WO2024054048A1 - 자가 환형화 rna 구조체 - Google Patents

자가 환형화 rna 구조체 Download PDF

Info

Publication number
WO2024054048A1
WO2024054048A1 PCT/KR2023/013376 KR2023013376W WO2024054048A1 WO 2024054048 A1 WO2024054048 A1 WO 2024054048A1 KR 2023013376 W KR2023013376 W KR 2023013376W WO 2024054048 A1 WO2024054048 A1 WO 2024054048A1
Authority
WO
WIPO (PCT)
Prior art keywords
region
self
rna
igs
circularizing
Prior art date
Application number
PCT/KR2023/013376
Other languages
English (en)
French (fr)
Inventor
이성욱
이경현
김성철
Original Assignee
알지노믹스 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 알지노믹스 주식회사 filed Critical 알지노믹스 주식회사
Publication of WO2024054048A1 publication Critical patent/WO2024054048A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/12—Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
    • C12N2310/128—Type of nucleic acid catalytic nucleic acids, e.g. ribozymes processing or releasing ribozyme
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/50—Physical structure
    • C12N2310/53—Physical structure partially self-complementary or closed
    • C12N2310/532—Closed or circular
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/42—Vector systems having a special element relevant for transcription being an intron or intervening sequence for splicing and/or stability of RNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00—Vectors comprising a special translation-regulating system
    • C12N2840/20—Vectors comprising a special translation-regulating system translation of more than one cistron
    • C12N2840/203—Vectors comprising a special translation-regulating system translation of more than one cistron having an IRES

Definitions

  • the present invention relates to RNA structures with improved self-circularization efficiency.
  • Circular RNA (circRNA, cRNA) is a covalently linked single-stranded transcript, and more than tens of thousands of types of circRNAs have been identified in various living organisms through RNA-seq data and newly developed bioinformatics approaches. It is known that in eukaryotes, circRNA is produced through back-splicing from mRNA and can regulate gene expression by performing a microRNA sponge function in vivo. It is not known whether circRNA causes immunogenicity, and due to its structural properties, it exists very stably in vivo.
  • mRNA messenger RNA
  • US 10,953,033 discloses circRNA for the purpose of gene expression in vivo based on the structural characteristics of circRNA.
  • the technical problem to be achieved by the present invention is to provide an RNA structure that is circularized by independently performing targeting and splicing reactions.
  • the present invention provides a self-circularizing RNA structure having the following structure:
  • the IGS region forms a guanine (G): uracil (U) wobble base pair with the target site, and the guanine forming the wobble base pair is of the IGS region.
  • Uracil which is located at the 5' end and forms the wobble base pair, is located at the 3' end of the target site region, and the IGS region may be composed of adenine (A) or uracil other than the bases that form the wobble base pair.
  • the IGS region includes or consists of the base sequence of 5'-GNNNNN-3', and the target site region includes 5'-N'N'N'N'U-3 It may contain or consist of the base sequence of '.
  • N of the IGS region and N' of the target site region may each independently be A or U, and in this case, the IGS region may include A and U in a 2:3 or 3:2 ratio.
  • the nucleotide sequence of the IGS region may be reverse complementary to the nucleotide sequence of the target site region, excluding the guanine.
  • the ribozyme may be a Group I intron ribozyme, and the ribozyme may include or consist of the base sequence of SEQ ID NO: 6.
  • the structure may include nucleotides extending in the 5' direction of the IGS region to form a P1 helix and a P10 helix, where the P1 helix extends in the 3' direction of the target site. It is formed in the region where complementary binding between the IGS region and the target site occurs with nucleotides, and the P10 helix is a nucleotide extended in the 5' direction of the IGS region that is reverse complementary to the extended nucleotide located between the ribozyme and the GOI region. It can be formed in a region where complementary binding to the sequence occurs.
  • the length of the extended nucleotide forming the P1 helix may be 3-nt
  • the length of the extended nucleotide forming the P10 helix may be 6-nt.
  • the structure may form a P1 helix but not a P10 helix.
  • the structure may include a region capable of complementary binding to each other at the 5' end and the 3' end, and an antisense binding sequence (ABS) region.
  • ABS antisense binding sequence
  • the ABS region may consist of a reverse complementary sequence to the AS region.
  • the length of the AS region may vary depending on the GOI, but may be 10 to 500-nt, preferably more than 50-nt but less than 400-nt, more preferably 150-350 nt. there is.
  • the GOI region may include an IRES (internal ribosome entry site) region at the 5' end, and may include an initiation codon and a termination codon.
  • IRES internal ribosome entry site
  • the structure may further include a spacer region consisting of a random base sequence, and the spacer region is located between the IGS region and the target gene region and/or between the target gene region and the target site. It can be located between areas.
  • the spacer region may include or consist of poly(A), where poly(A) is a polynucleotide in which adenine (A) is repeatedly linked, and A is repeated 10 to 50 times. It may be connected repeatedly, and preferably may be connected repeatedly 30 times.
  • the self-circulating RNA construct of the present invention can be expressed in a DNA vector and circularized through a self-targeting & splicing reaction without separate GTP treatment to form circRNA.
  • the circRNA may be composed of only a target gene, and the above purpose Genes have the advantage of being able to quickly express peptides or proteins by including an IRES region, start codon, and stop codon.
  • circRNA has a circular structure and its 5' and 3' ends are not exposed, so it is stable and has a high half-life. It is used for various purposes such as miRNA, anti-miRNA, shRNA, aptamer, mRNA vaccine, mRNA therapeutic, antibody, vaccine adjuvant, CAR-T.
  • Functional RNA such as mRNA, genome, or RNA editing-inducing RNA, can be manufactured into circRNA to ensure high stability within cells.
  • FIGS 1a and 1b are schematic diagrams of the process in which the self-circularizing RNA construct of the present invention, which contains only the IGS, ribozyme, target gene, and target site region, is formed into circRNA by self-targeting and splicing (STS) reaction.
  • STS self-targeting and splicing
  • Figure 2a is a schematic diagram of the process in which the self-circulating RNA structure of the present invention, including AS, IGS, ribozyme, gene of interest, target site, and ABS region, is formed into circRNA by STS reaction.
  • Figure 2b shows the self-circularizing RNA of the present invention, which includes an IRES and a stop codon in the target gene region to enable translation of the transgene, and additionally includes nucleotides extended in the 5' direction to form a P1 helix and a P10 helix.
  • This is a schematic diagram of the structure and the process by which the structure is formed into circRNA by the STS reaction.
  • Figure 2c shows one form of the self-circulating RNA structure of the present invention.
  • Figure 2d shows the DNA template base sequence for producing the self-circularizing RNA construct expression vector of the present invention.
  • Figure 3 shows the results of electrophoresis on a polyacrylamide gel to confirm whether circRNA is generated immediately after in vitro transcription of the self-circulating RNA construct expression vector of the present invention without additional GTP treatment.
  • Figure 4 verifies that Candidate 1, which is presumed to be a circRNA in the results of Figure 3, is a circRNA.
  • Figure 4a is the result of extracting RNA from the candidate 1 band and performing RT-PCR
  • Figure 4b is the result of extracting RNA from the candidate 1 band. This is the result of base sequence analysis of extracted RNA.
  • Figure 5 shows the verification that the RNA of the candidate 1 band in the results of Figure 4 is a monomer.
  • RNA was extracted from the candidate 1 and 2 bands, which are presumed to be circRNAs in the results of Figure 3, and treated with Mg 2+ to induce nick. This is the result of electrophoresis.
  • Figure 6 shows the results of confirming whether the self-circulating RNA construct expression vector of the present invention produces circRNA within the cell and the transgene containing the circRNA is expressed.
  • Figure 6a shows the structure of the self-circulating RNA construct expression vector
  • Figure 6b shows the results confirming the expression of the transgene through luciferase activity assay
  • Figures 6c and 6d verify that the transgene was expressed from circRNA. This is the result of RP-PCR and base sequence analysis.
  • Figures 7 and 8 show circRNA purification conditions and purification results through HPLC.
  • Figure 7a shows the HPLC analysis conditions using the Ultra HPLC system
  • Figure 7b shows the results of column purification of a sample obtained immediately after in vitro transcription
  • Figure 7c shows the results of column purification after treating the sample with RNase R. am
  • Figure 8a shows the results of confirming peaks in the fractions obtained through column purification
  • Figure 8b shows the electrophoresis results of fractions 7, 10, 11, 12, and 13 with prominent peaks in Figure 8a.
  • Figures 9 and 10 confirm the effect of the AS region on the STS reaction and circularization in the self-circulating RNA construct of the present invention.
  • Figure 9 shows the structures of self-circulating RNA containing AS regions of different lengths
  • Figure 10 shows electrophoresis results of samples obtained after in vitro transcription of the vector expressing the RNA.
  • Figures 11 and 12 confirm the effect of the spacer region on the STS reaction and circularization in the self-cycling and RNA structures of the present invention.
  • Figure 11 shows the control spacer and poly(A) spacers of various lengths. This is the structure of the self-circulating RNA containing the RNA, and
  • Figure 12 shows the electrophoresis results of the sample obtained after in vitro transcription of the vector expressing the RNA.
  • Figure 13 shows self-circularized RNA containing only the P1 region; Self-circularizing RNA containing only the P1 and P10 regions; and self-circulating RNA including the P1 region, P10 region, and AS region; the base sequence and each region near the region cleaved by the ribozyme are indicated.
  • Figure 14 is the base sequence of a DNA template for constructing a self-circularizing RNA expression vector containing only the P1 region and without the P10 and AS regions.
  • Figure 15 shows the results of electrophoresis of samples obtained after in vitro transcription of each self-circularized RNA expression vector in Figure 13.
  • Figures 16a and 16b show results confirming through electrophoresis that a self-circularizing RNA structure is formed as circRNA after in vitro transcription in a self-circularizing RNA expression vector containing only the P1 region and without the P10 and AS regions.
  • Figures 17 to 19 confirm the effect of the base sequence of the P1 region on the STS reaction and circularization in the self-cycling and RNA structures of the present invention.
  • Figure 17 shows the design of P1 regions of different base sequences
  • Figure 18 shows the results of electrophoresis of samples obtained after in vitro transcription of the self-circularizing RNA expression vector having the P1 region of Figure 17
  • Figure 19 shows electrophoresis results of samples obtained after in vitro transcription of a self-circularizing RNA expression vector with an AU-rich P1 region and a self-circularizing RNA expression vector with a 2-site P1 region, and RT confirming circular RNA.
  • -This is the result of PCR electrophoresis.
  • Figure 20 concisely shows only the essential components of the self-circularizing RNA structure.
  • Figure 20a shows that circRNA can be produced with only an RNA structure containing only the IGS, ribozyme and GOI regions and a uracil base at the 3' end
  • Figure 20b shows the GOI
  • circRNA production is possible simply with the RNA structure of the IGS, ribozyme, and GOI region if the 3' end of contains a uracil base, and in this case, the generated circRNA is a schematic diagram showing that it consists only of GOI.
  • Figure 20b shows that if uracil is included after the five unique base sequences in any part of the GOI, that part is set as the 3' end and the remaining part of the 3' side of the GOI is sent immediately after the ribozyme, creating a circular shape with only the GOI without additional uracil.
  • This is a schematic diagram of how RNA is composed.
  • Figure 21 shows the design of various combinations of AU-rich target sites.
  • Figures 22a and 22b are electrophoresis results of samples obtained after in vitro transcription of an autologous circularized RNA expression vector having the AU-rich target site of Figure 21 and the corresponding IGS region, and denature PAGE confirms circular RNA. It is a result.
  • Figure 23a is a simple schematic diagram to explain that circRNA consisting only of GOI can be produced by selecting a target site inside the target gene and reconstructing GOI based on this.
  • Figure 23b is a schematic diagram of a reconstructed GOI structure in which a target site is selected within a target gene and the GOI is reconstructed based on it.
  • Figure 23c shows the region of the target site in the base sequence of the target gene (CVB3 IRES-sGFP).
  • Figure 23d shows each region in the DNA template for expression of a self-circularizing RNA construct containing the target gene for reconstruction (CVB3 IRES-sGFP).
  • Figure 23e is the PAGE result after IVT using an expression vector for a self-circularizing RNA construct containing the gene of interest for reconstitution (CVB3 IRES-sGFP).
  • Figure 24 shows the results of HPLC after IVT using a self-circularizing RNA construct expression vector containing the target gene for reconstitution (CVB3 IRES-sGFP).
  • Figures 24a and 24b show the results of HPLC performance after IVT of a self-circularizing RNA construct expression vector using a reconstituted target gene rearranged based on the AU11 target site in the target gene (CVB3 IRES-sGFP).
  • Figures 24c and 24d show the results of HPLC performance after IVT of a self-circularizing RNA construct expression vector using a reconstituted target gene rearranged based on the AU19 target site in the target gene (CVB3 IRES-sGFP).
  • Figure 24e shows HPLC performance conditions.
  • Figure 25 shows the results of 4% denatured PAGE on the HPLC peak of the IVT result using an expression vector for a self-circularizing RNA construct containing the gene of interest for reconstruction (CVB3 IRES-sGFP).
  • Figure 26a shows the region of the target site in the base sequence of the target gene (CVB3 IRES-R.Luciferase mutant).
  • Figure 26b shows each region in the DNA template for expression of a self-circularizing RNA construct containing the target gene for reconstruction (CVB3 IRES-R.Luciferase mutant).
  • Figure 26c shows the PAGE results after IVT using an expression vector for a self-circulating RNA construct containing the target gene for reconstitution (CVB3 IRES-R.Luciferase mutant).
  • Figure 26d shows the results of 4% denatured PAGE on the HPLC peak of the IVT result using an expression vector for a self-circulating RNA construct containing the target gene for reconstitution (CVB3 IRES-R.Luciferase mutant).
  • Figure 27a shows the region of the target site in the base sequence of the target gene (CVB3 IRES-F.Luciferase).
  • Figure 27b shows each region in the DNA template for expression of a self-circularizing RNA construct containing the target gene for reconstruction (CVB3 IRES-F.Luciferase).
  • Figure 27c is the PAGE result after IVT using an expression vector for a self-circulating RNA construct containing the target gene for reconstitution (CVB3 IRES-F.Luciferase).
  • the present inventors used a trans-splicing ribozyme (T/S ribozyme) to produce circRNA, and developed a system (hereinafter referred to as ' Circularization system by self-targeting & splicing reaction) was designed ( Figures 1a and 1b).
  • Group I intron ribozyme can induce trans-splicing by cleaving the target RNA through two consecutive trans-esterification reactions and then linking separately existing transcripts at the cut 3' end. there is.
  • the system of the present invention constructs an internal guide sequence (IGS) in the 5' direction of the gene of interest (GOI) and a target site in the 3' direction, so that the IGS A circRNA can be produced by complementary binding to the target site and forming a guanine (G): uracil (U) wobble base pair to induce cleavage and splicing by the ribozyme located between GOI and IGS ( Figure 2a and Figure 2b).
  • IGS internal guide sequence
  • a vector into which the DNA template was inserted was prepared and transcribed in vitro (IVT), and the formation of circRNA was confirmed.
  • IVTT transcribed in vitro
  • STS self-targeting and splicing
  • the present inventors sought to confirm whether the self-circulating RNA construct expression vector can express the RNA construct of the present invention even within cells and whether the expressed RNA can express the target gene loaded in the form of circRNA.
  • an IRES and a stop codon are included in the target gene to enable translation of the transgene within the cell, a plasmid vector is prepared using gaussian luciferase as a transgene in the target gene, and the plasmid vector is introduced into the cell. By transformation, the production of circRNA and luciferase activity were confirmed.
  • the prepared plasmid vector expressed a self-circulating RNA construct within the cell
  • the construct was circularized into circRNA by a ribozyme, and the target gene was expressed from the circRNA (Example 3).
  • the present inventors attempted to optimize the RNA structure to efficiently form circRNA through an immediate STS (direct STS) reaction on IVT.
  • the self-circularization efficiency was similar for 50, 100, and 150-nt lengths, but it was confirmed that the in vitro transcription reaction itself decreased when 50 or 100-nt long AS and ABS regions were included, and cricRNA In terms of manufacturing efficiency, it was confirmed that the length of the AS region and ABS region is 150-nt (Example 5).
  • the ribozyme used was a group I intron ribozyme capable of continuous trans-esterification reaction.
  • Group I intronic ribozymes induce trans-splicing by linking separately existing transcripts to the cleaved 3' end after cutting the target site.
  • the 5' region of the GOI rather than the separately existing transcript, is used to induce trans-splicing. Since it is connected to the cleaved 3' end, it was confirmed whether the P1 and P10 helix regions, which are known to increase trans-splicing efficiency, and the AS and ABS regions at both ends of the self-circularizing RNA structure have a positive effect on circularization efficiency. I wanted to do it.
  • the present inventors prepared a self-circulating RNA expression vector containing only the P1 helix region, only the P1 and P10 helix regions, or both the P1 and P10 helix and the AS region, subjected the vector to IVT, and then applied direct STS. Efficiency was confirmed. As a result, surprisingly, it was found that the P10 helix region in the self-circularizing RNA structure decreased the circRNA production efficiency in the presence of the P1 helix and P10 helix regions. Meanwhile, excellent circRNA production efficiency was shown even when only the P1 helix region was included without the AS region (Example 7).
  • the present inventors designed a self-circularizing RNA structure so that only the IGS forms a P1 helix so that only the target gene remains in the final product, circRNA, and confirmed whether the STS reaction occurs in various IGS sequences.
  • the STS reaction of the self-circularizing RNA structure expressed from DNA was induced even when only the IGS region formed a P1 helix, and furthermore, circRNA was formed even though the IGS region and the target site region were not complementary to each other. was confirmed.
  • a non-specific reaction may occur at an undesired site and an undesired product may be generated.
  • circRNA As a result, the production of circRNA was confirmed in all combinations of AU-rich IGS, and in particular, it was confirmed that the AU-rich IGS sequence consisting of 2 A bases and 3 U bases had a relatively high autocircularization efficiency ( Example 8-2). From the above, the present inventors can obtain circRNA through STS reaction only with the RNA structure schematic in Figure 1a, and the self-circularizing RNA structure schematic in Figure 20a can be used to obtain circRNA as shown in the schematic diagram in Figure 20b. It was confirmed that the precursor could form a circRNA composed of only the target gene including a U base at the 3' end of the GOI.
  • the nucleotide sequence of the IGS region can be designed to be reverse complementary to the GOI, so that the final generated circRNA consists only of the GOI region (FIG. 20b).
  • the 3' end of the GOI does not end with a U base, it is difficult to produce a circRNA consisting of only the GOI.
  • the present inventors confirmed that by selecting a target site within the GOI and reconstructing the GOI based on the target site, it is possible to obtain a circRNA consisting of only the GOI even when the 3' end of the GOI does not end with a U base (Example 9).
  • the target gene for reconstruction is designed by connecting the 3' region GOI to the 5' direction of the 5' region GOI.
  • the target gene for reconstruction has a structure of 5'-[3' region GOI]-[5' region GOI]-3', and in this case, [3' region GOI] and [5' region GOI] are directly connected.
  • the present inventors designed a target gene to include an IRES and a transgene encoding a protein, selected a target site within the target gene, and then designed a target gene to reconstruct the circRNA so that it consists of only the IRES and the transgene.
  • a vector expressing the self-circularized RNA construct was constructed and the production of circular RNA was confirmed.
  • a target site was selected inside the target gene containing CVB3 as an IRES and sGFP (superfolder GFP), RLuc M185V/Q253A, or FLuc gene as a transgene, and a reconstructed GOI was designed based on this to create a reconstructed GOI.
  • the P1 helix is complementary to the base sequence connected to the front end (5' direction) of the ribozyme when forming the secondary structure of the group I intron ribozyme and the base sequence in the 3' direction of the transcript where splicing is induced by the ribozyme. It refers to a helix structure formed through complementary binding, and the P10 helix refers to a helix structure formed through complementary binding between the front region of the ribozyme and the base sequence in the 5' direction of the transcript cleaved by the ribozyme. .
  • the P1 helix can be formed through complementary binding of the IGS at the 5' end and the target site at the 3' end in the self-circularizing RNA structure of the present invention
  • the P10 helix can be formed by the extended base sequence at the 5' end and It refers to a helix structure formed through complementary bonding of base sequences connected to the rear end (3' direction) of the ribozyme.
  • the base sequence forming the P1 helix is referred to as the P1 region or P1 helix region, and similarly, the base sequence forming the P10 helix is referred to as the P10 region or P10 helix region.
  • the base sequence of the IGS region is 5'-GNNNNN-3'
  • the base sequence of the target site region is 5'-N'N'N'N'N'U-3'
  • the P1 helix is connected to the IGS region. It can be formed by complementary combination of target site regions, and in this case, the description of the P1 helix region can be used interchangeably with the base sequence of the IGS region to exclude redundant expression.
  • the P1 helix can be formed by including a base sequence extending in the 5' direction of the IGS region, and the base sequence of the naturally extended base sequence and the reverse complementary sequence extend in the 3' direction of the target site, forming P1. Constructs a helix.
  • the extended base sequence region is denoted as P1 to distinguish it from the IGS region. The same is true for the P10 helix.
  • the target site region is intended to represent a base sequence that binds complementary to the IGS region, and may overlap with the target gene (GOI) region depending on the base sequence design of the IGS region.
  • the target site In order to specify the region that binds complementary to the IGS region, the region that binds complementary to the IGS region within the target gene is named the target site.
  • the target site may overlap with part or all of the target gene region, or may exist separately from the target gene.
  • the AS (antisense sequence) region is located at the 5' end of the self-circularizing RNA structure and is intended to hydrogen bond with the base sequence of the ABS (antisense binding sequence) region located at the 3' end of the RNA structure.
  • the AS region essentially coexists with the ABS region, and the absence of the AS region is understood to include the absence of the ABS region, and similarly, the RNA structure containing the AS region is understood to also include the ABS region.
  • the present inventors confirmed the effect of the presence or absence of three types of components, the P1 region, P10 region, and AS region, on the circularization efficiency of the self-cycling RNA structure by the STS reaction, and the results showed that both the P1 and P10 regions and the AS region were included.
  • the amount of circRNA produced was high in the order of the case containing only the P1 region, followed by the case containing only the P1 and P10 regions, and the self-circularizing RNA structure in the case containing only the P1 region was also circularized with sufficient efficiency to produce circRNA.
  • the present invention provides a self-circularizing RNA structure containing only the P1 region.
  • a self-circularizing RNA structure containing only the P1 region means that the P10 region and the AS region are absent, and is not used to exclude other structures.
  • the self-circularizing RNA structure containing only the P1 region and the AS region means that the P10 region does not exist and is not used to exclude other configurations other than the P10 region.
  • Self-circularized RNA was designed as shown in Figure 2c, and the T7 promoter sequence was additionally included in the DNA template for expressing it for in vitro transcription reaction (Figure 2d).
  • the DNA template amplification product was inserted into pTOP TA V2 cloning vector (Enzynomics) using PstI restriction enzyme to prepare a self-circulating RNA expression vector.
  • the self-circulating RNA expression vector prepared in Example 1 was transcribed in vitro using NEB's HiScribe T7 High Yield RNA Synthesis Kit according to the manufacturer's protocol. Specifically, after reaction at 37°C for 3 hours with 20 uL scale (1 ug T7 DNA template, 1 After adding water, 1 uL of RNase-free DNase I (10 U/ul) was added and reacted at 37°C for 30 minutes to induce an immediate circularization (direct STS) reaction after transcription.
  • NEB's HiScribe T7 High Yield RNA Synthesis Kit according to the manufacturer's protocol. Specifically, after reaction at 37°C for 3 hours with 20 uL scale (1 ug T7 DNA template, 1 After adding water, 1 uL of RNase-free DNase I (10 U/ul) was added and reacted at 37°C for 30 minutes to induce an immediate circularization (direct STS) reaction after transcription.
  • an additional circularization reaction was induced to confirm the stage at which the self-circularization reaction was completed.
  • additional 28 uL of nuclease-free water and 20 uL of 5X STS buffer 50 mM Hepes (pH 7.0), 150 mM NaCl, 5 mM MgCl2 ), 2 uL of 100 mM GTP (final 2 mM) was added to make a volume of 100 uL, and the self-circulation reaction was performed at 37°C for 1 hour.
  • RNA obtained from each STS step and 250 ng of each sample treated with RNase R were mixed 1:1 with 10 M Urea-BPB (1X TBE) dye, heated at 75°C for 5 minutes, and then mixed with 4% Polyacrylamide-7 M Urea denature PAGE (electrophoresis maintained at 50°C for 2 hours under 50 W conditions) was performed, the gel was stained with SYBR Gold Nucleic Acid Stain (Thermo Fisher Scientific), and ImageQuant 800 (Cytiva product) was used. and analyzed.
  • RT-PCR base sequence analysis was performed to verify that Candidate 1 was a circRNA among the RNA bands that were not cleaved by RNase R in the PAGE results. Specifically, the band at the Candidate 1 position in the PAGE was cut, crushed, and then eluted in water at 37°C for 3 to 16 hours. Circular RNA samples purified by ethanol precipitation and ribozyme sites and antisense sites were not present, so they could be circularized. Using the absence of linear RNA as a control, RT-PCR was performed using primers that allow PCR amplification only when circRNA is created.
  • RT Reverse transcription
  • PCR was performed using AccuPower Taq PCR premix (Bioneer), with 2 uL of RT sample and 20 uM of Circular STS F (5'-CCCTGAGTGGCTGAGCTCAGG-3') and Circular STS R (5'-CAGCAAGCATACTAAATTGCCAG-3') ) were added 1 uL each, the volume was adjusted to 20 uL with water, and PCR amplification was performed under the following conditions: 95°C for 1 minute, [95°C 30 seconds, 65°C 30 seconds, 72°C 30 seconds] 35 cycles, 72°C 5 minutes.
  • Circular STS F 5'-CCCTGAGTGGCTGAGCTCAGG-3'
  • Circular STS R 5'-CAGCAAGCATACTAAATTGCCAG-3'
  • the PCR product was separated and purified from the obtained band of the expected size according to the manufacturer's protocol using a gel extraction kit (Cosmogenetech product), cloned using the TOPcloner TA-Blunt kit (Engenomics product), and DH5alpha Transform E. coli (Chemically competent E. coli, Enzynomics product) to obtain E. coli colonies on LB-Agar (including Kanamycin) plates, and extract plasmid DNA using a DNA purification kit (Cosmogenetech product) according to the manufacturer's protocol.
  • Candidate 1 is a circular RNA.
  • Candidate 1 was confirmed to be a circRNA through RT-PCR, theoretically, the possibility that Candidate 1 is in the form of a dimer cannot be ruled out. Accordingly, we attempted to re-verify that Candidate 1 is a circRNA by performing a nicking test.
  • RNA candidates 1 and 2 (100 ng) were mixed with MgCl 2 to a final concentration of 0, 2.5, and 5 mM, respectively.
  • the sample in the final 10 uL of water was heated at 65°C for 30 minutes and stored on ice for a while. Afterwards, 10 uL of 10 M Urea-BPB (1X TEB) loading dye was mixed.
  • Candidate 1 in the absence of Mg 2+ , a band of a size corresponding to a slightly nicked circular RNA was included (1092-nt), and in the case of 2.5 mM Mg 2+ , the position of Candidate 1, which is believed to be the location of circular RNA, was included. It was confirmed that the band of was reduced and that a band of nicked circular RNA size still existed. In the case of 5mM Mg 2+ conditions, it was confirmed that even the nicked circular RNA band disappeared due to hydrolysis.
  • Candidate 1, or circular RNA passed through the 1092-nt size expected to be a monomer (2.5mM Mg2+) when nicking occurred and was eventually completely decomposed (5mM Mg2+), thus reconfirming that Candidate 1 is a circular RNA and a monomer. I was able to.
  • Candidate 2 has a size similar to the intact RNA size of 1874-nt (around 2000-nt of the marker), and, unlike Candidate 1, under mild nicking conditions of 2.5 mM Mg 2+ , the size of nicked circular RNA is 1092-nt. The -nt band was not generated and disappeared, showing that it was not circular RNA.
  • Example 2 it was confirmed that the self-circulating RNA expression vector prepared in Example 1 was transcribed in vitro to form circRNA. It was confirmed whether the vector operates equally in cells, and furthermore, whether the target gene contained in the circRNA is expressed in the cell. We wanted to check whether it was expressed smoothly within the system.
  • the target gene was designed with the structure of 5'-EMCV IRES-transgene-stop codon-3', and gaussian luciferase (G.luci) was used as the transgene to easily confirm the expressed target gene. ) was used.
  • 293A cells were seeded at 2x10 5 /well in a 6 well plate, and 24 hours later, they were transformed with the plasmid vector using lipofectamine 2000 transfection reagent. The culture medium was replaced 6 hours after transformation. Then, 100 uL culture medium was collected at 12, 24, and 48 hours after transformation to measure G.luci activity. G.luci activity was detected in the culture medium, and it was confirmed that the activity increased over time, confirming that the G.luci gene, a transgene, was expressed in the vector introduced into the cells ( Figure 6b).
  • RT Reverse transcription
  • PCR was performed using AccuPower Taq PCR premix (Bioneer product), with 2 uL of RT sample and 20 uM of Circular STS primer F (5' - caaggacttggagcccatggagcag - 3') and primer R (5' - tgtgccgcctttgcaggtgtatc - 3). ') was added in 1 uL each, the volume was adjusted to 20 uL with water, and PCR amplification was performed under the conditions of 95°C for 1 minute, [95°C for 30 seconds, 65°C for 30 seconds, 72°C for 30 seconds] 35 cycles, and 72°C for 5 minutes.
  • the expected length of the STS PCR product is 479 bp, and circular RNA is present when analyzed with GeneRuler 50 bp DNA ladder (Thermo Fisher Scientific product) on a 1.5% agarose gel (containing 1X concentration of RedSafe Nucleic Acid Staining Solution, a product of Intron Bio). Only in this case was it possible to confirm a specific PCR product of the expected size. At this time, 5 uL of the PCR product was placed in 1 uL of 6
  • the obtained band of the expected size was separated and purified from the PCR product according to the manufacturer's protocol using a gel extraction kit (Cosmogenetech product), cloned using the TOPcloner TA-Blunt kit (Engenomics product), and cloned into DH5alpha E. coli.
  • a gel extraction kit (Cosmogenetech product)
  • cloned using the TOPcloner TA-Blunt kit Engenomics product
  • DH5alpha E. coli (Chemically competent E. coli, Enzynomics product) was transformed to obtain an E. coli colony on an LB-Agar (containing Kanamycin) plate, and the plasmid DNA was extracted and purified using a DNA purification kit (Cosmogenetech product) and manual, and converted to base.
  • the prepared plasmid vector expressed a self-circulating RNA construct within the cell
  • the construct was circularized into circRNA by a ribozyme, and the target gene was expressed from the circRNA.
  • Example 1 Vectors capable of expressing each RNA construct were prepared in the same manner as in Example 2, and in vitro transcription was performed at 37°C for 3 hours, and the degree of immediate STS reaction was measured using a 4% Polyacrylamide-7 M Urea gel (20 x 20 cm, 1 mm) and compared and confirmed by relative band intensity.
  • the base sequence of each spacer region is shown in Table 3 below.
  • spacers A10, A30, and A30 were used by adding a restriction site to the 3' end for IRES insertion immediately after the spacer region. did.
  • an AatII site was added to the 3' end of the spacer.
  • the self-circularizing RNA structure designed in Example 1 includes an AS region, a P1 helix, and a P10 helix region.
  • an AS region a P1 helix region
  • a P10 helix region a region that influences the effect of each configuration on the immediate circularization reaction during the in vitro transcription process.
  • only the P1 helix region, only the P1 and P10 helix regions, or the P1 and P10 helix and the AS region are included, as schematized in Figure 13.
  • Create a DNA template containing all of the above prepare a vector capable of expressing each RNA construct in the same manner as in Example 1, perform in vitro transcription at 37°C for 3 hours as in Example 2, and perform an immediate STS reaction. The extent was confirmed by performing PAGE on 4% Polyacrylamide-7 M Urea gel (20 x 20 cm, 1 mm) and comparing relative band intensity.
  • Example 7-1 From the results of Example 7-1, it can be seen that sufficient circRNA can be prepared from a DNA template (P1 structure) that does not contain the P10 and AS regions without an additional circularization step during the in vitro transcription process.
  • the product was treated with RNase R to remove linear RNA, PAGE was performed as in the previous experiment, and RT-PCR and base sequence analysis were performed as in Example 2-2. was carried out.
  • Example 7 confirmed that the self-circularizing construct without P10, AS, and ABS can sufficiently produce circRNA. Accordingly, if only the base sequences of the Internal Guide Sequence (IGS) present at the 5' end of the P1 helix and the target site at the 3' end are complementary to each other (U and G are wobble base pairs), circular RNA is formed. We assumed that would be created and attempted to verify it.
  • IGS Internal Guide Sequence
  • the final generated circRNA consists of only one U base and the GOI region ( Figure 1a and Figure 1b). Additionally, if the 3' end of the GOI ends with a U base, the nucleotide sequence of the IGS region can be designed to be reverse complementary to the GOI, so that the final generated circRNA is composed of only the GOI region ( Figures 20a and 20b).
  • Example 17 As shown in Figure 17, the sequences of the IGS and target site were designed in various ways, the vector was prepared by the method of Example 1, and then the in vitro transcription (IVT) of Example 2-1 was performed.
  • the GOI was selected so that no 32 AU-rich sequences exist, and the AU-rich sequence complementary to the IGS was examined in the self-cyclic and RNA structures produced to determine whether the IGS can complement other regions other than the target site. The sequences were counted.
  • One sequence complementary to IGS Nos. 17 and 18 was identified in the ribozyme sequence, and no other sequences complementary to IGS were identified in the RNA structure.
  • the circular RNA produced from the self-circularizing RNA construct expression vector containing the IGS at positions 17 and 18 is attached to the ribozyme through complementary binding between the IGS and the target site. It is created by targeting and splicing.
  • the present inventors selected a GOI region capable of forming wobble base pairs with IGS as a target site to form circRNA.
  • a target site within a GOI is selected and circRNA is formed as is, the GOI in the region downstream of the target site is cleaved by a ribozyme and is not included in the circRNA. Accordingly, it is necessary to reconstruct GOIs located upstream and downstream of the target site area ( Figure 23a).
  • the GOI area located downstream of the target site area is referred to as the 3’ region GOI
  • the GOI area excluding the 3’ region GOI is referred to as the 5’ region GOI.
  • the present inventors selected five bases located upstream, including the U base that can form a wobble base pair within the GOI, as the target site, and placed the 3' region GOI located downstream of the U base at the top of the 5' region GOI.
  • the circRNA formed by reorganizing the GOI was designed to be composed of an intact GOI.
  • the GOI may contain two or more U bases that can form wobble base pairs. Therefore, when multiple candidate regions of the target site exist within the GOI, for efficient circRNA production, as confirmed in Example 8-2, the target site has A and U contents in the five consecutive bases upstream of the U base. This is selected as high. In the figure, areas with high A and U contents are indicated as “AU rich.”
  • Figure 23b schematically illustrates an example of target site selection within GOI and resulting GOI reconstruction.
  • the present inventors sought to confirm whether the intended circRNA could be produced through the above-described target site selection and GOI reconstruction. Specifically, in the GOI using CVB3 as the IRES and sGFP, RLuc M185V/Q253A, or FLuc gene as the transgene, a target site was selected within the GOI, the GOI was reconstructed, a circular RNA precursor expression vector was created, and IVT was performed. For comparison, a circular RNA precursor was produced with a target site set in the spacer region, and the target site located in the spacer region is named spacer target. Circular RNA precursors in specific cases are illustrated in the figures. Using the IVT results of each circular RNA precursor, the production and yield of circular RNA were confirmed through PAGE and HPLC.
  • the target gene was designed so that sGFP could be expressed by CVB3 IRES.
  • CVB3 IRES two AU-rich target site candidate regions were selected (indicated as AU11 and AU19, respectively).
  • Figure 23c shows the sequence of the target gene and two AU rich target site regions present within it.
  • Spacer target was used as control.
  • the initially designed spacer region (AC40 spacer) does not have a region that can be a target site candidate. Meanwhile, in previous studies, it has been confirmed that the length of the spacer region does not affect circularization efficiency. Accordingly, as a spacer target, the AC108 spacer was designed separately and manufactured to be included in the circular RNA precursor.
  • Figure 23d shows each region as a DNA template for expression of circular RNA precursor when AU11 is selected as the target site.
  • AU19 was selected as the target site
  • GOI was reconstructed to design a DNA template, and each was prepared as a vector according to the method of Example 1, followed by in vitro transcription (Example 2-1) IVT) was performed.
  • Table 7 shows the self-circularization efficiency and final yield of the circular RNA precursor designed according to target site selection within GOI.
  • AU16 and AU28 are not shown in Figure 23c, and the target site (5'-ACGGCU-3') located in the spacer is a control for comparison.
  • the target gene was designed so that the RLuc mutant (M185V/Q235A) could be expressed by CVB3 IRES.
  • Select the AU11 target site within the sequence of the target gene reconstruct the GOI based on this, design a DNA template, prepare it as a vector according to the method of Example 1, and then perform the in vitro transcription (IVT) of Example 2-1. carried out.
  • Spacer target was used as control.
  • the circular RNA precursor used as a control was designed and manufactured to include the AC108 spacer.
  • Figure 26a shows the sequence of the target gene and the AU rich target site region present therein
  • Figure 26b shows the specific sequence and each DNA template of circular RNA precursor expression, in which GOI was reconstructed based on the selected AU11 target site region. It marks the area.
  • Example 9-2 The same experiment was performed in Example 9-2 by changing the transgene to F.luciferase.
  • Figure 27a shows the sequence of the target gene and the AU rich target site region and spacer target site region present within it
  • Figure 27b shows the circular RNA precursor expression DNA template in which GOI was reconstructed based on the selected AU11 target site region. The specific sequence and each region are indicated.
  • the spacer target was used as a control, and in this experiment, all circular RNA precursors were designed and manufactured to contain the AC108 spacer.
  • the present invention can be used to prepare circRNA for protein expression in vitro, in cells, and in vivo, and can be used to produce miRNA, anti-miRNA, shRNA, aptamer, mRNA vaccine, mRNA therapeutic agent, antibody, vaccine adjuvant, CAR-T mRNA It can be used to produce functional RNA such as circRNA.

Landscapes

  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

본 발명의 자가 환형화 RNA 구조체는 DNA 벡터에서 발현됨과 동시에 self-targeting & splicing 반응을 통해 circularization되어 circRNA를 형성할 수 있으며, 상기 circRNA는 목적 유전자만으로 구성될 수 있으며, 상기 목적 유전자는 IRES 영역, 개시코돈 및 종결코돈을 포함하여 펩타이드 또는 단백질의 빠른 발현이 가능한 장점이 있다.

Description

자가 환형화 RNA 구조체
본 발명은 자가 환형화 효율이 향상된 RNA 구조체 등에 관한 것이다.
본 발명은 과학기술정보통신부의 재원으로 한국연구재단 '감염병 차세대 백신 기초 원천핵심 기술개발' 사업의 지원을 받아 완성되었다(과제번호: 2022M3E5F1017657).
Circular RNA (circRNA, cRNA)는 공유 결합으로 연결된 단일 가닥의 전사물(transcript)로서, RNA-seq 데이터와 새롭게 개발된 생물정보학 접근법을 통해 다양한 생명체에서 수만 개가 넘는 종류의 circRNA가 확인되었다. 진핵생물에서 circRNA는 mRNA로부터 백스플라이싱(back-splicing)을 통해 생성되고, 생체 내에서 microRNA 스폰지(sponge) 기능을 수행하여 유전자 발현을 조절할 수 있음이 알려져 있다. circRNA가 면역원성을 유발하는지 여부는 알려져 있지 아니하며, 그 구조적 특성에 의해 생체 내에서 매우 안정적으로 존재한다.
한편, 최근 messenger RNA (mRNA)를 이용한 치료제 개발이 활발하다. 그러나 mRNA는 생체 내에서 쉽게 분해되어 비교적 짧은 반감기를 갖는 한계가 있다. 이러한 한계를 극복하기 위하여 mRNA에 poly(A)tail을 붙여 안정성을 향상시키는 등의 연구가 진행되고 있다. 같은 맥락에서 US 10,953,033는 circRNA의 구조적 특성에 기초하여 생체 내에서 유전자 발현을 목적으로 circRNA를 개시하고 있다.
본 발명이 이루고자 하는 기술적 과제는 자체적으로 표적화 및 스플라이싱 반응을 수행하여 환형화되는 RNA 구조체를 제공하는 것이다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당해 기술분야의 통상의 기술자에게 명확하게 이해될 수 있을 것이다.
상기 과제를 해결하기 위하여, 본 발명은 하기 구조를 갖는 자가 환형화 RNA 구조체를 제공한다:
5' - IGS (internal guide sequence) - 리보자임(Ribozyme) - 목적 유전자 (gene of interest) - 타겟 사이트(target site) - 3'.
본 발명의 일 구현예로서, 상기 IGS 영역은 타겟 사이트와 구아닌(Guanine, G) : 우라실(Uracil, U) 워블 염기쌍(wobble base pair)을 형성하고, 상기 워블 염기쌍을 형성하는 구아닌은 IGS 영역의 5’ 말단에 위치하고, 상기 워블 염기쌍을 형성하는 우라실은 타겟 사이트 영역의 3’ 말단에 위치하며, 상기 IGS 영역은 워블 염기쌍을 형성하는 염기 외에는 아데닌(Adenine, A) 또는 우라실로 이루어진 것일 수 있다.
본 발명의 다른 구현예로서, 상기 IGS 영역은 5’-GNNNNN-3’의 염기서열을 포함하거나 이로 이루어지고, 상기 타겟 사이트 영역은 5’-N’N’N’N’N’U-3’의 염기서열을 포함하거나 이로 이루어진 것일 수 있다. 상기 IGS 영역의 N과 타겟 사이트 영역의 N’는 각각 독립적으로 A 또는 U일 수 있으며, 이때 IGS 영역은 A 및 U를 2:3 또는 3:2 비율로 포함할 수 있다.
본 발명의 또 다른 구현예로서, 상기 IGS 영역의 염기 서열은 상기 구아닌을 제외하고 타겟 사이트의 영역의 염기서열과 역상보적일 수 있다.
본 발명의 다른 구현예로서, 상기 리보자임은 그룹 Ⅰ 인트론 리보자임 (Group Ⅰ intron ribozyme)일 수 있으며, 상기 리보자임은 서열번호 6의 염기서열을 포함하거나 이로 이루어진 것일 수 있다.
본 발명의 또 다른 구현예로서, 상기 구조체는 IGS 영역의 5’ 방향으로 연장된 뉴클레오티드를 포함하여 P1 helix 및 P10 helix를 형성하는 것일 수 있으며, 이때 P1 helix는 타겟 사이트의 3’ 방향으로 연장된 뉴클레오티드와 함께 IGS 영역과 타겟 사이트의 상보적 결합이 이루어지는 영역에서 형성되고, P10 helix는 IGS 영역의 5’ 방향으로 연장된 뉴클레오티드가 리보자임과 GOI 영역 사이에 위치하는 상기 연장된 뉴클레오타이드와 역상보적인 서열과 상보적 결합이 이루어지는 영역에서 형성될 수 있다. 상기 P1 helix를 형성하는 연장된 뉴클레오티드의 길이는 3-nt일 수 있으며, P10 helix를 형성하는 연장된 뉴클레오티드의 길이는 6-nt일 수 있다.
본 발명의 또 다른 구현예로서, 상기 구조체는 P1 helix는 형성하되 P10 helix는 형성하지 않는 것일 수 있다.
본 발명의 또 다른 구현예로서, 상기 구조체는 5’ 말단 및 3’ 말단에 서로 상보적으로 결합할 수 있는 영역과 ABS(antisense binding sequence) 영역을 포함할 수 있다.
본 발명의 또 다른 구현예로서, 상기 ABS 영역은 AS 영역과 역상보적인(reverse complementary) 서열로 이루어질 수 있다.
본 발명의 또 다른 구현예로서, 상기 AS 영역의 길이는 GOI에 따라 가변적일 수 있으나, 10 내지 500-nt, 바람직하게는 50-nt 초과 400-nt 미만, 더욱 바람직하게는 150-350nt 일 수 있다.
본 발명의 또 다른 구현예로서, 상기 GOI 영역은 5’ 말단에 IRES (internal ribosome entry site) 영역을 포함할 수 있으며, 개시코돈 및 종결코돈을 포함할 수 있다.
본 발명의 또 다른 구현예로서, 상기 구조체는 무작위 염기서열로 이루어진 스페이서 (Spacer) 영역을 추가로 포함할 수 있으며, 상기 스페이서 영역은 IGS 영역과 목적 유전자 영역 사이 및/또는 목적 유전자 영역과 타겟 사이트 영역 사이에 위치할 수 있다.
본 발명의 또 다른 구현예로서, 상기 스페이서 영역은 poly(A)을 포함하거나 이로 이루어진것일 수 있으며, poly(A)는 아데닌(A)이 반복적으로 연결된 폴리 뉴클레오티드로 상기 A는 10 내지 50회 반복하여 연결된 것일 수 있으며, 바람직하게는 30회 반복하여 연결된 것일 수 있다.
본 발명의 자가 환형화 RNA 구조체는 DNA 벡터에서 발현됨과 동시에 별도의 GTP 처리 없이도 self-targeting & splicing 반응을 통해 circularization되어 circRNA를 형성할 수 있으며, 상기 circRNA는 목적 유전자만으로 구성될 수 있으며, 상기 목적 유전자는 IRES 영역, 개시코돈 및 종결코돈을 포함하여 펩타이드 또는 단백질을 빠르게 발현할 수 있는 장점이 있다. 또한, circRNA는 원형의 구조로 5’ 및 3’ 말단이 노출되지 않으므로 안정적이고 높은 반감기를 가지는바, miRNA, anti-miRNA, shRNA, aptamer, mRNA 백신, mRNA 치료제, 항체, 백신 보조제, CAR-T mRNA, genome 또는 RNA editing 유도 RNA 등의 기능성 RNA를 circRNA로 제조하여 세포 내에서 높은 안정성을 갖도록 할 수 있다.
도 1a와 도 1b는 IGS, 리보자임, 목적 유전자, 및 타겟 사이트 영역만을 포함하는 본 발명의 자가 환형화 RNA 구조체가 self-targeting and splicing (STS) reaction에 의하여 circRNA로 형성되는 과정의 모식도이다.
도 2a는 AS, IGS, 리보자임, 목적 유전자, 타겟 사이트, 및 ABS 영역을 포함하는 본 발명의 자가 환형화 RNA 구조체가 STS reaction에 의하여 circRNA로 형성되는 과정의 모식도이다.
도 2b는 transgene의 번역이 가능하도록 목적 유전자 영역에 IRES와 종결코돈을 포함하고, P1 helix 및 P10 helix를 형성할 수 있도록 5’ 방향으로 연장된 뉴클레오타이드를 추가로 포함하는 본 발명의 자가 환형화 RNA 구조체와 상기 구조체가 STS reaction에 의하여 circRNA로 형성되는 과정의 모식도이다.
도 2c는 본 발명의 자가 환형화 RNA 구조체의 일 형태이다.
도 2d는 본 발명의 자가 환형화 RNA 구조체 발현 벡터 제조를 위한 DNA template 염기서열이다.
도 3은 본 발명의 자가 환형화 RNA 구조체 발현 벡터의 시험관 내 전사 후 즉시, 추가 GTP 처리 없이도, circRNA가 발생하는지 확인하기 위하여 폴리아크릴아미드 겔 상에서 전기영동한 결과이다. 전사 후 즉시(direct STS) 확보된 샘플과, 추가의 GTP를 처리하여 1차 및 2차 환형화 반응을 유도하는 1차 및 2차 STS 반응단계 이후의 샘플을 이용하였으며, 각 샘플의 일부는 RNase R을 처리하여 linear RNA를 제거함으로써 샘플 내 circRNA를 농축하여 전기영동하였다.
도 4는 도 3의 결과에서 circRNA로 추정되는 Candidate 1이 circRNA임을 검증한 것으로서, 도 4a는 상기 candidate 1 밴드에서 RNA를 추출하고 RT-PCR을 수행한 결과이고, 도 4b는 상기 candidate 1 밴드에서 추출한 RNA의 염기서열분석 결과이다.
도 5는 도 4의 결과에서 candidate 1 밴드의 RNA에 monomer임을 검증한 것으로서, 도 3의 결과에서 circRNA로 추정되는 candidate 1 및 2 밴드에서 RNA를 추출하고 Mg2+을 처리하여 nick을 유도한 후 전기영동한 결과이다.
도 6은 본 발명의 자가 환형화 RNA 구조체 발현 벡터가 세포 내에서 circRNA를 생성하고 circRNA가 포함하는 transgene이 발현되는지 확인한 결과이다. 구체적으로, 도 6a는 상기 자가 환형화 RNA 구조체 발현 벡터의 구조이고, 도 6b는 luciferase activity assay를 통한 transgene의 발현을 확인한 결과이고, 도 6c 및 도 6d는 상기 transgene이 circRNA에서 발현된 것임을 검증한 RP-PCR 및 염기서열 분석 결과이다.
도 7 및 도 8은 HPLC를 통한 circRNA 정제 조건 및 정제 결과이다.
구체적으로, 도 7a는 Ultra HPLC 시스템을 이용한 HPLC 분석 조건이고, 도 7b는 시험관 내 전사 후 즉시 확보한 샘플을 컬럼 정제한 결과이고, 도 7c는 상기 샘플에 RNase R을 처리한 후 컬럼 정제한 결과이다. 또한, 도 8a는 컬럼 정제를 통해 확보한 fraction에서 peak를 확인한 결과이고, 도 8b는 도 8a에서 peak가 두드러진 7번, 10번, 11번, 12번, 및 13번 fraction의 전기영동 결과이다.
도 9 및 도 10은 본 발명의 자가 환형화 RNA 구조체에서 AS 영역이 STS 반응 및 환형화에 미치는 영향을 확인한 것으로서, 도 9는 서로 다른 길이의 AS 영역을 포함하는 자가 환형화 RNA의 구조이고, 도 10은 상기 RNA를 발현하는 벡터의 시험관 내 전사 후 확보된 샘플의 전기영동 결과이다.
도 11 및 도 12는 본 발명의 자가 환형과 RNA 구조체에서 Spacer 영역이 STS 반응 및 환형화에 미치는 영향을 확인한 것으로서, 도 11은 대조군의 spacer (control spacer)과 다양한 길이의 poly(A) spacer를 포함하는 자가 환형화 RNA의 구조이고, 도 12는 상기 RNA를 발현하는 벡터의 시험관 내 전사 후 확보된 샘플의 전기영동 결과이다.
도 13은 P1 영역만 포함하는 자가 환형화 RNA; P1 및 P10 영역만 포함하는 자가 환형화 RNA; 및 P1 영역, P10 영역, 및 AS 영역을 포함하는 자가 환형화 RNA;의 리보자임에 의해 cleavage 되는 영역 부근의 염기서열과 각 영역을 표시한 것이다.
도 14는 P10 및 AS 영역이 없고 P1 영역만 포함하는 자가 환형화 RNA 발현 벡터 제작을 위한 DNA template의 염기서열이다.
도 15는 도 13의 각 자가 환형화 RNA 발현 벡터의 시험관 내 전사 후 확보된 샘플을 전기영동한 결과이다.
도 16a 및 도 16b는 P10 및 AS 영역이 없고 P1 영역만 포함하는 자가 환형화 RNA 발현 벡터에서 시험관 내 전사 후 자가 환형화 RNA 구조체가 circRNA로 형성됨을 전기영동을 통해 확인한 결과이다.
도 17 내지 도 19는 본 발명의 자가 환형과 RNA 구조체에서 P1 영역의 염기서열이 STS 반응 및 환형화에 미치는 영향을 확인한 것이다. 구체적으로, 도 17은 서로 다른 염기서열의 P1 영역을 설계한 것이고, 도 18은 상기 도 17의 P1 영역을 갖는 자가 환형화 RNA 발현 벡터의 시험관 내 전사 후 확보되는 샘플의 전기영동한 결과이며, 도 19는 AU-rich P1 영역을 갖는 자가 환형화 RNA 발현 벡터와 2-site P1 영역을 갖는 자가 환형화 RNA 발현 벡터의 시험관 내 전사 후 확보되는 샘플의 전기영동 결과로서, 원형 RNA를 확인하는 RT-PCR 전기영동 결과이다.
도 20은 자가 환형화 RNA 구조체의 필수 구성만을 간결하게 나타낸 것으로서, 도 20a는 IGS, 리보자임 및 GOI 영역과 3’ 말단에 우라실 염기만 포함하는 RNA 구조체 만으로도 circRNA 제작이 가능하며, 도 20b는 GOI의 3’ 말단에 우라실 염기가 포함되어 있다면 단순히 IGS, 리보자임, 및 GOI 영역의 RNA 구조체 만으로도 circRNA 제작이 가능함을 나타낸 것이고, 이 경우 생성되는 circRNA는 GOI만으로 구성됨을 나타낸 모식도이다. 다시 말해, 도 20b는 GOI의 어느 부위에서든 5개의 유일한 염기서열 뒤에 우라실이 포함되어 있다면 그 부분을 3' 말단으로 해서 GOI의 3'쪽 나머지 부분을 리보자임의 바로 뒤로 보내 추가적인 우라실 없이 GOI만으로 원형 RNA가 구성되는 모식도이다.
도 21은 다양한 조합의 AU-rich 타겟 사이트를 설계한 것이다.
도 22a 및 도 22b는 상기 도 21의 AU-rich 타겟 사이트와 이에 대응하는 IGS 영역을 갖는 자가환형화 RNA 발현 벡터의 시험관 내 전사 후 확보되는 샘플의 전기영동 결과로서, 원형 RNA를 확인하는 denature PAGE 결과이다.
도 23a는 목적 유전자 내부에 타겟 사이트를 선정하고 이를 기준으로 GOI를 재구성함으로써 GOI만으로 이루어진 circRNA가 제작이 가능함을 설명하기 위한 간단한 모식도이다.
도 23b는 목적 유전자 내부에 타겟 사이트 선정과 이를 기준으로 GOI를 재구성한 재구성GOI 구조의 모식도이다.
도 23c는 목적유전자(CVB3 IRES-sGFP)의 염기서열에서 타겟 사이트의 영역을 표시한 것이다.
도 23d는 재구성 목적유전자(CVB3 IRES-sGFP)를 포함하는 자가 환형화 RNA 구조체 발현용 DNA template에서 각 영역을 표시한 것이다.
도 23e는 재구성 목적유전자(CVB3 IRES-sGFP)를 포함하는 자가 환형화 RNA 구조체 발현 벡터를 이용한 IVT 수행 후 PAGE 결과이다.
도 24는 재구성 목적유전자(CVB3 IRES-sGFP)를 포함하는 자가 환형화 RNA 구조체 발현 벡터를 이용한 IVT 수행 후 HPLC 수행 결과이다.
구체적으로, 도 24a 및 도 24b는 목적유전자(CVB3 IRES-sGFP)에서 AU11 target site를 기준으로 재배열된 재구성 목적유전자를 이용한 자가 환형화 RNA 구조체 발현 벡터의 IVT 후 HPLC 수행 결과이다. 도 24c 및 도 24d는 목적유전자(CVB3 IRES-sGFP)에서 AU19 target site를 기준으로 재배열된 재구성 목적유전자를 이용한 자가 환형화 RNA 구조체 발현 벡터의 IVT 후 HPLC 수행 결과이다. 도 24e는 HPLC 수행 조건이다.
도 25는 재구성 목적유전자(CVB3 IRES-sGFP)를 포함하는 자가 환형화 RNA 구조체 발현 벡터를 이용한 IVT 결과물의 HPLC peak에서 4% denatured PAGE를 수행한 결과이다.
도 26a는 목적유전자(CVB3 IRES- R.Luciferase mutant)의 염기서열에서 타겟 사이트의 영역을 표시한 것이다.
도 26b는 재구성 목적유전자(CVB3 IRES- R.Luciferase mutant)를 포함하는 자가 환형화 RNA 구조체 발현용 DNA template에서 각 영역을 표시한 것이다.
도 26c는 재구성 목적유전자(CVB3 IRES- R.Luciferase mutant)를 포함하는 자가 환형화 RNA 구조체 발현 벡터를 이용한 IVT 수행 후 PAGE 결과이다.
도 26d는 재구성 목적유전자(CVB3 IRES- R.Luciferase mutant)를 포함하는 자가 환형화 RNA 구조체 발현 벡터를 이용한 IVT 결과물의 HPLC peak에서 4% denatured PAGE를 수행한 결과이다.
도 27a는 목적유전자(CVB3 IRES- F.Luciferase)의 염기서열에서 타겟 사이트의 영역을 표시한 것이다.
도 27b는 재구성 목적유전자(CVB3 IRES- F.Luciferase)를 포함하는 자가 환형화 RNA 구조체 발현용 DNA template에서 각 영역을 표시한 것이다.
도 27c는 재구성 목적유전자(CVB3 IRES- F.Luciferase)를 포함하는 자가 환형화 RNA 구조체 발현 벡터를 이용한 IVT 수행 후 PAGE 결과이다.
본 발명자들은 circRNA 제작 위하여 트랜스 스플라이싱 리보자임(trans-splicing ribozyme, T/S ribozyme)을 이용하여 목적 유전자를 탑재한 RNA가 스스로 타겟팅 및 스플라이싱 반응을 수행하여 환형화되는 시스템(이하 ‘Circularization system by self-targeting & splicing reaction)을 고안하였다(도 1a 및 도 1b).
그룹 Ⅰ 인트론 리보자임 (Group Ⅰ intron ribozyme)은 두 번의 연속적인 trans-esterification 반응을 통해 표적 RNA를 절단한 후에 절단된 3’ 말단에 별도로 존재하는 전사체를 서로 연결하여 trans-splicing을 유도할 수 있다.
이에, 본 발명의 시스템은 목적 유전자(gene of interest, GOI)의 5’ 방향에 내부 가이드 서열(internal guide sequence, IGS)를 구성하고 3’ 방향에 타겟 사이트(target site)를 구성하여 상기 IGS가 타겟 사이트와 상보적 결합하도록 하되 구아닌(guanine, G) : 우라실(uracil, U) 워블 염기쌍을 형성시켜 GOI와 IGS 사이에 위치하는 ribozyme에 의한 절단 및 접합을 유도하여 circRNA를 제조할 수 있다(도 2a 및 도 2b).
한편, 본 발명자들은 그룹 Ⅰ 인트론 리보자임의 trans-splicing 효율 향상을 위한 이전의 연구(Mol Ther.2005 Nov;12(5):824-34.)에 착안하여 도 2c에 도식화된 바와 같이 자가 환형화 RNA 구조체의 5’ 및 3’ 말단에 서로 상보적 결합이 가능한 AS(antisense sequence) 영역과 ABS(antisense binding sequence)가 존재하고, 리보자임의 2차 구조 앞/뒤에 P1 및 P10 helix가 형성되도록 자가 환형화 RNA 구조체를 설계하고 T7 프로모터 하에서 상기 RNA 구조체를 발현할 수 있는 DNA template 제작하였다(실시예 1).
이어서, 상기 DNA template를 삽입한 벡터를 제조하고 이를 시험관 내에서 전사(in vitro transcription, IVT)시킨 후 circRNA의 형성을 확인하였다. 그 결과, 상기 벡터는 자가 환형화 RNA 구조체를 발현하고, 상기 RNA 구조체는 GTP의 추가 없이도 전사 후 즉시 self-targeting and splicing (STS) 반응을 통해 monomer의 circRNA를 형성함을 알 수 있었다 (실시예 2).
나아가, 본 발명자들은 상기 자가 환형화 RNA 구조체 발현 벡터가 세포 내에서도 본 발명의 RNA 구조체를 발현하고, 발현된 RNA가 circRNA 형태로 탑재한 목전 유전자를 발현할 수 있는지 확인하고자 하였다. 구체적으로 세포 내에서 유전자(transgene)의 번역(translation)이 가능하도록 목적 유전자 내에 IRES 및 종결코돈을 포함시키고, gaussian luciferase를 목적 유전자 내에 transgene으로 이용하여 플라스미드 벡터를 제조하고, 상기 플라스미드 벡터를 세포 내에 형질전환시켜 circRNA의 생성 및 luciferase activity를 확인하였다. 그 결과, 제조된 플라스미드 벡터가 세포 내에서 자가 환형화 RNA 구조체를 발현하고, 상기 구조체는 리보자임에 의해 circRNA로 환형화되고, 상기 circRNA에서 목적 유전자가 발현됨을 분자 수준에서 확인할 수 있었다(실시예 3).
이어서, 본 발명자들은 IVT상에서 즉각적으로 STS (direct STS) 반응을 통해 효율적으로 circRNA를 형성할 수 있도록 RNA 구조체 최적화를 시도하였다.
먼저, 구체적인 실험을 통해 IVT상에서 AS 영역의 길이에 따른 direct STS 반응율을 확인하였다. 구체적으로 상기 AS 영역과 ABS 영역의 길이가 50, 100, 150, 200, 250, 또는 300-nt가 되도록 자가 환형화 RNA 발현 벡터를 제조하고 상기 벡터를 IVT 시킨 후 direct STS 효율을 확인하였다. 그 결과, 200-nt 이상의 길이에서 자가 환형화 효율이 현저하게 감소함을 확인할 수 있었다. 한편, 50, 100, 및 150-nt 길이에서 자가 환형화 효율은 유사하였으나, 50 또는 100-nt 길이의 AS 영역 및 ABS 영역을 포함하는 경우 시험관 내 전사 반응 자체가 감소함을 확인하였는바, cricRNA 제조 효율 측면에서 AS 영역과 ABS 영역의 길이는 150-nt가 바람직함을 확인하였다(실시예 5).
한편, AS 영역 및 ABS 영역의 길이에 따른 circRNA 제조 효율을 확인한 것과 마찬가지로 IVT상에서 spacer 영역의 길이 및 염기서열에 따른 circRNA 제조 효율을 확인한 결과, 그 길이와 염기서열이 circRNA 제조 효율에 큰 영향을 미치지는 않으나 30개의 아데닌(A)이 연결된 것이 ribozyme과 EMCV IRES의 경우에서 ribozyme과 IRES의 좁은 간격으로 인해 발생할 수 있는 구조적 충돌을 만들지 않기에 충분함을 알 수 있었다(실시예 6).
본 발명에서 리보자임은 연속적인 trans-esterification 반응이 가능한 그룹 Ⅰ 인트론 리보자임을 이용하였다. 그룹 Ⅰ 인트론 리보자임은 타겟 사이트 절단 후 절단된 3’ 말단에 별도로 존재하는 전사체를 서로 연결하여 trans-splicing을 유도하는데, 자가 환형화 RNA 구조체에서는 별도로 존재하는 전사체가 아닌 GOI의 5’ 부위를 절단된 3’ 말단에 연결시키는 것인 바, trans-splicing 효율을 증가시키는 것으로 알려진 P1 및 P10 helix 영역과 자가 환형화 RNA 구조체 양 말단의 AS 영역 및 ABS 영역이 circularization 효율에도 긍정적인 영향을 미치는지 확인하고자 하였다.
구체적으로, 본 발명자들은 P1 helix 영역만 포함하거나, P1 및 P10 helix 영역만 포함하거나, P1 및 P10 helix와 AS 영역을 모두 포함하는 자가 환형화 RNA 발현 벡터를 제조하고 상기 벡터를 IVT 시킨 후 direct STS 효율을 확인하였다. 그 결과, 놀랍게도 자가 환형화 RNA 구조체에 P10 helix 영역은 P1 helix와 P10 helix 영역의 존재 하에서 circRNA 제조 효율을 감소시킴을 알 수 있었다. 한편, AS 영역 없이 P1 helix 영역만 포함하는 경우에도 우수한 circRNA 제조 효율을 나타내었다(실시예 7).
나아가, 본 발명자들은 최종 산물인 circRNA에 목적 유전자만 남길 수 있도록 IGS 만이 P1 helix를 형성하도록 자가 환형화 RNA 구조체를 설계하고 다양한 IGS 서열에서 STS 반응이 발생하는지 확인하였다. 그 결과, 놀랍게도 IGS 영역만이 P1 helix를 형성하는 경우에도 DNA 에서 발현된 자가 환형화 RNA 구조체의 STS 반응이 유도되었으며, 나아가 IGS 영역과 타겟 사이트 영역이 서로 상보적이지 않음에도 불구하고 circRNA가 형성됨을 확인하였다. 그러나, IGS 영역과 타겟 사이트 영역이 서로 상보적이지 않은 경우 원하지 않는 부위에서의 비특이적인 반응이 일어날 수 있어 원치않는 산물이 생성될 수 있다. 5’-GNNNNN-3’의 IGS 영역과 5’-N’N’N’N’N’U-3’의 타겟 사이트 영역은 서로 상보적 결합이 가능한 염기서열의 비율이 증가할수록 circRNA 제조 효율이 증가함을 알 수 있었다(실시예 8-1). 나아가, 본 발명자들은 AU-rich에서 환형화 효율이 높은 결과에서 착안하여 IGS의 특정 서열에서 circRNA 제조 효율이 증가될 수 있는지 확인하고자 하였다. 이에, 워블 염기쌍을 형성하는 염기를 제외하고 다양한 조합의 AU-rich의 IGS를 설계하고 이와 상보적인 타겟 사이트를 갖도록 자가 환형화 RNA 구조체 발현 DNA template를 제작하고 circRNA 형성 정도를 확인하였다. 그 결과 모든 조합의 AU-rich IGS에서 circRNA의 생성을 확인할 수 있었으며, 특히, 2개의 A 염기와 3개의 U 염기로 구성된 AU-rich IGS 서열이 비교적으로 자가환형화 효율이 높음을 확인할 수 있었다(실시예 8-2).상기로부터, 본 발명자들은 도 1a에 도식화된 RNA 구조체만으로도 STS 반응을 통해 circRNA를 획득할 수 있으며, 도 20a에 도식화된 자가 환형화 RNA 구조체는 도 20b의 모식도와 같이 circRNA 전구체에서 GOI 3’ 말단에 U 염기를 포함한 목적 유전자만으로 구성된 circRNA를 형성할 수 있음을 확인하였다.
한편, GOI의 3’ 말단이 U 염기로 끝나는 경우 IGS 영역의 염기서열을 GOI와 역상보적으로 설계함으로써 최종적으로 생성되는 circRNA가 GOI 영역만으로 구성되도록 제작할 수 있다(도 20b). 그러나, GOI의 3’말단이 U 염기로 끝나지 않는 경우에는 GOI 만으로 이루어진 circRNA 제작에 어려움이 있다. 본 발명자들은 GOI 내부에서 타겟 사이트를 선정하고, 상기 타겟 사이트를 기준으로 GOI를 재구성함으로써 GOI의 3’ 말단이 U 염기로 끝나지 않는 경우에도 GOI만으로 이루어진 circRNA를 획득할 수 있음을 확인하였다(실시예 9).
타겟 사이트를 목적 유전자의 내부로 선정하는 경우, 타겟 사이트의 우라실 염기를 기준으로 3’ 방향으로 위치하는 GOI의 일부는 “3’ 영역 GOI”라고 명명하고, 상기 3’ 영역 GOI를 제외한 GOI는 “5’ 영역 GOI”라고 명명한다. 이때, 재구성 목적 유전자는 3’ 영역 GOI를 5’ 영역 GOI의 5’ 방향에 연결하여 설계된다. 즉, 재구성 목적 유전자는 5’-[3’ 영역 GOI]-[5’ 영역 GOI]-3’의 구조를 가지며, 이때 [3’ 영역 GOI]과 [5’ 영역 GOI]은 직접적으로 연결된다.
본 발명자들은 단백질 발현용 circRNA 제작을 위해 IRES와 단백질을 암호화하는 transgene을 포함하도록 목적 유전자를 설계하고, 목적 유전자 내부에서 타겟 사이트를 선정한 후 circRNA가 IRES와 transgene만으로 이루어질 수 있도록 재구성 목적 유전자를 설계하여, 자가 환형화 RNA 구조체를 발현하는 벡터를 제작하여 원형 RNA 생성을 확인하였다. 구체적으로, IRES로 CVB3를 포함하고 transgene으로 sGFP(superfolder GFP), RLuc M185V/Q253A, 또는 FLuc 유전자를 포함하는 목적 유전자의 내부에 타겟 사이트를 선정하고 이를 기준으로 재구성 GOI를 설계하여, 재구성 GOI를 포함하는 원형 RNA 전구체 발현 벡터를 제작, IVT 수행, PAGE 및 HPLC 수행을 통해 원형 RNA 생성과 그 수율을 확인하였다(실시예 9-1 내지 9-3). 그 결과, transgene의 종류와 무관하게 재구성 목적 유전자를 포함한 원형 RNA 전구체는 원형 RNA를 생성하였으며, 타겟 사이트의 선정은 원형 RNA 생성 수율에 영향을 미침을 알 수 있었다.
한편, P1 helix는 그룹 Ⅰ 인트론 리보자임의 2차 구조 형성 시 리보자임의 전단(5’ 방향) 방향에 연결된 염기서열과 리보자임에 의해 접합이 유도되는 전사체의 3’ 방향의 염기서열이 상보적인 결합을 통해 형성되는 helix 구조를 의미하며, P10 helix는 상기 리보자임의 전단 영역과 리보자임에 의한 절단되는 전사체의 5’ 방향의 염기서열이 상보적인 결합을 통해 형성되는 helix 구조를 의미한다.
본 발명에서 P1 helix는 본 발명의 자가 환형화 RNA 구조체에서 5’ 말단의 IGS와 3’ 말단의 타겟 사이트의 상보적 결합을 통해 형성될 수 있고, P10 helix는 5’ 말단의 연장된 염기서열과 리보자임의 후단(3’ 방향)에 연결된 염기서열이 상보적인 결합을 통해 형성되는 helix 구조를 의미한다.
본 명세서에서 P1 helix를 형성하는 염기서열을 P1 영역 또는 P1 helix 영역이라고 하며, 마찬가지로 P10 helix를 형성하는 염기서열을 P10 영역 또는 P10 helix 영역이라고 명명한다.
본 발명에서 IGS 영역의 염기서열은 5’-GNNNNN-3’ 이고, target site 영역의 염기서열은 5’-N’N’N’N’N’U-3’으로, P1 helix은 IGS 영역과 target site 영역이 서로 상보적으로 결합하여 형성될 수 있으며, 이때, 중복적인 표현을 배재하기 위하여 P1 helix 영역의 기술은 IGS 영역의 염기서열과 혼용하여 사용될 수 있다.
본 발명에서 P1 helix는 상기 IGS 영역의 5’ 방향으로 연장된 염기서열을 포함하여 형성될 수 있으며, 자연히 연장된 염기서열과 역상보적 서열의 염기서열이 target site의 3’ 방향으로 연장되어 P1 helix를 구성한다. 이때, 상기 연장된 염기서열이 존재하는 경우 본 명세서에서는 IGS 영역과 구분을 위해 상기 연장된 염기서열 영역을 P1으로 표시한다. P10 helix의 경우도 마찬가지 이다.
한편, 본 발명에서 타겟 사이트(target site) 영역은 IGS 영역과 상보적인 결합을 하는 염기서열을 나타내기 위한 것으로서, IGS 영역의 염기서열 설계에 따라서 목적 유전자(GOI) 영역과 중첩될 수 있으며, 이때에도 IGS 영역과 상보적인 결합하는 영역을 특정하기 위하여 목적 유전자 내에서 IGS 영역과 상보적인 결합을 하는 영역을 타겟 사이트로 구분하여 명명한다. 환언하면, 본 발명에서 타겟 사이트는 목적 유전자 영역의 일부 또는 전부와 중첩되거나, 목적 유전자와 별도로 존재할 수 있다.
본 발명에서 AS(antisense sequence) 영역은 자가 환형화 RNA 구조체의 5’ 말단에 위치하여 상기 RNA 구조체의 3’ 말단에 위치하는 ABS(antisense binding sequence) 영역의 염기서열과 수소결합을 목적으로 하는바, 본 발명에서 AS 영역은 ABS 영역과 필수적으로 공존하는 것으로서 AS 영역의 부존재는 ABS 영역의 부존재를 포함하는 의미로 이해되고, 마찬가지로 AS 영역을 포함하는 RNA 구조체는 ABS 영역도 포함하는 것으로 이해된다.
한편, 본 발명자들은 자가 환형화 RNA 구조체의 STS 반응에 의한 환형화 효율에 있어 P1 영역, P10 영역, 및 AS 영역의 3종 구성 존부가 미치는 영향을 확인한 결과 P1 및 P10 영역과 AS 영역을 모두 포함하는 경우, P1 영역만 포함하는 경우, P1 및 P10 영역만 포함하는 경우의 순서로 circRNA 생성량이 많은 것을 확인하였으며, P1 영역만 포함하는 경우의 자가 환형화 RNA 구조체도 충분한 효율로 환형화 되어 circRNA를 생성함을 확인하였는바, 본 발명은 P1 영역만 포함된 경우의 자가 환형화 RNA 구조체를 제공한다.
따라서, 본 명세서에서 P1 영역만 포함된 자가 환형화 RNA 구조체란 P10 영역과 AS 영역이 존재하지 않는 것을 의미하고 이외에 다른 구성을 배제하는 의미로 사용된 것은 아니다. 마찬가지로 P1 영역 및 AS 영역만을 포함하는 자가 환형화 RNA 구조체는 P10 영역이 존재하지 않는 것을 의미하는 것이고 P10 영역 이외의 다른 구성을 배제하는 의미로 사용된 것은 아니다.
이하에서, 첨부된 도면을 참조하여 실시예들을 상세하게 설명한다. 그러나, 실시예들에는 다양한 변경이 가해질 수 있어서 특허출원의 권리 범위가 이러한 실시예들에 의해 제한되거나 한정되는 것은 아니다. 실시예들에 대한 모든 변경, 균등물 내지 대체물이 권리 범위에 포함되는 것으로 이해되어야 한다.
실시예에서 사용한 용어는 단지 설명을 목적으로 사용된 것으로, 한정하려는 의도로 해석되어서는 안된다. 단수의 표현은 문맥상 명백하게 다르게 뜻하지 않는 한, 복수의 표현을 포함한다. 본 명세서에서, "포함하다" 또는 "가지다" 등의 용어는 명세서 상에 기재된 특징, 숫자, 단계, 동작, 구성요소, 부품 또는 이들을 조합한 것이 존재함을 지정하려는 것이지, 하나 또는 그 이상의 다른 특징들이나 숫자, 단계, 동작, 구성요소, 부품 또는 이들을 조합한 것들의 존재 또는 부가 가능성을 미리 배제하지 않는 것으로 이해되어야 한다.
다르게 정의되지 않는 한, 기술적이거나 과학적인 용어를 포함해서 여기서 사용되는 모든 용어들은 실시예가 속하는 기술 분야에서 통상의 지식을 가진 자에 의해 일반적으로 이해되는 것과 동일한 의미를 가지고 있다. 일반적으로 사용되는 사전에 정의되어 있는 것과 같은 용어들은 관련 기술의 문맥 상 가지는 의미와 일치하는 의미를 가지는 것으로 해석되어야 하며, 본 출원에서 명백하게 정의하지 않는 한, 이상적이거나 과도하게 형식적인 의미로 해석되지 않는다.
또한, 첨부 도면을 참조하여 설명함에 있어, 도면 부호에 관계없이 동일한 구성 요소는 동일한 참조부호를 부여하고 이에 대한 중복되는 설명은 생략하기로 한다. 실시예를 설명함에 있어서 관련된 공지 기술에 대한 구체적인 설명이 실시예의 요지를 불필요하게 흐릴 수 있다고 판단되는 경우 그 상세한 설명을 생략한다.
[실시예]
실시예 1. 자가 환형화 RNA 설계 및 상기 RNA 발현 벡터 제조
자가 환형화 RNA는 도 2c와 같이 설계하고, 이를 발현하기 위한 DNA template에 시험관 내 전사 반응을 위하여 T7 promoter 서열을 추가로 포함시켰다(도 2d). 상기 DNA template는 T7 Circular Forward primer: 5’-GGGATTCGAACATCGATTAATACGACTCACTATAGGGGCATCGATTGAATTGTCGA-3’ (Tm = 77.5℃) 및 T7 Circular Reverse primer: 5’-AGATCTCTCGAGCAGCGCTGCTCGAGGCAAGCTT-3’ (Tm = 79.4℃)을 이용하여 PCR로 증폭하고, 상기 DNA template 증폭 산물은 PstI 제한효소를 이용하여 pTOP TA V2 cloning vector (Enzynomics)에 삽입하여 자가 환형화 RNA 발현 벡터를 제조하였다.
실시예 2. 시험관 내 전사 및 자가 환형화 확인
2-1. 시험관 내 전사 (In vitro transcription, IVT)
상기 실시예 1에서 제조한 자가 환형화 RNA 발현 벡터를 NEB의 HiScribe T7 High Yield RNA Synthesis Kit를 이용하여 제조사의 프로토콜에 따라 시험관 내 전사를 수행하였다. 구체적으로, 20 uL scale (1 ug T7 DNA template, 1 X Reaction buffer, 10 mM each ATP, UTP, CTP, GTP, T7 RNA polymerase mix 2 ul)로 37℃에서 3시간 반응 후 29 uL의 Nuclease-free water를 추가한 다음 RNase-free DNase I (10 U/ul) 을 1 uL 넣어 37℃에서 30분 반응시켜 전사 후 즉각적인 circularization (direct STS) 반응을 유도하였다.
이어서, 자가 환형화 반응이 완성되는 단계를 확인하기 위하여 추가의 circularization 반응을 유도하였다. 구체적으로, 첫번째 Self-targeting and splicing(1st STS) 반응을 유도하기 위하여 추가로 Nuclease-free water 28 uL와 20 uL의 5X STS buffer (50 mM Hepes (pH 7.0), 150 mM NaCl, 5 mM MgCl2), 2 uL의 100 mM GTP (최종 2 mM)를 첨가해 100 uL의 볼륨을 만들어 37℃에서 1시간 동안 자가 환형화 반응을 시켰다. 그리고, 55℃에서 15분 가열한 다음 Monarch RNA cleanup kit (NEB)를 이용하여 컬럼 정제를 수행하였다. 컬럼 정제된 50 uL의 샘플에 다시 20 uL의 5X STS buffer, 100 mM GTP (최종 2 mM), Nuclease-free water 28 uL를 넣어 최종 100 uL를 만들고 37℃에서 3시간 반응시켜 두번째 STS(2nd STS) 반응을 유도하였다. 반응 후 55℃에서 8분 가열하고 Monarch RNA cleanup kit (NEB)를 이용하여 컬럼 정제를 수행하고, Nanodrop (Thermo Fisher Scientific 제품)장비를 이용하여 농도를 측정하였다.
한편, 반응 산물에서 linear RNA를 제거하기 위하여 첫번째 및 두번째 STS 반응 후 컬럼 정제된 샘플 중 일부에 대해 RNase R을 처리하였다. 구체적으로, 최대 100 ug 정도의 컬럼 정제된 IVT RNA에 10 uL의 10X RNase R reaction buffer (10X: 0.2 M Tris-HCl pH 8.0, 1 M KCl, 1 mM MgCl2), RNase R 20 Unit을 첨가하여 (물로 볼륨을 100 uL로 맞춤) 37℃에서 30분 반응시킨 다음 추가로 RNase R 10 unit을 첨가해 30분 더 반응시킨 후 Monarch RNA cleanup kit (NEB)를 이용하여 컬럼 정제를 수행하고 Nanodrop으로 농도를 측정하였다.
각 STS 단계별로 얻은 RNA와 각 단계별로 얻은 RNA에 RNase R을 처리한 샘플 각 250 ng은 10 M Urea-BPB (1X TBE) dye와 1:1로 혼합하고 75℃에서 5분간 가열한 후 4% Polyacrylamide-7 M Urea denature PAGE (50℃ 온도 유지하며 50 W 조건으로 2시간 전기영동)를 수행하고, Gel을 SYBR Gold Nucleic Acid Stain 제품 (Thermo Fisher Scientific)으로 염색하여 ImageQuant 800 (Cytiva 제품)을 이용하여 분석하였다.
그 결과, 도 3에서 확인할 수 있는 바와 같이, RNase R을 처리하면 RNase R에 잘 잘리지 않아 풍부해지는 RNA 밴드가 나타났으며 (Candidate 1), 이 밖에 RNase R 처리에도 불구하고 뚜렷하게 관찰이 가능한 밴드들이 확인되었다 (Candidate 2 및 Nicked circular RNA로 추정되는 밴드). 또한, 추가적인 1st 및 2nd STS 반응을 수행하지 않아도 이미 direct STS 반응, 즉 시험관 내 전사 반응만으로 circRNA로 추정되는 물질이 충분히 만들어짐을 확인할 수 있었다.
2-2. 자가 환형화 확인
이어서, 상기 PAGE 수행 결과에서 RNase R에 의해 절단되지 않는 RNA 밴드 중에서 Candidate 1이 circRNA임을 검증하기 위하여 RT-PCR 염기 서열 분석을 수행하였다. 구체적으로 상기 PAGE에서 Candidate 1 위치의 밴드를 잘라 으깬 후 37℃에서 3시간에서 최대 16시간까지 물에 elution하여 Ethanol precipitation으로 정제한 Circular RNA 샘플과 Ribozyme 부위와 antisense부위가 존재하지 않아 원형화될 수 없는 linear RNA를 대조구로 하여 오직 circRNA가 만들어졌을 때에만 PCR 증폭이 가능한 primer를 이용하여 RT-PCR을 수행하였다.
Reverse transcription (RT)은 OneScript Plus RTase (Abm)을 이용하였으며, 125 ng의 각각의 RNA (Control RNA와 Circular RNA로 추정되는 RNA에 RNase R을 처리하거나 처리하지 않은 샘플)를 70℃에서 5분간 가열 후 얼음에 두고 순서대로, 5X RT buffer 4 uL, 10 mM dNTP mix 1 uL, 2 uM reverse primer (Circular STS R) 1 uL, 및 OneScript Plus RTase 200 U을 넣어 최종 20 uL의 볼륨으로 50℃에서 15분간 반응시키고, 95℃에서 5분간 가열하여 효소를 비활성화 시킨 후 얼음에 보관하였다.
이어서, AccuPower Taq PCR premix (바이오니아)을 이용하여 PCR을 수행하였으며, 2 uL의 RT 샘플과 20 uM의 Circular STS F (5’-CCCTGAGTGGCTGAGCTCAGG-3’) 및 Circular STS R (5’-CAGCAAGCATACTAAATTGCCAG-3’)을 1 uL 씩을 넣고 물로 20 uL 볼륨을 맞춰 95℃ 1 분, [95℃ 30초, 65℃ 30초, 72℃ 30초] 35 cycles, 72℃ 5분의 조건으로 PCR 증폭을 수행하였다. 5 uL의 PCR 산물은 1 uL의 6X DNA loading dye에 넣어 150 V로 35분 전기영동 후, gel imaging system (영인과학의 Davinch-Gel 제품)으로 이미지를 분석하였다. 예상되는 STS PCR 산물의 길이는 479 bp이며 1.5% agarose gel (인트론바이오 제품인 RedSafe Nucleic Acid Staining Solution가 1X 농도로 함유)에서 GeneRuler 50 bp DNA ladder (Thermo Fisher Scientific)로 분석했을 때 Circular RNA로 추정되는 RNA 샘플의 경우에만 RNase R 처리에 관계없이 예측되는 사이즈의 특이적인 PCR 산물이 관찰되었다(도 4a).
또한, 얻어진 예상되는 사이즈의 밴드에서 gel extraction kit (코스모진텍 제품)을 이용하여 제조사의 프로토콜에 따라 PCR 산물을 분리 및 정제하고, TOPcloner TA-Blunt kit (엔지노믹스 제품)를 이용하여 클로닝하고 DH5alpha 대장균 (Chemically competent E. coli, 엔지노믹스 제품)에 형질 전환하여 LB-Agar (Kanamycin 포함) 플레이트에서 대장균 colony를 얻고 plasmid DNA를 DNA purification kit (코스모진텍 제품)을 이용하여 제조사의 프로토콜에 따라 추출 및 정제하여 염기서열 분석을 의뢰한 결과 (코스모진텍 회사의 Sanger sequencing 서비스, 업체에서 제공하는 M13R (-40) 혹은 M13F(-20) universal primer를 이용), Gaussia Luciferase의 3‘ 과 IRES의 5’이 STS junction 부위에서 정확히 연결된 것을 확인할 수 있었다(도 4b).
상기 결과로부터, Candidate 1이 원형의 RNA임을 알 수 있다.
2-3. 자가 환형화 재검증
RT-PCR을 통해 Candidate 1이 circRNA임을 확인하였으나, 이론적으로 상기 candidate 1이 dimer의 형태일 가능성을 배제할 수 없다. 이에, nicking test를 수행하여 Candidate 1이 circRNA임을 재검증하고자 하였다.
정제된 원형 RNA candidate 1과 2 (100 ng)에 MgCl2를 각각 최종 0, 2.5, 5 mM로 섞어주고 최종 10 uL의 물에 존재하는 샘플을 65℃에서 30분간 가열한 다음 얼음에 잠시 보관한 후, 10 uL의 10 M Urea-BPB (1X TEB) loading dye를 섞어 주었다.
75℃에서 5분간 가열한 후 4% Polyacrylamide-7 M Urea denature PAGE (50℃ 온도 유지하며 50 W 조건으로 2시간 전기영동)를 수행하고, Gel을 SYBR Gold Nucleic Acid Stain 제품 (Thermo Fisher Scientific)으로 staining하여 ImageQuant 800 (Cytiva 제품)을 이용하여 분석한 결과는 도 5와 같다.
Candidate 1의 경우 Mg2+가 없는 조건에서 약간의 nicked circular RNA에 해당하는 사이즈의 밴드가 포함되어 있었고 (1092-nt), 2.5 mM Mg2+ 조건의 경우 원형 RNA의 위치로 여겨지는 Candidate 1 위치의 밴드가 줄어듦을 확인하였고 여전히 nicked circular RNA 사이즈의 밴드가 존재함을 확인하였다. 5 mM Mg2+ 조건의 경우 nicked circular RNA 밴드까지 가수분해에 의해 전부 사라짐을 확인할 수 있었다. 이를 통해 Candidate 1 즉 원형 RNA가 nicking이 일어났을때 monomer로 예상되는 1092-nt 사이즈를 거쳐 (2.5 mM Mg2+) 결국 전부 분해됨 (5 mM Mg2+)을 관찰하였으므로 Candidate 1이 원형 RNA이며 monomer인것을 재확인할 수 있었다.
한편, Candidate 2는 intact RNA 사이즈인 1874-nt에 유사한 사이즈 (마커의 2000-nt 주위)를 가지며, 2.5 mM Mg2+ 조건의 mild한 nicking 조건에서 Candidate 1과는 다르게 nicked circular RNA의 사이즈인 1092-nt 밴드가 생성되지 않고 사라져 버렸는바, 원형 RNA가 아님을 알 수 있었다.
실시예 3. 세포 내 전사 및 자가 환형화 확인
실시예 2에서 실시예 1에서 제조한 자가 환형화 RNA 발현 벡터가 시험관 내에서 전사되어 circRNA를 형성함을 확인하였는바, 상기 벡터가 세포 내에서도 동일하게 작동하는지, 나아가 circRNA가 포함하는 목적 유전자가 세포 내에서 원활하게 발현되는지 확인하고자 하였다.
세포 내에서 목적 유전자의 발현을 위해 목적 유전자는 5'-EMCV IRES-transgene-stop codon-3’의 구조로 설계하고, 발현된 목적 유전자의 용이한 확인을 위하여 transgene으로는 gaussian luciferase (G.luci)을 이용하였다.
상술한 목적 유전자를 포함하는 자가 환형과 RNA 구조체를 설계하고, 이를 발현할 수 있는 DNA template를 pCMV promoter의 하에서 발현되도록 플라스미드에 삽입하였다(도 6a). 상기 플라스미드 벡터를 293A 세포에 transfection하고, circRNA의 생성을 RT-PCR 및 염기서열 분석을 통해 확인하고, transgene의 발현은 luciferase activity assay를 수행하여 확인하였다.
구체적으로, 6 well plate에 2x105/well로 293A 세포를 seeding 하고 24시간 뒤에 lipofectamine 2000 transfection reagent를 이용하여 상기 플라스미드 벡터로 형질전환하였다. 형질전환 6시간 후 배양액을 교체하였다. 그리고, 형질전환 후 12, 24, 및 48 시간에 100 uL 배양액을 회수하여 G.luci activity를 측정하였다. 배양액에서 G.luci 활성이 검출되었고, 시간이 지남에 따라 활성이 증가함을 확인하였는바, 세포 내 도입된 벡터에서 transgene인 G.luci 유전자가 발현되었음을 확인하였다(도 6b).
Transgene의 발현이 circRNA의 형성에 의한 것인지를 RT-PCR과 염기서열 분석을 통해 분자 수준에서 확인하였다. 형질전환 후 48시간 시간 뒤, 상기 플라스미드 벡터가 도입된 293A 세포에서 trizol reagent를 이용하여 total RNA를 추출한 뒤, RT-PCR을 수행하여 원형 RNA가 생성되었음을 확인하였다.
Reverse transcription (RT)은 OneScript Plus RTase (Abm 제품)을 이용하였으며, 1ug의 total RNA를 70℃에서 5분간 가열 후 얼음에 두고 순서대로, 5X RT buffer 4 uL, 10 mM dNTP mix 1 uL, 2 uM reverse primer (Circular STS R) 1 uL, OneScript Plus RTase 200 U을 넣어 최종 20 uL의 볼륨으로 50℃에서 15분간 반응시키고, 95℃에서 5분간 가열하여 효소를 비활성화 시킨 후 얼음에 보관하였다.
이어서, AccuPower Taq PCR premix (바이오니아 제품)을 이용하여 PCR을 수행하였으며, 2 uL의 RT 샘플과 20 uM의 Circular STS primer F (5’ - caaggacttggagcccatggagcag - 3’)와 primer R (5’ - tgtgccgcctttgcaggtgtatc - 3’)를 1 uL 씩을 넣고 물로 20 uL 볼륨을 맞춰 95℃ 1 분, [95℃ 30초, 65℃ 30초, 72℃ 30초] 35 cycles, 72℃ 5분의 조건으로 PCR 증폭을 수행하였다. 예상되는 STS PCR 산물의 길이는 479 bp이며 1.5% agarose gel (인트론바이오 제품인 RedSafe Nucleic Acid Staining Solution가 1X 농도로 함유)에서 GeneRuler 50 bp DNA ladder (Thermo Fisher Scientific 제품)로 분석했을 때 Circular RNA가 존재할 경우에만 예측되는 사이즈의 특이적인 PCR 산물을 확인할 수 있었다. 이때, 5 uL의 PCR 산물은 1 uL의 6X DNA loading dye에 넣어 150 V로 35분 전기영동 후, gel imaging system (영인과학의 Davinch-Gel 제품)으로 이미지를 분석하였다(도 6c).
또한, 얻어진 예상되는 사이즈의 밴드는 gel extraction kit (코스모진텍 제품)을 이용하여 제조사의 프로토콜에 따라 PCR 산물을 분리 및 정제하고 TOPcloner TA-Blunt kit (엔지노믹스 제품)와 이용하여 클로닝하고 DH5alpha 대장균 (Chemically competent E. coli, 엔지노믹스 제품)에 형질 전환하여 LB-Agar (Kanamycin 포함) 플레이트에서 대장균 colony를 얻고 plasmid DNA를 DNA purification kit (코스모진텍 제품)과 매뉴얼을 이용하여 추출, 정제하여 염기서열 분석을 의뢰한 결과 (코스모진텍 회사의 Sanger sequencing 서비스, 업체에서 제공하는 M13R (-40) 혹은 M13F(-20) universal primer를 이용), Gaussia Luciferase의 3' 과 IRES의 5’이 STS junction 부위에서 정확히 연결된 염기서열을 확인할 수 있었다(도 6d).
상기로부터, 제조된 플라스미드 벡터가 세포 내에서 자가 환형화 RNA 구조체를 발현하고, 상기 구조체는 리보자임에 의해 circRNA로 환형화되고, 상기 circRNA에서 목적 유전자가 발현됨을 분자 수준에서 확인할 수 있었다.
실시예 4. circRNA 정제
4-1. HPLC 수행으로 circRNA 정제 가능성 확인
인체 주입을 위한 circRNA 제조에 있어 면역원성 발생을 최소화하기 위하여 HPLC를 이용한 분석 및 정제를 수행하였다. 구체적으로, agilent 1290 Infinity II Bio UHPLC 시스템을 이용하였으며 분석 조건은 도 7a와 같다. 분석의 경우 [Analytical]의 gradient 조건을 사용하였으며, 샘플의 분취는 [Fraction collection]의 조건을 사용하였다.
IVT를 하고나서 Monarch RNA cleanup kit (NEB)를 사용해 컬럼 정제만 한 RNA(도 7b)와 RNase R을 처리한 RNA(도 7c)를 분석해 보았을 때 RNase R을 처리한 샘플에서 증가하는 peak이 존재하며 이로부터 RNase R 처리 없이도 circRNA를 HPLC로 분리할 수 있음을 알 수 있었다.
4-2 HPLC 수행으로 circRNA 정제
HPLC를 통해 fraction collection 조건에 나와있는 gradient를 이용하여 분취하였고 도 8a와 같이 각각의 fraction을 확보하였다. Peak가 확연한 7번, 및 10번 내지 13번 fraction을 4% denature PAGE에서 각 200 ng씩 걸어 앞선 방법과 동일하게 전기영동을 수행하였다.
그 결과, 도 8b에서 확인할 수 있는 바와 같이, fraction 12에서 깨끗한 circular RNA가 분리 정제되었다.
실시예 5. AS(antisense sequence) 영역 최적화
시험관 내 전사 과정 중에서 즉각적인 환형화 반응에 AS(antisense sequence) 영역과 이에 역-상보적인(reverse complementary) ABS(antisense binding sequence) 영역의 길이가 미치는 영향을 확인하고자 하였다. 이에, AS 영역과 ABS 영역의 길이를 50, 100, 150, 200, 250, 또는 300-nt로 달리하는 DNA template를 제작하고(도 9), 실시예 1과 동일하게 각각의 RNA 구조체를 발현할 수 있는 벡터를 제조하고, 실시예 2와 동일하게 37℃에서 3시간 동안 시험관 내 전사를 수행하고 즉각적인 STS 반응 정도를 4% Polyacrylamide-7 M Urea gel(20 x 20 cm, 1 mm)에서 PAGE를 수행하여 Relative band intensity로 비교확인하였다.
각 AS 영역의 염기서열은 아래 표 1에 나타내었다.
구분 염기서열(5’ --> 3’)
AS50 AAGTTAGGGCCTTCTGTGCCATTCATGGCTGTGGCCCTTGTGGCTGACCC
AS100 ACTCGAAGTGGCTGCGTACCACACCCGTCGCATTGGAGAAGGGCACGTAGAAGTTAGGGCCTTCTGTGCCATTCATGGCTGTGGCCCTTGTGGCTGACCC
AS150 GGCGGCCAGCATGGAGAACTGCCATGGCTCAGCCAGGTAGTACTGTGGGTACTCGAAGTGGCTGCGTACCACACCCGTCGCATTGGAGAAGGGCACGTAGAAGTTAGGGCCTTCTGTGCCATTCATGGCTGTGGCCCTTGTGGCTGACCC
AS200 AGCGTGAGGAAGTTGATGGGGAAGCCCAGCACGATCAGCAGAAACATGTAGGCGGCCAGCATGGAGAACTGCCATGGCTCAGCCAGGTAGTACTGTGGGTACTCGAAGTGGCTGCGTACCACACCCGTCGCATTGGAGAAGGGCACGTAGAAGTTAGGGCCTTCTGTGCCATTCATGGCTGTGGCCCTTGTGGCTGACCC
AS250 GGATGTAGTTGAGAGGCGTGCGCAGCTTCTTGTGCTGGACGGTGACGTAGAGCGTGAGGAAGTTGATGGGGAAGCCCAGCACGATCAGCAGAAACATGTAGGCGGCCAGCATGGAGAACTGCCATGGCTCAGCCAGGTAGTACTGTGGGTACTCGAAGTGGCTGCGTACCACACCCGTCGCATTGGAGAAGGGCACGTAGAAGTTAGGGCCTTCTGTGCCATTCATGGCTGTGGCCCTTGTGGCTGACCC
AS300 GGTGAAGCCACCTAGGACCATGAAGAGGTCAGCCACGGCTAGGTTGAGCAGGATGTAGTTGAGAGGCGTGCGCAGCTTCTTGTGCTGGACGGTGACGTAGAGCGTGAGGAAGTTGATGGGGAAGCCCAGCACGATCAGCAGAAACATGTAGGCGGCCAGCATGGAGAACTGCCATGGCTCAGCCAGGTAGTACTGTGGGTACTCGAAGTGGCTGCGTACCACACCCGTCGCATTGGAGAAGGGCACGTAGAAGTTAGGGCCTTCTGTGCCATTCATGGCTGTGGCCCTTGTGGCTGACCC
그 결과, 도 10 및 하기 표 2에서 확인할 수 있는 바와 같이, AS50, AS100, AS150의 경우 자가 환형화 효율이 AS200이상의 길이에 비해 상대적으로 우수하였다. 한편, AS50과 AS100은 시험관 내 전사 반응이후 생산된 전체 RNA 현저하게 적었다. 따라서, 자가 환형화 RNA 구조체 발현 및 원형의 RNA 제작에 있어 AS150이 가장 최적의 길이임을 알 수 있었다.
AS series AS50 AS100 AS150 AS200 AS250 AS300
A: 생성된 Total RNA 양 (μg) 69.5 ± 1.77 9.15 ± 0.46 176.5 ± 3.89 140 ± 3.54 133 ± 2.83 141 ± 5.66
B: Relative band intensity of circular RNA (%) 6.35 ± 0.25 6.75 ± 0.04 5.95 ± 0.18 4.30 ± 0.07 4.20 ± 0.07 3.60 ± 0.14
Relative factor
(A * B)		 441 62 1050 602 559 508
실시예 6. Spacer 영역 최적화
이어서, 시험관 내 전사 과정 중에서 즉각적인 환형화 반응에 spacer 영역의 길이 또는 종류가 미치는 영향을 확인하고자, 서로 다른 길이 및 염기서열의 spacer 영역을 포함하는 DNA template를 제작하고(도 11), 실시예 1과 동일하게 각각의 RNA 구조체를 발현할 수 있는 벡터를 제조하고, 실시예 2와 동일하게 37℃에서 3시간 동안 시험관 내 전사를 수행하고 즉각적인 STS 반응 정도를 4% Polyacrylamide-7 M Urea gel(20 x 20 cm, 1 mm)에서 PAGE를 수행하여 Relative band intensity로 비교확인하였다. 각 spacer 영역의 염기서열은 하기 표 3과 같으며, 본 실험에서 A10, A30, 및 A30의 spacer는 spacer 영역의 바로 뒤에 IRES 삽입을 위하여 3’ 말단에 제한 인식 부위(restriction site)을 부가하여 이용하였다. 본 실험에서는 spacer의 3’말단에 AatⅡ site (GACGTC)를 부가하여 이용하였다.
구분 염기서열(5’ --> 3’)
A10 AAAAAAAAAA
A30 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
A50 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Control spacer 1 GGTAGTGGTGCTACTAACTTCAGCCTGCTGAAGCA
Control spacer 2 GGTAGTAAACTACTAACTACAACCTGCTGAAGCA
그 결과, 도 12 및 하기 표 4에서 확인할 수 있는 바와 같이, spacer의 길이와 sequence 차이에도 불구하여 시험관 내 전사 과정에서 즉각적인 환형화 효율에 큰 차이를 나타내지 않았으나, 자가 환형화 RNA 구조체 발현 및 원형의 RNA 제작에 있어 A30이 가장 최적의 spacer로 작동함을 알 수 있었다.
AS150
Spacer version		 A10 Control spacer 1 Control spacer 1 A30 A50
A: 생성된 Total RNA 양 (μg) 199.5 ± 9.19 199.5 ± 6.36 187 ±
5.66		 190 ±
8.49		 192.5 ± 0.71
B: Relative band intensity of circular RNA (%) 5.55 ±
0.35		 6.7 ±
0.14		 6.15 ±
0.07		 6.5 ±
1.27		 5.7 ±
0.85
Relative factor
(A * B)		 1106 ±
19		 1311 ±
70		 1150 ±
21		 1240 ±
297		 1097 ±
160
실시예 7. 자가 환형화 RNA 구조체 최적화
7-1. AS 영역, P1 helix, 및 P10 helix 영역
실시예 1에서 설계한 자가 환형화 RNA 구조체는 AS 영역, P1 helix, 및 P10 helix 영역을 포함한다. 이하, 각 구성이 시험관 내 전사 과정 중에서 즉각적인 환형화 반응에 미치는 영향을 확인하고자 도 13에 도식화한 것과 같이 P1 helix 영역만 포함하거나, P1 및 P10 helix 영역만 포함하거나, P1 및 P10 helix와 AS 영역을 모두 포함하는 DNA template를 제작하고 실시예 1과 동일하게 각각의 RNA 구조체를 발현할 수 있는 벡터를 제조하고, 실시예 2와 동일하게 37℃에서 3시간 동안 시험관 내 전사를 수행하고 즉각적인 STS 반응 정도를 4% Polyacrylamide-7 M Urea gel(20 x 20 cm, 1 mm)에서 PAGE를 수행하여 Relative band intensity로 비교확인하였다.
P1 helix 영역만 포함하는 T7 DNA template의 염기서열은 도 14과 같다.
그 결과, 도 15 및 하기 표 5에서 확인할 수 있는 바와 같이, 각각의 벡터가 시험관 내 전사 생성된 총 RNA 에는 큰 차이가 없었으나, P1 및 P10 helix와 AS 영역을 모두 포함하는 경우, P1 helix 영역만 포함하는 경우, P1 및 P10 영역만 포함하는 경우의 순서로 원형 RNA 생성량이 많은 것을 알 수 있었다.
AS150 P1 (No AS) P1&P10 (No AS) P1&P10 (AS150)
A: 생성된 Total RNA 양 (μg) 200 196 182
B: Relative band intensity of circular RNA (%) 3.2 0.5 5.1
Relative factor (A * B) 640 98 928
7-2. P10 및 AS 영역을 포함하지 않는 자가 환형화 RNA 구조체의 환형화 검증
실시예 7-1의 결과로부터 P10 및 AS 영역을 포함하지 않는 DNA template(P1 구조체)에서 시험관 내 전사 과정 중에서 추가적인 circularization 단계 없이도 충분한 circRNA를 제조할 수 있음을 알 수 있다. 이를 검증하기 위하여 실시예 7-1의 STS 반응 후 산물에 RNase R을 처리하여 linear RNA를 제거하고 앞선 실험과 동일하게 PAGE를 수행하고, 실시예 2-2와 동일하게 RT-PCR 및 염기서열 분석을 수행하였다.
그 결과, 도 16a 및 도 16b에서 확인할 수 있는 바와 같이, P1 구조체를 이용해 자가 환형화를 수행한 경우에도 RNase R을 처리하면 RNase R에 잘 잘리지 않아 풍부해지는 RNA 밴드가 관찰되었으며, 상기 밴드에 STS 반응 산물을 RT-PCR과 염기서열 분석을 수행한 결과, circRNA임을 확인하였다.
실시예 8. P1 helix 영역 최적화
8-1. P1 helix 영역과 자가환형화
실시예 7의 결과를 통해 P10과 AS 및 ABS가 없는 자가 환형화 구조체도 충분하게 circRNA를 만들 수 있음을 확인하였다. 이에, P1 helix를 구성하는 5’ 말단에 존재하는 Internal Guide Sequence (IGS)와 3’ 말단에 존재하는 target site의 염기서열만 서로 상보적으로 결합하게 하면 (U와 G는 wobble base pair) 원형 RNA가 생성될 것으로 가정하고 이를 검증하고자 하였다.
IGS 영역은 GNNNNN이고, Target site 염기서열은 N’N’N’N’N’U이기 때문에 GOI에 U 한 개의 뉴클레오타이드만 추가하면 최종적으로 생성되는 circRNA는 한 개의 U 염기와 GOI 영역만으로 구성된다 (도 1a 및 도 1b). 또한, GOI의 3’ 말단이 U 염기로 끝나는 경우 IGS 영역의 염기서열을 GOI와 역상보적으로 설계함으로써 최종적으로 생성되는 circRNA가 GOI 영역만으로 구성되도록 제작할 수 있다 (도 20a 및 도 20b).
도 17에 나타낸 바와 같이 IGS와 target site의 서열을 다양하게 설계하고 실시예 1의 방법으로 벡터를 제조한 후 실시예 2-1의 시험관 내 전사(IVT)를 수행하였다.
그 결과, 도 18-19 및 하기 표 6에서 확인할 수 있는 바와 같이, 양쪽 말단이 Complementary한 시퀀스를 가진 경우 시험관 내 전사 후 즉각적인 STS 반응을 통해 생성된 circRNA 증가를 확인할 수 있었으며, 특히 IGS와 target site가 AU-rich 서열인 경우 circRNA 생성 효율이 보다 높음을 확인할 수 있었다. 한편, No-complement IGS 영역을 포함하는 벡터는 매우 낮은 수준의 circRNA를 생성함을 알 수 있었다. 상기로부터, IGS와 target site는 서로 상보적이라면 모두 효율적으로 자가 환형화 반응을 유도할 수 있음을 알 수 있다.
P1 variants
(No AS)		 AS150
(P1&P10)		 RZ004 RZ001 RZ003 GC-rich AU-rich 2 sites No complement
Relative band intensity of circular RNA (%) 5.4 3.7 7.9 6.6 5.4 11.6 6.1 1
8-2. P1 helix 영역 최적화
IGS와 target site의 서열이 상보적인 경우 시험관 내 전사 후 즉각적인 STS 반응이 발생하지만, 특히 AU-rich의 IGS 및 target site의 서열에서 보다 STS 반응이 활발하게 일어남을 알 수 있었다. 이어서, P1 helix를 구성하는 A 및 U의 염기 중에서 특정 서열이 자가환형화 효율에 영향을 미치는지 확인하고자 총 32개 조합의 AU-rich의 IGS를 설계하고 상기 IGS에 상보적인 서열을 갖도록 target site를 제작하고 앞선 실시예 8-1과 동일하게 실험을 수행하였다(도 21). 동일한 조건 설정을 위하여 GOI는 32개의 AU-rich 서열이 존재하지 않도록 선택하였으며, 상기 IGS가 target site 외에 다른 영역과 상보결합할 수 있는지 제작된 자가 환형과 RNA 구조체에서 상기 IGS와 상보적인 AU-rich의 서열을 계수하였다. 17번 및 18번의 IGS과 상보적인 서열은 ribozyme 서열 내에서 1개 확인되었으며, 그 외에 다른 IGS과 상보적인 서열은 상기 RNA 구조체 내에서 확인되지 않았다. 한편, ribozyme은 그 내부 서열을 타겟팅하여 스플라이싱할 수 없으므로, 17번 및 18번의 IGS를 포함하는 자가 환형화 RNA 구조체 발현 벡터에서 생산되는 환형 RNA는 상기 IGS와 target site의 상보결합으로 ribozyme에 의해 타겟팅 및 스플라이싱되어 생성된 것이다.
20 uL scale (1 ug T7 DNA template, 1 X Reaction buffer, 10 mM each ATP, UTP, CTP, GTP, T7 RNA polymerase mix 2 ul)로 37℃에서 3시간 반응 후 29 uL의 Nuclease-free water를 추가한 다음 RNase-free DNase I (10 U/ul) 을 1 uL 넣어 37℃에서 30분 반응시켰다. 이어서, Monarch RNA cleanup kit (NEB)를 이용하여 컬럼 정제를 수행하고, Nanodrop (Thermo Fisher Scientific 제품)장비를 이용하여 농도를 측정하였다. 각 샘플 250 ng은 10 M Urea-BPB (1X TBE) dye와 최소 샘플:Dye=1:1 혹은 Dye가 비율이 더 높게 잘 섞은 후 75℃에서 5분간 가열한 후 50℃ 온도 유지하며 50 W 조건으로 4% Polyacrylamide-7 M Urea denature PAGE(SYBR Gold Nucleic Acid Stain, Thermo Fisher Scientific) 상에서 2시간 동안 전기영동을 하여 환형 RNA 생성을 확인하였다.
1번 내지 16번의 IGS 조건에서 결과는 도 22a과 같으며, 14, 15, 및 16번의 IGS 조건 하에서 Relative band intensity가 높게 나타났으며, 그 중에서 16번의 IGS 서열에서 자가 환형화 효율이 가장 높은 것을 알 수 있었다.
나머지 17번 내지 32번의 IGS 조건에서 결과는 도 22b와 같으며 17, 18, 25, 28-32번의 IGS 서열에서 Relative band intensity가 높게 나타났다. 반복 실험을 통한 환형 RNA 밴드의 강도와 일정한 정도를 고려하였을 때, 2개의 A 염기와 3개의 U 염기로 구성된 AU-rich IGS 서열이 비교적으로 자가환형화 효율이 높았으며, 16번의 IGS 서열에서 자가환형화 효율이 가장 높고, 이어서 28번 IGS 서열에서 자가환형화 효율이 높음을 알 수 있었다.
실시예 9. GOI 재구성
추가로, 본 발명자들은 GOI 만으로 이루어진 circRNA 제작을 위하여, IGS와 워블 염기쌍을 형성할 수 있는 GOI 영역을 target site로 선택하여 circRNA를 형성하도록 하였다. 그러나, GOI 내부에 target site를 선택하고 그대로 circRNA를 형성할 경우 target site의 하류(downstream)영역의 GOI는 리보자임에 의해 절단되어 circRNA에 포함되지 않는다. 이에, target site 영역의 상류(upstream)과 하류에 위치하는 GOI를 재구성할 필요가 있다(도 23a). 이하에서는 target stie 영역의 하류에 위치하는 GOI 영역은 3’ 영역 GOI(3’ Region of GOI)라고 하고, 3’ 영역 GOI 을 제외한 GOI 영역은 5’ 영역 GOI(5’ Region of GOI)라고 한다.
즉, 본 발명자들은 GOI 내부에 워블 염기쌍을 형성할 수 있는 U 염기를 포함하여 그 상류에 위치한 5개 염기를 target site로 선정하고 U 염기 하류에 위치한 3‘ 영역 GOI를 5’ 영역 GOI의 상부에 위치하도록 GOI를 재구성함으로써 형성된 circRNA가 온전한 GOI로 구성될 수 있도록 설계하였다.
한편, GOI 내부에는 워블 염기쌍을 형성할 수 있는 U 염기가 2개 이상 포함될 수 있다. 이에, target site의 여러 개 후보 영역이 GOI 내부에 존재하는 경우, 효율적인 circRNA 제작을 위하여 실시예 8-2에서 확인한 바와 같이, target site는 U 염기 상류에 연속된 5개 염기가 A 및 U의 함량이 높은 것으로 선정한다. 도면에서 A 및 U의 함량이 높은 영역은 “AU rich”로 표기된다.
도 23b는 GOI 내부에 target site 선정과 그에 따른 GOI 재구성의 일례를 도식화한 것이다.
이하에서는 본 발명자들은 상술한 target site 선정과 GOI 재구성을 통해 의도한 circRNA를 제작할 수 있는지 확인하고자 하였다. 구체적으로, IRES로 CVB3를 이용하고 transgene으로 sGFP, RLuc M185V/Q253A, 또는 FLuc 유전자를 이용한 GOI에서 GOI 내부에 target site를 선정하고 GOI를 재구성하여 원형 RNA 전구체 발현 벡터를 제작하고 IVT를 수행하였다. 비교를 위하여 Spacer 영역에 target site를 설정한 원형 RNA 전구체를 제작하였으며, spacer 영역에 위치한 target site는 spacer target이라고 명명한다. 구체적인 경우의 원형 RNA 전구체는 도면에서 설명된다. 각 원형 RNA 전구체의 IVT 수행 결과물을 이용하여 PAGE 및 HPLC를 통해 원형 RNA 생성과 그 수율을 확인하였다.
9-1. GOI : CVB3 IRES-sGFP
CVB3 IRES에 의해 sGFP가 발현될 수 있도록 목적 유전자를 설계하였다. CVB3 IRES에서 AU rich의 target site 후보 영역이 2개를 선정하였다(각각 AU11 및 AU19로 표시함) 존재한다. 도 23c는 상기 목적 유전자의 서열과 그 내부에 존재하는 2개의 AU rich target site 영역을 표시한 것이다. Spacer target은 컨트롤로 이용하였다. 최초 설계된 spacer region(AC40 spacer)는 target site의 후보가 될 수 있는 영역이 존재하지 아니한다. 한편, 선행연구에서 Spacer region의 길이는 원형화 효율에 영향을 미치지 아니함이 확인된 바 있다. 이에, spacer target은 AC108 spacer를 별도로 설계하여 원형 RNA 전구체에 포함되도록 제작하였다.
상기 목적 유전자의 AU11 또는 AU19의 target site 상류 및 하류의 GOI를 재구성하고, IVT를 수행하여 circRNA 형성을 확인하였다. 도 23d는 AU11을 target site로 선정한 경우에 원형 RNA 전구체 발현을 위한 DNA template로서 각 영역을 표시한 것이다. AU19를 target site로 선정한 경우도 AU11을 target site로 선정한 경우와 마찬가지로 GOI를 재구성하여 DNA template를 설계하고 각각을 실시예 1의 방법에 따라 벡터로 제조한 후 실시예 2-1의 시험관 내 전사(IVT)를 수행하였다.
IVT 후 PAGE를 수행하여 circRNA 생성을 확인하였다(도 23e). 그 결과, AU11 및 AU19를 target site로 하는 원형 RNA 전구체는 STS 반응을 통해 circRNA를 형성하였음을 확인할 수 있었으며, AU11 target site의 원형 RNA 전구체에서 보다 높은 효율의 환형화를 확인할 수 있었다.
상기 PAGE 결과를 IP-RP HPLC를 수행하여 재확인하였다(도 24a 내지 24d). AU11 target site를 이용한 자가환형화를 수행하고 RNase R를 처리한 샘플을 분석했을 때 높은 수준의 원형 RNA peak을 볼 수 있었다. 반면, PAGE의 결과와 동일하게 상대적으로 자가환형화 효율이 떨어지는 AU19 target site를 이용한 자가환형화 구조체는 RNase R 처리 후 HPLC로 분석하였을 때 circRNA peak이 상대적으로 작은 것을 볼 수 있었다. 상기 IP-RP HPLC 결과로부터 확인되는 각각의 peak(도 24b 및 도 24d에서 peak)를 대상으로 4% denatured PAGE를 수행하였으며, 원형 RNA가 정제됨을 확인하였다(도 25).
아래의 표 7은 GOI 내부에서 target site 선정에 따라 설계된 원형 RNA 전구체의 자가환형화 효율과 최종 수율을 나타낸 것이다. 표 7에서 AU16 및 AU28은 도 23c에 표시하지 않았으며, Spacer에 위치한 target site (5’-ACGGCU-3’)는 비교하기 위한 컨트롤이다.
IRES P1 target site Gene 최종 Circular 획득 효율 (%)
= IP-RP HPLC룰 통해 정제된 Circular RNA 양/IVT 양
CVB3 AU16 GFP 6.2
AU28 6.5
AU11 22.9
AU19 1.9
spacer 6.6
상기 결과는 완전히 동일한 GOI 서열이나 P1 구조체를 위한 AU rich target site를 무엇으로 선택하는지에 따라 자가 환형화 효율과 최종 수율에 현저한 차이가 나타남을 제시한다.
9-2. GOI : CVB3 IRES-R.Luciferase(M185V/Q235A)
CVB3 IRES에 의해 RLuc 돌연변이(M185V/Q235A)가 발현될 수 있도록 목적 유전자를 설계하였다. 상기 목적 유전자의 서열 내부에서 AU11 target site를 선정하고 이를 기준으로 GOI를 재구성하여 DNA template를 설계하고 실시예 1의 방법에 따라 벡터로 제조한 후 실시예 2-1의 시험관 내 전사(IVT)를 수행하였다. Spacer target은 컨트롤로 이용하였다. 실시예 9-1과 동일하게 컨트롤로 이용된 원형 RNA 전구체는 AC108 spacer가 포함되도록 설계 및 제작하였다.
도 26a는 상기 목적 유전자의 서열과 그 내부에 존재하는 AU rich target site 영역을 표시한 것이고, 도 26b는 선정한 AU11 target site 영역을 기준으로 GOI를 재구성한 원형 RNA 전구체 발현 DNA template을 구체적인 서열과 각 영역을 표시한 것이다.
IVT 수행 후 PAGE를 수행한 결과는 도 26c와 같으며, AU11을 target site로 하는 원형 RNA 전구체는 STS 반응을 통해 circRNA를 형성하였으며, 이는 IP-RP HPLC 수행을 통해 재확인되었다. HPLC의 피크에서 4% denatured PAGE를 수행하여 원형 RNA가 정제된 것을 확인하였다(도 26d).
AU11을 target site로 하는 경우 원형 RNA 수율은 아래 표 8과 같다.
IRES P1 target site Gene 최종 Circular 획득 효율 (%)
= 정제된 Circular RNA 양/IVT 양
CVB3 spacer R.Luci 2.1
AU11 13.7
9-3. GOI : CVB3 IRES-F.Luciferase
실시예 9-2에서 transgene을 F.luciferase로 변경하여 동일한 실험을 수행하였다.
도 27a는 목적 유전자의 서열과 그 내부에 존재하는 AU rich target site 영역 및 spacer target site 영역을 표시한 것이고, 도 27b는 선정한 AU11 target site 영역을 기준으로 GOI를 재구성한 원형 RNA 전구체 발현 DNA template을 구체적인 서열과 각 영역을 표시한 것이다. Spacer target은 컨트롤로 이용되었으며, 금번 실험에서 원형 RNA 전구체는 모두 AC108 spacer가 포함되도록 설계 및 제작하였다.
IVT 수행 후 PAGE를 수행한 결과는 도 27c와 같으며, AU11을 target site로 하는 원형 RNA 전구체는 STS 반응을 통해 circRNA를 형성하였으며, 이는 IP-RP HPLC 수행을 통해 재확인되었다. HPLC의 피크에서 4% denatured PAGE를 수행하여 원형 RNA가 정제된 것을 확인하였다(도 27d).
IRES P1 target site Gene 최종 Circular 획득 효율 (%)
= 정제된 Circular RNA 양/IVT 양
CVB3 spacer FLuc N.C.
AU11 (AC 108) 5.7
상기 결과로부터, 목적유전자 내에 transgene의 종류에 상관없이 목적유전자 내부에 target site를 선정하고 그에 따라서 GOI를 재구성하는 경우에도 원형 RNA 전구체에 의해 온전한 형태의 GOI만을 포함하는 원형 RNA가 형성됨을 알 수 있다.
이상과 같이 실시예들이 비록 한정된 도면에 의해 설명되었으나, 해당 기술분야에서 통상의 지식을 가진 자라면 상기를 기초로 다양한 기술적 수정 및 변형을 적용할 수 있다. 예를 들어, 설명된 기술들이 설명된 방법과 다른 순서로 수행되거나, 및/또는 설명된 시스템, 구조, 장치, 회로 등의 구성요소들이 설명된 방법과 다른 형태로 결합 또는 조합되거나, 다른 구성요소 또는 균등물에 의하여 대치되거나 치환되더라도 적절한 결과가 달성될 수 있다.
그러므로, 다른 구현들, 다른 실시예들 및 특허청구범위와 균등한 것들도 후술하는 청구범위의 범위에 속한다.
본 발명은 시험관 내, 세포 내, 및 생체 내에서 단백질 발현을 위한 circRNA 제조에 이용될 수 있으며, miRNA, anti-miRNA, shRNA, aptamer, mRNA 백신, mRNA 치료제, 항체, 백신 보조제, CAR-T mRNA 등의 기능성 RNA를 circRNA로 제조하는 것에 이용될 수 있다.

Claims (26)

  1. 자가 환형화 RNA 구조체로서,
    상기 구조체는 5' - IGS (internal guide sequence) - 리보자임(Ribozyme) - 목적 유전자 (gene of interest) - 타겟 사이트(target site) - 3'의 구조를 가지며,
    상기 IGS 영역은 타겟 사이트와 구아닌(Guanine, G) : 우라실(Uracil, U) 워블 염기쌍(wobble base pair)을 형성하고,
    상기 워블 염기쌍을 형성하는 구아닌은 IGS 영역의 5’ 말단에 위치하고,
    상기 워블 염기쌍을 형성하는 우라실은 타겟 사이트 영역의 3’ 말단에 위치하며,
    상기 IGS 영역은 워블 염기쌍을 형성하는 염기 외에는 아데닌(Adenine, A) 또는 우라실로 이루어진 것인, 자가 환형화 RNA 구조체.
  2. 제1항에 있어서,
    상기 타겟 사이트 영역은 목적 유전자 영역과 중첩된 것인, 자가 환형화 RNA 구조체.
  3. 제1항에 있어서,
    상기 IGS 영역의 염기 서열은 상기 구아닌을 제외하고 타겟 사이트의 영역의 염기서열과 역상보적인 것을 특징으로 하는, 자가 환형화 RNA 구조체.
  4. 제1항에 있어서,
    상기 리보자임은 그룹 Ⅰ 인트론 리보자임 (Group Ⅰ intron ribozyme)인, 자가 환형화 RNA 구조체.
  5. 제1항에 있어서,
    상기 리보자임은 서열번호 6의 염기서열을 포함하는 것인, 자가 환형화 RNA 구조체.
  6. 제1항에 있어서,
    상기 구조체는 IGS 영역의 5’ 방향으로 연장된 뉴클레오티드를 포함하여 P10 helix를 형성하는 것인, 자가 환형화 RNA 구조체.
  7. 제1항에 있어서,
    상기 구조체는 IGS 영역의 5’ 방향 및 타겟 사이트의 3’ 방향으로 연장된 뉴클레오티드를 포함하여 P1 helix를 형성하는 것인, 자가 환형화 RNA 구조체.
  8. 제7항에 있어서,
    상기 구조체는 P10 helix를 형성하지 않는 것인, 자가 환형화 RNA 구조체.
  9. 제1항 또는 제6항에 있어서,
    상기 구조체는 IGS 영역의 5’ 방향으로 AS(antisense sequence) 영역과,
    타겟 사이트의 3’ 방향으로 상기 AS 영역과 상보적으로 결합할 수 있는 ABS(antisense binding sequence) 영역을 추가로 포함하는 것인, 자가 환형화 RNA 구조체.
  10. 제9항에 있어서,
    상기 AS 영역의 길이는 50 내지 400 nt 인 것인, 자가 환형화 RNA 구조체.
  11. 제1항에 있어서,
    상기 목적 유전자 영역은 5’ 말단에 IRES (internal ribosome entry site) 영역을 포함하는 것인, 자가 환형화 RNA 구조체.
  12. 제1항에 있어서,
    상기 구조체는 리보자임 영역과 목적 유전자 영역이 무작위 염기서열로 이루어진 스페이서 (Spacer) 영역으로 연결된 것인, 자가 환형화 RNA 구조체.
  13. 제1항에 있어서,
    상기 구조체는 목적 유전자 영역과 타겟 사이트 영역이 무작위 염기서열로 이루어진 스페이서 (Spacer) 영역으로 연결된 것인, 자가 환형화 RNA 구조체.
  14. 제1항의 자가 환형화 RNA 구조체를 발현하는 벡터.
  15. 제14항에 있어서,
    상기 벡터는 자가 환형과 RNA를 암호화하는 유전자와 작동 가능하게 연결된 프로모터를 포함하는 것인, 벡터.
  16. 자가 환형화 RNA 구조체로서,
    상기 구조체는 5' - IGS (internal guide sequence) - 리보자임(Ribozyme) - 재구성 목적 유전자 (reconstructed gene of interest) - 3'의 구조를 가지며,
    상기 재구성 목적 유전자는 목적 유전자의 배열을 달리한 것으로서,
    상기 목적 유전자는 우라실(Uracil, U) 염기를 포함하고,
    상기 재구성 목적 유전자는 상기 우라실 염기의 3’ 방향으로 연결된 목적 유전자의 3’ 영역이 상기 목적 유전자의 5’ 말단에 연결되어 3’말단에 상기 우라실 염기가 위치하는 것이고,
    상기 IGS 영역은 5’ 말단에 상기 목적 유전자 내부의 우라실 염기와 워블 염기쌍(wobble base pair)을 형성할 수 있는 구아닌(Guanine, G)을 포함하고, 상기 목적 유전자에서 상기 우라실 염기의 5’ 방향으로 연결된 5개의 연속된 염기서열과 역상보적인 서열을 포함하는 것인, 자가 환형화 RNA 구조체.
  17. 제16항에 있어서,
    상기 재구성 목적 유전자의 3’ 말단의 우라실 염기의 5’ 방향으로 연결된 5개의 연속된 염기서열은 아데닌(Adenine, A) 및/또는 우라실 염기를 1 내지 5개 포함하는 것인, 자가 환형화 RNA 구조체.
  18. 제16항에 있어서,
    상기 리보자임은 그룹 Ⅰ 인트론 리보자임 (Group Ⅰ intron ribozyme)인, 자가 환형화 RNA 구조체.
  19. 제16항에 있어서,
    상기 리보자임은 서열번호 6의 염기서열을 포함하는 것인, 자가 환형화 RNA 구조체.
  20. 제16항에 있어서,
    상기 구조체는 IGS 영역의 5’ 방향으로 연장된 뉴클레오티드를 포함하고, 상기 연장된 뉴클레오티드는 재구성 목적 유전자의 5’ 말단과 역상보적인 서열로 이루어져 P10 helix를 형성하는 것인, 자가 환형화 RNA 구조체.
  21. 제16항에 있어서,
    상기 구조체는 IGS 영역의 5’ 방향으로 연장된 뉴클레오티드를 포함하고,
    재구성 목적 유전자의 3’ 방향으로 연장된 뉴클레오티드를 포함하며,
    상기 각 연장된 뉴클레오티드는 역상보적인 서열인 것인, 자가 환형화 RNA 구조체.
  22. 제16항 또는 제20항에 있어서,
    상기 구조체는 IGS 영역의 5’ 방향으로 AS(antisense sequence) 영역과,
    재구성 목적 유전자의 3’ 방향으로 상기 AS 영역과 상보적으로 결합할 수 있는 ABS(antisense binding sequence) 영역을 추가로 포함하는 것인, 자가 환형화 RNA 구조체.
  23. 제22항에 있어서,
    상기 AS 영역의 길이는 50 내지 400 nt 인 것인, 자가 환형화 RNA 구조체.
  24. 제16항에 있어서,
    상기 구조체는 리보자임 영역과 재구성 목적 유전자 영역이 무작위 염기서열로 이루어진 스페이서(Spacer) 영역으로 연결된 것인, 자가 환형화 RNA 구조체.
  25. 제16항의 자가 환형화 RNA 구조체를 발현하는 벡터.
  26. 제25항에 있어서,
    상기 벡터는 자가 환형과 RNA를 암호화하는 유전자와 작동 가능하게 연결된 프로모터를 포함하는 것인, 벡터.
PCT/KR2023/013376 2022-09-06 2023-09-06 자가 환형화 rna 구조체 WO2024054048A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2022-0112826 2022-09-06
KR20220112826 2022-09-06

Publications (1)

Publication Number Publication Date
WO2024054048A1 true WO2024054048A1 (ko) 2024-03-14

Family

ID=90191511

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/013376 WO2024054048A1 (ko) 2022-09-06 2023-09-06 자가 환형화 rna 구조체

Country Status (2)

Country Link
KR (1) KR20240034676A (ko)
WO (1) WO2024054048A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5712128A (en) * 1992-01-13 1998-01-27 Duke University Enzymatic RNA molecules
KR100235792B1 (ko) * 1991-01-17 1999-12-15 데이비드 제이.글라스 트랜스-스플라이싱 리보자임
US6210931B1 (en) * 1998-11-30 2001-04-03 The United States Of America As Represented By The Secretary Of Agriculture Ribozyme-mediated synthesis of circular RNA
US20100305197A1 (en) * 2009-02-05 2010-12-02 Massachusetts Institute Of Technology Conditionally Active Ribozymes And Uses Thereof
WO2019236673A1 (en) * 2018-06-06 2019-12-12 Massachusetts Institute Of Technology Circular rna for translation in eukaryotic cells

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3724208A4 (en) 2017-12-15 2021-09-01 Flagship Pioneering Innovations VI, LLC COMPOSITIONS WITH CIRCULAR POLYRIBONUCLEOTIDES AND USES THEREOF

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100235792B1 (ko) * 1991-01-17 1999-12-15 데이비드 제이.글라스 트랜스-스플라이싱 리보자임
US5712128A (en) * 1992-01-13 1998-01-27 Duke University Enzymatic RNA molecules
US6210931B1 (en) * 1998-11-30 2001-04-03 The United States Of America As Represented By The Secretary Of Agriculture Ribozyme-mediated synthesis of circular RNA
US20100305197A1 (en) * 2009-02-05 2010-12-02 Massachusetts Institute Of Technology Conditionally Active Ribozymes And Uses Thereof
WO2019236673A1 (en) * 2018-06-06 2019-12-12 Massachusetts Institute Of Technology Circular rna for translation in eukaryotic cells

Also Published As

Publication number Publication date
KR20240034676A (ko) 2024-03-14

Similar Documents

Publication Publication Date Title
WO2022191642A1 (ko) 자가 환형화 rna 구조체
CN108103090B (zh) 靶向RNA甲基化的RNA Cas9-m6A修饰载体系统及其构建方法和应用
EP3222723B1 (en) Development of universal cancer drugs and vaccines
CN114174510A (zh) 添加了功能性碱基序列的靶标编辑指导rna
Ono et al. Analysis of human small nucleolar RNAs (snoRNA) and the development of snoRNA modulator of gene expression vectors
Inatomi et al. TFB2M and POLRMT are essential for mammalian mitochondrial DNA replication
Takao et al. Nucleotide sequence of a cloned fragment of rat mitochondrial DNA containing the replication origin
WO2022065689A1 (ko) 편집 효율이 향상된 프라임 편집 기반 유전자 교정용 조성물 및 이의 용도
CN112608948A (zh) 两种多功能基因编辑工具的构造及其使用方法
WO2024054048A1 (ko) 자가 환형화 rna 구조체
JP2023002469A (ja) 抗ウイルス及び抗がんワクチンに用いる新規なｍＲＮＡ組成物及びその製造方法
WO2024054047A1 (ko) 자가 환형화 rna 구조체
WO2023153845A2 (ko) 상동지정복구를 위한 target 시스템 및 이를 이용한 유전자 편집 방법
Cedar et al. Effect of DNA methylation on gene expression
WO2023059115A1 (ko) 유전자 편집을 위한 target 시스템 및 이의 용도
WO2022010241A1 (ko) 질환 세포-특이적인 mirna에 의해 세포 생리 활성 조절 물질의 활성을 조절하는 복합체 및 이를 crispr/cas 시스템에 적용한 질환 특이적 유전자 조작용 복합체
WO2022270969A1 (ko) 비천연 5'-비번역 영역 및 3'-비번역 영역 및 그의 용도
WO2022158898A1 (ko) Francisella novicida cas9 모듈 기반의 역전사 효소를 사용한 유전체 치환 및 삽입 기술
WO2023172115A1 (ko) Nhej 복구 경로 조절을 통해 핵산 세그먼트의 결실 효율을 증가시키기 위한 조성물 및 방법
WO2017188707A1 (en) Dicer substrate rna nanostructures with enhanced gene silencing effect and preparation method thereof
WO2024058589A1 (ko) 유전자 가위 넉-인을 이용하여 제조한 키메릭 항원 수용체 세포 및 이의 용도
WO2023219479A1 (ko) Dicer에 의한 dsrna 가공의 서열 결정 인자
WO2024054006A1 (ko) 신규한 유전체 세이프 하버 및 이의 용도
WO2024143924A1 (ko) 덤벨 구조를 이용한 원형 rna 제조 방법
WO2018030738A1 (ko) 폴리락토사민 생합성 저해에 의한 n-결합 당쇄 안테나구조가 강화된 재조합 당단백질 제조방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23863512

Country of ref document: EP

Kind code of ref document: A1