND-LEU	P EXP -GND-T PEX20 , LEU, CEN, Ori1001, Amp R , ColE1
pYL- PUAS1B8TEF(136) -ZWF-LEU	P UAS1B8TEF(136) -ZWF-T PEX20 , LEU, CEN, Ori1001, Amp R , ColE1
pYL- PUAS1B8TEF(136) -GND-LEU	P UAS1B8TEF(136) -GND-T PEX20 , LEU, CEN, Ori1001, Amp R , ColE1

Example 7: GND and ZWF Evaluation of mycosporine-like amino acid production ability through overexpression of

It was confirmed as follows whether the production of mycosporine-like amino acids increases when GND or ZWF is overexpressed.

Specifically, pYL-LEU, pYL-P _EXP -ZWF-LEU, pYL-P _EXP -GND-LEU, pYL-P _{UAS1B8TEF (136)} -ZWF-LEU, prepared in Example 6 in the CBEYL002 aro3△aro4△ strain. Alternatively, the pYL-P _{UAS1B8TEF(136)} -GND-LEU plasmid was transformed using the LiAc/SS carrier DNA/PEG method. Transformed yeast strains are shown in Table 4. The obtained transformed yeast strain was inoculated into SC-Leu medium (20 g/L glucose, 6.7 g/L YNB without amino acid, amino acid added except leucine) at OD ₆₀₀ = 0.2 and incubated at 30°C and 220 rpm for 148 hours. cultured for a while. The concentration of mycosporine-like amino acids was measured as described in Example 5 and is shown in Figure 4 and Table 7.

As shown in Figure 4 and Table 7, when the two genes were expressed under the control of the EXP promoter, there was no effect, but when the two genes were expressed under the control of the UAS1B8TEF (136) promoter, the production of mycosporine-like amino acids increased significantly. In addition, compared to the CBEYL002 aro3△aro4△ [EV] strain carrying an empty vector, the CBEYL002 aro3△aro4△ [P _{UAS1B8TEF(136)} -ZWF] strain and the CBEYL002 aro3△aro4△ [P _{UAS1B8TEF(136)} -GND] strain The production of mycosporine-like amino acids increased by 2.4-fold and 2.7-fold, respectively.

120h	Mycosporine-like amino acids (mg/L)
	Shinorin	Porphyra-334	Sum
CBEYL002 aro3△aro4△ [EV]	11.93±0.77	12.35±1.73	24.28±1.76
CBEYL002 aro3△aro4△ [P EXP -ZWF]	13.31±2.82	16.22±4.02	29.54±4.84
CBEYL002 aro3△aro4△ [P EXP -GND]	9.58±1.70	10.19±1.94	19.77±2.57
CBEYL002 aro3△aro4△ [P UAS1B8TEF(136) -ZWF]	24.30±0.67	26.90±1.91	57.25±1.82
CBEYL002 aro3△aro4△ [P UAS1B8TEF(136) -GND]	32.94±2.70	38.13±3.01	65.02±4.04

From the above experimental results, according to one embodiment of the present invention, a strain in which the gene encoding 3-deoxy-7-phosphoheptulonate synthase (DAHPS) involved in the shikimate pathway is inactivated according to the present invention It can be seen that when GND or ZWF is overexpressed under the control of the UAS1B8TEF (136) promoter, the production of mycosporine-like amino acids is significantly increased. This suggests that the microorganism according to one embodiment of the present invention can be usefully used to produce mycosporine-like amino acids.

Claims (8)

1. A microorganism that produces mycosporine-like amino acids in which the activity of 3-deoxy-7-phosphoheptulonate synthase is inactivated compared to unmodified microorganisms.
2. The method of claim 1, wherein the microorganism has 2-demethyl 4-deoxygadusol synthase, O-methyltransferase, and ATP-grasp ligase. ), and D-alanine D-alanine ligase (D-Ala D-Ala ligase), a microorganism that produces mycosporine-like amino acids, comprising a gene encoding one or more proteins selected from the group consisting of
3. The method according to claim 1 or 2, from the group consisting of glucose-6-phosphate 1-dehydrogenase and 6-phosphogluconate dehydrogenase. Microorganisms that produce mycosporine-like amino acids in which the activity of one or more selected proteins is enhanced compared to unmodified microorganisms.
4. The method according to any one of claims 1 to 3, wherein the gene encoding one or more proteins selected from the group consisting of glucose-6-phosphate 1-dehydrogenase and 6-phosphogluconate dehydrogenase is selected from the UAS1B8TEF promoter and A microorganism that produces operably linked mycosporin-like amino acids.
5. The microorganism according to any one of claims 1 to 4, wherein the microorganism is yeast.
6. The method according to any one of claims 1 to 5, wherein the mycosporine-like amino acid is mycosporine-2-glycine, palythinol, palythenic acid, and deoxygadusol. (deoxygadusol), mycosporine-methylamine-threonine, mycosporine-glycine-valine, palythine, asterina-330 , shinorine, porphyra-334, euhalothece-362, mycosporine-glycine, mycosporine-ornithine, myco mycosporine-lysine, mycosporine-glutamic acid-glycine, mycosporine-methylamine-serine, mycosporine-taurine, pal selected from the group consisting of palythene, palythine-serine, palythine-serine-sulfate, palythinol, and usujirene One or more recombinant microorganisms.
7. Culturing the microorganism according to any one of claims 1 to 6; and

   A method for producing mycosporine-like amino acids, comprising the step of recovering mycosporine-like amino acids from the cultured microorganism or medium.
8. A composition for producing a mycosporine-like amino acid, comprising the microorganism according to any one of claims 1 to 6.

Images