WO2024063484A1 - CBFβ 발현 혈관평활근세포 또는 이의 배양액을 유효성분으로 포함하는 노인성 질환 예방 또는 치료용 약학 조성물 - Google Patents

CBFβ 발현 혈관평활근세포 또는 이의 배양액을 유효성분으로 포함하는 노인성 질환 예방 또는 치료용 약학 조성물 Download PDF

Info

Publication number
WO2024063484A1
WO2024063484A1 PCT/KR2023/014083 KR2023014083W WO2024063484A1 WO 2024063484 A1 WO2024063484 A1 WO 2024063484A1 KR 2023014083 W KR2023014083 W KR 2023014083W WO 2024063484 A1 WO2024063484 A1 WO 2024063484A1
Authority
WO
WIPO (PCT)
Prior art keywords
cbfβ
protein
smooth muscle
vascular smooth
geriatric
Prior art date
Application number
PCT/KR2023/014083
Other languages
English (en)
French (fr)
Inventor
최제용
차상국
김한
Original Assignee
경북대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020230122311A external-priority patent/KR20240040635A/ko
Application filed by 경북대학교 산학협력단 filed Critical 경북대학교 산학협력단
Publication of WO2024063484A1 publication Critical patent/WO2024063484A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material

Definitions

  • the present invention relates to a pharmaceutical composition for preventing or treating geriatric diseases containing Cbf ⁇ (Core-binding factor subunit beta)-expressing vascular smooth muscle cells or their culture fluid as an active ingredient.
  • Cbf ⁇ Core-binding factor subunit beta
  • Osteoporosis is a representative geriatric disease resulting from dysfunction of skeletal cells, aging blood vessels, and various inflammatory changes due to aging.
  • Vascular calcification is one of the cardiovascular diseases and can be caused by diabetes, kidney disease, osteoporosis, etc.
  • Biomolecules or proteins secreted from vascular cells can affect the activity of skeletal cells, and in particular, among vascular cell-derived proteins, they promote the activity of osteoclasts, destroying bone tissue and causing osteoporosis. Accordingly, the development of new drugs that can simultaneously treat cardiovascular diseases and bone diseases is actively underway.
  • the purpose of the present invention is to provide a pharmaceutical composition for preventing or treating geriatric diseases containing Cbf ⁇ (Core-binding factor subunit beta)-expressing vascular smooth muscle cells or their culture fluid as an active ingredient.
  • Cbf ⁇ Core-binding factor subunit beta
  • Another object of the present invention is to provide a health functional food composition for preventing or improving geriatric diseases containing the cells or their culture medium as an active ingredient.
  • Another object of the present invention is to provide a pharmaceutical composition for preventing or treating geriatric diseases, which contains as an active ingredient a Cbf ⁇ (Core-binding factor subunit beta) protein or an agent that induces the expression or activity of the gene encoding it.
  • a Cbf ⁇ Core-binding factor subunit beta
  • Another object of the present invention is to provide a biomarker composition for diagnosing geriatric diseases containing Cbf ⁇ (Core-binding factor subunit beta) protein or the gene encoding it as an active ingredient.
  • Cbf ⁇ Core-binding factor subunit beta
  • Another object of the present invention is to provide a composition for diagnosing geriatric diseases containing as an active ingredient an agent capable of confirming the expression level of the protein or the gene encoding it.
  • Another object of the present invention is to provide a kit for diagnosing geriatric diseases containing the composition for diagnosing geriatric diseases as an active ingredient.
  • Another object of the present invention is to separate a biological sample from an individual (step 1); And a method of providing information for diagnosing geriatric diseases, including a step (second step) of measuring the expression level of Cbf ⁇ (Core-binding factor subunit beta) protein or the gene encoding it in the biological sample isolated in the first step. It is provided.
  • Another object of the present invention is to treat a geriatric disease cell line with a test substance (first step); Measuring the expression of Cbf ⁇ (Core-binding factor subunit beta) protein or the gene encoding it in the cell line of the first step (second step): and the expression of Cbf ⁇ compared to the geriatric disease cell line that was not treated with the test substance.
  • first step Measuring the expression of Cbf ⁇ (Core-binding factor subunit beta) protein or the gene encoding it in the cell line of the first step
  • second step the expression of Cbf ⁇ compared to the geriatric disease cell line that was not treated with the test substance.
  • the present invention provides a pharmaceutical composition for preventing or treating geriatric diseases containing Cbf ⁇ (Core-binding factor subunit beta)-expressing vascular smooth muscle cells or their culture medium as an active ingredient.
  • Cbf ⁇ Core-binding factor subunit beta
  • the present invention provides a health functional food composition for preventing or improving geriatric diseases containing the cells or their culture medium as an active ingredient.
  • the present invention provides a pharmaceutical composition for preventing or treating geriatric diseases, which contains as an active ingredient a Cbf ⁇ (Core-binding factor subunit beta) protein or an agent that induces the expression or activity of the gene encoding it.
  • a Cbf ⁇ Core-binding factor subunit beta
  • the present invention provides a biomarker composition for diagnosing geriatric diseases containing Cbf ⁇ (Core-binding factor subunit beta) protein or the gene encoding it as an active ingredient.
  • Cbf ⁇ Core-binding factor subunit beta
  • the present invention provides a composition for diagnosing geriatric diseases, which includes as an active ingredient an agent capable of confirming the expression level of the protein or the gene encoding the protein.
  • the present invention provides a kit for diagnosing geriatric diseases containing the composition for diagnosing geriatric diseases as an active ingredient.
  • the present invention includes the steps of isolating a biological sample from an individual (first step); And a method of providing information for diagnosing geriatric diseases, including a step (second step) of measuring the expression level of Cbf ⁇ (Core-binding factor subunit beta) protein or the gene encoding it in the biological sample isolated in the first step. to provide.
  • the present invention includes the steps of treating a geriatric disease cell line with a test substance (first step); Measuring the expression of the Cbf ⁇ (Core-binding factor subunit beta) protein or the gene encoding it in the cell line of the first step (second step): and the expression of the Cbf ⁇ compared to the geriatric disease cell line that was not treated with the test substance.
  • first step Measuring the expression of the Cbf ⁇ (Core-binding factor subunit beta) protein or the gene encoding it in the cell line of the first step
  • second step the expression of the Cbf ⁇ compared to the geriatric disease cell line that was not treated with the test substance.
  • a screening method for a treatment for geriatric diseases including the step of selecting test substances that induce (third step).
  • Cbf ⁇ Core-binding factor subunit beta
  • vascular smooth muscle cells when suppressing the expression of Cbf ⁇ (Core-binding factor subunit beta) in vascular smooth muscle cells, vascular calcification and osteoclast differentiation are promoted, and by confirming that Cbf ⁇ -expressing vascular smooth muscle cell culture media suppresses osteoclast differentiation.
  • It can be usefully used as a composition for preventing, treating, improving or diagnosing geriatric diseases.
  • Figure 1 shows the results of analyzing the effect of Cbf ⁇ on vascular homeostasis.
  • Figure 2 shows the results of analyzing the effect of Cbf ⁇ on blood pressure. *p ⁇ 0.05
  • Figure 3 shows the results of analyzing the effect of Cbf ⁇ on vascular calcification.
  • Figure 4 shows the results of analyzing the effect of Cbf ⁇ on bone metabolism.
  • Figure 5 shows the results of analyzing the effect of vascular smooth muscle cell-derived proteins on osteoclast activity.
  • Figure 6 shows the results of analyzing the effect of Cbf ⁇ -deleted vascular smooth muscle cell culture medium on osteoclast activity and differentiation.
  • Figure 7 shows the results of analyzing the effect of Cbf ⁇ -overexpressing vascular smooth muscle cell culture medium on osteoclast differentiation.
  • Figure 8 shows the results of analyzing the effect of Cbf ⁇ on the expression of genes related to osteoclast differentiation.
  • the present invention provides a pharmaceutical composition for preventing or treating geriatric diseases containing Cbf ⁇ (Core-binding factor subunit beta)-expressing vascular smooth muscle cells or their culture fluid as an active ingredient.
  • Cbf ⁇ Core-binding factor subunit beta
  • the Cbf ⁇ -expressing vascular smooth muscle cells or their culture medium increase blood pressure; Alternatively, it may inhibit osteoclast differentiation.
  • the geriatric disease may be a vascular aging disease or a bone disease.
  • the vascular aging disease may be one or more selected from the group consisting of vascular calcification, osteoporosis, osteoarthritis, arteriosclerosis, fatty liver, liver fibrosis, diabetes, and dementia, but is not limited thereto.
  • the bone disease may be one or more selected from the group consisting of fractures, osteoarthritis, rheumatoid arthritis, osteoporosis, and osteomalacia, but is not limited thereto.
  • the pharmaceutical composition of the present invention is prepared in unit dose form or in a multi-dose container by formulating it using a pharmaceutically acceptable carrier according to a method that can be easily performed by a person skilled in the art. It can be manufactured by internalizing it.
  • the pharmaceutically acceptable carriers are commonly used in formulations and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, Includes, but is not limited to, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methyl hydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, etc.
  • the pharmaceutical composition of the present invention may further include lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc.
  • the content of additives included in the pharmaceutical composition is not particularly limited and can be appropriately adjusted within the content range used in conventional formulations.
  • the pharmaceutical compositions include injectable formulations such as aqueous solutions, suspensions, and emulsions, pills, capsules, granules, tablets, creams, gels, patches, sprays, ointments, warning agents, lotions, liniment agents, paste agents, and cataplasmase agents. It may be formulated in the form of one or more external skin preparations selected from the group consisting of, but is not limited to this.
  • the pharmaceutical composition of the present invention may additionally contain pharmaceutically acceptable carriers and diluents for formulation.
  • the pharmaceutically acceptable carriers and diluents include excipients such as starch, sugar and mannitol, fillers and extenders such as calcium phosphate, cellulose derivatives such as carboxymethylcellulose, hydroxypropylcellulose, gelatin, alginate, polyvinyl pyrrolidone. It includes, but is not limited to, binders such as talc, calcium stearate, lubricants such as hydrogenated castor oil and polyethylene glycol, disintegrants such as povidone and crospovidone, and surfactants such as polysorbate, cetyl alcohol, glycerol, etc.
  • the pharmaceutically acceptable carrier and diluent may be biologically and physiologically friendly to the subject. Examples of diluents include, but are not limited to, saline, aqueous buffers, solvents, and/or dispersion media.
  • the pharmaceutical composition of the present invention can be administered orally or parenterally (for example, intravenously, subcutaneously, intraperitoneally, or topically) depending on the desired method.
  • parenterally for example, intravenously, subcutaneously, intraperitoneally, or topically
  • it can be formulated as tablets, troches, lozenges, aqueous suspensions, oily suspensions, powders, granules, emulsions, hard capsules, soft capsules, syrups, elixirs, etc.
  • parenteral administration it can be formulated as an injection, suppository, powder for respiratory inhalation, aerosol for spray, ointment, powder for application, oil, cream, etc.
  • the dosage of the pharmaceutical composition of the present invention is determined by the patient's condition, weight, age, gender, health, dietary constitution specificity, nature of the preparation, degree of disease, administration time of the composition, administration method, administration period or interval, excretion rate, and
  • the range may vary depending on the drug form and can be appropriately selected by a person skilled in the art. For example, it may range from about 0.1 to 10,000 mg/kg, but is not limited and may be administered once or in divided doses several times a day.
  • the pharmaceutical composition may be administered orally or parenterally (eg, intravenously, subcutaneously, intraperitoneally, or topically applied) depending on the desired method.
  • the pharmaceutically effective amount and effective dosage of the pharmaceutical composition of the present invention may vary depending on the formulation method, administration method, administration time, administration route, etc. of the pharmaceutical composition, and those skilled in the art will know that it is effective for the desired treatment. Dosage can be easily determined and prescribed.
  • the pharmaceutical composition of the present invention may be administered once a day, or may be administered in several divided doses.
  • the present invention provides a health functional food composition for preventing or improving geriatric diseases containing Cbf ⁇ (Core-binding factor subunit beta)-expressing vascular smooth muscle cells or their culture fluid as an active ingredient.
  • Cbf ⁇ Core-binding factor subunit beta
  • the present invention can be generally used with commonly used foods.
  • the food composition of the present invention can be used as a health functional food.
  • health functional food refers to food manufactured and processed using raw materials or ingredients with functionality useful to the human body in accordance with the Health Functional Food Act, and “functionality” refers to food that is related to the structure and function of the human body. It means ingestion for the purpose of controlling nutrients or obtaining useful health effects such as physiological effects.
  • the health functional food composition may contain common food additives, and its suitability as a “food additive” is determined in accordance with the general provisions and general test methods of the food additive code approved by the Ministry of Food and Drug Safety, unless otherwise specified. The decision is made based on the specifications and standards for the item.
  • Items listed in the “Food Additives Code” include, for example, chemical compounds such as ketones, glycine, potassium citrate, nicotinic acid, and cinnamic acid; natural additives such as subchromic pigment, licorice extract, crystalline cellulose, high-liquid pigment, and guar gum; Examples include mixed preparations such as sodium L-glutamate preparations, noodle additive alkaline preparations, preservative preparations, and tar coloring preparations.
  • the food composition of the present invention can be manufactured and processed in the form of tablets, capsules, powders, granules, liquids, pills, etc.
  • hard capsules can be manufactured by mixing and filling the composition according to the present invention with additives such as excipients in a regular hard capsule
  • soft capsules can be manufactured by mixing and filling the composition according to the present invention. It can be manufactured by mixing with additives such as excipients and filling it with a capsule base such as gelatin.
  • the soft capsule may contain plasticizers such as glycerin or sorbitol, colorants, preservatives, etc., if necessary.
  • prevention refers to all actions that suppress or delay geriatric diseases by administering the composition according to the present invention.
  • treatment refers to any action that improves or beneficially changes the symptoms of a geriatric disease by administering the composition according to the present invention.
  • the term “improvement” refers to any action that improves the bad condition of a senile disease by administering the composition according to the present invention.
  • the present invention provides a pharmaceutical composition for preventing or treating geriatric diseases, which contains as an active ingredient a Cbf ⁇ (Core-binding factor subunit beta) protein or an agent that induces the expression or activity of the gene encoding it.
  • a Cbf ⁇ Core-binding factor subunit beta
  • the present invention provides a biomarker composition for diagnosing geriatric diseases containing Cbf ⁇ (Core-binding factor subunit beta) protein or the gene encoding it as an active ingredient.
  • Cbf ⁇ Core-binding factor subunit beta
  • the geriatric disease may be a vascular aging disease or a bone disease.
  • the expression of the protein or the gene encoding it may be reduced in vascular smooth muscle cells of patients with geriatric diseases.
  • diagnosis means confirming the presence or characteristics of a pathological condition, and for the purposes of the present invention, means identifying a geriatric disease, and determining the subject's susceptibility to a geriatric disease or at least one symptom thereof. judgment, therametrics (e.g., monitoring the condition of an object to provide information about treatment efficacy), etc. It also includes primary diagnosis of a clinical condition or diagnosis of recurrent disease.
  • biomarker is an indicator that can detect changes in the body, and is a substance that can confirm the normal or pathological state of a living organism and whether there is a change in this, including polypeptides, nucleic acids, lipids, glycolipids, It may include organic biomolecules such as glycoproteins and sugars (monosaccharides, disaccharides, oligosaccharides, etc.), and can be used to diagnose geriatric diseases as in the present invention.
  • the present invention provides a composition for diagnosing geriatric diseases containing as an active ingredient an agent capable of checking the expression level of Cbf ⁇ (Core-binding factor subunit beta) protein or the gene encoding it.
  • Agents that can confirm the expression level include antibodies, peptides, aptamers, or compounds that specifically bind to the protein; Alternatively, it may be a primer or probe that specifically binds to the gene encoding the protein, but is not limited thereto.
  • a "primer” is a nucleic acid sequence with a short free 3' hydroxyl group, capable of forming base pairs with a complementary template, and serving as a starting point for copying the template strand. refers to a short nucleic acid sequence that Primers can initiate DNA synthesis in the presence of four different nucleotide triphosphates and reagents for polymerization (i.e., DNA polymerase or reverse transcriptase) in an appropriate buffer solution and temperature. PCR conditions and lengths of sense and antisense primers can be appropriately selected according to techniques known in the art.
  • probe refers to a fragment of several to hundreds of base sequences that can specifically bind to a gene or miRNA, and is labeled so that the presence or absence and expression level of the gene can be confirmed. there is. Appropriate probes and hybridization conditions can be appropriately selected according to techniques known in the art.
  • the present invention provides a kit for diagnosing geriatric diseases containing the composition for diagnosing geriatric diseases as an active ingredient.
  • the kit can be used to diagnose the occurrence of a geriatric disease by measuring the expression level of the protein or the gene encoding it in a sample isolated from an individual suspected of having a geriatric disease.
  • the kit may include not only an agent for measuring the expression level of the protein or the gene encoding it, but also one or more other component compositions, solutions, or devices suitable for the analysis method.
  • the kit according to the present invention includes genomic DNA derived from a sample to be analyzed to perform PCR, a primer set specific for the marker gene of the present invention, an appropriate amount of DNA polymerase, a dNTP mixture, a PCR buffer solution, and It may be a kit containing water.
  • the PCR buffer solution may include KCl, Tris-HCl, and MgCl 2 .
  • components necessary for performing electrophoresis that can confirm the amplification of the PCR product may be additionally included in the kit of the present invention.
  • the kit according to the present invention may be a kit containing essential elements required to perform RT-PCR.
  • the RT-PCR kit contains test tubes or other suitable containers, reaction buffer, deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNase inhibitors, and DEPC.
  • dNTPs deoxynucleotides
  • -Can include DEPC-water, sterilized water, etc. Additionally, it may include a pair of primers specific to the gene used as a quantitative control.
  • the present invention includes the steps of isolating a biological sample from an individual (first step); And a method of providing information for diagnosing geriatric diseases, including a step (second step) of measuring the expression level of Cbf ⁇ (Core-binding factor subunit beta) protein or the gene encoding it in the biological sample isolated in the first step. to provide.
  • the biological sample may be vascular smooth muscle cells.
  • Methods for measuring the protein expression level include Western blot, ELISA (enzyme linked immunosorbent assay), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, and rocket.
  • ELISA enzyme linked immunosorbent assay
  • RIA radioimmunoassay
  • Ouchterlony immunodiffusion and rocket.
  • It may be one or more selected from the group consisting of immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay, complement fixation assay, FACS, and protein chip, but is not limited thereto.
  • Methods for measuring the gene expression level include microarray, next generation sequencing (NGS), polymerase chain reaction (PCR), reverse transcription PCR (RT-PCR), and competitive RT-PCR (Competitive PCR). It may be one or more selected from the group consisting of RT-PCR), real-time RT-PCR, RNase protection assay (RPA), Northern blotting, and DNA chip. It is not limited.
  • the present invention includes the steps of treating a geriatric disease cell line with a test substance (first step); Measuring the expression of Cbf ⁇ (Core-binding factor subunit beta) protein or the gene encoding it in the cell line of the first step (second step): and the expression of Cbf ⁇ compared to the geriatric disease cell line that was not treated with the test substance.
  • first step Measuring the expression of Cbf ⁇ (Core-binding factor subunit beta) protein or the gene encoding it in the cell line of the first step
  • second step the expression of Cbf ⁇ compared to the geriatric disease cell line that was not treated with the test substance.
  • a screening method for a treatment for geriatric diseases including the step of selecting test substances that induce (third step).
  • test substance refers to an unknown candidate substance used in screening to test whether it affects the expression level of a gene or affects the expression or activity of a protein.
  • the test substances include, but are not limited to, chemicals, nucleic acids, antisense-RNA, siRNA (small interference RNA), and natural product extracts.
  • Cbf ⁇ f /f 16-week-old male mice were purchased and used from RIKEN, Japan
  • Sm22a Cre 16-week-old male mice (Sm22a Cre overexpressing mice) were purchased and used from Professor Jo Je-yeol's laboratory at Seoul National University
  • ROR26 mice were purchased from Professor Kim Jeong-eun's laboratory at Kyungpook National University. It was purchased and used.
  • Cbf ⁇ deletion mice were created using the principle that the Cbf ⁇ gene is specifically removed from the vascular smooth muscle cells of the crossbred mice (Sm22a Cre;Cbf ⁇ f /f ).
  • mice used in the experiment are as follows.
  • the experiments were conducted after acclimatization for one week in an SPF (Specific Pathogen Free) laboratory animal breeding room (temperature 25°C and relative humidity 60%).
  • the feed was regular food (Super bead Co, Korea), and all animal experiments were conducted in accordance with the regulations of the Animal Experiment Ethics Committee of Kyungpook National University (animal experiment approval number: KNU 2021-0099).
  • Mouse bone marrow monocytes were isolated from the femur and tibia of 8-week-old mice. In a mouse with a dislocated cervical spine, the femur and tibia were separated, the muscles were removed, both ends were cut, and bone marrow cells were separated by passing ⁇ -MEM using a syringe.
  • the separated bone marrow cells were centrifuged, red blood cell lysate was added to hemolyze the red blood cells, and the medium [ ⁇ -MEM, 10% (v/v) FBS, penicillin (100 units/ml), and streptomycin (100 units/ml)] was added and cultured for 1 day in a constant temperature and humidity incubator at 37°C and 5% (v/v) CO 2 conditions. Only cells that did not stick to the culture dish and were floating were collected, treated with M-CSF (20ng/ml), and cultured for 3 days to obtain bone marrow-derived monocyte/macrophage cells. To differentiate macrophages into osteoclasts, M-CSF (30ng/ml) and RANKL (30ng/ml) were added and cultured for 4 days. While inducing differentiation, the medium was changed every 2 days.
  • Real-time PCR was performed by mixing 0.5 ⁇ l of synthesized cDNA with 2 ⁇ SYBR green PCR master mixture (5 ⁇ l) and specific primer (0.2 ⁇ l). The primers used for real-time PCR are listed in Table 2 below, and the primers were designed using Primer Express software (ABI).
  • M-CSF (20ng/ml) was treated with intramedullary monocytes isolated from the femur and tibia of mice, reacted for 1 day, collected cells attached to the culture vessel, and dispensed at 3 ⁇ 10 cells/well in a 48-well multi-plate. Then, it was replaced with osteoclast differentiation induction medium and cultured for 4 days. After removing the medium and washing with PBS (phosphate-buffered saline), cells fixed with 10% formaldehyde solution were treated with Trap staining solution [Naphthol As-Mx, Fast red violet LB and N,N-dimethylformamide in 50mM acetate. dissolved in buffer (pH 5.0)] and stained at 37°C for 30 minutes. The solution was removed, washed twice using PBS, and then observed under a microscope.
  • PBS phosphate-buffered saline
  • H&E staining was performed. After rehydrating the vascular paraffin sections, the cell nuclei were stained with hematoxylin and the cytoplasm was stained with eosin, and then observed under a microscope.
  • VVG staining was performed. After rehydrating the vascular paraffin sections, they were reacted in Verhoeff's solution for 1 hour, washed three times in running water, and reacted with 2% iron chloride for 2 minutes. After washing in running water, it was reacted with 5% sodium thiosulfate for 5 minutes, washed again, stained with Van Gieson's solution, and observed under a microscope. All procedures were carried out according to the method disclosed at the site below (https://www.ihcworld.com/_protocols/special_stains/vvg.htm).
  • Tri-EGTA Tris 1.211g + EGTA 0.19g/ddH 2 O 1L; TEG
  • TEG Tris 1.211g + EGTA 0.19g/ddH 2 O 1L
  • the retrieval sample was blocked with 3% H 2 O 2 /methanol and 1% BSA/PBS solution, and permibilized with 0.1% Triton X-100.
  • the primary antibody was reacted at 4°C overnight, and the secondary antibody was reacted at room temperature for 1 hour. Finally, color was developed using DAB substrate, dehydrated, mounted, and observed under a microscope.
  • vascular paraffin sections After rehydrating the vascular paraffin sections, they were blocked for 1 hour using 1% BSA (Bovine Serum Albumin) and reacted with CD31 antibody for 1 hour at room temperature. Afterwards, it was reacted with HRP (Horse Radish Peroxidase)-attached secondary antibody for 1 hour, developed with DAB (3,3'-diaminobenzidine) (Dako, Carpinteria, CA, USA), and mounted. , observed under a microscope.
  • BSA Bovine Serum Albumin
  • vascular paraffin sections After rehydrating the vascular paraffin sections, they were blocked using 1% BSA for 1 hour and reacted with PCNA antibody for 1 hour at room temperature. After reacting with a fluorescent secondary antibody for 1 hour, cell nuclei were stained with DAPI (4',6-diamidino-2-phenylindole), mounted, and observed under a microscope.
  • DAPI 4,',6-diamidino-2-phenylindole
  • the entire tissue was fixed in 4% paraformaldehyde (PFA)/0.1M calcium phosphate solution [pH 7.4, 2mM MgCl 2 , 5mM ethylene glycol tetra-acetic acid (EGTA)] for 30 minutes. Afterwards, it was washed three times and stained in X-gal staining solution overnight at 37°C. Stained samples were made into paraffin blocks, cut into sections, and counterstained with Nuclear Fast Red (Sigma Aldrich, St. Louis, MO, USA).
  • PFA paraformaldehyde
  • EGTA ethylene glycol tetra-acetic acid
  • BV/TV cancellous bone volume
  • Tb.Th cancellous bone thickness
  • Tb.N cancellous bone number
  • Tb.Sp cancellous bone dead area
  • BMD cancellous bone bone density
  • the mouse femur was separated, the muscles were removed, placed in 0.9% sodium chloride (pH 7.4), and stored at -20°C. Before analyzing the sample, it was slowly melted at 4°C, and max load (N) and slope (N/mm) were measured using Instron (Tensile Tester, Williamston, SC, USA).
  • mouse blood pressure was measured. Before measuring mouse blood pressure, it was stabilized for 5 minutes and measured using an automatic blood pressure monitor (Tango+, Suntech, NC, USA).
  • MTS assay was performed. MC3T3-E1 cells were planted in a 48-well multi-plate at 3 ⁇ 10 4 cells/well, and after 24 hours, culture medium obtained from vascular smooth muscle cells was treated. After culturing for 24 hours, 20 ⁇ l of MTS solution was added to each well. It was added to 100 ⁇ l culture medium and incubated for 4 hours. After 4 hours, absorbance was measured at a wavelength of 490 nm using an ELISA reader.
  • vascular calcification was induced by subcutaneously injecting high-dose vitamin D (6 ⁇ 10 5 IU/Kg) into mice, and Alizarin Red staining (Experimental Example 13) Vascular calcification was observed in the kidney and arterial blood vessels.
  • high-dose vitamin D (6 ⁇ 10 5 IU/Kg)
  • Alizarin Red staining (Experimental Example 13)
  • Vascular calcification was observed in the kidney and arterial blood vessels.
  • the experimental group was set as follows.
  • bone density bone density of cancellous bone in Cbf ⁇ deletion mice (Cbf ⁇ ⁇ vc /+ and Cbf ⁇ ⁇ vc / ⁇ vc ) compared to normal mice (Cbf ⁇ fl /fl ) Tb. BMD), cancellous bone mass (Tb. BV/TV), cancellous bone thickness (Tb.Th), and trabecular bone number (Tb.N) were significantly decreased, and cancellous bone dead area (Tb.Sp) was significantly increased.
  • osteoclast differentiation markers c-fos, c-fms, RANK, TRAP, OSCAR, NFACT1, Cathepsin K, and DC-STAMP
  • c-fos, c-fms, RANK, TRAP, OSCAR, NFACT1, Cathepsin K, and DC-STAMP was decreased in the vascular smooth muscle cell culture medium-treated group compared to the control group. This was confirmed through real-time PCR (Experimental Example 2). From the above results, it was confirmed that the vascular smooth muscle cell-derived protein participates in bone metabolism by promoting osteoclast proliferation and inhibiting osteoclast differentiation.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 Cbfβ(Core-binding factor subunit beta) 발현 혈관평활근세포 또는 이의 배양액을 유효성분으로 포함하는 노인성 질환 예방 또는 치료용 약학 조성물에 관한 것으로, 혈관평활근세포에서 Cbfβ 발현을 억제하는 경우, 혈관 석회화 및 파골세포 분화가 촉진되고, Cbfβ 발현 혈관평활근세포 배양액이 파골세포 분화를 억제하는 것을 확인함으로써, 노인성 질환 예방, 치료, 개선 또는 진단용 조성물로써, 유용하게 활용될 수 있다.

Description

CBFβ 발현 혈관평활근세포 또는 이의 배양액을 유효성분으로 포함하는 노인성 질환 예방 또는 치료용 약학 조성물
본 발명은 Cbfβ(Core-binding factor subunit beta) 발현 혈관평활근세포 또는 이의 배양액을 유효성분으로 포함하는 노인성 질환 예방 또는 치료용 약학 조성물에 관한 것이다.
고령인구의 증가로 심혈관 질환과 골질환이 함께 생기는 경우가 급격히 증가하고 있다. 골다공증(Osteoporosis)은 노화에 따른 골격계 세포들의 기능 부전과 혈관 노화, 다양한 염증성 변화에 따른 결과로 대표적인 노인성 질환이다. 혈관석회화는 심혈관 질환의 하나로 당뇨, 신장 질환, 골다공증 등에 의해 발생할 수 있다. 골량이 감소하면 혈관석회화가 발생할 가능성이 높아지는데, 만성 혈관성 질환들과 골다공증은 비례 관계에 있다. 혈관세포에서 분비되는 생체분자나 단백질들이 골격계 세포의 활성에 영향을 미칠 수 있고, 특히 혈관세포 유래 단백질 중 파골세포의 활성을 촉진하여 뼈 조직을 파괴하여 골다공증 유발시킨다. 이에 따라, 심혈관질환과 골질환을 동시에 치료할 수 있는 신약 개발이 활발히 진행 중인 상황이다.
본 발명의 목적은 Cbfβ(Core-binding factor subunit beta) 발현 혈관평활근세포 또는 이의 배양액을 유효성분으로 포함하는 노인성 질환 예방 또는 치료용 약학 조성물을 제공하는 것이다.
본 발명의 다른 목적은 상기 세포 또는 이의 배양액을 유효성분으로 포함하는 노인성 질환 예방 또는 개선용 건강기능식품 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 Cbfβ(Core-binding factor subunit beta) 단백질 또는 이를 코딩하는 유전자의 발현 또는 활성 유도제를 유효성분으로 포함하는 노인성 질환 예방 또는 치료용 약학 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 Cbfβ(Core-binding factor subunit beta) 단백질 또는 이를 코딩하는 유전자를 유효성분으로 포함하는 노인성 질환 진단용 바이오마커 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 단백질 또는 이를 코딩하는 유전자의 발현 수준을 확인할 수 있는 제제를 유효성분으로 포함하는 노인성 질환 진단용 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 노인성 질환 진단용 조성물을 유효성분으로 포함하는 노인성 질환 진단용 키트를 제공하는 것이다.
본 발명의 또 다른 목적은 개체로부터 생물학적 시료를 분리하는 단계(제1단계); 및 상기 제1단계에서 분리한 생물학적 시료에서 Cbfβ(Core-binding factor subunit beta) 단백질 또는 이를 코딩하는 유전자의 발현 수준을 측정하는 단계(제2단계)를 포함하는 노인성 질환 진단을 위한 정보 제공 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 노인성 질환 세포주에 시험물질을 처리하는 단계(제1단계); 상기 제1단계의 세포주에서 Cbfβ(Core-binding factor subunit beta) 단백질 또는 이를 코딩하는 유전자의 발현을 측정하는 단계(제2단계): 및 시험물질을 처리하지 않은 노인성 질환 세포주와 비교해서 상기 Cbfβ 발현을 유도하는 시험물질을 선별하는 단계(제3단계)를 포함하는, 노인성 질환 치료제 스크리닝 방법을 제공하는 것이다.
상기 목적을 달성하기 위해, 본 발명은 Cbfβ(Core-binding factor subunit beta) 발현 혈관평활근세포 또는 이의 배양액을 유효성분으로 포함하는 노인성 질환 예방 또는 치료용 약학 조성물을 제공한다.
또한, 본 발명은 상기 세포 또는 이의 배양액을 유효성분으로 포함하는 노인성 질환 예방 또는 개선용 건강기능식품 조성물을 제공한다.
또한, 본 발명은 Cbfβ(Core-binding factor subunit beta) 단백질 또는 이를 코딩하는 유전자의 발현 또는 활성 유도제를 유효성분으로 포함하는 노인성 질환 예방 또는 치료용 약학 조성물을 제공한다.
또한, 본 발명은 Cbfβ(Core-binding factor subunit beta) 단백질 또는 이를 코딩하는 유전자를 유효성분으로 포함하는 노인성 질환 진단용 바이오마커 조성물을 제공한다.
또한, 본 발명은 상기 단백질 또는 이를 코딩하는 유전자의 발현 수준을 확인할 수 있는 제제를 유효성분으로 포함하는 노인성 질환 진단용 조성물을 제공한다.
또한, 본 발명은 상기 노인성 질환 진단용 조성물을 유효성분으로 포함하는 노인성 질환 진단용 키트를 제공한다.
또한, 본 발명은 개체로부터 생물학적 시료를 분리하는 단계(제1단계); 및 상기 제1단계에서 분리한 생물학적 시료에서 Cbfβ(Core-binding factor subunit beta) 단백질 또는 이를 코딩하는 유전자의 발현 수준을 측정하는 단계(제2단계)를 포함하는 노인성 질환 진단을 위한 정보 제공 방법을 제공한다.
또한, 본 발명은 노인성 질환 세포주에 시험물질을 처리하는 단계(제1단계); 상기 제1단계의 세포주에서 Cbfβ(Core-binding factor subunit beta) 단백질 또는 이를 코딩하는 유전자의 발현을 측정하는 단계(제2단계): 및 시험물질을 처리하지 않은 노인성 질환 세포주와 비교해서 상기 Cbfβ 발현을 유도하는 시험물질을 선별하는 단계(제3단계)를 포함하는, 노인성 질환 치료제 스크리닝 방법을 제공한다.
본 발명에 따르면, 혈관평활근세포에서 Cbfβ(Core-binding factor subunit beta) 발현을 억제하는 경우, 혈관 석회화 및 파골세포 분화가 촉진되고, Cbfβ 발현 혈관평활근세포 배양액이 파골세포 분화를 억제하는 것을 확인함으로써, 노인성 질환 예방, 치료, 개선 또는 진단용 조성물로써, 유용하게 활용될 수 있다.
도 1은 Cbfβ가 혈관 항상성에 미치는 영향을 분석한 결과이다.
도 2는 Cbfβ가 혈압에 미치는 영향을 분석한 결과이다. *p<0.05
도 3은 Cbfβ가 혈관 석회화에 미치는 영향을 분석한 결과이다.
도 4는 Cbfβ가 골대사에 미치는 영향을 분석한 결과이다.
도 5는 혈관평활근세포 유래 단백질이 파골세포 활성에 미치는 영향을 분석한 결과이다.
도 6은 Cbfβ 결실 혈관평활근세포 배양액이 파골세포 활성 및 분화에 미치는 영향을 분석한 결과이다.
도 7은 Cbfβ가 과발현 혈관평활근세포 배양액이 파골세포 분화에 미치는 영향을 분석한 결과이다.
도 8은 Cbfβ가 파골세포 분화 관련 유전자 발현에 미치는 영향을 분석한 결과이다.
이하, 본 발명을 보다 상세하게 설명한다.
본 발명은 Cbfβ(Core-binding factor subunit beta) 발현 혈관평활근세포 또는 이의 배양액을 유효성분으로 포함하는 노인성 질환 예방 또는 치료용 약학 조성물을 제공한다.
상기 Cbfβ 발현 혈관평활근세포 또는 이의 배양액은 혈압 상승; 또는 파골세포 분화를 억제할 수 있다.
상기 노인성 질환은 혈관 노화 질환 또는 골질환일 수 있다.
상기 혈관 노화 질환은 혈관 석회화, 골다공증, 골관절염, 동맥경화, 지방간, 간섬유화, 당뇨 및 치매로 이루어진 군에서 선택된 하나 이상일 수 있으나, 이에 한정되는 것은 아니다.
상기 골질환은 골절, 골관절염, 류마티스 관절염, 골다공증 및 골연화증으로 이루어진 군에서 선택된 하나 이상일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 약학 조성물은 당해 발명이 속하는 기술 분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다.
상기 약제학적으로 허용되는 담체는 제제시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산칼슘, 알기네이트, 젤라틴, 규산칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸 히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘, 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 본 발명의 약학 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다.
본 발명에 있어서, 상기 약학 조성물에 포함되는 첨가제의 함량은 특별히 한정되는 것은 아니며 통상의 제제화에 사용되는 함량 범위 내에서 적절하게 조절될 수 있다.
상기 약학 조성물은 수용액, 현탁액, 유탁액 등과 같은 주사용 제형, 환약, 캡슐, 과립, 정제, 크림, 젤, 패취, 분무제, 연고제, 경고제, 로션제, 리니멘트제, 파스타제 및 카타플라스마제로 이루어진 군에서 선택된 하나 이상의 피부 외용제 형태로 제형화될 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 약학 조성물은 제형화를 위해 추가로 있는 약학적으로 허용 가능한 담체 및 희석제를 포함할 수 있다. 상기 약학적으로 허용 가능한 담체 및 희석제는 전분, 당 및 만니톨과 같은 부형제, 칼슘 포스페이트 등과 같은 충전제 및 증량제, 카르복시메틸셀룰로오스, 히드록시프로필셀룰로오스 등과 같은 셀룰로오스 유도체, 젤라틴, 알긴산염, 폴리비닐 피롤리돈 등과 같은 결합제, 활석, 스테아린산 칼슘, 수소화 피마자유 및 폴리에틸렌글리콜과 같은 윤활제, 포비돈 및 크로스포비돈과 같은 붕해제, 폴리소르베이트, 세틸알코올, 글리세롤 등과 같은 계면활성제를 포함하나, 이에 한정되지 않는다. 상기 약학적으로 허용 가능한 담체 및 희석제는 대상체에게 생물학적 및 생리학적으로 친화적인 것일 수 있다. 희석제의 예로는 염수, 수용성 완충액, 용매 및/또는 분산제(dispersion media)를 들 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 약학 조성물은 목적하는 방법에 따라 경구 투여하거나 비경구 투여(예를 들어, 정맥 내, 피하, 복강 내 또는 국소에 적용)할 수 있다. 경구 투여일 경우, 정제, 트로키제(troches), 로젠지(lozenge), 수용성 현탁액, 유성 현탁액, 조제 분말, 과립, 에멀젼, 하드 캡슐, 소프트 캡슐, 시럽, 엘릭시르제 등으로 제형화될 수 있다. 비경구 투여일 경우, 주사액, 좌제, 호흡기 흡입용 분말, 스프레이용 에어로졸제, 연고, 도포용 파우더, 오일, 크림 등으로 제형화 될 수 있다.
본 발명의 약학 조성물의 투여량은 환자의 상태, 체중, 연령, 성별, 건강상태, 식이 체질 특이성, 제제의 성질, 질병의 정도, 조성물의 투여시간, 투여방법, 투여기간 또는 간격, 배설율 및 약물 형태에 따라 그 범위가 다양할 수 있으며, 이 분야 통상의 기술자에 의해 적절하게 선택될 수 있다. 예컨대, 약 0.1 내지 10,000mg/kg의 범위일 수 있으나 이제 제한되지 않으며, 하루 일회 내지 수회에 나누어 투여될 수 있다.
상기 약학 조성물은 목적하는 방법에 따라 경구 투여되거나 비경구 투여(예를 들면, 정맥 내, 피하 내, 복강 내 또는 국소에 적용)될 수 있다. 본 발명의 약학 조성물의 약학적 유효량 및 유효 투여량은 약학 조성물의 제제화 방법, 투여 방식, 투여 시간, 투여 경로 등에 의해 다양해질 수 있으며, 당해 기술 분야에서 통상의 지식을 가진 자는 목적하는 치료에 효과적인 투여량을 용이하게 결정하고 처방할 수 있다. 본 발명의 약학 조성물의 투여는 하루에 1회 투여될 수 있고, 수회에 나누어 투여될 수도 있다.
또한, 본 발명은 Cbfβ(Core-binding factor subunit beta) 발현 혈관평활근세포 또는 이의 배양액을 유효성분으로 포함하는 노인성 질환 예방 또는 개선용 건강기능식품 조성물을 제공한다.
본 발명은 통상적으로 이용되는 식품으로써 일반적으로 사용될 수 있다.
본 발명의 식품 조성물은 건강기능식품으로서 사용될 수 있다. 상기 “건강기능식품”이라 함은 건강기능 식품에 관한 법률에 따른 인체에 유용한 기능성을 가진 원료나 성분을 사용하여 제조 및 가공한 식품을 의미하며, “기능성”이라 함은 인체의 구조 및 기능에 대하여 영양소를 조절하거나 생리학적 작용 등과 같은 보건용도에 유용한 효과를 얻을 목적으로 섭취하는 것을 의미한다.
상기 건강기능식품 조성물은 통상의 식품 첨가물을 포함할 수 있으며, 상기 “식품 첨가물”로서의 적합 여부는 다른 규정이 없는 한, 식품의약품안전처에 승인된 식품 첨가물 공전의 총칙 및 일반시험법 등에 따라 해당 품목에 관한 규격 및 기준에 의하여 판정한다.
상기 “식품 첨가물 공전”에 수재된 품목으로는 예를 들어, 케톤류, 글리신, 구연산칼륨, 니코틴산, 계피산 등의 화학적 합성물, 감색소, 감초추출물, 결정셀룰로오스, 고량색소, 구아검 등의 천연첨가물, L-글루타민산나트륨 제제, 면류첨가알칼리제, 보존료제제, 타르색소제제 등의 혼합제제류들을 들 수 있다.
본 발명의 식품 조성물은 정제, 캡슐, 분말, 과립, 액상, 환 등의 형태로 제조 및 가공할 수 있다. 예를 들어, 캡슐 형태의 건강기능 식품 중 경질 캡슐제는 통상의 경질 캡슐에 본 발명에 따른 조성물을 부형제 등의 첨가제와 혼합 및 충진 하여 제조할 수 있으며, 연질 캡슐제는 본 발명에 따른 조성물을 부형제 등의 첨가제와 혼합하고 젤라틴 등 캡슐기제에 충진하여 제조할 수 있다. 상기 연질 캡슐제 는 필요에 따라 글리세린 또는 소르비톨 등의 가소제, 착색제, 보존제 등을 함유할 수 있다.
상기 부형제, 결합제, 붕해제, 활택제, 교미제, 착향제 등에 대한 용어 정의 는 당업계에 공지된 문헌에 기재된 것으로 그 기능 등이 동일 내지 유사한 것들을 포함한다. 상기 식품의 종류에는 특별한 제한이 없으며, 통상적인 의미에서의 건강 기능식품을 모두 포함한다.
본 발명에서 용어 “예방”은 본 발명에 따른 조성물의 투여로 노인성 질환을 억제 또는 지연시키는 모든 행위를 말한다.
본 발명에서 용어 “치료”는 본 발명에 따른 조성물의 투여로 노인성 질환의 증세가 호전되거나 이롭게 변경하는 모든 행위를 말한다.
본 발명에서 용어 “개선”은 본 발명에 따른 조성물의 투여로 노인성 질환의 나쁜 상태를 좋게 하는 모든 행위를 말한다.
또한, 본 발명은 Cbfβ(Core-binding factor subunit beta) 단백질 또는 이를 코딩하는 유전자의 발현 또는 활성 유도제를 유효성분으로 포함하는 노인성 질환 예방 또는 치료용 약학 조성물을 제공한다.
또한, 본 발명은 Cbfβ(Core-binding factor subunit beta) 단백질 또는 이를 코딩하는 유전자를 유효성분으로 포함하는 노인성 질환 진단용 바이오마커 조성물을 제공한다.
상기 노인성 질환은 혈관 노화 질환 또는 골질환일 수 있다.
상기 단백질 또는 이를 코딩하는 유전자는 노인성 질환 환자군의 혈관평활근세포에서 발현이 감소할 수 있다.
본 명세서에서, “진단(diagnosis)”은 병리 상태의 존재 또는 특징을 확인하는 것으로, 본 발명의 목적상 노인성 질환을 확인하는 것을 의미하며, 노인성 질환 또는 이의 적어도 하나 이상의 증상에 대한 대상의 감수성을 판정하는 것, 테라메트릭스(therametrics)(예를 들어, 치료 효능에 대한 정보를 제공하기 위하여 객체의 상태를 모니터링하는 것) 등을 포함한다. 또한, 임상 상태의 일차 진단 또는 재발한 질병의 진단을 포함한다.
본 명세서에서, “바이오마커(biomarker)”란 몸 안의 변화를 알아낼 수 있는 지표로서, 생명체의 정상 또는 병리적인 상태, 이의 변화 여부 등을 확인할 수 있는 물질로, 폴리펩타이드, 핵산, 지질, 당지질, 당단백질, 당(단당류, 이당류, 올리고당류 등) 등과 같은 유기 생체 분자 등을 포함할 수 있고, 이를 이용하여 본 발명과 같이 노인성 질환을 진단할 수 있다.
또한, 본 발명은 Cbfβ(Core-binding factor subunit beta) 단백질 또는 이를 코딩하는 유전자의 발현 수준을 확인할 수 있는 제제를 유효성분으로 포함하는 노인성 질환 진단용 조성물을 제공한다.
상기 발현 수준을 확인할 수 있는 제제는 상기 단백질에 특이적으로 결합하는 항체, 펩타이드, 앱타머 또는 화합물; 또는 상기 단백질을 코딩하는 유전자에 특이적으로 결합하는 프라이머 또는 프로브일 수 있으나, 이에 한정되는 것은 아니다.
본 명세서에서, "프라이머(primer)"는 짧은 자유 3말단 수산화기(free 3' hydroxl group)를 가지는 핵산 서열로, 상보적인 주형과 염기쌍을 형성할 수 있고, 주형 가닥 복사를 위한 시작 시점으로 기능을 하는 짧은 핵산 서열을 의미한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응(즉, DNA polymerase 또는 역전사효소)을 위한 시약 및 상이한 4가지 뉴클레오타이드 트리포스페이트(nucleotide triphosphate)의 존재 하에서 DNA 합성을 개시할 수 있다. PCR 조건, 센스 및 안티센스 프라이머의 길이는 당해 기술 분야에 공지된 기술에 따라 적절히 선택될 수 있다.
본 명세서에서, "프로브(probe)"는 유전자 또는 miRNA와 특이적으로 결합을 이룰 수 있는 수 개 내지 수백 개의 염기서열의 단편을 의미하며, 라벨링 되어있어서 상기 유전자의 존재 유무 및 발현량을 확인할 수 있다. 적절한 프로브 및 혼성화 조건은 당해 기술 분야에 공지된 기술에 따라 적절히 선택될 수 있다.
또한, 본 발명은 상기 노인성 질환 진단용 조성물을 유효성분으로 포함하는 노인성 질환 진단용 키트를 제공한다.
상기 키트는 노인성 질환이 의심되는 개체로부터 분리된 시료에서 상기 단백질 또는 이를 코딩하는 유전자의 발현수준을 측정하여 노인성 질환 발병 여부를 진단하는 데 사용될 수 있다.
또한, 상기 키트는 상기 단백질 또는 이를 코딩하는 유전자 발현수준을 측정하는 제제뿐만 아니라, 분석 방법에 적합한 한 종류 또는 그 이상의 다른 구성 성분 조성물, 용액 또는 장치를 포함할 수 있다.
예를 들어, 본 발명에 따른 키트는 PCR을 수행하기 위해 분석하고자 하는 시료로부터 유래된 게놈 DNA, 본 발명의 마커 유전자에 대해 특이적인 프라이머 세트, 적당량의 DNA 중합 효소, dNTP 혼합물, PCR 완충용액 및 물을 포함하는 키트일 수 있다. 상기 PCR 완충용액은 KCl, Tris-HCl 및 MgCl2를 포함할 수 있다. 이외에 PCR 산물의 증폭 여부를 확인할 수 있는 전기영동 수행에 필요한 구성 성분들이 본 발명의 키트에 추가로 포함될 수 있다.
또한, 본 발명에 따른 키트는 RT-PCR을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있다. RT-PCR 키트는 마커 유전자에 대한 특이적인 각각의 프라이머 쌍 외에도 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액, 데옥시뉴클레오티드(dNTPs), Taq-폴리머레이즈 및 역전사 효소와 같은 효소, DNase, RNase 억제제, DEPC-수(DEPC-water), 멸균수 등을 포함할 수 있다. 또한, 정량 대조군으로 사용되는 유전자에 특이적인 프라이머 쌍을 포함할 수 있다.
또한, 본 발명은 개체로부터 생물학적 시료를 분리하는 단계(제1단계); 및 상기 제1단계에서 분리한 생물학적 시료에서 Cbfβ(Core-binding factor subunit beta) 단백질 또는 이를 코딩하는 유전자의 발현 수준을 측정하는 단계(제2단계)를 포함하는 노인성 질환 진단을 위한 정보 제공 방법을 제공한다.
상기 생물학적 시료는 혈관평활근세포일 수 있다.
상기 단백질 발현 수준을 측정하는 방법은 웨스턴블랏, ELISA(enzyme linked immunosorbent asay), 방사선면역분석(Radioimmunoassay; RIA), 방사면역확산법(radioimmunodiffusion), 오우크테로니(Ouchterlony) 면역 확산법, 로케이트(rocket) 면역전기영동, 조직면역염색, 면역침전 분석법(Immunoprecipitation assay), 보체고정분석법(Complement Fixation Assay), FACS 및 단백질 칩으로 이루어진 군에서 선택된 하나 이상일 수 있으나, 이에 한정되는 것은 아니다.
상기 유전자 발현수준을 측정하는 방법은 마이크로어레이(microarray), 차세대 염기서열 분석(Next generation sequencing; NGS), 중합효소연쇄반응(PCR), RT-PCR(Reverse transcription PCR), 경쟁적 RT-PCR(Competitive RT-PCR), 실시간 RT-PCR(Real-time RT-PCR), RNase 보호 분석법(RPA; RNase protection assay), 노던 블랏팅(Northern blotting) 및 DNA 칩으로 이루어진 군에서 선택된 하나 이상일 수 있으나, 이에 한정되는 것은 아니다.
또한, 본 발명은 노인성 질환 세포주에 시험물질을 처리하는 단계(제1단계); 상기 제1단계의 세포주에서 Cbfβ(Core-binding factor subunit beta) 단백질 또는 이를 코딩하는 유전자의 발현을 측정하는 단계(제2단계): 및 시험물질을 처리하지 않은 노인성 질환 세포주와 비교해서 상기 Cbfβ 발현을 유도하는 시험물질을 선별하는 단계(제3단계)를 포함하는, 노인성 질환 치료제 스크리닝 방법을 제공한다.
본 명세서에서, "시험물질"은 유전자의 발현량에 영향을 미치거나, 단백질의 발현 또는 활성에 영향을 미치는지 여부를 검사하기 위하여 스크리닝에서 이용되는 미지의 후보 물질을 의미한다. 상기 시험물질은 화학물질, 핵산, 안티센스-RNA, siRNA(small interference RNA) 및 천연물 추출물을 포함하나, 이에 한정되는 것은 아니다.
이하, 본 발명의 이해를 돕기 위하여 실시예를 들어 상세하게 설명하기로 한다. 다만 하기의 실시예는 본 발명의 내용을 예시하는 것일 뿐 본 발명의 범위가 하기 실시예에 한정되는 것은 아니다. 본 발명의 실시예는 당업계에서 평균적인 지식을 가진 자에게 본 발명을 보다 완전하게 설명하기 위해 제공되는 것이다.
[ 실험예 1] 실험 준비
1-1. 시약
본 실험에서 사용한 시약(물질) 및 구입처는 하기 표 1과 같다.
시약 구입처
DMSO(dimethyl sulfoxide) Sigma
ethanol
fast red violet LB
glycerol
napthol As-Mx phosphate
N,N-dimethylformamide
nitric acid
nonylphenyl-polyethyleneglycol acetate
PFA(paraformaldehyde)
acetone JUNSEI
(Nihonbashi-honcho, Chuo-ku, Tokyo)
formaldehyde solution
sodium acetate trihydrate
sodium tartrate dihydrate
α-MEM(α-minimum essential medium) hyclone Thermo scientific
(Rockford, IL, U.S.A)
permount
FBS(Fetal bovine serum) GIBCO
(Grand Island, NY, U.S.A)
M-CSF(human macrophage-colony stimulation factor) PEPROTECH, INC.(Rocky Hill, NJ, USA)
N,N-dimethyl-p-toluidine MP Biomedicals(Solon-Ohio, BC, U.S.A)
페니실린/스트렙토마이신
(penicillin/streptomycin)		 Lonza(Rockland, ME, USA)
적혈구 용해액 BioLegend(San Diego, CA, U.S.A)
RANKL(receptor activator for nuclear factor κB ligand) R&D systems(Minneapolis, MN, U.S.A)
1-2. 실험동물
Cbfβf /f 16주령 수컷 마우스는 일본 RIKEN에서 분양받아 사용하였고, Sm22a Cre 16주령 수컷 마우스(Sm22a Cre 과발현 마우스)는 서울대 조제열 교수님 실험실에서 분양받아 사용하였으며, ROR26 마우스는 경북대학교 김정은 교수님 실험실에서 분양받아 사용하였다. Sm22a Cre 마우스와 Cbfβf /f 마우스를 교배 시, 교배한 마우스(Sm22a Cre;Cbfβf /f)의 혈관평활근세포에서 Cbfβ 유전자가 특이적으로 제거되는 원리를 이용하여 Cbfβ 결실 마우스를 제작하였다. 또한, Sm22a-Cre 마우스와 ROR26 마우스를 교배 시, 교배한 마우스에서 Sm22a-Cre가 발현하는 위치를 X-GAL 염색을 통해 확인할 수 있기 때문에, 교배를 수행하였다. 구체적으로, 실험에 사용한 마우스는 하기와 같다.
1) Cbfβf /f 마우스 : 정상 마우스(대조군; WT)
2) Sm22a Cre;Cbfβf /f 마우스(CbfβΔvc /+) : 이형접합(heterogeneous) Cbfβ 결실 마우스(HE)
3) Sm22a Cre;Cbfβf /f 마우스(CbfβΔvc / Δvc) : 동형접합(homogeneous) Cbfβ 결실 마우스(HO)
4) Sm22a-Cre;ROR26 마우스 : Sm22a Cre 과발현 마우스
SPF(Specific Pathogen Free) 실험동물 사육실(온도 25℃ 및 상대습도 60%)에서 1주일간 적응시킨 후 실험을 진행하였다. 사료는 일반식을 주었으며(Super bead Co, Korea), 모든 동물실험은 경북대학교 동물실험윤리위원회 규정을 따라 수행하였다(동물실험승인번호: KNU 2021-0099).
1-3. 세포
골수강 단핵구(mouse bone marrow monocyte; mBMM)는 8주령의 마우스 대퇴골과 경골에서 분리하였다. 경추 탈골한 생쥐에서 대퇴골과 경골을 분리하여 근육을 제거하고, 양 말단을 자른 후 실린지(syringe)를 이용하여 α-MEM를 통과시켜 골수세포들을 분리하였다. 분리된 골수 세포들을 원심분리하고, 적혈구 용해액을 넣어 적혈구를 용혈시킨 후, 배지[α-MEM, 10%(v/v) FBS, 페니실린(100units/㎖) 및 스트렙토마이신(100units/㎖)]를 넣고 37℃ 및 5%(v/v) CO2 조건의 항온항습배양기에서 1일 동안 배양하였다. 배양 접시에 붙지 않고 떠있는 세포들만 모아 M-CSF(20ng/㎖)를 처리하고 3일간 배양하여 골수유래 단핵구 대식세포(monocyte/ macrophage)를 확보하였다. 대식세포를 파골세포로 분화시키기 위해, M-CSF(30ng/㎖) 및 RANKL(30ng/㎖)을 첨가하여 4일 동안 배양하였다. 분화를 유도하는 동안 배지는 2일마다 교체해 주었다.
[ 실험예 2] Real-time PCR
파골세포 분화표지자의 유전자 발현 변화를 확인하기 위해, Real-time PCR을 수행하였다. 분화된 파골세포를 RNA 추출 Kit(Easy-blue)를 이용하여 total RNA를 추출하고, 2㎍의 Total RNA을 역전사효소를 이용하여 cDNA로 합성하였다. 합성된 cDNA 0.5㎕에 2× SYBR green PCR master mixture(5㎕)와 특정 프라이머(specific primer, 0.2㎕)를 섞어서 Real-time PCR을 수행하였다. Real-time PCR에 사용한 프라이머는 하기 표 2와 같고, 프라이머는 Primer Express software(ABI)를 이용하여 디자인하였다.
mDCSTAMP Forward CTTCCGTGGGCCAGAAGTT
Reverse AGGCCAGTGCTGACTAGGATGA
mc-fms Forward CCTGAATCTCCCGGAAGCA
Reverse CAAGCTCGGTACAACGGTAGGT
mRank Forward TCTGCAGCTCTTCCATGACACT
Reverse GAAGAGGAGCAGAACGATGAGACT
mTRAP Forward TCCCCAATGCCCCATTC
Reverse CGGTTCTGGCGATCTCTTTG
mGapdh Forward TGTGTCCGTCGTGGATCTGA
Reverse CCTGCTTCACCACCTTCTTGA
mc-fos Forward GCATGGGCTCTCCTGTCAA
Reverse GGCACTAGAGACGGACAGATCTG
mOscar Forward ACCTGGCACCTACTGTTGCTATTAC
Reverse GCTGGCTGCGCTGTGAT
mCathepsin K Forward GGCTGTGGAGGCGGCTAT
Reverse AGAGTCAATGCCTCCGTTCTG
mVegf Forward CAGGCTGCTGTAACGATGAA
Reverse GCATTCACATCTGCTGTGCT
mRankL Forward GATTTTTCAAGCTCCGAGCTGG
Reverse CCTGAACTTTGAAAGCCCCAA
mOpg Forward ACTCGAACCTCACCACAGAGCA
Reverse CGCTCGATTTGCAGGTCTTTC
mRunx1 Forward CAGGCAGATCCAGCCATC
Reverse TTGAGAGTCGACTGGAAAGTTCT
mRunx2 Forward GCACAAACATGGCCAGATTCA
Reverse AAGCCATGGTGCCCGTTAG
mCbfβ Forward GTTTACAGCTCTTTGGGTTCCA
Reverse TTACTGCCAGCAGCTGTGA
mSmmhc Forward GCGCAATACCACGCCTAACTT
Reverse AGATGCGGATGCCTTCCAA
mPPARG Forward GAAAGACAACGGACAAATCACC
Reverse GGGGGTGATATGTTTGAACTTG
mPDGFB Forward CAAGAGTGTGGGCAGGGTTA
Reverse CATCGAGACAGACGGACGAG
mPDGFRB Forward AAGCTGCAGGTCAATGTCCC
Reverse CTCTGCAGGTAGACCAGGTG
mElastin Forward GGGATAAAACGAGGCGCTGA
Reverse AGCTCCTGGAACCCCTCC
mAngptl4 Forward GTTTGCAGACTCAGCTCAAGG
Reverse CCAAGAGGTCTATCTGGCTCTG
[ 실험예 3] Trap( Tartrate resistant acid phosphatase ) 염색
마우스의 대퇴골과 경골에서 분리한 골수강 단핵구에 M-CSF(20ng/㎖)를 처리하고, 1일간 반응시켜 배양용기에 붙은 세포들을 모아서 48-웰 멀티 플레이트에 3×104 cells/well 씩 분주하고, 파골세포 분화유도배지로 교체해 주면서 4일간 배양하였다. 배지를 제거하고 PBS(phosphate-buffered saline)로 세척한 후, 10% 포름알데하이드(Formaldehyde) 용액으로 고정한 세포에 Trap 염색 용액[Naphthol As-Mx, Fast red violet LB 및 N,N-dimethylformamide를 50mM acetate buffer(pH 5.0)에 녹인 것]을 처리하고, 37℃에서 30분간 염색시켰다. 용액을 제거하고 PBS를 이용하여 2회 세척한 다음, 현미경으로 관찰하였다.
[ 실험예 4] H&E( Hematoxylin & Eosin) 염색
혈관의 형태를 관찰하기 위해, H&E 염색을 진행하였다. 혈관파라핀 절편을 재수화한 후, 헤마톡실린(Hematoxylin)으로 세포핵을 염색하고, 에오신(Eosin)으로 세포질을 염색한 후, 현미경으로 관찰하였다.
[ 실험예 5] VVG ( Verhoeff -Van Gieson ) 염색
혈관의 탄성섬유(Elastic fiber)를 관찰하기 위해, VVG 염색을 진행하였다. 혈관파라핀 절편을 재수화한 후, Verhoeff’s 용액에 1시간 반응 후, 흐르는 물에 3회 세척하고 2% 염화철로 2분간 반응시켰다. 흐르는 물에 세척 후, 5% 티오황산나트륨(sodium thiosulfate)과 5분간 반응시키고 다시 세척한 후, Van Gieson’s 용액으로 염색하고, 현미경으로 관찰하였다. 모든 절차는 하기 사이트에서 개시한 방법에 따라 진행하였다(https://www.ihcworld.com/_protocols/special_stains/vvg.htm).
[ 실험예 6] 조직면역학 염색
혈관파라핀 절편을 재수화한 후, Tri-EGTA(Tris 1.211g + EGTA 0.19g/ddH2O 1L; TEG) 용액에 넣어서 전자레인지에 끓여 retrieval하고 상온에서 천천히 식혔다. Retrieval된 샘플을 3% H2O2/메탄올 및 1% BSA/PBS 용액으로 블로킹(blocking)하고, 0.1% Triton X-100로 permibilization시켰다. 그 후, 일차 항체를 4℃에서 하룻밤 동안 반응시키고, 이차 항체를 상온에서 1시간 반응시켰다. 마지막으로 DAB 기질(substrate)을 이용하여 발색시키고, 탈수하여 마운팅(mounting)하고 현미경으로 관찰하였다.
[ 실험예 7] Von Kossa 염색
뼈의 광화 진행 정도를 관찰하기 위해, Von Kossa 염색을 수행하였다. 척추 뼈를 4℃에서 4% PFA에 하루 동안 고정하였다. 고정 후 탈회하지 않은 상태에서 파라핀 샘플을 만들었다. 파라핀 절편을 재수화한 후 1% 질산은(AgNO3)을 첨가 후 UV(ultraviolet) 아래에서 5분 동안 반응시켰다. 반응이 끝난 후 3차수로 2번 세척하고, 5% 티오황산나트륨(sodium thiosulfate)을 첨가하여 5분 동안 반응시킨 후, 비특이적인 신호를 제거하였다. 그 후, 마운팅(mounting)하고, 현미경으로 관찰하였다.
[ 실험예 8] 조직면역학 염색
혈관 파라핀 절편을 재수화 후, 1% BSA(Bovine Serum Albumin)를 이용하여 1시간 블로킹하고, CD31 항체와 1시간 상온에서 반응시켰다. 그 후, HRP(Horse Radish Peroxidase)가 부착된 2차 항체와 1시간 반응시킨 후, DAB(3,3'-diaminobenzidine)(Dako, Carpinteria, CA, USA)로 발색시키고, 마운팅(mounting)한 후, 현미경으로 관찰하였다.
[ 실험예 9] 형광면역학 염색
혈관 파라핀 절편을 재수화 후, 1% BSA를 이용하여 1시간 블로킹하고, PCNA 항체와 1시간 상온에서 반응시켰다. 그 후, 형광이 부착된 2차 항체와 1시간 반응시킨 후, DAPI(4',6-diamidino-2-phenylindole)로 세포핵을 염색시키고 마운팅(mounting)한 후, 현미경으로 관찰하였다.
[ 실험예 10] X-Gal 염색
전체 조직을 4% 파라포름알데히드(PFA)/0.1M 인산칼슘용액[pH 7.4, 2mM MgCl2, 5mM EGTA(ethylene glycol tetra-acetic acid)]에서 30분 동안 고정하였다. 그 후, 3번 세척하고, 37℃에서 밤새 X-gal 염색 용액에 넣어 염색하였다. 염색된 샘플은 파라핀 블록으로 만들고 절편으로 자른 후 Nuclear Fast Red(Sigma Aldrich, St. Louis, MO, USA)로 대비 염색하였다.
[ 실험예 11] micro-CT 분석
생쥐 대퇴골을 분리하여 근육을 제거한 후, 4% PFA를 통하여 하루 동안 4℃에서 고정하고, 다음날 PBS 용액에 3번 세척 후 PBS에 보관하였다. 보관된 대퇴골은 Skysan 1272(bruker, Massachusetts, USA) 모델로 성장판 아래 1.6mm부터 2.3 mm구간을 6㎛단위로 스캔하여 분석하였다. micro-CT를 이용하여 해면골의 골량 (BV/TV), 해면골의 두께(Tb.Th), 해면골수(Tb.N), 해면골사의 면적(Tb.Sp) 및 해면골의 골밀도(BMD)를 측정하며 피질골의 골량(BV/TV) 및 골밀도(BMD)를 측정하였다.
[ 실험예 12] 골강도 측정
생쥐대퇴골을 분리하여 근육을 제거한 후, 0.9% 염화나트륨(pH 7.4)에 넣어 -20℃에 보관하였다. 샘플을 분석하기 전 4℃에서 서서히 녹이고, Instron(Tensile Tester, Williamston, SC, USA)로 max load(N) 및 Slope(N/mm)을 측정하였다.
[ 실험예 13] 혈액생화학 분석
생체 내 파골세포의 흡수 정도를 확인하기 위해, 혈청에서 CTX의 분비를 ELISA를 이용하여 측정하였다. 모든 실험 절차는 cloud clone(WUHAN, PRC)의 표준 메뉴얼에 따라 진행하였다.
[ 실험예 14] 혈압 측정
Cbfβ 결실이 혈압에 미치는 영향을 확인하기 위해, 마우스 혈압을 측정하였다. 마우스 혈압을 측정하기 전, 5분간 안정화시키고 자동 혈압계(Tango+, Suntech, NC, USA)를 이용하여 측정하였다.
[ 실험예 15] Alizarin Red 염색
고용량 비타민 D를 이용한 혈관석회화 유도 모델에서 Cbfβ의 결실이 혈관석회화에 미치는 영향을 확인하기 위해, Alizarin Red 염색을 진행하였다. 희생된 마우스에서 분리된 신장과 혈관을 PBS로 10분씩 3회 세척한 후, 4% PFA로 고정하고 3차 증류수로 10분씩 3번 세척하고 Alizarin Red 용액으로 10분간 반응시켰다. 3차 증류수로 3번 세척 후 현미경으로 관찰하였다.
[ 실험예 16] MTS assay
조골세포 및 파골세포 증식에 미치는 영향을 확인하기 위해, MTS assay를 수행하였다. MC3T3-E1 세포를 48-웰 멀티 플레이트에 3×104 cells/well씩 심고, 24시간 후에 혈관평활근세포에서 얻은 배양액을 처리하고, 24시간 동안 배양한 후, MTS 용액 20㎕을 각각의 웰에 100㎕ 배양액에 같이 넣고, 4시간 동안 배양시켰다. 4시간 후 ELISA reader를 이용하여 490㎚ 파장에서 흡광도를 측정하였다.
[ 실시예 1] 혈관 항상성 분석
혈관평활근세포에서 Cbfb가 혈관 항상성에 미치는 영향을 분석한 결과, 도 1A와 같이, Sm22a-Cre 과발현 마우스(Sm22a-Cre;ROR26) 유래 혈관평활근세포에서 Sm22a-cre 발현이 증가하는 것을 X-gal 염색(실험예 10)을 통해 확인하였다. 또한, 도 1B와 같이, Cbfβ 결실 마우스(CbfβΔvc / Δvc) 유래 혈관평활근세포에서 Cbfβ 및 Runx1 발현이 감소하는 것을 형광면역학 염색(실험예 9)을 통해 확인하였다. 또한, 도 1C와 같이, 상기 Cbfβ 결실 마우스 유래 혈관평활근의 탄성 섬유(elastin fiber)가 평평(flat)하고 불규칙적인 것을 H&E 및 VVG 염색(실험예 4~5)을 통해 확인하였고, 도 1D와 같이, 상기 Cbfβ 결실 마우스 유래 혈관평활근세포에서 CD31 발현이 증가하고, 혈관평활근세포 증식이 감소하는 것을 형광면역학 염색(실험예 9)을 통해 확인하였다. 상기 결과로부터, Cbfβ가 혈관 항상성에 관여하는 것을 확인하였다.
[ 실시예 2] 혈압 분석
혈관평활근세포에서 Cbfβ가 혈압에 미치는 영향을 분석한 결과(실험예 12), 도 2와 같이, 정상 마우스(Cbfβfl /fl) 대비 Cbfβ 결실 마우스(CbfβΔvc / Δvc)에서 혈압이 높게 나타났다(n=4-5/group, *p<0.05). 상기 결과로부터, Cbfβ가 혈압 항상성에 관여하는 것을 확인하였다.
[ 실시예 3] 혈관석회화 분석
혈관평활근세포에서 Cbfβ가 혈관석회화에 미치는 영향을 확인하기 위해, 마우스에 고용량 비타민 D(6×105IU/Kg)를 피하주사하여 혈관석회화를 유도하고, Alizarin Red 염색(실험예 13)을 통해 신장 및 동맥혈관에서 혈관석회화를 관찰하였다. 대조군으로 비타민 D 대신 PBS를 투여할 때도 피하주사로 투여하였다. 구체적으로, 실험군은 하기와 같이 설정하였다.
1) PBS 투여(200μl) 정상 마우스(WT)(n=2)
2) 비타민 D 투여(6×105 IU/Kg) 정상 마우스(WT)(n=4)
3) PBS 투여(200μl) Cbfβ 결실 마우스(CbfβΔvc / Δvc)(n=2)
4) 비타민 D 투여(6×105 IU/Kg) Cbfβ 결실 마우스(CbfβΔvc / Δvc)(n=4)
그 결과, 도 3과 같이, 비타민 D를 투여한 정상 마우스(Cbfβfl /fl) 및 Cbfβ 결실 마우스(CbfβΔvc / Δvc)의 신장(Kidney) 및 동맥혈관(Aorta)에서 혈관석회화가 촉진되었고, 정상 마우스 대비 Cbfβ 결실 마우스에서 혈관석회화가 더 유의하게 나타났다. 상기 결과로부터, Cbfβ가 혈관석회화를 억제하는 것을 확인하였다.
[ 실시예 4] 골대사 분석
혈관평활근세포에서 Cbfβ가 골대사에 미치는 영향을 분석한 결과, 도 4A~4B와 같이, 정상 마우스(Cbfβfl /fl) 대비 Cbfβ 결실 마우스(CbfβΔvc /+ 및 CbfβΔvc / Δvc)의 해면골의 골밀도(Tb. BMD), 해면골의 골량(Tb. BV/TV), 해면골의 두께(Tb.Th) 및 해면골수(Tb.N)가 유의하게 감소하였고, 해면골사의 면적(Tb.Sp)이 유의하게 증가하였으며, 골 강도지표인 대퇴골길이(Femur Length), Slope 및 YLD.load 값이 감소하는 것을 micro-CT 및 Instron(실험예 9~10)을 통해 확인하였다. 또한, 도 4C와 같이, 정상 마우스 대비 Cbfβ 결실 마우스(CbfβΔvc / Δvc)에서 CTX 및 RANKL 발현이 증가하는 것을 혈액생화학 분석(실험예 11)을 통해 확인하였고, 도 4D와 같이, 정상 마우스 대비 Cbfβ 결실 마우스(CbfβΔvc / Δvc)에서 파골세포의 수(Oc.NO) 및 파골세포 단위표면적/뼈 단위표면적(Oc.S/BS)이 증가하는 것을 TRAP 염색(실험예 3)을 통해 확인하였으며, 척추골에서 골량(BV/TV), 골 두께(Tb.Th) 및 해면골 수(Tb.N)가 감소하고, 해면골 면적(Tb.Sp)이 증가하는 것을 Von Kossa 염색(실험예 7)을 통해 확인하였다. 상기 결과로부터, Cbfβ가 골대사 항상성에 관여하는 것을 확인하였다.
[ 실시예 5] 파골세포 활성 및 분화 분석
5-1. 혈관평활근세포
혈관평활근세포 유래 단백질이 파골세포 활성 및 분화에 미치는 영향을 분석한 결과, 도 5A 및 5C와 같이, 대조군(미처리군; Control) 대비 혈관평활근세포 배양액 처리군(WT-CM, CM = vascular smooth muscle cell derived conditional media)이 파골세포(단핵구세포)의 증식을 촉진하는 반면, 파골세포의 분화는 억제하는 것을 MTS assay(실험예 16) 및 Trap 염색(실험예 3)을 통해 확인하였다. 또한, 도 5B와 같이, 대조군 대비 혈관평활근세포 배양액 처리군에서 파골세포의 분화표지자(c-fos, c-fms, RANK, TRAP, OSCAR, NFACT1, Cathepsin K 및 DC-STAMP)가 발현이 감소하는 것을 Real-time PCR(실험예 2)을 통해 확인하였다. 상기 결과로부터, 혈관평활근세포 유래 단백질 파골세포 증식 촉진 및 파골세포 분화 억제를 통해 골대사에 관여하는 것을 확인하였다.
5-2. Cbfβ 결실 혈관평활근세포
Cbfβ 결실 혈관평활근세포 배양액이 파골세포 활성 및 분화에 미치는 영향을 분석한 결과, 도 6A 및 6C와 같이, 파골세포 증식은 실험군간 유의한 차이가 나타나지 않은 반면, 대조군(WT-CM; 정상 혈관평활근세포 배양액 처리군, CM = vascular smooth muscle cell derived conditional media) 대비 Cbfβ 결실 혈관평활근세포 배양액 처리군(HO-CM)에서 파골세포 분화가 증가하는 것을 MTS assay(실험예 16) 및 Trap 염색(실험예 3)을 통해 확인하였다. 또한, 도 6B와 같이, 대조군 대비 Cbfβ 결실 혈관평활근세포 배양액 처리군에서 RUNX2 및 OCN 발현이 감소하였고, Osterix 및 OPN 발현이 증가하며, ALP 및 Colla 발현은 실험군간 유의한 차이가 나타나지 않는 것을 Real-time PCR(실험예 2)을 통해 확인하였다. 또한, 도 7과 같이, 대조군(정상 혈관평활근세포 배양액 처리군; pcDN3.1 CM) 대비 Cbfβ 과발현 혈관평활근세포 배양액 처리군(Cbfβ CM)에서 파골세포 분화가 감소하는 것을 Trap 염색(실험예 3)을 통해 확인하였다. 상기 결과로부터, Cbfβ는 파골세포 분화를 억제하는 것을 확인하였다.
[ 실시예 6] 파골세포 분화 관련 유전자 발현 분석
혈관평활근세포에서 Cbfβ가 파골세포 분화 관련 유전자 발현에 미치는 영향을 분석한 결과, 도 8A와 같이, 대조군(정상 마우스 세포; Cbfβfl /fl) 대비 Cbfβ 결실 마우스 세포(CbfβΔvc / Δvc)에서 Runx1, Runx2, VEGF, PDGF-BB, PDGFRB, RANKL 및 RANKL/OPG 발현이 유의하게 증가하고, Cbfβ, OPG, PPARG, OPN 및 ANGPTL4 발현이 유의하게 감소하는 것을 Real-time PCR(실험예 2)를 통해 확인하였다. 또한, 도 8B와 같이, 대조군(WT CM) 대비 Cbfβ 결실 마우스 세포(HE CM 및 HO CM)에서 RANKL 발현이 유의하게 증가하는 것을 ELISA(실험예 11)를 통해 확인하였다. 상기 결과로부터, Cbfβ가 파골세포 분화 관련 유전자 발현 조절을 통해 파골세포 분화를 억제하는 것을 확인하였다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 즉, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다.

Claims (18)

  1. Cbfβ(Core-binding factor subunit beta) 발현 혈관평활근세포 또는 이의 배양액을 유효성분으로 포함하는 노인성 질환 예방 또는 치료용 약학 조성물.
  2. 제1항에 있어서, 상기 Cbfβ 발현 혈관평활근세포 또는 이의 배양액은 혈압 상승; 또는 파골세포 분화를 억제하는 것을 특징으로 하는 약학 조성물.
  3. 제1항에 있어서, 상기 노인성 질환은 혈관 노화 질환 또는 골질환인 것을 특징으로 하는 약학 조성물.
  4. 제3항에 있어서, 상기 혈관 노화 질환은 혈관 석회화, 골다공증, 골관절염, 동맥경화, 지방간, 간섬유화, 당뇨 및 치매로 이루어진 군에서 선택된 하나 이상인 것을 특징으로 하는 약학 조성물.
  5. 제3항에 있어서, 상기 골질환은 골절, 골관절염, 류마티스 관절염, 골다공증 및 골연화증으로 이루어진 군에서 선택된 하나 이상인 것을 특징으로 하는 약학 조성물.
  6. Cbfβ(Core-binding factor subunit beta) 발현 혈관평활근세포 또는 이의 배양액을 유효성분으로 포함하는 노인성 질환 예방 또는 개선용 건강기능식품 조성물.
  7. Cbfβ(Core-binding factor subunit beta) 단백질 또는 이를 코딩하는 유전자의 발현 또는 활성 유도제를 유효성분으로 포함하는 노인성 질환 예방 또는 치료용 약학 조성물.
  8. Cbfβ(Core-binding factor subunit beta) 단백질 또는 이를 코딩하는 유전자를 유효성분으로 포함하는 노인성 질환 진단용 바이오마커 조성물.
  9. 제8항에 있어서, 상기 노인성 질환은 혈관 노화 질환 또는 골질환인 것을 특징으로 하는 바이오마커 조성물.
  10. 제8항에 있어서, 상기 단백질 또는 이를 코딩하는 유전자는 노인성 질환 환자군의 혈관평활근세포에서 발현이 감소하는 것을 특징으로 하는 바이오마커 조성물.
  11. Cbfβ(Core-binding factor subunit beta) 단백질 또는 이를 코딩하는 유전자의 발현 수준을 확인할 수 있는 제제를 유효성분으로 포함하는 노인성 질환 진단용 조성물.
  12. 제11항에 있어서, 상기 발현 수준을 확인할 수 있는 제제는 상기 단백질에 특이적으로 결합하는 항체, 펩타이드, 앱타머 또는 화합물; 또는 상기 단백질을 코딩하는 유전자에 특이적으로 결합하는 프라이머 또는 프로브인 것을 특징으로 하는 진단용 조성물.
  13. 제11항 또는 제12항 중 어느 한 항의 조성물을 유효성분으로 포함하는 노인성 질환 진단용 키트.
  14. 개체로부터 생물학적 시료를 분리하는 단계(제1단계); 및
    상기 제1단계에서 분리한 생물학적 시료에서 Cbfβ(Core-binding factor subunit beta) 단백질 또는 이를 코딩하는 유전자의 발현 수준을 측정하는 단계(제2단계)를 포함하는 노인성 질환 진단을 위한 정보 제공 방법.
  15. 제14항에 있어서, 상기 생물학적 시료는 혈관평활근세포인 것을 특징으로 하는 정보 제공 방법.
  16. 제14항에 있어서, 상기 단백질 발현 수준을 측정하는 방법은 웨스턴블랏, ELISA(enzyme linked immunosorbent asay), 방사선면역분석(Radioimmunoassay; RIA), 방사면역확산법(radioimmunodiffusion), 오우크테로니(Ouchterlony) 면역 확산법, 로케이트(rocket) 면역전기영동, 조직면역염색, 면역침전 분석법(Immunoprecipitation assay), 보체고정분석법(Complement Fixation Assay), FACS 및 단백질 칩으로 이루어진 군에서 선택된 하나 이상인 것을 특징으로 하는 정보 제공 방법.
  17. 제14항에 있어서, 상기 유전자 발현수준을 측정하는 방법은 마이크로어레이(microarray), 차세대 염기서열 분석(Next generation sequencing; NGS), 중합효소연쇄반응(PCR), RT-PCR(Reverse transcription PCR), 경쟁적 RT-PCR(Competitive RT-PCR), 실시간 RT-PCR(Real-time RT-PCR), RNase 보호 분석법(RPA; RNase protection assay), 노던 블랏팅(Northern blotting) 및 DNA 칩으로 이루어진 군에서 선택된 하나 이상인 것을 특징으로 하는 정보 제공 방법.
  18. 노인성 질환 세포주에 시험물질을 처리하는 단계(제1단계); 상기 제1단계의 세포주에서 Cbfβ(Core-binding factor subunit beta) 단백질 또는 이를 코딩하는 유전자의 발현을 측정하는 단계(제2단계): 및 시험물질을 처리하지 않은 노인성 질환 세포주와 비교해서 상기 Cbfβ 발현을 유도하는 시험물질을 선별하는 단계(제3단계)를 포함하는, 노인성 질환 치료제 스크리닝 방법.
PCT/KR2023/014083 2022-09-21 2023-09-18 CBFβ 발현 혈관평활근세포 또는 이의 배양액을 유효성분으로 포함하는 노인성 질환 예방 또는 치료용 약학 조성물 WO2024063484A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2022-0119428 2022-09-21
KR20220119428 2022-09-21
KR10-2023-0122311 2023-09-14
KR1020230122311A KR20240040635A (ko) 2022-09-21 2023-09-14 Cbfβ 발현 혈관평활근세포 또는 이의 배양액을 유효성분으로 포함하는 노인성 질환 예방 또는 치료용 약학 조성물

Publications (1)

Publication Number Publication Date
WO2024063484A1 true WO2024063484A1 (ko) 2024-03-28

Family

ID=90454966

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/014083 WO2024063484A1 (ko) 2022-09-21 2023-09-18 CBFβ 발현 혈관평활근세포 또는 이의 배양액을 유효성분으로 포함하는 노인성 질환 예방 또는 치료용 약학 조성물

Country Status (1)

Country Link
WO (1) WO2024063484A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20180282700A1 (en) * 2015-10-15 2018-10-04 Medizinische Universität Wien Cell culture model of vascular calcification
KR102249135B1 (ko) * 2019-12-31 2021-05-07 경북대학교 산학협력단 골관절염 자연발생 모델 및 이의 용도
KR20210062959A (ko) * 2019-11-22 2021-06-01 강원대학교산학협력단 Cbfβ 단백질을 포함하는 줄기세포 골분화 촉진용 조성물 및 이를 이용한 골분화 촉진 방법
WO2021207655A1 (en) * 2020-04-09 2021-10-14 Emory University Methods of generating pluripotent stem cell-derived vascular smooth muscle cells, uses, and composition related thereto
KR20220127749A (ko) * 2021-03-11 2022-09-20 강원대학교산학협력단 체세포로부터 조골세포로 직접교차분화를 유도하는 융합단백질 제조 방법 및 이의 용도

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20180282700A1 (en) * 2015-10-15 2018-10-04 Medizinische Universität Wien Cell culture model of vascular calcification
KR20210062959A (ko) * 2019-11-22 2021-06-01 강원대학교산학협력단 Cbfβ 단백질을 포함하는 줄기세포 골분화 촉진용 조성물 및 이를 이용한 골분화 촉진 방법
KR102249135B1 (ko) * 2019-12-31 2021-05-07 경북대학교 산학협력단 골관절염 자연발생 모델 및 이의 용도
WO2021207655A1 (en) * 2020-04-09 2021-10-14 Emory University Methods of generating pluripotent stem cell-derived vascular smooth muscle cells, uses, and composition related thereto
KR20220127749A (ko) * 2021-03-11 2022-09-20 강원대학교산학협력단 체세포로부터 조골세포로 직접교차분화를 유도하는 융합단백질 제조 방법 및 이의 용도

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
CHE XIANGGUO, JIN XIAN, PARK NA RAE, KIM HEE-JUNE, KYUNG HEE-SOO, KIM HYUN-JU, LIAN JANE B., STEIN JANET L., STEIN GARY S., CHOI J: "Cbfβ Is a Novel Modulator against Osteoarthritis by Maintaining Articular Cartilage Homeostasis through TGF-β Signaling", CELLS, vol. 12, no. 7, 1 April 2023 (2023-04-01), pages 1064, XP093149311, ISSN: 2073-4409, DOI: 10.3390/cells12071064 *

Similar Documents

Publication Publication Date Title
WO2018074758A2 (ko) 면역질환 치료를 위한 고효능 줄기세포 선별방법
US9802994B2 (en) Composition for preventing or treating fracture or osteoporosis using slit-robo system
Wu et al. Synovial TRPV1 is upregulated by 17-β-estradiol and involved in allodynia of inflamed temporomandibular joints in female rats
WO2018056706A1 (ko) 티오레독신 결합단백질 유래 펩타이드 또는 이를 암호화 하는 폴리뉴클레오타이드를 유효성분으로 함유하는 노화 줄기세포의 역노화용 조성물 및 이의 용도
WO2014178653A1 (ko) 지방세포 분화 과정에서 인간 작은 류신 지퍼 단백질의 용도
WO2024063484A1 (ko) CBFβ 발현 혈관평활근세포 또는 이의 배양액을 유효성분으로 포함하는 노인성 질환 예방 또는 치료용 약학 조성물
WO2013119033A1 (ko) Ｕｂａｐ２를 포함하는 골다공증 진단 및 치료효과 평가용 바이오 마커 조성물
EP2490724A2 (en) Compositions for improving migration potential of stem cells
WO2019235876A1 (ko) C-src의 발현 또는 활성 억제제를 포함하는 시누클레인병증의 예방 또는 치료용 약학 조성물
WO2019124803A1 (ko) 셀라지넬라 로씨 추출물, 이의 분획물을 포함하는 대사증후군의 예방 또는 치료용 조성물
WO2024071848A1 (ko) 혈관석회화 치료제 스크리닝 방법
WO2018212503A1 (ko) 조혈모세포의 항상성 유지에 관여하는 cotl1 단백질 및 이의 용도
WO2019245269A1 (ko) Flt3 억제제를 유효성분으로 포함하는 만성 골수성 백혈병 약물 내성 억제용 조성물
WO2015056970A1 (ko) 프로그래뉼린 억제제를 유효성분으로 함유하는 골다공증 예방 또는 치료용 조성물
KR102633897B1 (ko) Pannexin3을 포함하는 혈관 석회화 진단용 바이오마커 조성물 및 이를 이용한 진단방법
KR20240040635A (ko) Cbfβ 발현 혈관평활근세포 또는 이의 배양액을 유효성분으로 포함하는 노인성 질환 예방 또는 치료용 약학 조성물
WO2017052340A1 (ko) 운동유사효과 유도용 약학 조성물
WO2017023002A1 (ko) 비알콜성 지방간 조절인자 14-3-3 단백질
WO2017023001A1 (ko) 비알콜성 지방간 조절인자 14-3-3 단백질
CN110141566B (zh) Sglt2抑制剂在调控炎症中的应用
KR101284521B1 (ko) 비만 또는 비만 관련 질환 진단용 바이오마커 조성물, 비만 관련 질환 치료제의 스크리닝 방법 및 비만 관련 질환의 진단을 위한 정보를 제공하는 방법
WO2014051359A1 (ko) 네퍼린을 유효성분으로 포함하는 간암 예방 또는 치료용 약제학적 조성물
Ma et al. The effect of the α7nAChR agonist on Wnt/β-catenin signaling in osteoporosis
US20110136108A1 (en) XBP1(S) Protein Acting as an Adipocyte Differentiation Marker Having a Facility to Regulate Differentiation into Adipocytes, and an Application Therefor
KR20240043697A (ko) 혈관석회화 치료제 스크리닝 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23868536

Country of ref document: EP

Kind code of ref document: A1