WO2024071848A1 - 혈관석회화 치료제 스크리닝 방법 - Google Patents

혈관석회화 치료제 스크리닝 방법 Download PDF

Info

Publication number
WO2024071848A1
WO2024071848A1 PCT/KR2023/014445 KR2023014445W WO2024071848A1 WO 2024071848 A1 WO2024071848 A1 WO 2024071848A1 KR 2023014445 W KR2023014445 W KR 2023014445W WO 2024071848 A1 WO2024071848 A1 WO 2024071848A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
cabp9k
vascular calcification
expression
vascular
Prior art date
Application number
PCT/KR2023/014445
Other languages
English (en)
French (fr)
Inventor
최제용
차상국
김한
김현주
Original Assignee
경북대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 경북대학교 산학협력단 filed Critical 경북대학교 산학협력단
Priority claimed from KR1020230126066A external-priority patent/KR20240043697A/ko
Publication of WO2024071848A1 publication Critical patent/WO2024071848A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B6/00—Apparatus or devices for radiation diagnosis; Apparatus or devices for radiation diagnosis combined with radiation therapy equipment
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B6/00—Apparatus or devices for radiation diagnosis; Apparatus or devices for radiation diagnosis combined with radiation therapy equipment
    • A61B6/02—Arrangements for diagnosis sequentially in different planes; Stereoscopic radiation diagnosis
    • A61B6/03—Computed tomography [CT]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/483—Physical analysis of biological material
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/558—Immunoassay; Biospecific binding assay; Materials therefor using diffusion or migration of antigen or antibody

Definitions

  • the present invention relates to a screening method for a treatment for vascular calcification.
  • Blood vessels are circulatory organs that continuously regulate the movement of body fluids, supplying oxygen and nutrients to tissues, and receiving and processing carbon dioxide and waste products from tissues.
  • Decreased vascular function causes various diseases such as cardiovascular disease, blood pressure, diabetes, and Alzheimer's disease. Therefore, it is very important to protect blood vessel health.
  • vascular calcification is the deposition of minerals such as calcium and phosphoric acid in blood vessels, which increases the stiffness of blood vessels and causes blood vessels to rupture, causing various diseases such as cardiovascular disease. Loss of calcium accumulation inhibitors, induction of bone formation, nucleation complexes in the blood, and apoptosis are considered to be the main causes of vascular calcification, but the exact mechanism is not yet known, and prevention and treatment methods have not yet been developed.
  • compositions for preventing, improving, or treating vascular calcification Accordingly, there is a need to develop technology for compositions for preventing, improving, or treating vascular calcification.
  • the purpose of the present invention is to provide a screening method for a treatment for vascular calcification.
  • Another object of the present invention is to provide a composition for preventing, improving or treating vascular calcification.
  • Another object of the present invention is to provide a composition for diagnosing vascular calcification; Or, providing a diagnostic kit.
  • Another object of the present invention is to provide a method for providing information for diagnosing vascular calcification.
  • the present invention includes the steps of treating cells of a group of patients with vascular calcification with a test substance (first step); Measuring the expression of CaBP9K (calbindin-D9K) protein or the gene encoding it in cells treated with the test substance in the first step (second step); And a step (third step) of selecting a test substance that inhibits the expression of the CaBP9K protein or the gene encoding it compared to the cells of the vascular calcification patient group that were not treated with the test substance (step 3). to provide.
  • the present invention provides a pharmaceutical composition for preventing or treating vascular calcification containing an expression or activity inhibitor of the protein or the gene encoding the protein as an active ingredient.
  • the present invention provides a health functional food composition for preventing or improving vascular calcification containing an expression or activity inhibitor of the protein or the gene encoding the protein as an active ingredient.
  • the present invention provides a biomarker composition for diagnosing vascular calcification comprising the above protein or its encoding gene as an active ingredient; A composition for diagnosing vascular calcification comprising as an active ingredient an agent capable of confirming the expression level of the protein or the gene encoding the protein; and a kit for diagnosing vascular calcification containing the composition for diagnosing vascular calcification as an active ingredient.
  • the present invention includes the steps of isolating a biological sample from an individual (first step); and measuring the expression level of the protein or the gene encoding it in the biological sample isolated in the first step (second step).
  • vascular calcification was improved in the CaBP9K deletion model compared to the model in which CaBP9K was normally expressed, thereby providing a composition for preventing, treating, improving or diagnosing vascular calcification, It can be useful as a screening method for calcification treatments.
  • FIG. 1 CaBP9K is related to body weight; This is the result of analyzing the effect on blood calcium and phosphorus concentrations.
  • Figure 2A shows the results of analyzing the effect of CaBP9K on the amount (weight) of calcium in the kidney
  • Figure 2B shows the results of analyzing CaBP9K expression in a vascular calcification induction model; This is the result of analyzing the effect of CaBP9K on vascular calcification.
  • Figure 3 shows the results of analyzing the effect of CaBP9K on gene expression of factors related to vascular calcification.
  • Figure 4 shows the results of analyzing the effect of CaBP9K on protein expression of factors related to vascular smooth muscle cell differentiation.
  • Figures 5 and 6 show the results of analyzing whether vascular calcification occurs in vascular smooth muscle cells (vascular smooth muscle cells derived from a CaBP9K deletion experimental model) in which CaBP9K expression is suppressed.
  • the present invention includes the steps of treating cells of a group of patients with vascular calcification with a test substance (first step); Measuring the expression of CaBP9K (calbindin-D9K) protein or the gene encoding it in cells treated with the test substance in the first step (second step); And a step (third step) of selecting a test substance that inhibits the expression of the CaBP9K protein or the gene encoding it compared to the cells of the vascular calcification patient group that were not treated with the test substance (step 3). to provide.
  • the cells may be vascular smooth muscle cells.
  • test substance refers to an unknown candidate substance used in screening to test whether it affects the expression level of a gene or affects the expression or activity of a protein.
  • the test substances include, but are not limited to, chemicals, nucleic acids, antisense-RNA, siRNA (small interference RNA), and natural product extracts.
  • the present invention provides a pharmaceutical composition for preventing or treating vascular calcification, which contains an expression or activity inhibitor of the CaBP9K (calbindin-D9K) protein or the gene encoding it as an active ingredient.
  • a pharmaceutical composition for preventing or treating vascular calcification which contains an expression or activity inhibitor of the CaBP9K (calbindin-D9K) protein or the gene encoding it as an active ingredient.
  • the pharmaceutical composition of the present invention is prepared in unit dose form or in a multi-dose container by formulating it using a pharmaceutically acceptable carrier according to a method that can be easily performed by a person skilled in the art. It can be manufactured by internalizing it.
  • the pharmaceutically acceptable carriers are those commonly used in preparation, and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, Includes, but is not limited to, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methyl hydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, etc.
  • the pharmaceutical composition of the present invention may further include lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc.
  • the content of additives included in the pharmaceutical composition is not particularly limited and can be appropriately adjusted within the content range used in conventional formulations.
  • the pharmaceutical compositions include injectable formulations such as aqueous solutions, suspensions, and emulsions, pills, capsules, granules, tablets, creams, gels, patches, sprays, ointments, warning agents, lotions, liniment agents, paste agents, and cataplasmase agents. It may be formulated in the form of one or more external skin preparations selected from the group consisting of, but is not limited to this.
  • the pharmaceutical composition of the present invention may additionally contain pharmaceutically acceptable carriers and diluents for formulation.
  • the pharmaceutically acceptable carriers and diluents include excipients such as starch, sugar and mannitol, fillers and extenders such as calcium phosphate, cellulose derivatives such as carboxymethylcellulose, hydroxypropylcellulose, gelatin, alginate, polyvinyl pyrrolidone. It includes, but is not limited to, binders such as talc, calcium stearate, lubricants such as hydrogenated castor oil and polyethylene glycol, disintegrants such as povidone and crospovidone, and surfactants such as polysorbate, cetyl alcohol, glycerol, etc.
  • the pharmaceutically acceptable carrier and diluent may be biologically and physiologically friendly to the subject. Examples of diluents include, but are not limited to, saline, aqueous buffers, solvents, and/or dispersion media.
  • the pharmaceutical composition of the present invention can be administered orally or parenterally (for example, intravenously, subcutaneously, intraperitoneally, or topically) depending on the desired method.
  • parenterally for example, intravenously, subcutaneously, intraperitoneally, or topically
  • it can be formulated as tablets, troches, lozenges, aqueous suspensions, oily suspensions, powders, granules, emulsions, hard capsules, soft capsules, syrups, elixirs, etc.
  • parenteral administration it can be formulated as an injection, suppository, powder for respiratory inhalation, aerosol for spray, ointment, powder for application, oil, cream, etc.
  • the dosage of the pharmaceutical composition of the present invention is determined by the patient's condition, weight, age, gender, health, dietary constitution specificity, nature of the preparation, degree of disease, administration time of the composition, administration method, administration period or interval, excretion rate, and
  • the range may vary depending on the drug form and can be appropriately selected by a person skilled in the art. For example, it may range from about 0.1 to 10,000 mg/kg, but is not limited and may be administered once to several times a day.
  • the pharmaceutical composition may be administered orally or parenterally (eg, intravenously, subcutaneously, intraperitoneally, or topically applied) depending on the desired method.
  • the pharmaceutically effective amount and effective dosage of the pharmaceutical composition of the present invention may vary depending on the formulation method, administration method, administration time, administration route, etc. of the pharmaceutical composition, and those skilled in the art will know that it is effective for the desired treatment. Dosage can be easily determined and prescribed.
  • the pharmaceutical composition of the present invention may be administered once a day, or may be administered in several divided doses.
  • the present invention provides a health functional food composition for preventing or improving vascular calcification containing as an active ingredient an expression or activity inhibitor of the CaBP9K (calbindin-D9K) protein or the gene encoding it.
  • CaBP9K calbindin-D9K
  • the present invention can be generally used with commonly used foods.
  • the food composition of the present invention can be used as a health functional food.
  • health functional food refers to food manufactured and processed using raw materials or ingredients with functionality useful to the human body in accordance with the Health Functional Food Act, and “functionality” refers to food that is related to the structure and function of the human body. It means ingestion for the purpose of controlling nutrients or obtaining useful health effects such as physiological effects.
  • the health functional food composition may contain common food additives, and its suitability as a “food additive” is determined in accordance with the general provisions and general test methods of the food additive code approved by the Ministry of Food and Drug Safety, unless otherwise specified. The decision is made based on the specifications and standards for the item.
  • Items listed in the “Food Additives Code” include, for example, chemical compounds such as ketones, glycine, potassium citrate, nicotinic acid, and cinnamic acid; natural additives such as subchromic pigment, licorice extract, crystalline cellulose, high-liquid pigment, and guar gum; Examples include mixed preparations such as sodium L-glutamate preparations, noodle additive alkaline preparations, preservative preparations, and tar coloring preparations.
  • the food composition of the present invention can be manufactured and processed in the form of tablets, capsules, powders, granules, liquids, pills, etc.
  • hard capsules can be manufactured by mixing and filling the composition according to the present invention with additives such as excipients in a regular hard capsule
  • soft capsules can be manufactured by mixing and filling the composition according to the present invention. It can be manufactured by mixing with additives such as excipients and filling it with a capsule base such as gelatin.
  • the soft capsule may contain plasticizers such as glycerin or sorbitol, colorants, preservatives, etc., if necessary.
  • prevention refers to all actions that inhibit or delay vascular calcification by administering the composition according to the present invention.
  • treatment refers to any action that improves or beneficially changes the symptoms of vascular calcification by administering the composition according to the present invention.
  • the term “improvement” refers to any action that improves the bad state of vascular calcification by administering the composition according to the present invention.
  • the present invention provides a biomarker composition for diagnosing vascular calcification containing the CaBP9K (calbindin-D9K) protein or its encoding gene as an active ingredient.
  • CaBP9K calbindin-D9K
  • the expression of the protein or the gene encoding it may be increased in vascular smooth muscle cells of patients with vascular calcification.
  • diagnosis means confirming the presence or characteristics of a pathological condition, and for the purposes of the present invention, means confirming vascular calcification, and determining the subject's susceptibility to vascular calcification or at least one symptom thereof. judgment, therametrics (e.g., monitoring the condition of an object to provide information about treatment efficacy), etc. It also includes primary diagnosis of a clinical condition or diagnosis of recurrent disease.
  • biomarker is an indicator that can detect changes in the body, and is a substance that can confirm the normal or pathological state of a living organism and whether there is a change in it, and includes polypeptides, nucleic acids, lipids, glycolipids, It may include organic biomolecules such as glycoproteins and sugars (monosaccharides, disaccharides, oligosaccharides, etc.), and can be used to diagnose vascular calcification as in the present invention.
  • the present invention provides a composition for diagnosing vascular calcification containing as an active ingredient an agent capable of confirming the expression level of the CaBP9K (calbindin-D9K) protein or the gene encoding it.
  • Agents that can confirm the expression level include antibodies, peptides, aptamers, or compounds that specifically bind to the protein; Alternatively, it may be a primer or probe that specifically binds to the gene encoding the protein, but is not limited thereto.
  • a "primer” is a nucleic acid sequence with a short free 3' hydroxyl group, capable of forming base pairs with a complementary template, and serving as a starting point for copying the template strand. refers to a short nucleic acid sequence that Primers can initiate DNA synthesis in the presence of four different nucleotide triphosphates and reagents for polymerization (i.e., DNA polymerase or reverse transcriptase) in an appropriate buffer solution and temperature. PCR conditions and lengths of sense and antisense primers can be appropriately selected according to techniques known in the art.
  • probe refers to a fragment of several to hundreds of base sequences that can specifically bind to a gene or miRNA, and is labeled so that the presence or absence and expression level of the gene can be confirmed. there is. Appropriate probes and hybridization conditions can be appropriately selected according to techniques known in the art.
  • the present invention provides a kit for diagnosing vascular calcification containing the composition for diagnosing vascular calcification as an active ingredient.
  • the kit can be used to diagnose the occurrence of vascular calcification by measuring the expression level of the protein or the gene encoding it in a sample isolated from an individual suspected of having vascular calcification.
  • the kit may include not only an agent for measuring the expression level of the protein or the gene encoding it, but also one or more other component compositions, solutions, or devices suitable for the analysis method.
  • the kit according to the present invention includes genomic DNA derived from a sample to be analyzed to perform PCR, a primer set specific for the marker gene of the present invention, an appropriate amount of DNA polymerase, a dNTP mixture, a PCR buffer solution, and It may be a kit containing water.
  • the PCR buffer solution may include KCl, Tris-HCl, and MgCl 2 .
  • components necessary for performing electrophoresis that can confirm the amplification of the PCR product may be additionally included in the kit of the present invention.
  • the kit according to the present invention may be a kit containing essential elements required to perform RT-PCR.
  • the RT-PCR kit contains test tubes or other suitable containers, reaction buffer, deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNase inhibitors, and DEPC.
  • dNTPs deoxynucleotides
  • -Can include DEPC-water, sterilized water, etc. Additionally, it may include a pair of primers specific to the gene used as a quantitative control.
  • the present invention includes the steps of isolating a biological sample from an individual (first step); and measuring the expression level of the CaBP9K (calbindin-D9K) protein or the gene encoding it in the biological sample isolated in the first step (second step).
  • the biological sample may be vascular smooth muscle cells.
  • Methods for measuring the protein expression level include Western blot, ELISA (enzyme linked immunosorbent assay), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, and rocket.
  • ELISA enzyme linked immunosorbent assay
  • RIA radioimmunoassay
  • Ouchterlony immunodiffusion and rocket.
  • It may be one or more selected from the group consisting of immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay, complement fixation assay, FACS, and protein chip, but is not limited thereto.
  • Methods for measuring the gene expression level include microarray, next generation sequencing (NGS), polymerase chain reaction (PCR), reverse transcription PCR (RT-PCR), and competitive RT-PCR (Competitive PCR). It may be one or more selected from the group consisting of RT-PCR), real-time RT-PCR, RNase protection assay (RPA), Northern blotting, and DNA chip. It is not limited.
  • Ascorbic acid benzoyl peroxide, DMSO (Dimethyl sulfoxide), ethanol, fast red violet LB, glycerol, Naphthol As-Mx phosphate, N,N-dimethylformamide, nitric acid (nitric acid), nonylphenyl-polyethyleneglycol acetate, PFA (Paraformaldehyde), picric acid solution, silver nitrate, sodium acetate, sodium carbonate, sodium thiosulfate and ⁇ -glycerophosphate was purchased from Sigma (St. Louis, MO, U.S.A.).
  • Acetone and formaldehyde solution were purchased from JUNSEI (Nihonbashi-honcho, Chuo-ku, Tokyo).
  • DMEM Dulbecco's Modified Essential Medium
  • Hyclone was purchased from Hyclone, and permount was purchased from Thermo scientific (Rockford, IL, U.S.A.).
  • Fetal bovine serum (FBS) was from GIBCO (Grand Island, NY, U.S.A.)
  • oligo(dT) was from Promega (Madison, WI, USA)
  • penicillin/streptomycin was from Lonza (Rockland, ME, USA).
  • SuperScript II Reverse Transcriptase was purchased from Intron (iNtRON Biotechnology, Gyeinggi-do, Korea), and SYBR green master mixture was purchased from ABI (Carlsbad, CA, U.S.A.).
  • Vascular smooth muscle cells were isolated from the blood vessels of the mice in Experimental Examples 1-4 above, 10% (v/v) FBS, penicillin (100 units/ml), and streptomycin (100 units/ml) were added to DMEM, and incubated at 37°C and 5°C. It was cultured in a constant temperature and humidity incubator under % (v/v) CO 2 conditions. When the culture dish was 100% filled with vascular smooth muscle cells, differentiation was induced by adding ascorbic acid (50 ⁇ g/ml) and ⁇ -glycerophosphate (10mM). During the differentiation period, the differentiation medium was changed every 3 days.
  • ascorbic acid 50 ⁇ g/ml
  • ⁇ -glycerophosphate 10mM
  • CaBP9K -/- 12-week-old male mouse [CaBP9K (NCBI gene ID: 12309) deletion mouse] was obtained from Professor Oh Gu-taek's laboratory at Ewha Mans University. Mice were acclimatized in an SPF (Specific Pathogen Free) laboratory animal room (temperature 25°C and relative humidity 60%) for one week. The feed was regular food, and all animal experiments were conducted in accordance with the guidelines of the Animal Experiment Ethics Committee of Kyungpook National University (animal experiment approval number: KNU-2021-0099).
  • SPF Specific Pathogen Free
  • Vitamin D (6 ⁇ 10 5 IU/Kg) was administered subcutaneously to CaBP9K -/- 12-week-old male mice for 3 days, and the mice were sacrificed on the 9th day after administration to check the degree of vascular calcification.
  • the experimental group was set up as follows.
  • Vascular smooth muscle cells were seeded in a 48-well multi-plate at 5 ⁇ 10 4 cells/well and cultured for 14 days while being replaced with differentiation induction medium 2 days later. It was washed three times with PBS and fixed at room temperature for 10 minutes using 4% formaldehyde as a fixative. It was washed three times using tertiary distilled water, 1% silver nitrate (AgNO 3 ) was added, and then reacted for 5 minutes under UV (Ultraviolet). Afterwards, it was washed several times with PBS and observed under a microscope.
  • AgNO 3 silver nitrate
  • the animal model of Experimental Example 2 was sacrificed, the arteries were isolated, fixed for one day at 4°C using 4% PFA, and then paraffin samples were prepared. The paraffin section was rehydrated, 1% silver nitrate was added, and reacted for 5 minutes under UV light. Afterwards, it was washed twice with tertiary distilled water, and 5% sodium thiosulfate was added and reacted for 5 minutes to remove non-specific signals. Afterwards, counter staining was performed with Eosin, mounting was performed, and analysis was conducted under a microscope.
  • the vascular paraffin section prepared in Experimental Example 3-2 was rehydrated, placed in Tris-EGTA (Tris 1.211g + EGTA 0.19g/ddH 2 O 1L; TEG), boiled in a microwave, retrieval, and slowly cooled at room temperature. .
  • the retrieval sample was blocked with 3% H 2 O 2 /methanol and 1% BSA/PBS solution, and permeabilized with 0.1% Triton X-100.
  • the primary antibody was reacted at 4°C overnight, and the secondary antibody was reacted at room temperature for 1 hour.
  • color was developed using DAB (3,3'-diaminobenzidine) substrate, dehydrated, mounted, and analyzed under a microscope.
  • RNA extraction kit Easy-blue
  • 2 ⁇ g of total RNA was synthesized into cDNA using reverse transcriptase.
  • Real-time PCR was performed by mixing 0.5 ⁇ l of synthesized cDNA with 2 ⁇ SYBR green PCR master mixture (5 ⁇ l) and specific primer (0.2 ⁇ l). Primers used for real-time PCR are listed in Table 1 below. Primers were designed using Primer Express software (ABI).
  • the PBS administration group (WT PBS and CaBP9K -/- PBS) showed no significant change in body weight over time
  • the vitamin D administration group (WT Vitamin D) compared to the PBS administration group.
  • CaBP9K -/- Vitamin D) significantly decreased body weight over time.
  • the weight loss in the CaBP9K deletion model was lower than that in the normal model. From the above results, it was confirmed that when CaBP9K was deleted, weight loss due to vitamin D administration was suppressed.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • General Health & Medical Sciences (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Medical Informatics (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Organic Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicinal Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Optics & Photonics (AREA)
  • Radiology & Medical Imaging (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Surgery (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Genetics & Genomics (AREA)
  • High Energy & Nuclear Physics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Food Science & Technology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Cell Biology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 혈관석회화 치료제 스크리닝 방법에 관한 것으로, 혈관석회화를 유도한 동물모델 중에서, CaBP9K 결실 모델이 정상 모델과 비교해서, 혈관석회화가 개선되는 것을 확인함으로써, 혈관석회화 예방, 치료, 개선 또는 진단용 조성물이나, 혈관석회화 치료제 스크리닝 방법으로써, 유용하게 활용될 수 있다.

Description

혈관석회화 치료제 스크리닝 방법
본 발명은 혈관석회화 치료제 스크리닝 방법에 관한 것이다.
혈관은 체액의 이동을 지속적으로 조절하는 순환기관으로, 산소, 영양분 등을 조직에 공급하고, 이산화탄소나 노폐물을 조직으로부터 받아 처리하는 기능을 한다. 혈관 기능 저하는 심혈관 질환, 혈압, 당뇨병, 알츠하이머병 등 각종 질병을 유발하는 원인이 된다. 그러므로 혈관 건강을 지키는 것이 매우 중요하다. 특히 혈관 석회화는 혈관에 칼슘 및 인산 등의 무기질이 침착되어 혈관의 경직도를 증가시켜 혈관 파열을 초래하여 심혈관 질환 등 다양한 질병을 유발시킨다. 칼슘 축적 억제기 전의 소실, 골 형성 유도, 혈액 내 핵화 복합체 및 세포사멸 등을 혈관 석회화의 주된 원인으로 보고 있으나 그 정확한 기전은 아직까지 밝혀져 있지 않아 그 예방 및 치료제도 아직 개발되어 있지 않다.
이에 따라, 혈관 석회화의 예방, 개선 또는 치료용 조성물에 대한 기술 개발이 필요한 실정이다.
본 발명의 목적은 혈관석회화 치료제 스크리닝 방법을 제공하는 것이다.
본 발명의 다른 목적은 혈관석회화 예방, 개선 또는 치료용 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 혈관석회화 진단용 조성물; 또는 진단용 키트를 제공하는 것이다.
본 발명의 또 다른 목적은 혈관석회화 진단을 위한 정보 제공 방법을 제공하는 것이다.
상기 목적을 달성하기 위해, 본 발명은 혈관석회화 환자군의 세포에 시험물질을 처리하는 단계(제1단계); 상기 제1단계의 시험물질을 처리한 세포에서 CaBP9K(calbindin-D9K) 단백질 또는 이를 코딩하는 유전자의 발현을 측정하는 단계(제2단계); 및 상기 시험물질을 처리하지 않은 혈관석회화 환자군의 세포와 비교해서 상기 CaBP9K 단백질 또는 이를 코딩하는 유전자의 발현을 억제하는 시험물질을 선별하는 단계(제3단계)를 포함하는, 혈관석회화 치료제 스크리닝 방법을 제공한다.
또한, 본 발명은 상기 단백질 또는 이를 코딩하는 유전자의 발현 또는 활성 억제제를 유효성분으로 포함하는 혈관석회화 예방 또는 치료용 약학 조성물을 제공한다.
또한, 본 발명은 상기 단백질 또는 이를 코딩하는 유전자의 발현 또는 활성 억제제를 유효성분으로 포함하는 혈관석회화 예방 또는 개선용 건강기능식품 조성물을 제공한다.
또한, 본 발명은 상기 단백질 또는 이의 코딩하는 유전자를 유효성분으로 포함하는 혈관석회화 진단용 바이오마커 조성물; 상기 단백질 또는 이를 코딩하는 유전자의 발현 수준을 확인할 수 있는 제제를 유효성분으로 포함하는 혈관석회화 진단용 조성물; 및 상기 혈관석회화 진단용 조성물을 유효성분으로 포함하는 혈관석회화 진단용 키트를 제공한다.
또한, 본 발명은 개체로부터 생물학적 시료를 분리하는 단계(제1단계); 및 상기 제1단계에서 분리한 생물학적 시료에서 상기 단백질 또는 이를 코딩하는 유전자의 발현 수준을 측정하는 단계(제2단계)를 포함하는 혈관석회화 진단을 위한 정보 제공 방법을 제공한다.
본 발명에 따르면, 혈관석회화를 유도한 동물모델 중에서, CaBP9K 결실 모델이 CaBP9K가 정상 발현하는 모델과 비교해서, 혈관석회화가 개선되는 것을 확인함으로써, 혈관석회화 예방, 치료, 개선 또는 진단용 조성물이나, 혈관석회화 치료제 스크리닝 방법으로써, 유용하게 활용될 수 있다.
도 1은 CaBP9K가 체중; 및 혈중 칼슘 및 인 농도에 미치는 영향을 분석한 결과이다.
도 2A는 CaBP9K가 신장 내 칼슘 양(무게)에 미치는 영향을 분석한 결과이고, 도 2B는 혈관석회화 유도 모델에서 CaBP9K 발현을 분석한 결과; 및 CaBP9K가 혈관석회화에 미치는 영향을 분석한 결과이다.
도 3은 CaBP9K가 혈관석회화 관련인자의 유전자 발현에 미치는 영향을 분석한 결과이다.
도 4는 CaBP9K가 혈관평활근세포 분화 관련인자의 단백질 발현에 미치는 영향을 분석한 결과이다.
도 5 및 도 6은 CaBP9K 발현이 억제된 혈관평활근세포(CaBP9K 결실 실험모델 유래 혈관평활근세포)에서 혈관석회화가 나타나는지 분석한 결과이다.
이하, 본 발명을 보다 상세하게 설명한다.
본 발명은 혈관석회화 환자군의 세포에 시험물질을 처리하는 단계(제1단계); 상기 제1단계의 시험물질을 처리한 세포에서 CaBP9K(calbindin-D9K) 단백질 또는 이를 코딩하는 유전자의 발현을 측정하는 단계(제2단계); 및 상기 시험물질을 처리하지 않은 혈관석회화 환자군의 세포와 비교해서 상기 CaBP9K 단백질 또는 이를 코딩하는 유전자의 발현을 억제하는 시험물질을 선별하는 단계(제3단계)를 포함하는, 혈관석회화 치료제 스크리닝 방법을 제공한다.
상기 세포는 혈관평활근세포일 수 있다.
본 명세서에서, "시험물질"은 유전자의 발현량에 영향을 미치거나, 단백질의 발현 또는 활성에 영향을 미치는지 여부를 검사하기 위하여 스크리닝에서 이용되는 미지의 후보 물질을 의미한다. 상기 시험물질는 화학물질, 핵산, 안티센스-RNA, siRNA(small interference RNA) 및 천연물 추출물을 포함하나, 이에 한정되는 것은 아니다.
또한, 본 발명은 CaBP9K(calbindin-D9K) 단백질 또는 이를 코딩하는 유전자의 발현 또는 활성 억제제를 유효성분으로 포함하는 혈관석회화 예방 또는 치료용 약학 조성물을 제공한다.
본 발명의 약학 조성물은 당해 발명이 속하는 기술 분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다.
상기 약제학적으로 허용되는 담체는 제제시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸 히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘, 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 본 발명의 약학 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다.
본 발명에 있어서, 상기 약학 조성물에 포함되는 첨가제의 함량은 특별히 한정되는 것은 아니며 통상의 제제화에 사용되는 함량 범위 내에서 적절하게 조절될 수 있다.
상기 약학 조성물은 수용액, 현탁액, 유탁액 등과 같은 주사용 제형, 환약, 캡슐, 과립, 정제, 크림, 젤, 패취, 분무제, 연고제, 경고제, 로션제, 리니멘트제, 파스타제 및 카타플라스마제로 이루어진 군에서 선택된 하나 이상의 피부 외용제 형태로 제형화될 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 약학 조성물은 제형화를 위해 추가로 있는 약학적으로 허용 가능한 담체 및 희석제를 포함할 수 있다. 상기 약학적으로 허용 가능한 담체 및 희석제는 전분, 당 및 만니톨과 같은 부형제, 칼슘 포스페이트 등과 같은 충전제 및 증량제, 카르복시메틸셀룰로오스, 히드록시프로필셀룰로오스 등과 같은 셀룰로오스 유도체, 젤라틴, 알긴산염, 폴리비닐 피롤리돈 등과 같은 결합제, 활석, 스테아린산 칼슘, 수소화 피마자유 및 폴리에틸렌글리콜과 같은 윤활제, 포비돈 및 크로스포비돈과 같은 붕해제, 폴리소르베이트, 세틸알코올, 글리세롤 등과 같은 계면활성제를 포함하나, 이에 한정되지 않는다. 상기 약학적으로 허용 가능한 담체 및 희석제는 대상체에게 생물학적 및 생리학적으로 친화적인 것일 수 있다. 희석제의 예로는 염수, 수용성 완충액, 용매 및/또는 분산제(dispersion media)를 들 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 약학 조성물은 목적하는 방법에 따라 경구 투여하거나 비경구 투여(예를 들어, 정맥 내, 피하, 복강 내 또는 국소에 적용)할 수 있다. 경구 투여일 경우, 정제, 트로키제(troches), 로젠지(lozenge), 수용성 현탁액, 유성 현탁액, 조제 분말, 과립, 에멀젼, 하드 캡슐, 소프트 캡슐, 시럽, 엘릭시르제 등으로 제형화될 수 있다. 비경구 투여일 경우, 주사액, 좌제, 호흡기 흡입용 분말, 스프레이용 에어로졸제, 연고, 도포용 파우더, 오일, 크림 등으로 제형화 될 수 있다.
본 발명의 약학 조성물의 투여량은 환자의 상태, 체중, 연령, 성별, 건강상태, 식이 체질 특이성, 제제의 성질, 질병의 정도, 조성물의 투여시간, 투여방법, 투여기간 또는 간격, 배설율 및 약물 형태에 따라 그 범위가 다양할 수 있으며, 이 분야 통상의 기술자에 의해 적절하게 선택될 수 있다. 예컨대, 약 0.1 내지 10,000mg/kg의 범위일 수 있으나 이제 제한되지 않으며, 하루 일회 내지 수회에 나누어 투여될 수 있다.
상기 약학 조성물은 목적하는 방법에 따라 경구 투여되거나 비경구 투여(예를 들면, 정맥 내, 피하 내, 복강 내 또는 국소에 적용)될 수 있다. 본 발명의 약학 조성물의 약학적 유효량 및 유효 투여량은 약학 조성물의 제제화 방법, 투여 방식, 투여 시간, 투여 경로 등에 의해 다양해질 수 있으며, 당해 기술 분야에서 통상의 지식을 가진 자는 목적하는 치료에 효과적인 투여량을 용이하게 결정하고 처방할 수 있다. 본 발명의 약학 조성물의 투여는 하루에 1회 투여될 수 있고, 수회에 나누어 투여될 수도 있다.
또한, 본 발명은 CaBP9K(calbindin-D9K) 단백질 또는 이를 코딩하는 유전자의 발현 또는 활성 억제제를 유효성분으로 포함하는 혈관석회화 예방 또는 개선용 건강기능식품 조성물을 제공한다.
본 발명은 통상적으로 이용되는 식품으로써 일반적으로 사용될 수 있다.
본 발명의 식품 조성물은 건강기능식품으로서 사용될 수 있다. 상기 “건강기능식품”이라 함은 건강기능 식품에 관한 법률에 따른 인체에 유용한 기능성을 가진 원료나 성분을 사용하여 제조 및 가공한 식품을 의미하며, “기능성”이라 함은 인체의 구조 및 기능에 대하여 영양소를 조절하거나 생리학적 작용 등과 같은 보건용도에 유용한 효과를 얻을 목적으로 섭취하는 것을 의미한다.
상기 건강기능식품 조성물은 통상의 식품 첨가물을 포함할 수 있으며, 상기 “식품 첨가물”로서의 적합 여부는 다른 규정이 없는 한, 식품의약품안전처에 승인된 식품 첨가물 공전의 총칙 및 일반시험법 등에 따라 해당 품목에 관한 규격 및 기준에 의하여 판정한다.
상기 “식품 첨가물 공전”에 수재된 품목으로는 예를 들어, 케톤류, 글리신, 구연산칼륨, 니코틴산, 계피산 등의 화학적 합성물, 감색소, 감초추출물, 결정셀룰로오스, 고량색소, 구아검 등의 천연첨가물, L-글루타민산나트륨 제제, 면류첨가알칼리제, 보존료제제, 타르색소제제 등의 혼합제제류들을 들 수 있다.
본 발명의 식품 조성물은 정제, 캡슐, 분말, 과립, 액상, 환 등의 형태로 제조 및 가공할 수 있다. 예를 들어, 캡슐 형태의 건강기능 식품 중 경질 캡슐제는 통상의 경질 캡슐에 본 발명에 따른 조성물을 부형제 등의 첨가제와 혼합 및 충진 하여 제조할 수 있으며, 연질 캡슐제는 본 발명에 따른 조성물을 부형제 등의 첨가제와 혼합하고 젤라틴 등 캡슐기제에 충진하여 제조할 수 있다. 상기 연질 캡슐제 는 필요에 따라 글리세린 또는 소르비톨 등의 가소제, 착색제, 보존제 등을 함유할 수 있다.
상기 부형제, 결합제, 붕해제, 활택제, 교미제, 착향제 등에 대한 용어 정의 는 당업계에 공지된 문헌에 기재된 것으로 그 기능 등이 동일 내지 유사한 것들을 포함한다. 상기 식품의 종류에는 특별한 제한이 없으며, 통상적인 의미에서의 건강 기능식품을 모두 포함한다.
본 발명에서 용어 “예방”은 본 발명에 따른 조성물의 투여로 혈관석회화를 억제 또는 지연시키는 모든 행위를 말한다.
본 발명에서 용어 “치료”는 본 발명에 따른 조성물의 투여로 혈관석회화의 증세가 호전되거나 이롭게 변경하는 모든 행위를 말한다.
본 발명에서 용어 “개선”은 본 발명에 따른 조성물의 투여로 혈관석회화의 나쁜 상태를 좋게 하는 모든 행위를 말한다.
또한, 본 발명은 CaBP9K(calbindin-D9K) 단백질 또는 이의 코딩하는 유전자를 유효성분으로 포함하는 혈관석회화 진단용 바이오마커 조성물을 제공한다.
상기 단백질 또는 이를 코딩하는 유전자는 혈관석회화 환자군의 혈관평활근세포에서 발현이 증가할 수 있다.
본 명세서에서, “진단(diagnosis)”은 병리 상태의 존재 또는 특징을 확인하는 것으로, 본 발명의 목적상 혈관석회화를 확인하는 것을 의미하며, 혈관석회화 또는 이의 적어도 하나 이상의 증상에 대한 대상의 감수성을 판정하는 것, 테라메트릭스(therametrics)(예를 들어, 치료 효능에 대한 정보를 제공하기 위하여 객체의 상태를 모니터링하는 것) 등을 포함한다. 또한, 임상 상태의 일차 진단 또는 재발한 질병의 진단을 포함한다.
본 명세서에서, “바이오마커(biomarker)”란 몸 안의 변화를 알아낼 수 있는 지표로서, 생명체의 정상 또는 병리적인 상태, 이의 변화 여부 등을 확인할 수 있는 물질로, 폴리펩타이드, 핵산, 지질, 당지질, 당단백질, 당(단당류, 이당류, 올리고당류 등) 등과 같은 유기 생체 분자 등을 포함할 수 있고, 이를 이용하여 본 발명과 같이 혈관석회화를 진단할 수 있다.
또한, 본 발명은 CaBP9K(calbindin-D9K) 단백질 또는 이를 코딩하는 유전자의 발현 수준을 확인할 수 있는 제제를 유효성분으로 포함하는 혈관석회화 진단용 조성물을 제공한다.
상기 발현 수준을 확인할 수 있는 제제는 상기 단백질에 특이적으로 결합하는 항체, 펩타이드, 앱타머 또는 화합물; 또는 상기 단백질을 코딩하는 유전자에 특이적으로 결합하는 프라이머 또는 프로브일 수 있으나, 이에 한정되는 것은 아니다.
본 명세서에서, "프라이머(primer)"는 짧은 자유 3말단 수산화기(free 3' hydroxl group)를 가지는 핵산 서열로, 상보적인 주형과 염기쌍을 형성할 수 있고, 주형 가닥 복사를 위한 시작 시점으로 기능을 하는 짧은 핵산 서열을 의미한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응(즉, DNA polymerase 또는 역전사효소)을 위한 시약 및 상이한 4가지 뉴클레오타이드 트리포스페이트(nucleotide triphosphate)의 존재 하에서 DNA 합성을 개시할 수 있다. PCR 조건, 센스 및 안티센스 프라이머의 길이는 당해 기술 분야에 공지된 기술에 따라 적절히 선택될 수 있다.
본 명세서에서, "프로브(probe)"는 유전자 또는 miRNA와 특이적으로 결합을 이룰 수 있는 수 개 내지 수백 개의 염기서열의 단편을 의미하며, 라벨링 되어있어서 상기 유전자의 존재 유무 및 발현량을 확인할 수 있다. 적절한 프로브 및 혼성화 조건은 당해 기술 분야에 공지된 기술에 따라 적절히 선택될 수 있다.
또한, 본 발명은 상기 혈관석회화 진단용 조성물을 유효성분으로 포함하는 혈관석회화 진단용 키트를 제공한다.
상기 키트는 혈관석회화가 의심되는 개체로부터 분리된 시료에서 상기 단백질 또는 이를 코딩하는 유전자의 발현수준을 측정하여 혈관석회화 발병 여부를 진단하는 데 사용될 수 있다.
또한, 상기 키트는 상기 단백질 또는 이를 코딩하는 유전자 발현수준을 측정하는 제제뿐만 아니라, 분석 방법에 적합한 한 종류 또는 그 이상의 다른 구성 성분 조성물, 용액 또는 장치를 포함할 수 있다.
예를 들어, 본 발명에 따른 키트는 PCR을 수행하기 위해 분석하고자 하는 시료로부터 유래된 게놈 DNA, 본 발명의 마커 유전자에 대해 특이적인 프라이머 세트, 적당량의 DNA 중합 효소, dNTP 혼합물, PCR 완충용액 및 물을 포함하는 키트일 수 있다. 상기 PCR 완충용액은 KCl, Tris-HCl 및 MgCl2를 포함할 수 있다. 이외에 PCR 산물의 증폭 여부를 확인할 수 있는 전기영동 수행에 필요한 구성 성분들이 본 발명의 키트에 추가로 포함될 수 있다.
또한, 본 발명에 따른 키트는 RT-PCR을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있다. RT-PCR 키트는 마커 유전자에 대한 특이적인 각각의 프라이머 쌍 외에도 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액, 데옥시뉴클레오티드(dNTPs), Taq-폴리머레이즈 및 역전사 효소와 같은 효소, DNase, RNase 억제제, DEPC-수(DEPC-water), 멸균수 등을 포함할 수 있다. 또한, 정량 대조군으로 사용되는 유전자에 특이적인 프라이머 쌍을 포함할 수 있다.
또한, 본 발명은 개체로부터 생물학적 시료를 분리하는 단계(제1단계); 및 상기 제1단계에서 분리한 생물학적 시료에서 CaBP9K(calbindin-D9K) 단백질 또는 이를 코딩하는 유전자의 발현 수준을 측정하는 단계(제2단계)를 포함하는 혈관석회화 진단을 위한 정보 제공 방법을 제공한다.
상기 생물학적 시료는 혈관평활근세포일 수 있다.
상기 단백질 발현 수준을 측정하는 방법은 웨스턴블랏, ELISA(enzyme linked immunosorbent asay), 방사선면역분석(Radioimmunoassay; RIA), 방사면역확산법(radioimmunodiffusion), 오우크테로니(Ouchterlony) 면역 확산법, 로케이트(rocket) 면역전기영동, 조직면역염색, 면역침전 분석법(Immunoprecipitation assay), 보체고정분석법(Complement Fixation Assay), FACS 및 단백질 칩으로 이루어진 군에서 선택된 하나 이상일 수 있으나, 이에 한정되는 것은 아니다.
상기 유전자 발현수준을 측정하는 방법은 마이크로어레이(microarray), 차세대 염기서열 분석(Next generation sequencing; NGS), 중합효소연쇄반응(PCR), RT-PCR(Reverse transcription PCR), 경쟁적 RT-PCR(Competitive RT-PCR), 실시간 RT-PCR(Real-time RT-PCR), RNase 보호 분석법(RPA; RNase protection assay), 노던 블랏팅(Northern blotting) 및 DNA 칩으로 이루어진 군에서 선택된 하나 이상일 수 있으나, 이에 한정되는 것은 아니다.
이하, 본 발명의 이해를 돕기 위하여 실시예를 들어 상세하게 설명하기로 한다. 다만, 하기의 실시예는 본 발명의 내용을 예시하는 것일 뿐 본 발명의 범위가 하기 실시예에 한정되는 것은 아니다. 본 발명의 실시예는 당업계에서 평균적인 지식을 가진 자에게 본 발명을 보다 완전하게 설명하기 위해 제공되는 것이다.
[ 실험예 1] 실험 준비
1-1. 시약
아스코브르산(Ascorbic acid), 벤조일 퍼옥사이드(benzoyl peroxide), DMSO(Dimethyl sulfoxide), 에탄올(ethanol), fast red violet LB, 글리세롤(glycerol), Naphthol As-Mx phosphate, N,N-dimethylformamide, 질산(nitric acid), nonylphenyl-polyethyleneglycol acetate, PFA(Paraformaldehyde), 피크르산 용액(picric acid solution), 질산은(silver nitrate), 아세트산나트륨(sodium acetate), 탄산나트륨(sodium carbonate), 티오황산나트륨(sodium thiosulfate) 및 β-glycerophosphate는 Sigma(St. Louis, MO, U.S.A)에서 구입하였다. 아세톤(Acetone) 및 포름알데하이드 용액(formaldehyde solution)은 JUNSEI(Nihonbashi-honcho, Chuo-ku, Tokyo)에서 구입하였다. DMEM(Dulbecco's Modified Essential Medium)은 Hyclone에서, permount는 Thermo scientific(Rockford, IL, U.S.A)에서 구입하였다. FBS(Fetal bovine serum)는 GIBCO(Grand Island, NY, U.S.A)에서, oligo(dT)는 Promega(Madison, WI, USA)에서, 페니실린/스트렙토마이신(penicillin/streptomycin)은 Lonza(Rockland, ME, USA)에서, SuperScript Ⅱ Reverse Transcriptase는 Intron(iNtRON Biotechnology, Gyeinggi-do, Korea)에서, SYBR green master mixture는 ABI(Carlsbad, CA, U.S.A)에서 구입하였다.
1-2. 실험기기
Real-time PCR은 ViiA7(Applied Biosystems, CA, USA)을 사용하였고, DNA 및 RNA 정량은 Nano drop 2000을 사용했으며, 배양기(Incubator)는 Thermo scientific(Rockford, IL, USA)을 사용하였다. 단백질 정량은 ELISA reader(TECAN, Mannedorf, Switzerland)를 사용하였다.
1-3. 세포
혈관평활근세포는 상기 실험예 1-4의 마우스의 혈관에서 분리하고, DMEM에 10%(v/v) FBS, 페니실린(100units/㎖) 및 스트렙토마이신(100units/㎖)을 넣고, 37℃ 및 5%(v/v) CO2 조건의 항온항습배양기에서 배양하였다. 혈관평활근세포가 배양접시에 100% 채워졌을 때 아스코브르산(50㎍/㎖) 및 β-glycerophosphate(10mM)를 첨가하여 분화를 유도하였다. 분화기간 동안 분화배지는 3일마다 교체해 주었다.
1-4. 실험동물
CaBP9K-/- 12주령 수컷 마우스[CaBP9K(NCBI gene ID : 12309) 결실 마우스]는 이화여대 오구택 교수님 연구실에서 분양받아 사용하였다. 마우스를 SPF(Specific Pathogen Free) 실험동물 사육실(온도 25℃ 및 상대습도 60%)에서 1주일간 적응시켰다. 사료는 일반식을 주었으며, 모든 동물실험은 경북대학교 동물실험윤리위원회 가이드라인에 따라 수행하였다(동물실험승인번호 : KNU-2021-0099).
[ 실험예 2] 혈관석회화 유도 동물모델 제작
혈관석회화 유도 동물모델을 하기와 같이 제작하였다. CaBP9K-/- 12주령 수컷 마우스 피하에 비타민 D(6×105 IU/Kg)를 3일간 투여하고, 투여한 지 9일째 되는 날 마우스를 희생하여 혈관석회화 정도를 확인하였다. 비교를 위해, 하기와 같이 실험군을 설정하였다.
1) PBS 투여(9.1㎕/g) 정상 마우스(WT)(n=3)
2) 비타민 D 투여(6×105 IU/Kg) 정상 마우스(WT)(n=3)
3) PBS 투여(9.1㎕/g) CaBP9K 결실 마우스(CaBP9K-/-)(n=3)
4) 비타민 D 투여(6×105 IU/Kg) CaBP9K 결실 마우스(CaBP9K-/-)(n=3)
[ 실험예 3] Von kossa 염색
3-1. in vitro
혈관평활근세포를 48-웰 멀티 플레이트에 5×104 cells/well 씩 심고 2일 후에 분화유도배지로 교체해 주면서 14일 동안 배양하였다. PBS로 3회 세척하고, 고정액으로 4% 포름알데하이드(formaldehyde)를 이용하여 10분 동안 상온에서 고정하였다. 3차 증류수를 이용하여 3회 세척하고, 1% 질산은(AgNO3)을 첨가한 후, UV(Ultraviolet) 아래에서 5분 동안 반응시켰다. 그 후, PBS로 수차례 세척하고, 현미경으로 관찰하였다.
3-2. ex vivo
상기 실험예 2의 동물모델을 희생하여 동맥을 분리하고, 4% PFA를 이용하여 4℃에서 하루 고정한 후, 파라핀 샘플을 제조하였다. 파라핀 절편을 재수화(rehydration)하고, 1% 질산은을 첨가한 후, UV 아래에서 5분 동안 반응시켰다. 그 후, 3차 증류수로 2번 세척하고, 5% 티오황산나트륨을 첨가하여 5분 동안 반응시켜 비특이적인 신호를 제거하였다. 그 후, 에오신(Eosin)으로 counter 염색을 하고 마운팅(mounting) 후 현미경으로 분석하였다.
[ 실험예 4] ELISA
상기 실험예 2의 동물모델의 혈중 칼슘 및 인의 농도를 확인하기 위해, ELISA를 수행하였다. 모든 실험 절차는 cloud clone(WUHAN, PRC)의 표준 메뉴얼에 따라 수행하였다.
[ 실험예 5] 조직면역학 염색
상기 실험예 3-2에서 제조한 혈관파라핀 절편을 재수화하고, Tris-EGTA(Tris 1.211g + EGTA 0.19g/ddH2O 1L; TEG) 용액에 넣은 후 전자레인지에 끓여 retrieval 하고 상온에서 천천히 식혔다. Retrieval된 샘플을 3% H2O2/메탄올 및 1% BSA/PBS 용액으로 블로킹(blocking)하고, 0.1% Tr iton X-100로 permeabilization시켰다. 그 후, 1차 항체를 4℃에서 하룻밤 동안 반응시키고, 2차 항체를 상온에서 1시간 반응시켰다. 마지막으로 DAB(3,3'-diaminobenzidine) substrate를 이용하여 발색시키고, 탈수하여 마운팅(mounting)하고 현미경으로 분석하였다.
[ 실험예 6] 웨스턴 블롯
혈관평활근세포 분화 관련인자의 단백질 발현을 확인하기 위해, 웨스턴 블롯(western blot)을 수행하였다. 혈관평활근세포 분화를 유도한지 8일, 15일 및 28일째에 단백질을 추출하여 bradford 방법으로 단백질을 정량화하고, 단백질을 20㎍을 8% 및 15% 아크릴아마이드(Acrylamide) 젤에 로딩하였다. 5% 탈지유를 이용하여 1시간 동안 블로킹(blocking)하고, TBS-T(0.1% tween 20/Tris-buffered saline)로 5분씩 3번 세척한 후, 1차 항체를 상온에서 1시간 30분 반응시켰다. 그 후, TBST로 3번 세척하고, 2차 항체를 상온에서 1시간 반응시킨 후, ECL 용액을 이용하여 발색하여 단백질 발현 양을 분석하였다.
[ 실험예 7] Real-time PCR
혈관석회화 관련인자의 유전자 발현을 확인하기 위해, Real-time PCR을 수행하였다. RNA 추출 키트(Easy-blue)를 이용하여 total RNA를 추출하고, 2㎍의 Total RNA을 역전사효소를 이용하여 cDNA로 합성하였다. 합성된 cDNA 0.5㎕에 2×SYBR green PCR master mixture(5㎕) 및 특이적 프라이머(specific primer, 0.2㎕)를 섞어서 real-time PCR을 수행하였다. Real-time PCR에 사용한 프라이머는 하기 표 1과 같다. 프라이머는 Primer Express software(ABI)를 이용하여 디자인하였다.
프라이머 방향 서열
mBMP2 Forward CCGCTCCACAAACGAGAAAA
Reverse ACCCCACATCACTGAAGTCCAC
mBMP4 Forward TGAGCCTTTCCAGCAAGTTTGT
Reverse CGGTTACCAGGAATCATGGTGT
mMGP Forward ACACCTTTATGTCCCCTCAGCA
Reverse ATCGCAGGCCTCTCTGTTGAT
mOPN Forward GATCAGGACAACAACGGAAACG
Reverse CACTCTCCTGGCTCTCTTTGGA
mGapdh Forward TGTGTCCGTCGTGGATCTGA
Reverse CCTGCTTCACCACCTTCTTGA
mRankL Forward GATTTTTCAAGCTCCGAGCTGG
Reverse CCTGAACTTTGAAAGCCCCAA
mOpg Forward ACTCGAACCTCACCACAGAGCA
Reverse CGCTCGATTTGCAGGTCTTTC
mRunx1 Forward CAGGCAGATCCAGCCATC
Reverse TTGAGAGTCGACTGGAAAGTTCT
mRunx2 Forward GCACAAACATGGCCAGATTCA
Reverse AAGCCATGGTGCCCGTTAG
mSmmhc Forward GCGCAATACCACGCCTAACTT
Reverse AGATGCGGATGCCTTCCAA
[ 실시예 1] CaBP9K가 신체에 미치는 영향 분석
1-1. 체중 분석
CaBP9K가 체중에 미치는 영향을 분석한 결과, 도 1A와 같이, PBS 투여군(WT PBS 및 CaBP9K-/- PBS)은 시간에 따른 유의한 체중 변화는 나타나지 않았고, PBS 투여군 대비 비타민 D 투여군(WT Vitamin D 및 CaBP9K-/- Vitamin D)은 시간에 따라 체중이 유의하게 감소하였다. 구체적으로, 비타민 D 투여군 중에서는 정상모델 대비 CaBP9K 결실 모델의 체중 감소폭이 더 낮게 나타났다. 상기 결과로부터, CaBP9K 결실 시, 비타민 D 투여에 의한 체중 감소가 억제되는 것을 확인하였다.
1-2. 혈중 칼슘 및 인 농도 분석
CaBP9K가 혈중 칼슘 및 인 농도에 미치는 영향을 분석한 결과, 도 1B와 같이, PBS 투여군 대비 비타민 D 투여군에서 혈중 칼슘 농도가 유의하게 증가하였고, 비타민 D 투여군 중에서는 정상모델 대비 CaBP9K 결실 모델의 혈중 칼슘 농도가 유의하게 낮았다. 또한, 혈중 인 농도는 모든 실험군간 유의한 차이는 나타나지 않았다. 상기 결과로부터, CaBP9K 결실 시, 비타민 D에 의한 혈중 칼슘 농도 증가가 억제되는 것을 확인하였다.
[ 실시예 2] CaBP9K가 혈관석회화에 미치는 영향 분석
2-1. 신장 내 칼슘 양(무게) 분석
CaBP9K가 신장 내 칼슘 양(무게)에 미치는 영향을 분석한 결과, 도 2A와 같이, 비타민 D 투여군에서 신장 내 칼슘 양(무게)이 증가하였고, 비타민 D 투여군 중에서는 정상모델 대비 CaBP9K 결실 모델의 신장 내 칼슘 양(무게)이 유의하게 낮았다. 상기 결과로부터, CaBP9K 결실 시, 비타민 D에 의한 신장 내 칼슘 증가가 억제되는 것을 확인하였다.
2-2. 혈관석회화 유도 모델에서 CaBP9K 발현 분석
혈관석회화 유도 모델에서 CaBP9K 발현을 분석한 결과, 도 2B와 같이, 정상모델 중에서 비타민 D 미투여군 대비 비타민 D 투여군의 혈관에서 CaBP9K 발현이 유의하게 증가하였다. 또한, CaBP9K가 혈관석회화에 미치는 영향을 분석한 결과, 도 2B와 같이, CaBP9K 결실 모델에서 혈관석회화 증상이 억제되는 것을 Von Kossa 염색을 통해 확인하였다. 상기 결과로부터, 비타민 D에 의한 혈관석회화 유도 모델에서 CaBP9K 발현이 증가하고, CaBP9K 결실 시, 비타민 D에 의한 혈관석회화가 억제되는 것을 확인하였다.
2-3. 혈관석회화 관련인자의 유전자 발현 분석
CaBP9K가 혈관석회화 관련인자의 유전자 발현에 미치는 영향을 분석한 결과, 도 3과 같이, PBS 투여군 대비 비타민 D 투여군에서 VDR, Runx2 및 OPN(Osteoponin) 유전자 발현이 유의하게 증가하였고, 비타민 D 투여군 중에서는 정상모델 대비 CaBP9K 결실 모델에서 상기 3종의 유전자 발현이 더 낮게 나타났다. 또한, SMMHC(Smooth muscle myosin heavy chain) 유전자의 경우, 비타민 D 투여군 중에서 정상모델 대비 CaBP9K 결실 모델에서 SMMHC 발현이 유의하게 높게 나타났다. 또한, MGP(matrix Gla protein)의 경우, 정상모델에서 비타민 D 투여에 의해 MGP 발현이 유의하게 증가하였고, 비타민 D 투여군 중에서는 정상모델 대비 CaBP9K 결실 모델에서 SMMHC 발현이 유의하게 낮았다.
2-4. 혈관평활근세포 분화 관련인자의 단백질 발현 분석
CaBP9K가 혈관평활근세포 분화 관련인자의 단백질 발현에 미치는 영향을 분석한 결과, 도 4와 같이, 정상모델 대비 CaBP9K 결실 모델의 혈관에서 Runx2 및 BMP2의 신호전달인자인 P-smad1/5/8 발현이 유의하게 증가하였다.
2-5. CaBP9K 유무에 따른 혈관평활근세포에서 혈관석회화 여부 분석
CaBP9K 발현이 억제된 혈관평활근세포(CaBP9K 결실 실험모델 유래 혈관평활근세포)에서 혈관석회화가 나타나는지 분석한 결과, 도 5 및 도 6과 같이, 비타민 D 투여군 중에서 정상모델 유래 세포 대비 CaBP9K 결실 모델 유래 세포에서 Runx2, BMP2 및 RANKL/OPG 발현이 유의하게 감소하였고, Runx2 및 BMP2 신호전달인자인 P-smad1/5 발현이 유의하게 감소하는 등, 혈관석회화가 개선되는 것을 확인하였다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 즉, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다.

Claims (13)

  1. 혈관석회화 환자군의 세포에 시험물질을 처리하는 단계(제1단계);
    상기 제1단계의 시험물질을 처리한 세포에서 CaBP9K(calbindin-D9K) 단백질 또는 이를 코딩하는 유전자의 발현을 측정하는 단계(제2단계); 및
    상기 시험물질을 처리하지 않은 혈관석회화 환자군의 세포와 비교해서 상기 CaBP9K 단백질 또는 이를 코딩하는 유전자의 발현을 억제하는 시험물질을 선별하는 단계(제3단계)를 포함하는, 혈관석회화 치료제 스크리닝 방법.
  2. 제1항에 있어서, 상기 세포는 혈관평활근세포인 것을 특징으로 하는 스크리닝 방법.
  3. CaBP9K(calbindin-D9K) 단백질 또는 이를 코딩하는 유전자의 발현 또는 활성 억제제를 유효성분으로 포함하는 혈관석회화 예방 또는 치료용 약학 조성물.
  4. CaBP9K(calbindin-D9K) 단백질 또는 이를 코딩하는 유전자의 발현 또는 활성 억제제를 유효성분으로 포함하는 혈관석회화 예방 또는 개선용 건강기능식품 조성물.
  5. CaBP9K(calbindin-D9K) 단백질 또는 이의 코딩하는 유전자를 유효성분으로 포함하는 혈관석회화 진단용 바이오마커 조성물.
  6. 제5항에 있어서, 상기 단백질 또는 이를 코딩하는 유전자는 혈관석회화 환자군의 혈관평활근세포에서 발현이 증가하는 것을 특징으로 하는 바이오마커 조성물.
  7. CaBP9K(calbindin-D9K) 단백질 또는 이를 코딩하는 유전자의 발현 수준을 확인할 수 있는 제제를 유효성분으로 포함하는 혈관석회화 진단용 조성물.
  8. 제7항에 있어서, 상기 발현 수준을 확인할 수 있는 제제는 상기 단백질에 특이적으로 결합하는 항체, 펩타이드, 앱타머 또는 화합물; 또는 상기 단백질을 코딩하는 유전자에 특이적으로 결합하는 프라이머 또는 프로브인 것을 특징으로 하는 진단용 조성물.
  9. 제7항 또는 제8항 중 어느 한 항의 조성물을 유효성분으로 포함하는 혈관석회화 진단용 키트.
  10. 개체로부터 생물학적 시료를 분리하는 단계(제1단계); 및
    상기 제1단계에서 분리한 생물학적 시료에서 CaBP9K(calbindin-D9K) 단백질 또는 이를 코딩하는 유전자의 발현 수준을 측정하는 단계(제2단계)를 포함하는 혈관석회화 진단을 위한 정보 제공 방법.
  11. 제10항에 있어서, 상기 생물학적 시료는 혈관평활근세포인 것을 특징으로 하는 정보 제공 방법.
  12. 제10항에 있어서, 상기 단백질 발현 수준을 측정하는 방법은 웨스턴블랏, ELISA(enzyme linked immunosorbent asay), 방사선면역분석(Radioimmunoassay; RIA), 방사면역확산법(radioimmunodiffusion), 오우크테로니(Ouchterlony) 면역 확산법, 로케이트(rocket) 면역전기영동, 조직면역염색, 면역침전 분석법(Immunoprecipitation assay), 보체고정분석법(Complement Fixation Assay), FACS 및 단백질 칩으로 이루어진 군에서 선택된 하나 이상인 것을 특징으로 하는 정보 제공 방법.
  13. 제10항에 있어서, 상기 유전자 발현수준을 측정하는 방법은 마이크로어레이(microarray), 차세대 염기서열 분석(Next generation sequencing; NGS), 중합효소연쇄반응(PCR), RT-PCR(Reverse transcription PCR), 경쟁적 RT-PCR(Competitive RT-PCR), 실시간 RT-PCR(Real-time RT-PCR), RNase 보호 분석법(RPA; RNase protection assay), 노던 블랏팅(Northern blotting) 및 DNA 칩으로 이루어진 군에서 선택된 하나 이상인 것을 특징으로 하는 정보 제공 방법.
PCT/KR2023/014445 2022-09-27 2023-09-21 혈관석회화 치료제 스크리닝 방법 WO2024071848A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20220122574 2022-09-27
KR10-2022-0122574 2022-09-27
KR1020230126066A KR20240043697A (ko) 2022-09-27 2023-09-21 혈관석회화 치료제 스크리닝 방법
KR10-2023-0126066 2023-09-21

Publications (1)

Publication Number Publication Date
WO2024071848A1 true WO2024071848A1 (ko) 2024-04-04

Family

ID=90478540

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/014445 WO2024071848A1 (ko) 2022-09-27 2023-09-21 혈관석회화 치료제 스크리닝 방법

Country Status (1)

Country Link
WO (1) WO2024071848A1 (ko)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2008530227A (ja) * 2005-02-16 2008-08-07 ザ リージェンツ オブ ザ ユニバーシティ オブ カリフォルニア 骨状態を治療または予防する薬剤組成物
KR20160087037A (ko) * 2015-01-12 2016-07-21 전남대학교산학협력단 혈관석회화 방지용 조성물 및 이를 포함하는 혈관 석회화 치료제
KR20210018423A (ko) * 2018-06-08 2021-02-17 에피존 파마 인코포레이티드 조직 석회화의 예방 또는 치료를 위한 방법 및 조성물
KR20210120870A (ko) * 2020-03-26 2021-10-07 경북대학교 산학협력단 Pannexin3을 포함하는 혈관 석회화 진단용 바이오마커 조성물 및 이를 이용한 진단방법

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2008530227A (ja) * 2005-02-16 2008-08-07 ザ リージェンツ オブ ザ ユニバーシティ オブ カリフォルニア 骨状態を治療または予防する薬剤組成物
KR20160087037A (ko) * 2015-01-12 2016-07-21 전남대학교산학협력단 혈관석회화 방지용 조성물 및 이를 포함하는 혈관 석회화 치료제
KR20210018423A (ko) * 2018-06-08 2021-02-17 에피존 파마 인코포레이티드 조직 석회화의 예방 또는 치료를 위한 방법 및 조성물
KR20210120870A (ko) * 2020-03-26 2021-10-07 경북대학교 산학협력단 Pannexin3을 포함하는 혈관 석회화 진단용 바이오마커 조성물 및 이를 이용한 진단방법

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
"Master's thesis", 1 January 2010, KYUNGPOOK NATIONAL UNIVERSITY, Korea, article CHE, XIANG GUO: "Functional Analyses of Calbindin-D9K and Calbindin-D28K in Skeletal and Non-skeletal Tissues", pages: 1 - 30, XP009554326 *

Similar Documents

Publication Publication Date Title
Xia et al. Hypoxia/ischemia promotes CXCL10 expression in cardiac microvascular endothelial cells by NFkB activation
WO2016137037A1 (ko) Dpp-4 억제제를 포함하는 판막 석회화의 예방 또는 치료용 조성물
EP3156074B1 (en) Composition for preventing or treating fracture or osteoporosis using slit-robo system
WO2020046045A1 (ko) 난소의 ｆｓｈ에 대한 반응성의 진단 또는 예측용 바이오마커 및 이의 용도
Liu et al. Senolytic elimination of senescent macrophages restores muscle stem cell function in severely dystrophic muscle
WO2018131909A1 (ko) 뇌신경계 질환의 치료 또는 진단을 위한 표적 단백질로서 pcnt
Tsukada et al. Mid-pregnancy maternal immune activation increases Pax6-positive and Tbr2-positive neural progenitor cells and causes integrated stress response in the fetal brain in a mouse model of maternal viral infection
WO2018105921A2 (ko) 지방간의 진단 또는 치료를 위한 류신 지퍼 단백질의 용도
WO2024071848A1 (ko) 혈관석회화 치료제 스크리닝 방법
CN107326067A (zh) 一种非酒精性脂肪肝的miRNA标记物
WO2013165061A1 (ko) Ｓｃｆ 또는 이의 수용체를 억제하는 물질을 포함하는 혈관 투과성 관련 질환의 치료 또는 예방용 조성물
WO2024063484A1 (ko) CBFβ 발현 혈관평활근세포 또는 이의 배양액을 유효성분으로 포함하는 노인성 질환 예방 또는 치료용 약학 조성물
WO2022025387A1 (ko) Microrna조합을 이용한 비알코올 지방간염 진단용 바이오마커
Li et al. Total flavones from Sceptridium ternatum alleviate pulmonary hypertension through inhibiting the proliferation of vascular endothelial cells
Fujiwara et al. Soyasapogenols contained in soybeans suppress tumour progression by regulating macrophage differentiation into the protumoural phenotype
KR20240043697A (ko) 혈관석회화 치료제 스크리닝 방법
WO2021080396A1 (ko) Rspo3 억제제를 포함하는 심장 판막 질환의 예방 또는 치료용 조성물
WO2015056970A1 (ko) 프로그래뉼린 억제제를 유효성분으로 함유하는 골다공증 예방 또는 치료용 조성물
KR20240045092A (ko) miR-191-5p 억제제를 유효성분으로 포함하는 장 누수 증후군 예방 또는 치료용 약학 조성물
WO2023101316A1 (ko) Axl을 포함하는 지방간 예방 또는 치료용 조성물
Zielińska et al. Effect of amygdalin on MCF-7, MDA-MB-231 and T-47D breast cancer cells in the in vitro study
KR20240040635A (ko) Cbfβ 발현 혈관평활근세포 또는 이의 배양액을 유효성분으로 포함하는 노인성 질환 예방 또는 치료용 약학 조성물
Ma et al. The effect of the α7nAChR agonist on Wnt/β-catenin signaling in osteoporosis
KR102624632B1 (ko) SARS-CoV-2 감염 질환 중증도 진단 또는 예후 예측용 바이오마커
WO2022045768A1 (ko) 당뇨병 치료제에 대한 약물반응성 예측용 마이크로 rna 바이오마커 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23872965

Country of ref document: EP

Kind code of ref document: A1