WO2024043708A1 - 글루카나제 활성을 갖는 변이체 폴리펩티드 - Google Patents

글루카나제 활성을 갖는 변이체 폴리펩티드 Download PDF

Info

Publication number
WO2024043708A1
WO2024043708A1 PCT/KR2023/012528 KR2023012528W WO2024043708A1 WO 2024043708 A1 WO2024043708 A1 WO 2024043708A1 KR 2023012528 W KR2023012528 W KR 2023012528W WO 2024043708 A1 WO2024043708 A1 WO 2024043708A1
Authority
WO
WIPO (PCT)
Prior art keywords
variant polypeptide
amino acid
present application
polypeptide
substitution
Prior art date
Application number
PCT/KR2023/012528
Other languages
English (en)
French (fr)
Inventor
손병삼
최은정
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Publication of WO2024043708A1 publication Critical patent/WO2024043708A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K20/00—Accessory food factors for animal feeding-stuffs
    • A23K20/10—Organic substances
    • A23K20/142—Amino acids; Derivatives thereof
    • A23K20/147—Polymeric derivatives, e.g. peptides or proteins
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/17—Amino acids, peptides or proteins
    • A23L33/18—Peptides; Protein hydrolysates
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405—Glucanases
    • D—TEXTILES; PAPER
    • D21—PAPER-MAKING; PRODUCTION OF CELLULOSE
    • D21H—PULP COMPOSITIONS; PREPARATION THEREOF NOT COVERED BY SUBCLASSES D21C OR D21D; IMPREGNATING OR COATING OF PAPER; TREATMENT OF FINISHED PAPER NOT COVERED BY CLASS B31 OR SUBCLASS D21G; PAPER NOT OTHERWISE PROVIDED FOR
    • D21H17/00—Non-fibrous material added to the pulp, characterised by its constitution; Paper-impregnating material characterised by its constitution
    • D—TEXTILES; PAPER
    • D21—PAPER-MAKING; PRODUCTION OF CELLULOSE
    • D21H—PULP COMPOSITIONS; PREPARATION THEREOF NOT COVERED BY SUBCLASSES D21C OR D21D; IMPREGNATING OR COATING OF PAPER; TREATMENT OF FINISHED PAPER NOT COVERED BY CLASS B31 OR SUBCLASS D21G; PAPER NOT OTHERWISE PROVIDED FOR
    • D21H17/00—Non-fibrous material added to the pulp, characterised by its constitution; Paper-impregnating material characterised by its constitution
    • D21H17/005—Microorganisms or enzymes
    • D—TEXTILES; PAPER
    • D21—PAPER-MAKING; PRODUCTION OF CELLULOSE
    • D21H—PULP COMPOSITIONS; PREPARATION THEREOF NOT COVERED BY SUBCLASSES D21C OR D21D; IMPREGNATING OR COATING OF PAPER; TREATMENT OF FINISHED PAPER NOT COVERED BY CLASS B31 OR SUBCLASS D21G; PAPER NOT OTHERWISE PROVIDED FOR
    • D21H17/00—Non-fibrous material added to the pulp, characterised by its constitution; Paper-impregnating material characterised by its constitution
    • D21H17/20—Macromolecular organic compounds
    • D21H17/21—Macromolecular organic compounds of natural origin; Derivatives thereof
    • D21H17/22—Proteins
    • D—TEXTILES; PAPER
    • D10—INDEXING SCHEME ASSOCIATED WITH SUBLASSES OF SECTION D, RELATING TO TEXTILES
    • D10B—INDEXING SCHEME ASSOCIATED WITH SUBLASSES OF SECTION D, RELATING TO TEXTILES
    • D10B2211/00—Protein-based fibres, e.g. animal fibres

Definitions

  • This application relates to variant polypeptides having glucanase activity.
  • 1,3-1,4- ⁇ -glucan is a polysaccharide that makes up the cell walls of various plants, and is especially present in large quantities in the cell walls of commercially valuable grains such as barley, rye, sorghum, rice, and wheat.
  • glucan is an anti-nutritional factor that prevents animals from digesting and absorbing plant-based feed.
  • glucanase EC 3.2.1.73
  • the purpose of the present application is to provide a variant polypeptide having glucanase activity in which at least one of the amino acids corresponding to positions 53, 199, and 200 from the N-terminus of SEQ ID NO: 1 is replaced with another amino acid. .
  • Another object of the present application is to provide polynucleotides encoding the polypeptides of the present application.
  • Another object of the present application is to provide a polypeptide of the present application; A polynucleotide encoding the polypeptide; And to provide a microorganism containing one or more of the vectors containing the polynucleotide.
  • Another object of the present application is to provide a composition for decomposing glucan, comprising one or more of the polypeptide of the present application and the microorganism of the present application.
  • Another object of the present application is to provide a method for decomposing glucan, comprising reacting one or more of the polypeptide of the present application and the microorganism of the present application with glucan.
  • Another object of the present application is to provide a feed additive composition comprising one or more of the polypeptide of the present application and the microorganism of the present application.
  • Another object of the present application is to provide a method for producing a feed product, comprising mixing a feed ingredient with a feed additive composition containing one or more of the polypeptide of the present application and the microorganism of the present application.
  • compositions for food comprising one or more of the polypeptide of the present application and the microorganism of the present application; Compositions for food production; detergent composition; Textile compositions; And to provide a composition for papermaking.
  • Another object of the present application is to provide a method for producing a variant polypeptide having glucanase activity, which includes culturing the microorganism of the present application.
  • the mutant polypeptide having glucanase activity of the present application has improved heat resistance and can be usefully applied to various industrial fields.
  • Figure 1 shows the results of evaluating the heat resistance of C, M1, M2, and M3 enzymes.
  • One aspect of the present application is a variant polypeptide having glucanase activity in which at least one of the amino acids corresponding to positions 53, 199, and 200 from the N-terminus of SEQ ID NO: 1 is replaced with another amino acid. .
  • variant polypeptide having glucanase activity corresponds to positions 53, 199 and 200 from the N-terminus of SEQ ID NO: 1 in any polypeptide or glucanase having glucanase activity. It refers to a variant containing the substitution of one or more amino acids with another amino acid.
  • glucanase refers to an enzyme that has the activity to decompose the glucosidic bond connecting two glucosyl residues in glucan.
  • Non-limiting examples of glucanase activity include endo-cellulase activity against beta-1,4 bonds between D-glucans, or beta-D-glucans containing 1,3- and 1,4-linkages. Examples include licheninase or lichenase activity that breaks down (1,4)-beta-D-glucosidic bonds.
  • the glucanase of the present application may have activity corresponding to a glucanase classified as EC 3.2.1.73.
  • the reference glucanase subject to mutation in the present application has the amino acid sequence of SEQ ID NO: 1 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, It may be a protein comprising an amino acid sequence having at least 97%, at least 98%, or at least 99% homology or identity.
  • the amino acid sequence has such homology or identity and shows efficacy corresponding to the protein
  • the protein having an amino acid sequence in which some sequences are deleted, modified, substituted, or added is also within the scope of the reference protein that is the subject of mutation in the present application. Inclusion is self-evident.
  • a protein containing the amino acid sequence of SEQ ID NO. 1 is defined as an example of a reference glucanase, but addition of meaningless sequences before or after the amino acid sequence, mutations that may occur naturally, or silent mutations thereof It does not exclude the addition of meaningless sequences before or after the amino acid sequence of SEQ ID NO: 1, mutations that may occur naturally, or silent mutations thereof, and does not exclude the protein consisting of the amino acid sequence of SEQ ID NO: 1 and each other. It is clear to those skilled in the art that if it has the same or corresponding activity, it may correspond to a reference glucanase.
  • reference glucanases include Orpinomyces sp., Neocallimastix sp., Piromyces sp., Clostridium sp., Rhodothermus sp., or Ruminococcus sp. Derived glucanase can be mentioned.
  • An example of another glucanase is a wild-type glucanase from the genus Orpinomyces (Orpinomyces sp.).
  • variants or “modified polypeptide” refers to a sequence in which one or more amino acids are modified by conservative substitution and/or modification of the recited sequence. ), but refers to a protein that maintains the functions or properties of the protein.
  • the variant differs from the identified sequence by several amino acid substitutions, deletions, or additions.
  • Such variants can generally be identified by modifying one or more amino acids in the amino acid sequence of the protein and evaluating the properties of the modified protein. In other words, the ability of the variant may be increased, unchanged, or decreased compared to the native protein.
  • some variants may include variant polypeptides in which one or more parts, such as the N-terminal leader sequence or transmembrane domain, have been removed.
  • Other variants may include variants in which a portion is removed from the N- and/or C-terminus of the mature protein.
  • the term “variant” or “variant polypeptide” may be used interchangeably with terms such as variant, modification, mutated protein, mutation, etc. (English expressions include modification, modified protein, mutant, mutein, divergent, variant, etc.). , if the term is used in a modified sense, it is not limited thereto.
  • conservative substitution means replacing one amino acid with another amino acid having similar structural and/or chemical properties. Typically, conservative substitutions may have little or no effect on the activity of the resulting polypeptide.
  • the variant may have, for example, one or more conservative substitutions while still retaining one or more biological activities.
  • conservative substitutions may generally occur based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or amphipathic nature of the residues.
  • Examples of this classification include positively charged (basic) amino acids: arginine, lysine, and histidine; Negatively charged (acidic) amino acids include glutamic acid and aspartate; Amino acids with nonpolar side chains (nonpolar amino acids) include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline; Amino acids with polar or hydrophilic side chains (polar amino acids) can be classified into serine, threonine, cysteine, tyrosine, asparagine, and glutamine.
  • arginine, lysine, histidine, glutamic acid, and aspartate are amino acids that have electrically charged side chains (electrically charged amino acids), and amino acids that have uncharged side chains (also referred to as neutral amino acids). It can be classified into glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, cysteine, tyrosine, asparagine and glutamine. As another example, phenylalanine, tryptophan, and tyrosine can be classified as aromatic amino acids.
  • valine, leucine, and isoleucine can be classified as branched amino acids.
  • 20 types of amino acids are classified according to size, starting from the amino acid group with relatively small volume; glycine, alanine, serine; Cysteine, proline, threonine, aspartate, asparagine; Valine, histidine, glutamic acid, glutamine; Isoleucine, leucine, methionine, lysine, arginine; and phenylalanine, tryptophan, and tyrosine.
  • variants may include deletions or additions of amino acids that have minimal effect on the properties and secondary structure of the polypeptide.
  • the polypeptide can be conjugated with a signal (or leader) sequence at the N-terminus of the protein that is involved in the transfer of the protein co-translationally or post-translationally.
  • the polypeptide may also be conjugated with other sequences or linkers to enable identification, purification, or synthesis of the polypeptide.
  • the variant polypeptide of the present application is one in which at least one of the amino acids corresponding to positions 53, 199, and 200 from the N-terminus of SEQ ID NO: 1 among the above-described glucanases is substituted with another amino acid. It may be a variant polypeptide having glucanase activity.
  • 'substitution with another amino acid' is not limited as long as it is an amino acid that is different from the amino acid before substitution. Meanwhile, in the present application, when it is expressed that 'a specific amino acid is substituted', it is obvious that it is substituted with an amino acid different from the amino acid before substitution, even if it is not separately indicated that it has been substituted with a different amino acid.
  • the variant polypeptide of the present application may comprise a substitution of the amino acid corresponding to position 53 with cysteine (C).
  • the variant polypeptide of the present application may include a substitution of the amino acid corresponding to position 199 with cysteine (C).
  • the variant polypeptide of the present application may include a substitution of the amino acid corresponding to position 200 with proline (P).
  • the variant polypeptide of the present application may comprise any one or more of the following substitutions: i) a substitution of the amino acid corresponding to position 53 to cysteine (C); ii) substitution of the amino acid corresponding to position 199 with cysteine (C); and substitution of the amino acid corresponding to position 200 with proline (P).
  • the variant polypeptide of the present application may comprise a substitution selected from the following: (i) a substitution of the amino acid corresponding to position 200 with proline (P); (ii) substitution of the amino acid corresponding to position 53 with cysteine (C) and substitution of the amino acid corresponding to position 199 with cysteine (C); or (iii) substitution of the amino acid corresponding to position 200 with proline (P), substitution of the amino acid corresponding to position 53 with cysteine (C), and substitution of the amino acid corresponding to position 199 with cysteine (C). Substitution of .
  • the variant polypeptide of the present application has a substitution of the amino acid corresponding to position 53 with cysteine (C), and a substitution of the amino acid corresponding to position 199 with cysteine (C). It may include a modification in which the substituted amino acid pair forms a disulfide bond (i.e., between cysteine residues).
  • N position in the present application may include the N position and an amino acid position corresponding to the N position.
  • a specific amino acid sequence may include an amino acid position corresponding to any amino acid residue in the disclosed mature polypeptide.
  • the specific amino acid sequence may be the amino acid sequence of SEQ ID NO: 1.
  • corresponding to refers to an amino acid residue at a recited position in a polypeptide, or an amino acid residue that is similar, identical, or homologous to a recited residue in a polypeptide. Identifying the amino acid at the corresponding position may be determining the specific amino acid in the sequence that refers to the specific sequence.
  • corresponding region generally refers to a similar or corresponding position in a related or reference protein.
  • specific numbering may be used for amino acid residue positions within the proteins used in this application. For example, by aligning the polypeptide sequence of the target protein to be compared with the protein of the present application, it is possible to renumber the positions corresponding to the amino acid residue positions of the protein of the present application.
  • an arbitrary amino acid sequence can be aligned with SEQ ID NO: 1, and based on this, each amino acid residue in the amino acid sequence can be numbered with reference to SEQ ID NO: 1 and the numerical position of the amino acid residue corresponding to the amino acid residue.
  • sequence alignment algorithms such as those described in this application can identify the positions of amino acids or where modifications such as substitutions, insertions, or deletions occur compared to a query sequence (also referred to as a “reference sequence”).
  • Such alignments include, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needleman program in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al. , 2000), Trends Genet. 16: 276-277), etc. may be used, but are not limited thereto, and sequence alignment programs and pairwise sequence comparison algorithms known in the art may be appropriately used.
  • the variant polypeptide of the present application has one or more amino acids corresponding to positions 53, 199, and 200 from the N-terminus of SEQ ID NO. Or it may include an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity thereto.
  • the variant polypeptide of the present application has one or more amino acids corresponding to positions 53, 199, and 200 from the N-terminus of SEQ ID NO: 1 substituted with another amino acid, , may have at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence homology or identity with the amino acid sequence of SEQ ID NO: 1.
  • the variant polypeptide of the present application may include any one of the amino acid sequences of SEQ ID NOs: 2 to 4.
  • the variant polypeptide of the present application may consist essentially of the amino acid sequence of any one of SEQ ID NOs: 2 to 4, and more specifically, SEQ ID NO: 2 It may consist of any one of amino acid sequences from 4 to 4, but is not limited thereto.
  • the variant includes the amino acid sequence of any one of SEQ ID NOs: 2 to 4, or the amino acids corresponding to positions 53, 199, and 200 in the amino acid sequence are fixed. (That is, in the amino acid sequence of the variant, the amino acids corresponding to positions 53, 199, and 200 of the amino acid sequence of any one of SEQ ID NOs. 2 to 4 are the amino acids of the amino acid sequence of any one of SEQ ID NOs. 2 to 4. identical to the amino acids at positions 53, 199, and 200), and may include a sequence having at least 80% or more homology or identity thereto.
  • the amino acid sequence has such homology or identity and shows efficacy corresponding to the variant
  • the amino acid sequence is an amino acid sequence in which some sequences are deleted, modified, substituted, or added in addition to one or more positions selected from positions 53, 199, and 200. It is obvious that proteins having are also included in the scope of the present application.
  • homology refers to the degree of similarity between two given amino acid sequences or base sequences and can be expressed as a percentage.
  • homology and identity can often be used interchangeably.
  • sequence homology or identity of a conserved polynucleotide or polypeptide is determined by standard alignment algorithms, and may be used with a default gap penalty established by the program used. Substantially homologous or identical sequences are generally capable of hybridizing to all or part of a sequence under moderate or high stringent conditions. It is obvious that hybridization also includes hybridization with a polynucleotide containing a common codon or a codon taking codon degeneracy into account.
  • Whether any two polynucleotide or polypeptide sequences have homology, similarity, or identity can be determined, for example, by Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: It can be determined using a known computer algorithm such as the “FASTA” program using default parameters as in 2444. Or, as performed in the Needleman program in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later), It can be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol.
  • a GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly aligned symbols (i.e., nucleotides or amino acids).
  • the default parameters for the GAP program are (1) the unitary comparison matrix (containing values 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: Weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap opening penalty of 10 and a gap extension penalty of 0.5); and (3) no penalty for end gaps. Accordingly, the term “homology” or “identity” used in this application refers to the relationship between sequences.
  • enzyme activity or “glucanase activity” refers to at least one catalytic activity. Specifically, it may be the conversion efficiency of the enzyme, mainly expressed as kcat/Km, but is not limited thereto.
  • kcat refers to the catalytic constant of conversion to product in unit time by one enzyme when the enzyme is completely saturated with substrate, and is also called turnover number.
  • Km is the substrate concentration when the reaction rate is half the maximum value (Vmax).
  • Examples of ways to express enzyme activity include specific activity (umol of converted substrate x mg -1 x min -1 ) or volumetric activity (umol of converted substrate x mL -1 x min -1). .
  • defining enzyme activity is not limited to the above, and can be defined and evaluated based on information known in the art.
  • enzyme stability means that enzyme activity is preserved during storage or reaction time.
  • the initial enzyme activity is measured and compared at time zero (100%) and after a certain period of time (x%) under specified conditions to determine the level at which enzyme activity is lost or enzyme stability. It can be expressed.
  • Factors that affect enzyme activity include, for example, pH, heat, and the presence of other substances (e.g., oxidizing agents, chelating agents).
  • thermal stability refers to the ability of a protein to function in a specific temperature range.
  • the variant polypeptide provided in the present application may have activity in the range from about 20°C to about 120°C, and specifically may have activity in the range from about 60°C to about 100°C.
  • thermo tolerance refers to the ability of a protein to function after exposure to a certain temperature, for example, high heat or extremely low temperature.
  • a thermostable protein may not function at the temperature it is exposed to, but may become functional again when returned to the optimal temperature environment.
  • the variant polypeptide provided in the present application can maintain the ability to function after exposure to high temperatures ranging from about 60°C to about 100°C.
  • Increased stability or heat resistance may include maintaining high enzyme activity compared to other enzymes, e.g., the wild-type enzyme, the parent enzyme, and/or other variant polypeptides; or increasing the range of pH, temperature and/or time over which the protein maintains its function.
  • the variant polypeptide provided in the present application may have improved heat resistance and/or heat stability compared to the polypeptide of SEQ ID NO: 1.
  • the mutant polypeptide provided in the present application may have improved heat resistance and/or heat stability compared to the wild-type polypeptide.
  • the variant polypeptide provided in the present application may have improved heat resistance compared to the polypeptide of SEQ ID NO: 1.
  • the characteristics of the variant polypeptide provided in the present application may be improved activity or activity suitable for application to various industrial fields including feed, baking, pulp bleaching, etc. there is.
  • Another aspect of the present application is a polynucleotide encoding a variant polypeptide of the present application.
  • polynucleotide refers to a DNA or RNA strand of a certain length or more, which is a polymer of nucleotides in which nucleotide monomers are connected in a long chain by covalent bonds.
  • the polynucleotide encoding the variant polypeptide of the present application may be included without limitation as long as it is a polynucleotide encoding the variant polypeptide of the present application and a polypeptide having a corresponding activity.
  • the polynucleotide encoding the variant polypeptide of the present application has a coding region within the range that does not change the amino acid sequence of the polypeptide due to codon degeneracy or in consideration of the preferred codon in the organism in which the polypeptide is to be expressed.
  • Various modifications may be made to .
  • the polynucleotide encoding the variant polypeptide of the present application has at least 50%, 60%, 70%, 75%, 80%, 85% or 90% homology or identity with the polynucleotide sequence of SEQ ID NO: 5. It may have or include a base sequence that is greater than or equal to 100%.
  • the polynucleotide encoding the glucanase variant of the present application has at least 50%, 60%, 70%, 75% homology or identity with the polynucleotide sequence of SEQ ID NO: 5.
  • the coding codon is one of the codons coding for an amino acid other than arginine (R);
  • the codon encoding the amino acid corresponding to position 199 is one of the codons encoding an amino acid other than threonine (T);
  • the codon encoding the amino acid corresponding to position 200 is one of the codons encoding an amino acid other than asparagine (N); Or it may be a combination of these.
  • the polynucleotide encoding the glucanase variant of the present application has at least 50%, 60%, 70%, 75% homology or identity with the polynucleotide sequence of SEQ ID NO: 5.
  • an amino acid corresponding to position 53 from the N-terminus of SEQ ID NO: 1 may be one of the codons encoding cysteine (C)
  • the codon encoding the amino acid corresponding to position 200 may be one of the codons encoding proline (P). It could be one of:
  • polynucleotide of the present application includes, without limitation, any probe that can be prepared from a known genetic sequence, for example, a sequence that can hybridize under stringent conditions with a complementary sequence to all or part of the polynucleotide sequence of the present application. You can.
  • stringent condition refers to conditions that enable specific hybridization between polynucleotides. These conditions are described in J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8).
  • polynucleotides with high homology or identity 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, Or, conditions in which polynucleotides with 99% or more homology or identity hybridize with each other and polynucleotides with lower homology or identity do not hybridize, or 60°C1, which is the washing condition for normal southern hybridization.
  • ⁇ SSC 0.1% SDS, specifically 60°C 0.1 ⁇ SSC, 0.1% SDS, more specifically 68°C 0.1 ⁇ SSC, 0.1% SDS, at a salt concentration and temperature equivalent to once, specifically 2 to 3 times. Cleaning conditions can be listed.
  • Hybridization requires that the two nucleic acids have complementary sequences, although mismatches between bases may be possible depending on the stringency of hybridization.
  • complementary is used to describe the relationship between nucleotide bases that are capable of hybridizing to each other. For example, with respect to DNA, adenine is complementary to thymine and cytosine is complementary to guanine. Accordingly, the polynucleotides of the present application may also include substantially similar nucleic acid sequences as well as isolated nucleic acid fragments that are complementary to the entire sequence.
  • polynucleotides having homology or identity with the polynucleotide of the present application can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. Additionally, the Tm value may be 60°C, 63°C, or 65°C, but is not limited thereto and may be appropriately adjusted by a person skilled in the art depending on the purpose.
  • the appropriate stringency to hybridize the polynucleotide depends on the length of the polynucleotide and the degree of complementarity, variables that are well known in the art (e.g., J. Sambrook et al., supra).
  • Another aspect of the present application provides a vector containing a polynucleotide encoding the variant polypeptide of the present application.
  • the variant polypeptides and polynucleotides are the same as described in the other embodiments above.
  • the term “vector” refers to a polynucleotide containing the base sequence of a polynucleotide encoding the target polypeptide operably linked to a suitable expression control region (or expression control sequence) to enable expression of the target polypeptide in a suitable host. refers to a DNA product.
  • the expression control region may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating termination of transcription and translation. After transformation into a suitable host cell, the vector can replicate or function independently of the host genome and can be integrated into the genome itself.
  • a polynucleotide encoding a target protein in a chromosome can be replaced with a mutated polynucleotide through a vector for intracellular chromosome insertion. Insertion of the polynucleotide into the chromosome may be accomplished by any method known in the art, for example, homologous recombination, but is not limited thereto.
  • a selection marker may be additionally included to confirm whether the chromosome has been inserted.
  • a selection marker is used to select cells transformed with a vector, that is, to confirm the insertion of a target nucleic acid molecule, and to impart selectable phenotypes such as drug resistance, auxotrophy, resistance to cytotoxic agents, or expression of surface proteins. Markers that do so may be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or show other expression traits, so transformed cells can be selected.
  • the vector used in this application is not particularly limited, and any vector known in the art can be used.
  • vectors commonly used in prokaryotic cells include pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A as phage vectors or cosmid vectors, and pBR-based plasmid vectors.
  • pUC-based, pBluescriptII-based, pGEM-based, pTZ-based, pCL-based, pET-based, etc. can be used.
  • pDZ pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, pDCM2 vectors can be used.
  • the yeast expression vector can be both an integrative yeast plasmid (YIp) and an extrachromosomal plasmid vector.
  • the extrachromosomal plasmid vector may include an episomal yeast plasmid (YEp), a replicative yeast plasmid (YRp), and a yeast centromeric plasmid (YCp).
  • YACs artificial yeast chromosomes
  • available vectors include pESCHIS, pESC-LEU, pESC-TRP, pESC-URA, Gateway pYES-DEST52, pAO815, pGAPZ A, pGAPZ B, pGAPZ C, pGAP ⁇ A, pGAP ⁇ B, pGAP ⁇ C, pPIC3.5K , pPIC6 A, pPIC6 B, pPIC6 C, pPIC6 ⁇ A, pPIC6 ⁇ B, pPIC6 ⁇ C, pPIC9K, pYC2/CT, pYD1 Yeast Display Vector, pYES2, pYES2/CT, pYES2/NT A, pYES2/NT B, pYES2/NT C , pYES2/CT, pYES2.1, pYES-DEST52, pTEF1/Zeo, pFLD1, PichiaPinkTM, p427-
  • the term “transformation” refers to introducing a vector containing a polynucleotide encoding a target protein into a host cell or microorganism so that the protein encoded by the polynucleotide can be expressed within the host cell.
  • the transformed polynucleotide can include both of these, regardless of whether it is inserted into the chromosome of the host cell or located outside the chromosome.
  • the polynucleotide includes DNA and RNA encoding the target protein.
  • the polynucleotide can be introduced in any form as long as it can be introduced and expressed into a host cell.
  • the polynucleotide can be introduced into the host cell in the form of an expression cassette, which is a genetic structure containing all elements necessary for self-expression.
  • the expression cassette may typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal that are operably linked to the polynucleotide.
  • the expression cassette may be in the form of an expression vector capable of self-replication.
  • the polynucleotide may be introduced into the host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto.
  • operably linked means that the gene sequence is functionally linked to a promoter sequence that initiates and mediates transcription of a polynucleotide encoding the target polypeptide of the present application.
  • the method of transforming the vector of the present application includes any method of introducing a nucleic acid into a cell, and can be performed by selecting an appropriate standard technique as known in the art depending on the host cell. For example, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and lithium acetate. -DMSO method, etc., but is not limited to this.
  • variant polypeptide of the present application is a variant polypeptide of the present application; A polynucleotide encoding the variant polypeptide; and a microorganism containing one or more of the vectors containing the variant polypeptide.
  • the microorganism may include the above-described variant polypeptide, a polynucleotide encoding the same, and a nucleic acid construct and/or vector containing the polynucleotide.
  • the nucleic acid construct or vector may be integrated into a chromosome or maintained as a self-replicating extrachromosomal vector.
  • Microorganisms of the present application may be included without limitation as long as they are capable of expressing the variant polypeptide of the present application.
  • any cell useful for the recombinant production of variant polypeptides of the present application is included, for example, the microorganism may be a prokaryotic cell or a eukaryotic cell.
  • examples of the microorganisms include fungi and bacteria.
  • the microorganism of the present application may be a microorganism of the genus Escherichia, such as Escherichia coli, Escherichia albertii, and Escherichia fergusonii. , Escherichia hermannii, Escherichia vulneris, or Escherichia blattae.
  • the microorganism may be, but is not limited to, Escherichia coli.
  • variant polypeptide of the present application is a variant polypeptide of the present application; and a microorganism comprising one or more of the variant polypeptide, a polynucleotide encoding the variant polypeptide, and a vector containing the polynucleotide; It is a composition for decomposing glucan containing one or more of the following.
  • variant polypeptide of the present application is a variant polypeptide of the present application; and a microorganism comprising one or more of the variant polypeptide, a polynucleotide encoding the variant polypeptide, and a vector containing the polynucleotide; It is used for decomposing glucan of a composition containing one or more of the above.
  • variant polypeptide of the present application is a variant polypeptide of the present application; and a microorganism comprising one or more of the variant polypeptide, a polynucleotide encoding the variant polypeptide, and a vector containing the polynucleotide; It is a method of decomposing glucan, comprising the step of reacting one or more of them with glucan.
  • the variant polypeptide of the present application and/or a microorganism comprising one or more of the variant polypeptide, a polynucleotide encoding the variant polypeptide, and a vector containing the polynucleotide can be used to decompose a material containing glucan.
  • composition for glucan degradation provided in the present application may further include a naturally occurring substance or a non-naturally occurring substance in addition to the variant polypeptide of the present application.
  • composition for glucan decomposition provided in the present application may further include any components suitable for application to various industrial fields such as animal feed, baking, biomass saccharification, and pulp bleaching.
  • substances that can be added include stabilizers, surfactants, builders, chelating agents, dispersants, enzymes, enzyme stabilizers, catalysts, activators, carriers, mixtures, lubricants, disintegrants, excipients, solubilizers, suspending agents, Includes, but is not limited to, colorants, flavorings, buffers, preservatives, analgesics, solubilizers, isotonic agents, diluents, lubricants, etc.
  • variant polypeptide of the present application is a variant polypeptide of the present application; and a microorganism comprising one or more of the variant polypeptide, a polynucleotide encoding the variant polypeptide, and a vector containing the polynucleotide; It is a feed additive composition containing one or more of the following.
  • variant polypeptide of the present application is a variant polypeptide of the present application; and a microorganism comprising one or more of the variant polypeptide, a polynucleotide encoding the variant polypeptide, and a vector containing the polynucleotide;
  • a method for manufacturing a feed product including at least one step of mixing a feed additive composition and a feed ingredient.
  • variant polypeptides of the present application or the microorganisms of the present application may be used in any of the following applications:
  • grain-based substances for example, these may be whole grains or parts of grains.
  • the feed product of the present application may refer to any natural or artificial diet, meal, etc., or components of the meal, for animals to eat, ingest, and digest, or suitable therefor, and may be used in various forms known in the art. Manufacturable.
  • the variant polypeptide having glucanase activity of the present application can be used in various industrial fields such as food, paper, pulp, detergent, industrial waste treatment, biomaterials, and bioenergy.
  • glucanases For industrial applications of glucanases, McCarthy TC, Lalor E, Hanniffy O, Savage AV, Tuohy MG, Comparison of wide-type and UV-mutant ⁇ glucanase-producing strains of Talaromyces emersonii with potential in brewing applications, J Ind.
  • composition for food comprising a variant polypeptide having glucanase activity of the present application or the microorganism of the present application; Or it is a composition for food production.
  • glucanase can be used in brewing (beer, wine, etc.) and the production of fruit juice.
  • Glucanase can be added during the saccharification process to reduce wort viscosity, improve filtration performance, increase malt dissolution rate, prevent beer turbidity, and stabilize beer quality.
  • detergent compositions are compositions used to remove unwanted compounds from items to be cleaned, such as fabrics, dishes, or hard surfaces.
  • detergent compositions include fabric detergents, fabric detergents, hard surface cleaning agents such as glass, wood, plastic, ceramic and metal countertops and windows, carpet cleaners, oven cleaners, fabric air fresheners, fabric softeners, dishwashing detergents, etc. there is.
  • Another aspect of the present application is a textile composition comprising the variant polypeptide having glucanase activity of the present application or the microorganism of the present application.
  • the glucanase of the present application can be used in the processing of fibers for garment production. These processes include processes such as bleaching, removal of dyes after dyeing, and biopolishing of cotton fabrics or cotton blended fabrics.
  • compositions for paper processing comprising the variant polypeptide having glucanase activity of the present application or the microorganism of the present application.
  • Articles of the Present Application Variant polypeptides having glucanase activity can be used in the pulp industry to remediate wastewater, deink, or decolorize.
  • composition provided in the present application may further include any components suitable for application to various industrial fields.
  • composition provided in the present application may further include any other enzyme suitable for use in the intended application.
  • composition provided in the present application may include the variant polypeptide having glucanase activity of the present application or the microorganism of the present application in an amount suitable for use in the intended application.
  • the composition provided in the present application may be provided in a form suitable for use for the intended purpose.
  • the composition may be in bar, tablet, powder, granule, paste or liquid form.
  • Another aspect of the present application includes culturing a microorganism containing one or more of the variant polypeptide of the present application, a polynucleotide encoding the variant polypeptide, and a vector containing the polynucleotide.
  • Glucanase activity This is a method for producing a variant polypeptide having.
  • the culturing may include culturing the microorganism in a culture medium.
  • the term “culturing” means growing the host cells under appropriately controlled environmental conditions.
  • the culture process of the present application can be carried out according to appropriate media and culture conditions known in the art. This culture process can be easily adjusted and used by a person skilled in the art depending on the strain selected. Specifically, the culture may be batch, continuous, or fed-batch, but is not limited thereto.
  • the term “medium” refers to a material that is mainly mixed with nutrients necessary for cultivating the host cells, and supplies nutrients and growth factors, including water, which are essential for survival and development.
  • the medium and other culture conditions used for cultivating the host cells of the present application can be any medium used for cultivating conventional host cells without particular limitation, but the host cells of the present application can be cultured with an appropriate carbon source, nitrogen source, It can be cultured under aerobic conditions in a normal medium containing phosphorus, inorganic compounds, amino acids and/or vitamins, etc. while controlling temperature, pH, etc.
  • the carbon source includes carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; Sugar alcohols such as mannitol, sorbitol, etc., organic acids such as pyruvic acid, lactic acid, citric acid, etc.; Amino acids such as glutamic acid, methionine, lysine, etc. may be included.
  • natural organic nutrient sources such as starch hydrolyzate, molasses, blackstrap molasses, rice bran, cassava, bagasse and corn steep liquor can be used, specifically glucose and sterilized pre-treated molasses (i.e. converted to reducing sugars).
  • Carbohydrates such as molasses
  • various other carbon sources in an appropriate amount can be used without limitation. These carbon sources may be used alone or in combination of two or more types, but are not limited thereto.
  • the nitrogen source includes inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate; Organic nitrogen sources such as amino acids such as glutamic acid, methionine, and glutamine, peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolyzate, fish or its decomposition products, defatted soybean cake or its decomposition products, etc. can be used These nitrogen sources may be used individually or in combination of two or more types, but are not limited thereto.
  • inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate
  • Organic nitrogen sources such as amino acids such as glutamic acid, methionine, and glutamine, peptone, NZ-amine, meat extract, yeast
  • the agent may include monopotassium phosphate, dipotassium phosphate, or the corresponding sodium-containing salt.
  • Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, and calcium carbonate, and may also include amino acids, vitamins, and/or appropriate precursors. These components or precursors can be added to the medium batchwise or continuously. However, it is not limited to this.
  • compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. can be added to the medium in an appropriate manner to adjust the pH of the medium. Additionally, during culturing, foam generation can be suppressed by using an antifoaming agent such as fatty acid polyglycol ester.
  • an antifoaming agent such as fatty acid polyglycol ester.
  • oxygen or oxygen-containing gas can be injected into the medium, or to maintain the anaerobic and microaerobic state, nitrogen, hydrogen, or carbon dioxide gas can be injected without gas injection, and is limited thereto. That is not the case.
  • the temperature of the medium may be 20°C to 55°C, specifically 25°C to 40°C, but is not limited thereto.
  • the culturing period may continue until the desired production amount of useful substances is obtained, and may specifically be 24 hours to 196 hours, but is not limited thereto.
  • the method for producing the variant polypeptide of the present application may further include the step of recovering the variant polypeptide of the present application expressed in the culturing step.
  • the mutant polypeptide expressed in the culturing step can be recovered using methods known in the art to which the present invention pertains.
  • the variant polypeptides can be recovered from the medium by routine procedures including, but not limited to, collection, centrifugation, filtration, extraction, spray-drying, evaporation, or precipitation.
  • the recovery method may be to collect polypeptides using a suitable method known in the art according to the microorganism culture method of the present application, such as a batch, continuous, or fed-batch culture method.
  • a suitable method known in the art such as a batch, continuous, or fed-batch culture method.
  • Various chromatographies such as chromatography, HPLC, and combinations of these methods can be used, and the variants of the present application can be recovered from medium or host cells using suitable methods known in the art.
  • the variant polypeptide expressed by the host cell in the culture step may not be recovered.
  • the host cell expressing the variant polypeptide itself can be used as the source of the variant polypeptide.
  • variant polypeptide of the present application is a variant polypeptide of the present application; and a microorganism comprising one or more of the polypeptide, a polynucleotide encoding the variant polypeptide, and a vector containing the polynucleotide; It is a composition containing one or more of the following.
  • the composition can be used for food, feed additives, food production, detergents, textiles, or papermaking. Accordingly, another aspect of the present application provides use of the composition in food, feed additive, food production, detergent, textile, or paper. This is the same as described in the above aspect.
  • Example 1-1 Production of mutant recombinant plasmids
  • Orpinomyces sp Based on the synthetic sequence C (SEQ ID NO: 1) produced from the gene derived from the genomic DNA of the PC-2 strain, three variants M1 (SEQ ID NO: 2), M2 (SEQ ID NO: 3), and M3 (SEQ ID NO: Number 4) was produced.
  • PCR was performed under the following conditions. Specifically, it was produced through PCR using a template, primer, and PCR premix (Taq 2X premix, Bioneer).
  • primers M1-F, M1, and R were used using synthetic sequence C as a template.
  • primers M2-F1, M2-F2, M2-R1, and M2-R2 were used using synthetic sequence C as a template.
  • M3, M3-F and M3R primers were used using M2 as a template.
  • PCR was performed using an Eppendorf Mastercycler Nexus GX2, and the reaction conditions were as follows.
  • the amplified gene was cloned into the pET28a vector using the In-Fusion HD cloning kit (Takara, Cat. No. 639650).
  • Mutants M1, M2, and M3 had mutations in the following regions.
  • M1 asparagine the amino acid at position 200 in SEQ ID NO: 1, was replaced with proline.
  • M2 arginine at position 53 in SEQ ID NO: 1 was substituted with cysteine, and threonine at position 199 was substituted with cysteine.
  • M3 in SEQ ID NO: 1, arginine at position 53 was replaced with cysteine, threonine at position 199 was replaced with cysteine, and asparagine at position 200 was replaced with proline.
  • Example 1-2 Construction of transformants with glucanase genes and expression of enzymes
  • the recombinant plasmid prepared in Example 1-1 was transformed into E. coli BL21. And to produce the glucanase mutant, the transformant was inoculated into 5 ml of LB medium and cultured at 37°C for 18 hours. For the main culture, 5 ml of pre-culture was inoculated into 300 ml LB medium and cultured at 37°C. Then, when the OD600 value was between 0.4 and 0.6, 120 ul of 1M IPTG was added and cultured for an additional 12 hours. The cells were recovered through centrifugation and redispersed in 35ml of lysis buffer (50mM Tris-HCl pH 8.0, 100mM NaCl, 10mM imidazole).
  • lysis buffer 50mM Tris-HCl pH 8.0, 100mM NaCl, 10mM imidazole.
  • Example 1-3 Purification of polypeptide with glucanase activity
  • the bacteria in the dispersion were disrupted using an ultrasonic disperser, and the supernatant, crude enzyme solution, was obtained through centrifugation.
  • the crude enzyme solution was adsorbed by flowing it to Ni-NTA resin (Qiagen, Cat no. 30230), and then purified by sequentially flowing washing buffer (imidazole concentration in the lysis buffer composition: 20mM) and elution buffer (imidazole concentration in the lysis buffer composition: 250mM).
  • washing buffer imidazole concentration in the lysis buffer composition: 20mM
  • elution buffer imidazole concentration in the lysis buffer composition: 250mM
  • Example 2-1 Determination of residual activity of glucanase variants
  • each purified enzyme was left at 75°C and 80°C for 5 minutes.
  • 50 ul of 1% glucan, 5 ul of 1M buffer, and an appropriate amount of enzyme before and after heat treatment were mixed and adjusted to a final volume of 100 ul with tertiary distilled water. This mixture was mixed well and reacted at 37°C, and the reducing sugar produced was measured by the DNS method.
  • the DNS solution manufacturing method is as follows.
  • M1, M2, M3 showed improved heat resistance.
  • M1 was 54% and M2 was 70% at 80°C, showing more than 50% improved heat resistance compared to 1% for C.
  • M3 showed excellent residual activity of over 92%.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Polymers & Plastics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Mycology (AREA)
  • Physics & Mathematics (AREA)
  • Nutrition Science (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Animal Husbandry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 출원은 글루카나제 변이체에 관한 것이다.

Description

글루카나제 활성을 갖는 변이체 폴리펩티드
본 출원은 글루카나제 활성을 갖는 변이체 폴리펩티드에 관한 것이다.
1,3-1,4-β-글루칸은 다양한 식물의 세포벽을 구성하는 다당류이며 특히 보리, 호밀, 수수, 쌀 및 밀과 같은 상업적 가치가 있는 곡물의 세포벽에 다량 존재한다. 하지만, 글루칸은 항영양인자의 요인으로써 동물들이 식물 기반 사료를 소화하고 흡수하는데 방해하는 역할을 한다. 특히 단위동물의 경우 이러한 항영양인자를 분해할 수 있는 글루카나제 (EC 3.2.1.73)의 부재로 글루칸을 분해하여 이용하기 어렵다.
따라서, 사료에 글루카나제를 첨가해 줌으로써 가축의 효율적인 영양섭취가 가능해지며 이를 위해 사료에 적합한 글루카나제 개발이 필요하다(Murphy P, Bello FD, O'Doherty JV, Arendt EK, Sweeney T, Coffey A (2012) Effects of cereal β-glucans and enzyme inclusion on the porcine gastrointestinal tract microbiota. Anaerobe 18(6):557-565).
한편 사료용 효소의 경우 고온 공정에서 견딜 수 있는 내열성이 필수적이다.
본 출원의 목적은 서열번호 1의 N-말단으로부터 53번, 199번 및 200번 위치에 상응하는 아미노산 중 어느 하나 이상의 아미노산이 다른 아미노산으로 치환된, 글루카나제 활성을 갖는 변이체 폴리펩티드를 제공하는 것이다.
본 출원의 다른 목적은 본 출원의 폴리펩티드를 코딩하는 폴리뉴클레오티드를 제공하는 것이다.
본 출원의 또 다른 목적은 본 출원의 폴리펩티드; 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드; 및 상기 폴리뉴클레오티드를 포함하는 벡터 중 1 이상을 포함하는 미생물을 제공하는 것이다.
본 출원의 또 다른 목적은 본 출원의 폴리펩티드 및 본 출원의 미생물 중 1 이상을 포함하는, 글루칸 분해용 조성물을 제공하는 것이다.
본 출원의 또 다른 목적은 본 출원의 폴리펩티드 및 본 출원의 미생물 중 1 이상을 글루칸과 반응시키는 단계를 포함하는, 글루칸의 분해 방법을 제공하는 것이다.
본 출원의 또 다른 목적은 본 출원의 폴리펩티드 및 본 출원의 미생물 중 1 이상을 포함하는, 사료 첨가제 조성물을 제공하는 것이다.
본 출원의 또 다른 목적은 본 출원의 폴리펩티드 및 본 출원의 미생물 중 1 이상을 포함하는 사료 첨가제 조성물과 사료 성분을 혼합하는 단계를 포함하는, 사료제품의 제조 방법을 제공하는 것이다.
본 출원의 또 다른 목적은 본 출원의 폴리펩티드 및 본 출원의 미생물 중 1 이상을 포함하는, 식품용 조성물; 식품 제조용 조성물; 세제 조성물; 방직용 조성물; 및 제지용 조성물을 제공하는 것이다.
본 출원의 또 다른 목적은 본 출원의 미생물을 배양하는 단계를 포함하는, 글루카나제 활성을 갖는 변이체 폴리펩티드의 제조방법을 제공하는 것이다.
본 출원의 글루카나제 활성을 갖는 변이체 폴리펩티드는 내열성이 개선되어, 다양한 산업 분야에 유용하게 적용될 수 있다.
도 1은 C, M1, M2, M3 효소의 내열성을 평가한 결과이다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다.
또한, 당해 기술분야의 통상의 지식을 가진 자는 통상의 실험만을 사용하여 본 출원에 기재된 본 출원의 특정 양태에 대한 다수의 등가물을 인지하거나 확인할 수 있다. 또한, 이러한 등가물은 본 출원에 포함되는 것으로 의도된다.
또한, 본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
본 출원의 하나의 양태는, 서열번호 1의 N-말단으로부터 53번, 199번 및 200번 위치에 상응하는 아미노산 중 어느 하나 이상의 아미노산이 다른 아미노산으로 치환된, 글루카나제 활성을 갖는 변이체 폴리펩티드이다.
본 출원에서 “글루카나제 활성을 갖는 변이체 폴리펩티드”는, 글루카나제 활성을 갖는 임의의 폴리펩티드 또는 글루카나제에서, 서열번호 1의 N-말단으로부터 53번, 199번 및 200번 위치에 상응하는 아미노산 중 어느 하나 이상의 아미노산의 다른 아미노산으로의 치환을 포함하는 변이체를 의미한다.
본 출원에서 “글루카나제”는 글루칸에서 2개의 글루코실 잔기를 연결하고 있는 글루코시드 결합을 분해할 수 있는 활성을 갖는 효소를 의미한다. 글루카나제 활성의 비제한적인 예시로 D-글루코스 간의 베타-1,4 결합에 대한 엔도-셀룰라제 활성을 가지거나, 1,3- 및 1,4-결합을 포함하는 베타-D-글루칸의 (1,4)-베타―D-글루코시드 결합을 분해하는 리케니나제(licheninase 또는 lichenase) 활성을 들 수 있다. 일 구현예로서 본 출원의 글루카나제는 EC 3.2.1.73 으로 분류되는 글루카나제에 상응하는 활성을 가질 수 있다.
일 구현예로, 본 출원에서 변이 대상이 되는 기준 (Reference) 글루카나제는 서열번호 1의 아미노산 서열 또는 이와 적어도 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% 이상, 또는 99% 이상 상동성 또는 동일성을 갖는 아미노산 서열을 포함하는 단백질일 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 상기 단백질에 상응하는 효능을 나타내는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 단백질도 본 출원의 변이 대상이 되는 기준 단백질의 범위 내에 포함됨은 자명하다.
본 출원에서 기준 글루카나제의 일 예로 서열번호 1의 아미노산 서열을 포함하는 단백질을 정의하였으나, 이의 아미노산 서열 앞뒤로의 무의미한 서열 추가 또는 자연적으로 발생할 수 있는 돌연변이, 혹은 이의 잠재성 돌연변이(silent mutation)를 제외하는 것이 아니며, 서열번호 1의 아미노산 서열 앞뒤로의 무의미한 서열 추가 또는 자연적으로 발생할 수 있는 돌연변이, 혹은 이의 잠재성 돌연변이(silent mutation)를 제외하는 것이 아니며, 서열번호 1의 아미노산 서열로 이루어진 단백질과 서로 동일 또는 상응하는 활성을 가지는 경우라면 기준 글루카나제에 해당될 수 있음은 당업자에게 자명하다. 다른 기준 글루카나제의 예시로는 Orpinomyces sp., Neocallimastix sp., Piromyces sp., Clostridium sp., Rhodothermus sp., 또는 Ruminococcus sp. 유래의 글루카나제를 들 수 있다. 또 다른 글루카나제의 하나의 예시로, 오르피노마이세스(Orpinomyces sp. )속 유래 야생형 글루카나제를 들 수 있다.
본 출원에서 용어, “변이체(variant)”또는 “변이형 폴리펩티드(modified polypeptide)”는 하나 이상의 아미노산이 보존적 치환(conservative substitution) 및/또는 변형(modification)에 있어서 상기 열거된 서열(the recited sequence)과 상이하나, 상기 단백질의 기능(functions) 또는 특성(properties)이 유지되는 단백질을 지칭한다.
상기 변이체는 수 개의 아미노산 치환, 결실 또는 부가에 의해 식별되는 서열(identified sequence)과 상이하다. 이러한 변이체는 일반적으로 상기 단백질의 아미노산 서열 중 하나 이상의 아미노산을 변형하고, 상기 변형된 단백질의 특성을 평가하여 식별될 수 있다. 즉, 변이체의 능력은 본래 단백질(native protein)에 비하여 증가되거나, 변하지 않거나, 또는 감소될 수 있다. 또한, 일부 변이체는 N-말단 리더 서열 또는 막전이 도메인(transmembrane domain)과 같은 하나 이상의 부분이 제거된 변이형 폴리펩티드를 포함할 수 있다. 다른 변이체는 성숙 단백질 (mature protein) 의 N- 및/또는 C-말단으로부터 일부분이 제거된 변이체를 포함할 수 있다. 상기 용어 “변이체” 또는 “변이형 폴리펩티드”는 변이형, 변형, 변이된 단백질, 변이 등의 용어(영문 표현으로는 modification, modified protein, mutant, mutein, divergent, variant 등)가 혼용되어 사용될 수 있으며, 변이된 의미로 사용되는 용어라면 이에 제한되지 않는다.
본 출원에서 용어 “보존적 치환(conservative substitution)”은 한 아미노산을 유사한 구조적 및/또는 화학적 성질을 갖는 또 다른 아미노산으로 치환시키는 것을 의미한다. 통상적으로, 보존적 치환은 생성된 폴리펩티드의 활성에 거의 영향을 미치지 않거나 또는 영향을 미치지 않을 수 있다.
상기 변이체는 하나 이상의 생물학적 활성을 여전히 보유하면서, 예를 들어 하나 이상의 보존적 치환을 가질 수 있다. 이러한 아미노산 치환은 일반적으로 잔기의 극성, 전하, 용해도, 소수성, 친수성 및/또는 양친매성(amphipathic nature)에서의 유사성에 근거하여 발생할 수 있다.
이러한 분류의 예로, 양으로 하전된(염기성) 아미노산은 아르기닌, 라이신, 및 히스티딘; 음으로 하전된(산성) 아미노산은 글루탐산 및 아스파테이트; 비극성 곁사슬(nonpolar side chain)을 갖는 아미노산(비극성 아미노산)은 글리신, 알라닌, 발린, 류신, 이소류신, 메티오닌, 페닐알라닌, 트립토판 및 프롤린; 극성(polar) 또는 친수성(hydrophilic) 곁사슬을 갖는 아미노산(극성 아미노산)은 세린, 쓰레오닌, 시스테인, 타이로신, 아스파라긴 및 글루타민이 속하는 것으로 분류할 수 있다. 다른 일 예로, 전하를 띠는 곁사슬을 가지는 아미노산인(electrically charged amino acid) 아르기닌, 라이신, 히스티딘, 글루탐산, 아스파테이트와, 전하를 띠지 않는 곁사슬을 갖는 아미노산(uncharged amino acid; neutral amino acid로도 지칭)인 글리신, 알라닌, 발린, 류신, 이소류신, 메티오닌, 페닐알라닌, 트립토판, 프롤린, 세린, 쓰레오닌, 시스테인, 타이로신, 아스파라긴 및 글루타민으로 분류할 수 있다. 다른 일 예로, 페닐알라닌, 트립토판 및 타이로신은 방향족 아미노산(aromatic amino acid)으로 분류할 수 있다. 다른 일 예로, 발린, 류신, 이소류신은 분지쇄 아미노산(branched amino acid)으로 분류할 수 있다. 다른 일 예로, 20종 아미노산을 크기에 따라 분류하여 상대적으로 부피(volume)가 작은 아미노산 그룹부터 글리신, 알라닌, 세린; 시스테인, 프롤린, 쓰레오닌, 아스파테이트, 아스파라긴; 발린, 히스티딘, 글루탐산, 글루타민; 이소류신, 류신, 메치오닌, 라이신, 아르기닌; 및 페닐알라닌, 트립토판, 타이로신의 5군으로 분류할 수 있다. 그러나 반드시 이에 제한되는 것은 아니다.
또한, 변이체는 폴리펩티드의 특성과 2차 구조에 최소한의 영향을 갖는 아미노산들의 결실 또는 부가를 포함할 수 있다. 예를 들면 폴리펩티드는 번역-동시에(co-translationally) 또는 번역-후에(post-translationally) 단백질의 이전(transfer)에 관여하는 단백질 N-말단의 시그널(또는 리더) 서열과 컨쥬게이트 할 수 있다. 또한 상기 폴리펩티드는 폴리펩티드를 확인, 정제, 또는 합성할 수 있도록 다른 서열 또는 링커와 컨쥬게이트 될 수 있다.
하나의 구현예로, 본 출원의 변이체 폴리펩티드는 전술한 글루카나제 중, 서열번호 1의 N-말단으로부터 53번, 199번 및 200번 위치에 상응하는 아미노산 중 어느 하나 이상의 아미노산이 다른 아미노산으로 치환된, 글루카나제 활성을 갖는 변이체 폴리펩티드 일 수 있다.
본 출원에서, '다른 아미노산으로 치환'은 치환 전의 아미노산과 다른 아미노산이면 제한되지 않는다. 한편, 본 출원에서 '특정 아미노산이 치환되었다'고 표현하는 경우, 다른 아미노산으로 치환되었다고 별도로 표기하지 않더라도 치환 전의 아미노산과 다른 아미노산으로 치환되는 것임은 자명하다.
전술한 구현예 중 어느 하나의 구현예로, 본 출원의 변이체 폴리펩티드는 53번 위치에 상응하는 아미노산의 시스테인(C)으로의 치환을 포함할 수 있다.
전술한 구현예 중 어느 하나의 구현예로, 본 출원의 변이체 폴리펩티드는 199번 위치에 상응하는 아미노산의 시스테인(C)으로의 치환을 포함할 수 있다.
전술한 구현예 중 어느 하나의 구현예로, 본 출원의 변이체 폴리펩티드는 200번 위치에 상응하는 아미노산의 프롤린(P)으로의 치환을 포함할 수 있다.
전술한 구현예 중 어느 하나의 구현예로, 본 출원의 변이체 폴리펩티드는 다음 중 어느 하나 이상의 치환을 포함할 수 있다: i) 53번 위치에 상응하는 아미노산의 시스테인(C)으로의 치환; ii) 199번 위치에 상응하는 아미노산의 시스테인(C)으로의 치환; 및 200번 위치에 상응하는 아미노산의 프롤린(P)으로의 치환.
전술한 구현예 중 어느 하나의 구현예로, 본 출원의 변이체 폴리펩티드는 다음 중 선택되는 치환을 포함할 수 있다: (i) 200번 위치에 상응하는 아미노산의 프롤린(P)으로의 치환; (ii) 53번 위치에 상응하는 아미노산의 시스테인(C)으로의 치환 및 199번 위치에 상응하는 아미노산의 시스테인(C)으로의 치환; 또는 (iii) 200번 위치에 상응하는 아미노산의 프롤린(P)으로의 치환, 53번 위치에 상응하는 아미노산의 시스테인(C)으로의 치환, 및 199번 위치에 상응하는 아미노산의 시스테인(C)으로의 치환.
전술한 구현예 중 어느 하나의 구현예로, 본 출원의 변이체 폴리펩티드는 53번 위치에 상응하는 아미노산의 시스테인(C)으로의 치환, 및 199번 위치에 상응하는 아미노산의 시스테인(C)으로의 치환을 포함하고, 상기 치환된 아미노산 쌍이 (즉, 시스테인 잔기 간에) 이황화결합을 형성하는 변형을 포함할 수 있다.
본 출원의 “N번 위치”는 N번 위치 및 N번 위치와 상응(corresponding)하는 아미노산 위치를 포함할 수 있다. 예를 들면 특정 아미노산 서열에 개시된 성숙 폴리펩티드(mature polypeptide)에서 임의의 아미노산 잔기에 상응하는 아미노산 위치를 포함할 수 있다. 일 예로, 상기 특정 아미노산 서열은 서열번호 1의 아미노산 서열일 수 있다.
본 출원에서, 용어 “상응하는(corresponding to)”은, 폴리펩티드에서 열거되는 위치의 아미노산 잔기이거나, 또는 폴리펩티드에서 열거되는 잔기와 유사하거나 동일하거나 상동한 아미노산 잔기를 지칭한다. 상응하는 위치의 아미노산을 확인하는 것은 특정 서열을 참조하는 서열의 특정 아미노산을 결정하는 것일 수 있다. 본 출원에 사용된 “상응 영역”은 일반적으로 관련 단백질 또는 참조 (reference) 단백질에서의 유사하거나 대응되는 위치를 지칭한다.
본 출원에서, 본 출원에 사용되는 단백질 내의 아미노산 잔기 위치에 특정 넘버링이 사용될 수 있다. 예를 들면, 비교하고자 하는 대상 단백질과 본 출원의 단백질의 폴리펩티드 서열을 정렬함으로써, 본 출원의 단백질의 아미노산 잔기 위치에 상응하는 위치에 대해 재넘버링 하는 것이 가능하다.
예를 들어, 임의의 아미노산 서열을 서열번호 1와 정렬(align)하고, 이를 토대로 상기 아미노산 서열의 각 아미노산 잔기는 서열번호 1와 아미노산 잔기와 상응하는 아미노산 잔기의 숫자 위치를 참조하여 넘버링 할 수 있다. 예를 들어, 본 출원에 기재된 것과 같은 서열 정렬 알고리즘은, 쿼리 시퀀스(“참조 서열”이라고도 함)와 비교하여 아미노산의 위치, 또는 치환, 삽입 또는 결실 등의 변형이 발생하는 위치를 확인할 수 있다.
이러한 정렬에는 예를 들어 Needleman-Wunsch 알고리즘(Needleman 및 Wunsch, 1970, J. Mol. Biol. 48: 443-453), EMBOSS 패키지의 Needleman 프로그램 (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277) 등을 이용할 수 있으나, 이에 제한되지 않고 당업계에 알려진 서열 정렬 프로그램, 쌍 서열(pairwise sequence) 비교 알고리즘 등을 적절히 사용할 수 있다.
일 구현예로, 본 출원의 변이체 폴리펩티드는 서열번호 1의 N-말단으로부터 53번, 199번 및 200번 위치에 상응하는 아미노산 중 어느 하나 이상의 아미노산이 다른 아미노산으로 치환되고, 서열번호 1의 아미노산 서열 또는 이와 적어도 80%, 85%, 90%, 95%, 96%, 97%, 98%, 또는 99% 이상의 상동성 또는 동일성을 갖는 아미노산 서열을 포함할 수 있다.
전술한 구현예 중 어느 하나의 구현예로, 본 출원의 변이체 폴리펩티드는 서열번호 1의 N-말단으로부터 53번, 199번 및 200번 위치에 상응하는 아미노산 중 어느 하나 이상의 아미노산이 다른 아미노산으로 치환되고, 서열번호 1의 아미노산 서열 또는 이와 적어도 80%, 85%, 90%, 95%, 96%, 97%, 98%, 또는 99% 이상의 서열 상동성 또는 동일성을 가질 수 있다.
전술한 구현예 중 어느 하나의 구현예로, 본 출원의 변이체 폴리펩티드는 서열번호 2 내지 4 중 어느 하나의 아미노산 서열을 포함할 수 있다.
전술한 구현예 중 어느 하나의 구현예로, 본 출원의 변이체 폴리펩티드는 서열번호 2 내지 4 중 어느 하나의 아미노산 서열로 필수적으로 구성되거나(consisting essentially of) 것일 수 있고, 보다 구체적으로는 서열번호 2 내지 4 중 어느 하나의 아미노산 서열로 구성되는 것일 수 있으나, 이에 제한되지 않는다.
전술한 구현예 중 어느 하나의 구현예로, 상기 변이체는 서열번호 2 내지 4 중 어느 하나의 아미노산 서열을 포함하거나, 또는 상기 아미노산 서열에서 53번, 199번 및 200번 위치에 상응하는 아미노산은 고정되고 (즉, 변이체의 아미노산 서열에서, 상기 서열번호 2 내지 4 중 어느 하나의 아미노산 서열의 53번, 199번 및 200번 위치에 상응하는 아미노산은 상기 서열번호 2 내지 4 중 어느 하나의 아미노산 서열의 53번, 199번 및 200번 위치의 아미노산과 동일하고), 이와 적어도 80% 이상의 상동성 또는 동일성을 갖는 서열을 포함할 수 있다.
또한, 이러한 상동성 또는 동일성을 가지며 상기 변이체에 상응하는 효능을 나타내는 아미노산 서열이라면, 53번, 199번, 200번 위치에서 선택된 하나 이상의 위치 이외에 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 단백질도 본 출원의 범위에 포함됨은 자명하다.
본 출원에서 용어, “상동성(homology)”또는 “동일성(identity)”은 두 개의 주어진 아미노산 서열 또는 염기 서열 상호간 유사한 정도를 의미하며 백분율로 표시될 수 있다. 용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.
보존된(conserved) 폴리뉴클레오티드 또는 폴리펩티드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성을 갖거나(homologous) 또는 동일한(identical) 서열은 일반적으로 서열 전체 또는 일부분과 중간 또는 높은 엄격한 조건(stringent conditions)에서 하이브리드할 수 있다. 하이브리드화는 폴리뉴클레오티드에서 일반 코돈 또는 코돈 축퇴성을 고려한 코돈을 함유하는 폴리뉴클레오티드와의 하이브리드화 역시 포함됨이 자명하다.
임의의 두 폴리뉴클레오티드 또는 폴리펩티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는, 예를 들어, Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444에서와 같은 디폴트 파라미터를 이용하여 “FASTA”프로그램과 같은 공지의 컴퓨터 알고리즘을 이용하여 결정될 수 있다. 또는, EMBOSS 패키지의 니들만 프로그램(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277)(버전 5.0.0 또는 이후 버전)에서 수행되는 바와 같은, 니들만-운치(Needleman-Wunsch) 알고리즘(Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453)이 사용되어 결정될 수 있다(GCG 프로그램 패키지(Devereux, J., et al, Nucleic Acids Research 12: 387(1984)), BLASTP, BLASTN, FASTA(Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, 및 [CARILLO et al.](1988) SIAM J Applied Math 48: 1073을 포함한다). 예를 들어, 국립 생물공학 정보 데이터베이스 센터의 BLAST, 또는 ClustalW를 이용하여 상동성, 유사성 또는 동일성을 결정할 수 있다.
폴리뉴클레오티드 또는 폴리펩티드의 상동성, 유사성 또는 동일성은, 예를 들어, Smith and Waterman, Adv. Appl. Math(1981) 2:482 에 공지된 대로, 예를 들면, Needleman et al.(1970), J Mol Biol. 48:443과 같은 GAP 컴퓨터 프로그램을 이용하여 서열 정보를 비교함으로써 결정될 수 있다. 요약하면, GAP 프로그램은 두 서열 중 더 짧은 것에서의 기호의 전체 수로, 유사한 배열된 기호(즉, 뉴클레오티드 또는 아미노산)의 수를 나눈 값으로 정의할 수 있다. GAP 프로그램을 위한 디폴트 파라미터는 (1) 유니터리 비교 매트릭스(동일성을 위해 1 그리고 비-동일성을 위해 0의 값을 함유함) 및 Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358(1979)에 의해 개시된 대로, Gribskov et al(1986) Nucl. Acids Res. 14: 6745의 가중된 비교 매트릭스 (또는 EDNAFULL (NCBI NUC4.4의 EMBOSS 버전) 치환 매트릭스); (2) 각 갭을 위한 3.0의 페널티 및 각 갭에서 각 기호를 위한 추가의 0.10 페널티(또는 갭 개방 패널티 10, 갭 연장 패널티 0.5); 및 (3) 말단 갭을 위한 무 페널티를 포함할 수 있다. 따라서, 본 출원에서 사용된 용어 “상동성” 또는 “동일성”은 서열들간의 관련성(relevance)을 나타낸다.
본 출원에서, “효소활성(enzymatic activity)”또는 “글루카나제 활성”은 적어도 하나의 촉매 활성(catalytic activity)을 나타낸다. 구체적으로는 kcat/Km으로 주로 표현되는 효소의 전환 효율일 수 있으나, 이에 제한되지 않는다.
kcat는 효소가 기질로 완전히 포화되었을 때, 한 개의 효소에 의한 단위시간에 생성물로 전환하는 속도상수(catalytic constant)를 의미하며, 전환수(turnover number)라고도 칭해진다. Km은 반응속도가 최고값(Vmax)의 절반일 때의 기질 농도(substrate concenstration)이다.
효소 활성을 표현하는 방법의 예시로, 특이적 활성(specific activity; umol of converted substrate x mg -1 x min -1) 또는 volumetric activity (umol of converted substrate x mL -1 x min -1)등이 있다. 다만 효소활성을 정의하는 것은 전술한 내용에 제한되지 않고, 당업계에 알려진 내용을 토대로 정의하고 평가할 수 있다.
본 출원에서 효소 안정성(enzyme stability)이란, 효소 활성이 저장 또는 반응 시간 동안 보존되는 것을 의미한다. 이러한 안정성의 변화를 측정하기 위해, 최초 효소 활성을 정해진 조건 하에 0시간(time zero) (100%) 및 일정 시간 경과 후 (x%) 측정하여 비교함으로써, 효소활성이 상실되는 수준 내지는 효소 안정성을 표현할 수 있다.
효소 활성에 영향을 미치는 요소는, 예를 들어 pH, 열, 다른 물질(예를 들어, 산화제, 킬레이트제)의 존재 등이 있다.
본 출원에서 용어, “열안정성(thermal stability)”이란 특정 온도 범위에서 단백질이 기능할 수 있는 능력을 의미한다. 하나의 구현예로, 본 출원에서 제공하는 변이체 폴리펩티드는 약 20℃내지 약 120℃범위에서 활성을 가질 수 있고, 구체적으로 약 60℃내지 약 100℃범위에서 활성을 가지는 것일 수 있다.
본 출원에서 용어, “내열성(thermal tolerance)”이란 단백질이 특정 온도, 예를 들어 고열 또는 극저온에 노출된 후 기능할 수 있는 능력을 의미한다. 예를 들어, 내열성을 갖는 단백질은 노출된 온도에서는 기능하지 않을 수 있으나, 최적 온도 환경으로 돌아오면 다시 기능을 가질 수 있다. 하나의 구현예로, 본 출원에서 제공하는 변이체 폴리펩티드는 약 60℃내지 약 100℃범위의 고온에 노출된 후 기능할 수 있는 능력을 유지할 수 있다.
안정성 혹은 내열성의 증가는 다른 효소, 예를 들어 야생형 효소, 모 효소 및/또는 다른 변이형 폴리펩티드와 비교하여, 높은 효소 활성 유지; 또는 단백질이 기능을 유지하는 pH, 온도 및/또는 시간 등의 범위 증가를 포함한다.
일 구현예로, 본 출원에서 제공하는 변이체 폴리펩티드는 서열번호 1의 폴리펩티드에 비해 내열성 및/또는 열안정성이 개선된 것일 수 있다.
일 구현예로, 본 출원에서 제공하는 변이체 폴리펩티드는 야생형 폴리펩티드에 비해 내열성 및/또는 열안정성이 개선된 것일 수 있다.
일 구현예로, 본 출원에서 제공하는 변이체 폴리펩티드는 서열번호 1의 폴리펩티드에 비해 내열성이 개선된 것일 수 있다.
전술한 구현예 중 어느 하나의 구현예로, 본 출원에서 제공하는 변이체 폴리펩티드가 가지는 특성은 사료, 제빵, 펄프 표백(Pulp bleaching) 등을 포함한 다양한 산업 분야에 적용하기 적합한 활성, 개선된 활성일 수 있다.
본 출원의 다른 하나의 양태는 본 출원의 변이체 폴리펩티드를 코딩하는 폴리뉴클레오티드이다.
본 출원에서 용어, “폴리뉴클레오티드”는 뉴클레오티드 단위체(monomer)가 공유결합에 의해 길게 사슬모양으로 이어진 뉴클레오티드의 중합체(polymer)로 일정한 길이 이상의 DNA 또는 RNA 가닥을 의미한다.
본 출원의 변이체 폴리펩티드를 코딩하는 폴리뉴클레오티드는, 본 출원의 변이체 폴리펩티드 및 이에 상응하는 활성을 갖는 폴리펩티드를 코딩하는 폴리뉴클레오티드라면 제한 없이 포함될 수 있다.
본 출원의 변이체 폴리펩티드를 코딩하는 폴리뉴클레오티드는 코돈의 축퇴성(degeneracy)으로 인하여 또는 상기 폴리펩티드를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 폴리펩티드의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩 영역에 다양한 변형이 이루어질 수 있다.
일 구현예로, 본 출원의 변이체 폴리펩티드를 코딩하는 폴리뉴클레오티드는 서열번호 5의 폴리뉴클레오티드 서열과 상동성 또는 동일성이 적어도 50%, 60%, 70%, 75%, 80%, 85% 또는 90% 이상이고 100% 미만인 염기서열을 가지거나 포함할 수 있다.
전술한 구현예 중 어느 하나의 구현예로, 본 출원의 글루카나제 변이체를 코딩하는 폴리뉴클레오티드는 서열번호 5의 폴리뉴클레오티드 서열과 상동성 또는 동일성이 적어도 50%, 60%, 70%, 75%, 80%, 85% 또는 90% 이상이고 100% 미만인 염기서열을 가지거나 포함할 수 있고, 상기 상동성 또는 동일성을 갖는 서열에서, 서열번호 1의 N-말단으로부터 53번 위치에 상응하는 아미노산을 코딩하는 코돈은 아르기닌(R) 이외의 아미노산을 코딩하는 코돈 중 하나이거나; 199번 위치에 상응하는 아미노산을 코딩하는 코돈은 쓰레오닌(T) 이외의 아미노산을 코딩하는 코돈 중 하나이거나; 200번 위치에 상응하는 아미노산을 코딩하는 코돈은 아스파라긴(N) 이외의 아미노산을 코딩하는 코돈 중 하나이거나; 또는 이들의 조합 일 수 있다.
전술한 구현예 중 어느 하나의 구현예로, 본 출원의 글루카나제 변이체를 코딩하는 폴리뉴클레오티드는 서열번호 5의 폴리뉴클레오티드 서열과 상동성 또는 동일성이 적어도 50%, 60%, 70%, 75%, 80%, 85% 또는 90% 이상이고 100% 미만인 염기서열을 가지거나 포함할 수 있고, 상기 상동성 또는 동일성을 갖는 서열에서, 서열번호 1의 N-말단으로부터 53번 위치에 상응하는 아미노산 및/또는 199번 위치에 상응하는 아미노산을 코딩하는 코돈은 시스테인(C)을 코딩하는 코돈 중 하나일 수 있고/있거나, 200번 위치에 상응하는 아미노산을 코딩하는 코돈은 프롤린(P)을 코딩하는 코돈 중 하나일 수 있다.
또한, 본 출원의 폴리뉴클레오티드는 공지의 유전자 서열로부터 제조될 수 있는 프로브, 예를 들면, 본 출원의 폴리뉴클레오티드 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이브리드화할 수 있는 서열이라면 제한없이 포함될 수 있다.
상기 “엄격한 조건(stringent condition)”이란 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다. 이러한 조건은 문헌(J. Sambrook et al.,Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al.,Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8 참조)에 구체적으로 기재되어 있다. 예를 들어, 상동성 또는 동일성이 높은 폴리뉴클레오티드끼리, 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성 또는 동일성을 갖는 폴리뉴클레오티드끼리 하이브리드화하고, 그보다 상동성 또는 동일성이 낮은 폴리뉴클레오티드끼리 하이브리드화하지 않는 조건, 또는 통상의 써던 하이브리드화(southern hybridization)의 세척 조건인 60℃1×SSC, 0.1% SDS, 구체적으로 60℃0.1×SSC, 0.1% SDS, 보다 구체적으로 68℃0.1×SSC, 0.1% SDS에 상당하는 염 농도 및 온도에서, 1회, 구체적으로 2회 내지 3회 세정하는 조건을 열거할 수 있다.
혼성화는 비록 혼성화의 엄격도에 따라 염기 간의 미스매치(mismatch)가 가능할지라도, 두 개의 핵산이 상보적 서열을 가질 것을 요구한다. 용어, “상보적”은 서로 혼성화가 가능한 뉴클레오티드 염기 간의 관계를 기술하는데 사용된다. 예를 들면, DNA에 관하여, 아데닌은 티민에 상보적이며 시토신은 구아닌에 상보적이다. 따라서, 본 출원의 폴리뉴클레오티드는 또한 실질적으로 유사한 핵산 서열뿐만 아니라 전체 서열에 상보적인 단리된 핵산 단편을 포함할 수 있다.
구체적으로, 본 출원의 폴리뉴클레오티드와 상동성 또는 동일성을 가지는 폴리뉴클레오티드는 55℃의 Tm 값에서 혼성화 단계를 포함하는 혼성화 조건을 사용하고 상술한 조건을 사용하여 탐지할 수 있다. 또한, 상기 Tm 값은 60℃, 63℃또는 65℃일 수 있으나, 이에 제한되는 것은 아니고 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다.
상기 폴리뉴클레오티드를 혼성화하는 적절한 엄격도는 폴리뉴클레오티드의 길이 및 상보성 정도에 의존하고 변수는 해당기술분야에 잘 알려져 있다(예컨대, J. Sambrook et al., 상동).
본 출원의 또 다른 하나의 양태는 본 출원의 변이체 폴리펩티드를 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 제공한다. 상기 변이체 폴리펩티드 및 폴리뉴클레오티드에 대해서는 상기 다른 양태에서 기재한 바와 같다.
본 출원에서 사용된 용어 “벡터”는 적합한 숙주 내에서 목적 폴리펩티드를 발현시킬 수 있도록 적합한 발현조절영역(또는 발현조절서열)에 작동 가능하게 연결된 상기 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드의 염기서열을 함유하는 DNA 제조물을 의미한다. 상기 발현조절영역은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다. 벡터는 적당한 숙주세포 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다.
일례로 세포 내 염색체 삽입용 벡터를 통해 염색체 내에 목적 단백질을 코딩하는 폴리뉴클레오티드를 변이된 폴리뉴클레오티드로 교체시킬 수 있다. 상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합에 의하여 이루어질 수 있으나, 이에 한정되지는 않는다. 상기 염색체 삽입 여부를 확인하기 위한 선별 마커(selection marker)를 추가로 포함할 수 있다. 선별 마커는 벡터로 형질전환된 세포를 선별, 즉 목적 핵산 분자의 삽입 여부를 확인하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 단백질의 발현과 같은 선택가능 표현형을 부여하는 마커들이 사용될 수 있다. 선택제(selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환된 세포를 선별할 수 있다.
본 출원에서 사용되는 벡터는 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다.
원핵세포에서 통상 사용되는 벡터의 예로, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등을 사용할 수 있다. 구체적으로는 pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, pDCM2 벡터 등을 사용할 수 있다.
진핵세포에서 사용되는 벡터의 일 예로서, 효모 발현 벡터는 조합 효모 플라스미드(YIp: integrative yeast plasmid) 및 염색체 외 플라스미드 벡터(extrachromosomal plasmid vector)가 모두 가능하다. 상기 염색체 외 플라스미드 벡터는 에피솜 효모 플라스미드(YEp: episomal yeast plasmid), 복제 효모 플라스미드(YRp: replicative yeast plasmid) 및 효모 중심체 플라스미드(YCp: yeast centromer plasmid)를 포함할 수 있다. 또한, 인위적 효모 염색체들(YACs: artificial yeast chromosomes)도 본 출원의 벡터로 이용이 가능하다. 구체적인 예로서, 이용 가능한 벡터는 pESCHIS, pESC-LEU, pESC-TRP, pESC-URA, Gateway pYES-DEST52, pAO815, pGAPZ A, pGAPZ B, pGAPZ C, pGAPα A, pGAPα B, pGAPα C, pPIC3.5K, pPIC6 A, pPIC6 B, pPIC6 C, pPIC6α A, pPIC6α B, pPIC6α C, pPIC9K, pYC2/CT, pYD1 Yeast Display Vector, pYES2, pYES2/CT, pYES2/NT A, pYES2/NT B, pYES2/NT C, pYES2/CT, pYES2.1, pYES-DEST52, pTEF1/Zeo, pFLD1, PichiaPinkTM, p427-TEF, p417-CYC, pGAL-MF, p427-TEF, p417-CYC, PTEF-MF, pBY011, pSGP47, pSGP46, pSGP36, pSGP40, ZM552, pAG303GAL-ccdB, pAG414GAL-ccdB, pAS404, pBridge, pGAD-GH, pGAD T7, pGBK T7, pHIS-2, pOBD2, pRS408, pRS410, pRS418, pRS420, pRS428, yeast micron A form, pRS403, pRS404, pRS405, pRS406, pYJ403, pYJ404, pYJ405 및 pYJ406를 포함하나, 이에 한정되는 것은 아니다.
본 출원에서 용어 “형질전환”은 표적 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 숙주세포 혹은 미생물 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오티드가 코딩하는 단백질이 발현할 수 있도록 하는 것을 의미한다. 형질전환된 폴리뉴클레오티드는 숙주세포 내에서 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함할 수 있다. 또한, 상기 폴리뉴클레오티드는 목적 단백질을 코딩하는 DNA 및 RNA를 포함한다. 상기 폴리뉴클레오티드는 숙주세포 내로 도입되어 발현될 수 있는 것이면, 어떠한 형태로도 도입될 수 있다. 예를 들면, 상기 폴리뉴클레오티드는 자체적으로 발현되는데 필요한 모든 요소를 포함하는 유전자 구조체인 발현 카세트(expression cassette)의 형태로 숙주세포에 도입될 수 있다. 상기 발현 카세트는 통상 상기 폴리뉴클레오티드에 작동 가능하게 연결되어 있는 프로모터(promoter), 전사 종결신호, 리보좀 결합부위 및 번역 종결신호를 포함할 수 있다. 상기 발현 카세트는 자체 복제가 가능한 발현 벡터 형태일 수 있다. 또한, 상기 폴리뉴클레오티드는 그 자체의 형태로 숙주세포에 도입되어 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있으며, 이에 제한되지 않는다.
또한, 상기에서 용어 “작동 가능하게 연결”된 것이란 본 출원의 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드의 전사를 개시 및 매개하도록 하는 프로모터 서열과 상기 유전자 서열이 기능적으로 연결되어 있는 것을 의미한다.
본 출원의 벡터를 형질전환 시키는 방법은 핵산을 세포 내로 도입하는 어떤 방법도 포함되며, 숙주세포에 따라 당 분야에서 공지된 바와 같이 적합한 표준 기술을 선택하여 수행할 수 있다. 예를 들어, 전기천공법(electroporation), 인산칼슘(CaPO4) 침전, 염화칼슘(CaCl2) 침전, 미세주입법(microinjection), 폴리에틸렌 글리콜(PEG)법, DEAE-덱스트란법, 양이온 리포좀법, 및 초산 리튬-DMSO법 등이 있으나, 이에 제한되지 않는다.
본 출원의 다른 하나의 양태는 본 출원의 변이체 폴리펩티드; 상기 변이체 폴리펩티드를 코딩하는 폴리뉴클레오티드; 및 상기 변이체 폴리펩티드를 포함하는 벡터 중 1 이상을 포함하는 미생물이다.
상기 미생물은 전술한 변이체 폴리펩티드, 이를 코딩하는 폴리뉴클레오티드, 상기 폴리뉴클레오티드를 포함하는 핵산 구조체 및/또는 벡터를 포함할 수 있다. 상기 핵산 구조체 또는 벡터는 염색체에 통합되거나, 또는 자가 복제되는 염색체외 벡터로 유지될 수 있다.
본 출원의 미생물은 본 출원의 변이체 폴리펩티드를 발현할 수 있는 것이면 제한 없이 포함될 수 있다. 예를 들어, 본 출원의 변이체 폴리펩티드의 재조합 생성에 유용한 임의의 세포가 포함되며, 예를 들어, 상기 미생물은 원핵세포 또는 진핵세포일 수 있다. 다른 예로, 상기 미생물의 예시에는 진균 (Fungi), 세균(Bacteria)가 포함된다.
하나의 구현예로, 본 출원의 미생물은 에스케리키아 속 미생물일 수 있고, 에스케리키아 콜라이(대장균; Escherichia coli), 에스케리키아 알베르티 (Escherichia albertii), 에스케리 키아 페르구소니 (Escherichia fergusonii), 에스케리키아 헤르만니 (Escherichia hermannii), 에스케리키아 불네리스 (Escherichia vulneris), 또는 에스케리키아 블랏태 (Escherichia blattae) 일 수 있다. 전술한 구현예 중 어느 하나의 구현예로, 상기 미생물은 에스케리키아 콜라이(Escherichia coli)일 수 있으나 이에 제한되지 않는다.
본 출원의 다른 하나의 양태는 본 출원의 변이체 폴리펩티드; 및 상기 변이체 폴리펩티드, 상기 변이체 폴리펩티드를 코딩하는 폴리뉴클레오티드, 및 상기 폴리뉴클레오티드를 포함하는 벡터 중 1 이상을 포함하는 미생물; 중 1 이상을 포함하는 글루칸 분해용 조성물이다. 본 출원의 다른 하나의 양태는 본 출원의 변이체 폴리펩티드; 및 상기 변이체 폴리펩티드, 상기 변이체 폴리펩티드를 코딩하는 폴리뉴클레오티드, 및 상기 폴리뉴클레오티드를 포함하는 벡터 중 1 이상을 포함하는 미생물; 중 1 이상을 포함하는 조성물의 글루칸 분해 용도이다.
본 출원의 다른 하나의 양태는 본 출원의 변이체 폴리펩티드; 및 상기 변이체 폴리펩티드, 상기 변이체 폴리펩티드를 코딩하는 폴리뉴클레오티드, 및 상기 폴리뉴클레오티드를 포함하는 벡터 중 1 이상을 포함하는 미생물; 중 1 이상을 글루칸과 반응시키는 단계를 포함하는, 글루칸의 분해 방법이다.
본 출원의 변이체 폴리펩티드 및/또는 상기 변이체 폴리펩티드, 상기 변이체 폴리펩티드를 코딩하는 폴리뉴클레오티드, 및 상기 폴리뉴클레오티드를 포함하는 벡터 중 1 이상을 포함하는 미생물은 글루칸을 함유하는 물질을 분해하는 데 사용될 수 있다.
일 구현예로, 본 출원에서 제공하는 글루칸 분해용 조성물은 본 출원의 변이체 폴리펩티드 외에, 자연적으로 발생한 물질 또는 자연적으로 비발생한(Non-naturally occurring) 물질을 더 포함할 수 있다.
일 구현예로, 본 출원에서 제공하는 글루칸 분해용 조성물은 동물 사료, 제빵, 바이오매스 당화, 펄프 표백 등 다양한 산업 분야에 적용하기 적합한 임의의 구성요소를 더 포함할 수 있다.
추가될 수 있는 물질의 예시는, 안정화제, 계면활성제, 빌더, 킬레이트제, 분산제, 효소, 효소 안정제, 촉매제, 활성화제, 담체, 합제, 활택제, 붕해제, 부형제, 가용화제, 현탁화제, 색소, 향료, 완충제, 보존제, 무통화제, 가용화제, 등장화제, 희석제, 윤활제 등을 포함하나, 이에 제한되지 않는다.
본 출원의 다른 하나의 양태는 본 출원의 변이체 폴리펩티드; 및 상기 변이체 폴리펩티드, 상기 변이체 폴리펩티드를 코딩하는 폴리뉴클레오티드, 및 상기 폴리뉴클레오티드를 포함하는 벡터 중 1 이상을 포함하는 미생물; 중 1 이상을 포함하는 사료 첨가제 조성물이다.
본 출원의 다른 하나의 양태는 본 출원의 변이체 폴리펩티드; 및 상기 변이체 폴리펩티드, 상기 변이체 폴리펩티드를 코딩하는 폴리뉴클레오티드, 및 상기 폴리뉴클레오티드를 포함하는 벡터 중 1 이상을 포함하는 미생물; 중 1 이상을 사료 첨가제 조성물과 사료 성분을 혼합하는 단계를 포함하는, 사료제품의 제조 방법이다.
본 출원의 변이체 폴리펩티드 또는 본 출원의 미생물은 하기 응용들 중 어느 하나로 사용될 수 있다:
a) 동물 사료원료에서의 첨가제; 및/또는
b) 동물용 사료 보충제; 및/또는
c) 곡물 기반 물질 (예를 들어, 이는 통곡물 또는 곡물의 일부일 수 있음)의 분해.
본 출원의 사료제품은 동물이 먹고, 섭취하며, 소화시키기 위한 또는 이에 적당한 임의의 천연 또는 인공 규정식, 한끼식 등 또는 상기 한끼식의 성분을 의미할 수 있으며, 당업계의 공지된 다양한 형태로 제조 가능하다.
본 출원의 글루카나제 활성을 갖는 변이체 폴리펩티드는 식품, 제지, 펄프, 세제, 공업 폐기물 처리, 바이오 소재 및 바이오 에너지 등 다양한 산업 분야에 이용될 수 있다. 글루카나제의 산업 분야에서의 응용에 대해서는 McCarthy TC, Lalor E, Hanniffy O, Savage AV, Tuohy MG, Comparison of wide-type and UV-mutant βglucanase-producing strains of Talaromyces emersonii with potential in brewing applications, J Ind Microbiol Biotechnol, 2005; Chaari F, Belghith-Fendri L, Blibech M, Driss D, Ellouzia SZ, Sameh M, Ellouz-Chaabouni S, Biochemical characterization of a lichenase from Penicillium occitanis Pol6 and its potential application in the brewing industry, Process Biochem, 2014; 및 Maktouf S, Moulis C, Kamoun A, Chaari F, Chaabouni SE, Remaud-Simeon M, A laundry detergent compatible lichenase: statistical optimization for production under solid state fermentation on crude millet, Ind Crops Prod, 2013 등의 문헌이 참조될 수 있다.
본 출원의 하나의 양태는 본 출원의 글루카나제 활성을 갖는 변이체 폴리펩티드 또는 본 출원의 미생물을 포함하는, 식품용 조성물; 또는 식품 제조용 조성물이다. 일 예로, 글루카나제는 양조(맥주, 와인 등), 과일 주스의 제조에 이용될 수 있다. 글루카나제는 당화 과정에서 첨가되어 맥아즙 점도를 낮추고 여과 성능을 향상시키며 맥아 용해율을 높이고 맥주 탁도를 방지하고 맥주 품질을 안정화시키는 역할을 할 수 있다.
본 출원의 다른 하나의 양태는 본 출원의 글루카나제 활성을 갖는 변이체 폴리펩티드 또는 본 출원의 미생물을 포함하는, 세제 조성물이다. 세제 조성물은 직물, 접시 또는 단단한 표면과 같은 세척될 품목으로부터 원하지 않는 화합물을 제거하는 데 사용되는 조성물이다. 세제 조성물의 예시로, 섬유 세제, 직물 세제, 유리, 목재, 플라스틱, 세라믹 및 금속 조리대 및 창문과 같은 단단한 표면 세척 제제, 카페트 세척제, 오븐 세척제, 섬유 방향제, 섬유 유연제, 식기 세척 세제 등을 들 수 있다.
본 출원의 다른 하나의 양태는 본 출원의 글루카나제 활성을 갖는 변이체 폴리펩티드 또는 본 출원의 미생물을 포함하는, 방직용 조성물이다. 본 출원의 글루카나제를 의복 제조를 위한 섬유의 가공에 사용할 수 있다. 이러한 가공은 표백, 염색 후 염료의 제거, 면 직물 혹은 면 혼방직물의 바이오폴리싱과 같은 가공을 포함한다.
본 출원의 다른 하나의 양태는 본 출원의 글루카나제 활성을 갖는 변이체 폴리펩티드 또는 본 출원의 미생물을 포함하는, 제지(paper processing)용 조성물이다. 본 출원의 글 글루카나제 활성을 갖는 변이체 폴리펩티드는 펄프 산업에서 폐수를 개선하거나, 잉크를 제거하거나 탈색에 사용될 수 있다.
전술한 구현예 중 어느 하나의 구현예로, 본 출원에서 제공하는 조성물은 다양한 산업 분야에 적용하기 적합한 임의의 구성요소를 더 포함할 수 있다. 전술한 구현예 중 어느 하나의 구현예로, 본 출원에서 제공하는 조성물은 목적하는 용도에 사용하기 적합한 임의의 다른 효소를 더 포함할 수 있다.
전술한 구현예 중 어느 하나의 구현예로, 본 출원에서 제공하는 조성물은 목적하는 용도에 사용하기 적합한 양으로 본 출원의 글루카나제 활성을 갖는 변이체 폴리펩티드 또는 본 출원의 미생물을 포함할 수 있다.
전술한 구현예 중 어느 하나의 구현예로, 본 출원에서 제공하는 조성물은 목적하는 용도에 사용하기 적합한 형태로 제공될 수 있다. 비제한적인 예시로, 상기 조성물은 바, 정제, 분말, 과립, 페이스트 또는 액체 형태 일 수 있다.
본 출원의 다른 하나의 양태는 본 출원의 변이체 폴리펩티드, 상기 변이체 폴리펩티드를 코딩하는 폴리뉴클레오티드, 및 상기 폴리뉴클레오티드를 포함하는 벡터 중 1 이상을 포함하는 미생물을 배양하는 단계를 포함하는, 글루카나제 활성을 갖는 변이체 폴리펩티드의 제조방법이다.
상기 배양은 미생물을 배양 배지에서 배양하는 단계를 포함할 수 있다.
본 출원에서, 용어 “배양”은 상기 숙주 세포를 적당히 조절된 환경 조건에서 생육시키는 것을 의미한다. 본 출원의 배양과정은 당업계에 알려진 적당한 배지와 배양조건에 따라 이루어질 수 있다. 이러한 배양 과정은 선택되는 균주에 따라 당업자가 용이하게 조정하여 사용할 수 있다. 구체적으로 상기 배양은 회분식, 연속식 및 유가식일 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서 용어, “배지”는 상기 숙주 세포를 배양하기 위해 필요로 하는 영양물질을 주성분으로 혼합한 물질을 의미하며, 생존 및 발육에 불가결한 물을 비롯하여 영양물질 및 발육인자 등을 공급한다. 구체적으로, 본 출원의 숙주 세포의 배양에 사용되는 배지 및 기타 배양 조건은 통상의 숙주 세포의 배양에 사용되는 배지라면 특별한 제한 없이 어느 것이나 사용할 수 있으나, 본 출원의 숙주 세포를 적당한 탄소원, 질소원, 인원, 무기화합물, 아미노산 및/또는 비타민 등을 함유한 통상의 배지 내에서 호기성 조건 하에서 온도, pH 등을 조절하면서 배양할 수 있다.
본 출원에서 상기 탄소원으로는 글루코오스, 사카로오스, 락토오스, 프룩토오스, 수크로오스, 말토오스 등과 같은 탄수화물; 만니톨, 소르비톨 등과 같은 당 알코올, 피루브산, 락트산, 시트르산 등과 같은 유기산; 글루탐산, 메티오닌, 라이신 등과 같은 아미노산 등이 포함될 수 있다. 또한, 전분 가수분해물, 당밀, 블랙스트랩 당밀, 쌀겨울, 카사버, 사탕수수 찌꺼기 및 옥수수 침지액 같은 천연의 유기 영양원을 사용할 수 있으며, 구체적으로는 글루코오스 및 살균된 전처리 당밀(즉, 환원당으로 전환된 당밀) 등과 같은 탄수화물이 사용될 수 있으며, 그 외의 적정량의 탄소원을 제한 없이 다양하게 이용할 수 있다. 이들 탄소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
상기 질소원으로는 암모니아, 황산암모늄, 염화암모늄, 초산암모늄, 인산암모늄, 탄산안모늄, 질산암모늄 등과 같은 무기질소원; 글루탐산, 메티오닌, 글루타민 등과 같은 아미노산, 펩톤, NZ-아민, 육류 추출물, 효모 추출물, 맥아 추출물, 옥수수 침지액, 카세인 가수분해물, 어류 또는 그의 분해생성물, 탈지 대두 케이크 또는 그의 분해 생성물 등과 같은 유기 질소원이 사용될 수 있다. 이들 질소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
상기 인원으로는 인산 제1칼륨, 인산 제2칼륨, 또는 이에 대응되는 소디움-함유 염 등이 포함될 수 있다. 무기화합물로는 염화나트륨, 염화칼슘, 염화철, 황산마그네슘, 황산철, 황산망간, 탄산칼슘 등이 사용될 수 있으며, 그 외에 아미노산, 비타민 및/또는 적절한 전구체 등이 포함될 수 있다. 이들 구성성분 또는 전구체는 배지에 회분식 또는 연속식으로 첨가될 수 있다. 그러나, 이에 한정되는 것은 아니다.
또한, 상기 숙주 세포의 배양 중에 수산화암모늄, 수산화칼륨, 암모니아, 인산, 황산 등과 같은 화합물을 배지에 적절한 방식으로 첨가하여, 배지의 pH를 조정할 수 있다. 또한, 배양 중에는 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 또한, 배지의 호기 상태를 유지하기 위하여, 배지 내로 산소 또는 산소 함유 기체를 주입하거나 혐기 및 미호기 상태를 유지하기 위해 기체의 주입 없이 혹은 질소, 수소 또는 이산화탄소 가스를 주입할 수 있으며, 이에 한정되는 것은 아니다.
배지의 온도는 20℃내지 55℃구체적으로는 25℃내지 40℃일 수 있으나 이에 제한되지 않는다. 배양 기간은 유용 물질의 원하는 생성량이 수득될 때까지 계속될 수 있으며, 구체적으로는 24 시간 내지 196 시간일 수 있으나 이에 제한되지 않는다.
일 구현예로, 본 출원의 변이체 폴리펩티드를 제조하는 방법은 상기 배양단계에서 발현되는 본 출원의 변이체 폴리펩티드를 회수하는 단계를 더 포함할 수 있다.
다른 하나의 구현예로, 상기 배양단계에서 발현된 변이체 폴리펩티드는 본 발명이 속하는 분야에 알려져 있는 방법을 사용하여 회수될 수 있다. 예를 들어, 상기 변이체 폴리펩티드는 수집, 원심분리, 여과, 추출, 분무-건조, 증발 또는 침전을 포함하나 이들에 한정되지 않는 통상적인 절차에 의해 배지로부터 회수될 수 있다.
상기 회수 방법은 본 출원의 미생물의 배양 방법, 예를 들어 회분식, 연속식 또는 유가식 배양 방법 등에 따라 당해 기술 분야에 공지된 적합한 방법을 이용하여 폴리펩티드를 수집(collect)하는 것일 수 있다. 예를 들어, 원심분리, 여과, 결정화 단백질 침전제에 의한 처리(염석법), 추출, 초음파 파쇄, 한외여과, 투석법, 분자체 크로마토그래피(겔여과), 흡착크로마토그래피, 이온교환 크로마토그래피, 친화도 크로마토그래피 등의 각종 크로마토그래피, HPLC 및 이들의 방법을 조합하여 사용될 수 있으며, 당해 분야에 공지된 적합한 방법을 이용하여 배지 또는 숙주 세포로부터 본 출원의 변이체를 회수할 수 있다.
다른 하나의 구현예로, 배양단계에서 숙주 세포에 의해 발현되는 변이체 폴리펩티드는 회수되지 않을 수 있다. 상기 구현예에서, 변이체 폴리펩티드를 발현하는 숙주 세포 자체를 변이체 폴리펩티드의 공급원으로 사용할 수 있다.
본 출원의 다른 하나의 양태는 본 출원의 변이체 폴리펩티드; 및 상기 폴리펩티드, 상기 변이체 폴리펩티드를 코딩하는 폴리뉴클레오티드, 및 상기 폴리뉴클레오티드를 포함하는 벡터 중 1 이상을 포함하는 미생물; 중 1 이상을 포함하는 조성물이다.
상기 조성물은 전술한 바와 같이, 식품용, 사료 첨가제, 식품 제조용, 세제용, 방직용, 또는 제지용으로 사용될 수 있다. 이에 따른 본 출원의 다른 하나의 양태는 상기 조성물의 식품, 사료 첨가제, 식품 제조, 세제, 방직, 또는 제지에 사용하기 위한 용도를 제공한다. 이에 대해서는 상기 양태에서 기술한 바와 같다.
이하 본 출원을 실시예 및 실험예를 통하여 보다 상세하게 설명한다. 그러나 이들 실시예 및 실험예는 본 출원을 예시적으로 설명하기 위한 것으로 본 출원의 범위가 이들 실시예 및 실험예에 한정되는 것은 아니다.
실시예 1. 글루카나제 활성을 가지는 단백질 생산
실시예 1-1. 변이체 재조합 플라스미드 제작
오르피노마이세스(Orpinomyces) sp. PC-2 균주의 지노믹 DNA(Genomic DNA)에서 유래한 유전자로부터 제작된 합성서열 C(서열번호 1)를 기반으로 변이체 3종 M1(서열번호 2), M2(서열번호 3), M3(서열번호 4)가 제작되었다.
클로닝을 위한 변이체 유전자 증폭을 위해 다음과 같은 조건으로 PCR이 진행되었다. 구체적으로, Template와 Primer, PCR premix(Taq 2X premix, Bioneer)를 사용하여 PCR을 통해 제작하였다. M1은 합성서열 C를 주형으로 에 M1-F, M1,R primer를 사용하였다. M2는 합성서열 C를 주형으로 M2-F1, M2-F2, M2-R1, M2-R2 primer를 사용하였다. M3는 M2를 주형으로 M3-F, M3R primer를 사용하였다.
PCR은 Eppendorf Mastercycler Nexus GX2를 이용하였고, 반응 조건은 다음과 같다.
최초 변성(Initial denaturation): - 95℃, 2min
변성(Denaturation): - 95℃, 20sec
어닐링(Annealing): - 50℃, 10sec
신장(Extension): - 72℃, 1min(Denaturation에서 Extension까지 30cycle)
최종 신장(Final Extension): - 72℃, 5min
증폭된 유전자는 In-Fusion HD cloning kit(Takara, Cat. No. 639650)를 이용하여 pET28a 벡터에 클로닝되었다.
Primer Sequence
>M1-F AACGGCCGTACCCCGATTAGCGCGTAT
>M1-R ATACGCGCTAATCGGGGTACGGCCGTT
>M2-F1 TTGACCATTGACTGCGATGGCAGCGGT
>M2-F2 TTTAACGGCCGTTGCAATATTAGCGCG
>M2-R1 ACCGCTGCCATCGCAGTCAATGGTCAA
>M2-R2 CGCGCTAATATTGCAACGGCCGTTAAA
>M3-F AACGGCCGTTGCCCGATTAGCGCGTAT
>M3-R ATACGCGCTAATCGGGCAACGGCCGTT
변이체 M1, M2, M3는 다음과 같은 부위에 변이가 발생하였다. M1은 서열번호 1에서 200번 위치의 아미노산인 아스파라진이 프롤린으로 치환되었다. M2는 서열번호 1에서 53번 위치의 아르기닌이 시스테인으로 치환되었으며, 199번 위치의 쓰레오닌이 시스테인으로 치환되었다. M3는 서열번호 1에서 53번 위치의 아르기닌이 시스테인으로, 199번 위치의 쓰레오닌이 시스테인으로, 그리고 200번 위치의 아스파라긴이 프롤린으로 치환되었다.
실시예 1-2. 글루카나제 유전자를 가지는 형질전환체 제작 및 효소 발현
실시예 1-1에서 제작한 재조합 플라스미드를 E.coli BL21으로 형질전환 하였다. 그리고 글루카나제 변이체를 생산하기 위해 LB 배지 5 ml에 형질전환체를 접종하였고 37℃에서 18시간 전 배양하였다. 본 배양을 위해 전 배양액 5 ml을 300 ml LB 배지에 접종하였고 37℃에서 배양하였다. 그리고, OD600 값이 0.4-0.6 사이일 때, 1M IPTG 120 ul를 넣어주고 12시간 추가로 배양하였다. 균체는 원심분리를 통해 회수되었으며 이는 lysis buffer(50mM Tris-HCl pH 8.0, 100mM NaCl, 10mM imidazole) 35ml에 재분산 되었다.
실시예 1-3. 글루카나제 활성을 가지는 폴리펩티드 정제
분산액 내의 균체는 초음파 분산기를 이용해 파쇄되었으며 원심분리를 통해 상등액인 조효소액을 확보하였다. 조효소액을 Ni-NTA resin(Qiagen, Cat no. 30230)에 흘려주어 흡착시킨 다음, washing buffer(lysis buffer 조성중 imidazole 농도만 20mM), Elution buffer(lysis buffer 조성에서 imidazole만 250mM)를 차례로 흘려주어 정제된 글루카나제 활성을 갖는 폴리펩티드를 확보하였다.
실시예 2. 글루카나제 변이체 내열성 평가
실시예 2-1. 글루카나제 변이체 잔존 활성 측정
변이체 내열성 평가를 위해 각각의 정제 효소를 75℃와 80℃에 5분간 방치하였다. 그리고 열처리된 효소의 활성을 측정하기 위해 50 ul의 1% 글루칸, 5 ul의 1M 버퍼 그리고 적당량의 열처리 전후 효소를 각각 섞어주고 최종 볼륨 100 ul가 되도록 3차 증류수로 맞춰주었다. 그리고 이 혼합액을 잘 섞은 뒤 37℃에서 반응하였고 생산된 환원당은 DNS법으로 측정하였다. DNS solution 제조법은 다음과 같다. 증류수 500ml 에 6.3g의 3,5-dinitrosalicylic acid(samchus, D1267) 를 첨가하고, 50℃에서 21g의 Sodium Hydroxide(Daejung, 7571-4400)을 첨가하면서 용해하고 Potassium sodium tartrate tetrahydrate(Daejung, 6618-4400)182g 및 Phenol(Sigma-Aldrich, P1037) 5g을 첨가하고, 증류수 300ml를 첨가하고, Sodium sulfite anhydrous(Daejung, 7634-4405) 5g을 첨가하여 용해 될 때까지 교반 한 후, 냉각 후 증류수로 최종 부피가 1000ml가 되도록 조정하여 여과하여 제조하였다.
실시예 3. 변이체의 내열성 평가 결과
글루카나제 활성을 갖는 단백질 및 변이체들의 내열성 평가를 위해 실시예 1-3에서 준비한 정제효소 C, M1, M2, M3 를 75℃와 80℃에 각각 5분간 방치하였다. 그리고 이 열처리된 효소를 이용하여 37℃에서 잔존활성을 확인하였다.
그 결과, C 대비 변이체 3종(M1, M2, M3) 모두 향상된 내열성을 보였다. 열처리 전 37℃에서의 효소활성을 100%로 하였을 때 80℃ 조건에서 M1은 54%, M2는 70%로 C의 1% 대비 50% 이상 향상된 내열성을 나타내었다. 또한, M3는 92% 이상의 우수한 잔존활성을 보였다.
이상의 설명으로부터, 본 출원이 속하는 기술분야의 당업자는 본 출원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 출원의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 출원의 범위에 포함되는 것으로 해석되어야 한다.

Claims (14)

  1. 서열번호 1의 N-말단으로부터 53번, 199번 및 200번 위치에 상응하는 아미노산 중 어느 하나 이상의 아미노산이 다른 아미노산으로 치환된, 글루카나제 활성을 갖는 변이체 폴리펩티드.
  2. 제1항에 있어서, 상기 변이체 폴리펩티드는 다음 중 어느 하나 이상의 치환을 포함하는 것인, 글루카나제 활성을 갖는 변이체 폴리펩티드:
    i) 53번 위치에 상응하는 아미노산의 시스테인(C)으로의 치환;
    ii) 199번 위치에 상응하는 아미노산의 시스테인(C)으로의 치환; 및
    iii) 200번 위치에 상응하는 아미노산의 프롤린(P)으로의 치환;
  3. 제1항에 있어서, 상기 변이체 폴리펩티드는 다음 중 선택되는 치환을 포함하는 것인, 글루카나제 활성을 갖는 변이체 폴리펩티드;
    (i) 200번 위치에 상응하는 아미노산의 프롤린(P)으로의 치환;
    (ii) 53번 위치에 상응하는 아미노산의 시스테인(C)으로의 치환 및 199번 위치에 상응하는 아미노산의 시스테인(C)으로의 치환; 또는
    (iii) 53번 위치에 상응하는 아미노산의 시스테인(C)으로의 치환, 199번 위치에 상응하는 아미노산의 시스테인(C)으로의 치환 및 200번 위치에 상응하는 아미노산의 프롤린(P)으로의 치환.
  4. 제1항에 있어서, 상기 변이체 폴리펩티드는 53번 위치에 상응하는 아미노산의 시스테인(C)으로의 치환 및 199번 위치에 상응하는 아미노산의 시스테인(C)으로의 치환을 포함하고, 상기 아미노산 쌍이 이황화결합을 형성하는 변형을 포함하는, 글루카나제 활성을 갖는 변이체 폴리펩티드.
  5. 제1항에 있어서, 상기 변이체 폴리펩티드는 서열번호 5 내지 7 중 선택되는 어느 하나의 아미노산 서열을 포함하는, 글루카나제 활성을 갖는 변이체 폴리펩티드.
  6. 제1항에 있어서, 상기 변이체 폴리펩티드는 서열번호 1의 폴리펩티드에 비해 내열성이 개선된 것인, 폴리펩티드.
  7. 제1항 내지 제6항 중 어느 한 항의 변이체 폴리펩티드를 코딩하는 폴리뉴클레오티드.
  8. 제1항 내지 제6항 중 어느 한 항의 변이체 폴리펩티드; 상기 변이체 폴리펩티드를 코딩하는 폴리뉴클레오티드; 및 상기 폴리뉴클레오티드를 포함하는 벡터 중 1 이상을 포함하는 미생물.
  9. 제1항 내지 제6항 중 어느 한 항의 변이체 폴리펩티드; 및
    제1항 내지 제6항 중 어느 한 항의 변이체 폴리펩티드, 상기 변이체 폴리펩티드를 코딩하는 폴리뉴클레오티드, 및 상기 폴리뉴클레오티드를 포함하는 벡터 중 1 이상을 포함하는 미생물
    중 1 이상을 포함하는, 글루칸 분해용 조성물.
  10. 제1항 내지 제6항 중 어느 한 항의 변이체 폴리펩티드; 및
    제1항 내지 제6항 중 어느 한 항의 변이체 폴리펩티드, 상기 변이체 폴리펩티드를 코딩하는 폴리뉴클레오티드, 및 상기 폴리뉴클레오티드를 포함하는 벡터 중 1 이상을 포함하는 미생물
    중 1 이상을 이상을 글루칸과 반응시키는 단계를 포함하는, 글루칸 분해방법.
  11. 제1항 내지 제6항 중 어느 한 항의 변이체 폴리펩티드; 및
    제1항 내지 제6항 중 어느 한 항의 변이체 폴리펩티드, 상기 변이체 폴리펩티드를 코딩하는 폴리뉴클레오티드, 및 상기 폴리뉴클레오티드를 포함하는 벡터 중 1 이상을 포함하는 미생물
    중 1 이상을 포함하는, 조성물.
  12. 제1항 내지 제6항 중 어느 한 항의 변이체 폴리펩티드; 및
    제1항 내지 제6항 중 어느 한 항의 변이체 폴리펩티드, 상기 변이체 폴리펩티드를 코딩하는 폴리뉴클레오티드, 및 상기 폴리뉴클레오티드를 포함하는 벡터 중 1 이상을 포함하는 미생물
    중 1 이상을 포함하는 사료 첨가제 조성물과,
    사료 성분을 혼합하는 단계를 포함하는, 사료제품의 제조 방법.
  13. 제11항에 있어서, 상기 조성물은 식품용, 사료 첨가제, 식품 제조용, 세제용, 방직용, 또는 제지용인 것인, 조성물.
  14. 제1항 내지 제6항 중 어느 한 항의 변이체 폴리펩티드; 상기 변이체 폴리펩티드를 코딩하는 폴리뉴클레오티드; 및 상기 폴리뉴클레오티드를 포함하는 벡터 중 1 이상을 포함하는 미생물을 배양하는 단계를 포함하는, 글루카나제 활성을 갖는 폴리펩티드의 제조방법.
PCT/KR2023/012528 2022-08-24 2023-08-24 글루카나제 활성을 갖는 변이체 폴리펩티드 WO2024043708A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020220106311A KR20240029583A (ko) 2022-08-24 2022-08-24 글루카나제 활성을 갖는 변이체 폴리펩티드
KR10-2022-0106311 2022-08-24

Publications (1)

Publication Number Publication Date
WO2024043708A1 true WO2024043708A1 (ko) 2024-02-29

Family

ID=90013765

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/012528 WO2024043708A1 (ko) 2022-08-24 2023-08-24 글루카나제 활성을 갖는 변이체 폴리펩티드

Country Status (2)

Country Link
KR (1) KR20240029583A (ko)
WO (1) WO2024043708A1 (ko)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005003319A2 (en) * 2003-07-02 2005-01-13 Diversa Corporation Glucanases, nucleic acids encoding them and methods for making and using them
WO2009020459A2 (en) * 2006-08-04 2009-02-12 Verenium Corporation Glucanases, nucleic acids encoding them and methods for making and using them
WO2015144824A1 (en) * 2014-03-27 2015-10-01 Novozymes A/S Beta-glucanase variants and polynucleotides encoding same
WO2017129754A1 (en) * 2016-01-29 2017-08-03 Novozymes A/S Beta-glucanase variants and polynucleotides encoding same

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005003319A2 (en) * 2003-07-02 2005-01-13 Diversa Corporation Glucanases, nucleic acids encoding them and methods for making and using them
WO2009020459A2 (en) * 2006-08-04 2009-02-12 Verenium Corporation Glucanases, nucleic acids encoding them and methods for making and using them
WO2015144824A1 (en) * 2014-03-27 2015-10-01 Novozymes A/S Beta-glucanase variants and polynucleotides encoding same
WO2017129754A1 (en) * 2016-01-29 2017-08-03 Novozymes A/S Beta-glucanase variants and polynucleotides encoding same

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DATABASE PROTEIN 25 July 2016 (2016-07-25), ANONYMOUS : "1,3-1,4-beta-D-glucanase, partial [Orpinomyces sp. GMLF18]", XP093142276, retrieved from NCBI Database accession no. ADQ12984.1 *

Also Published As

Publication number Publication date
KR20240029583A (ko) 2024-03-06

Similar Documents

Publication Publication Date Title
WO2019027267A2 (ko) Atp 포스포리보실 전이효소 변이체 및 이를 이용한 l-히스티딘 생산방법
WO2013162274A1 (ko) 신규한 ｄ형 젖산 생산균주 및 그의 용도
WO2013105802A2 (ko) 자일로즈 이용능이 부여된 코리네박테리움 속 미생물 및 이를 이용한 ｌ-라이신의 생산방법
WO2018182354A1 (ko) 타가토스 생산용 조성물 및 이를 이용한 타가토스 제조방법
WO2014003439A1 (ko) 에탄올 생산 경로가 봉쇄된 클루이베로마이세스 막시아누스 균주 및 이의 용도
WO2019164346A1 (ko) L-트립토판을 생산하는 재조합 코리네형 미생물 및 이를 이용한 l-트립토판을 생산하는 방법
WO2012030130A2 (ko) 수크로오즈와 글리세롤을 동시에 이용하는 신규 숙신산 생성 변이 미생물 및 이를 이용한 숙신산 제조방법
Kaneko et al. Purification and characterization of a thermostable raw starch digesting amylase from a Streptomyces sp. isolated in a milling factory
WO2011099670A1 (ko) 셀룰로시마이크로비움 펀케이 에이치와이-１３ 균주로부터 생산되는 신규한 자일라나아제
WO2024043708A1 (ko) 글루카나제 활성을 갖는 변이체 폴리펩티드
WO2022145623A1 (ko) 글루타메이트-시스테인 리가아제 변이체 및 이를 이용한 글루타치온 생산방법
WO2024043709A1 (ko) 글루카나제 활성을 갖는 신규 폴리펩티드
WO2020067618A1 (ko) 알파-글루코시다제의 활성이 강화된 l-아미노산을 생산하는 미생물 및 이를 이용한 l-아미노산 생산 방법
JP5284947B2 (ja) 新規アミダーゼ、その遺伝子、ベクター、形質転換体、及びそれらを利用した光学活性カルボン酸アミド及び光学活性カルボン酸の製造方法
WO2021201643A1 (ko) 신규한 프로모터 및 이를 이용한 글루타치온 생산 방법
WO2021125867A1 (ko) 화합물을 생산하는 미생물 및 이를 이용한 화합물의 생산 방법
WO2024117529A1 (ko) 신규한 프로피온알데하이드 디하이드로게나제 활성을 갖는 변이체 폴리펩티드 및 이의 용도
KR102312807B1 (ko) 비피도박테리움 속의 저항전분 분해 활성을 가지는 아밀라아제들 및 이의 용도
WO2023224183A1 (ko) 신규한 글루타메이트 글루코네이트 리프레서 변이체 및 이를 이용한 l-아르기닌 생산 방법
WO2022260403A1 (ko) 슈퍼옥사이드 디스뮤테이즈 1 변이체 및 이를 이용한 글루타치온 또는 그 유도체의 생산방법
JP4358984B2 (ja) アルカリセルラーゼ遺伝子
WO2022231342A1 (ko) 변이형 spot 단백질 및 이를 이용한 l-아미노산을 생산하는 방법
CN114807103B (zh) 一种氨基甲酰基水解酶突变体及基因和应用
WO2021150019A1 (ko) 타가토스 생산용 조성물 및 이를 이용한 타가토스 제조 방법
WO2023287256A1 (ko) 신규한 베타-카로틴 15,15 -옥시게네이즈 변이체 및 이를 이용한 레티노이드 생산방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23857740

Country of ref document: EP

Kind code of ref document: A1