WO2024023208A1 - Plantes de maïs à inactivation d'eif4e pour résistance virale - Google Patents

Plantes de maïs à inactivation d'eif4e pour résistance virale Download PDF

Info

Publication number
WO2024023208A1
WO2024023208A1 PCT/EP2023/070825 EP2023070825W WO2024023208A1 WO 2024023208 A1 WO2024023208 A1 WO 2024023208A1 EP 2023070825 W EP2023070825 W EP 2023070825W WO 2024023208 A1 WO2024023208 A1 WO 2024023208A1
Authority
WO
WIPO (PCT)
Prior art keywords
maize
gene
plant
elf4e
genetically modified
Prior art date
Application number
PCT/EP2023/070825
Other languages
English (en)
Inventor
Stéphane Lafarge
Christophe Sallaud
Jacques Rouster
Original Assignee
Limagrain Europe
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Limagrain Europe filed Critical Limagrain Europe
Publication of WO2024023208A1 publication Critical patent/WO2024023208A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8283—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for virus resistance
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses

Definitions

  • the present invention relates to resistance of maize to viral diseases.
  • Maize can be affected by many viral diseases, in particular caused by several potyviruses, such as Sugarcane Mosaic Virus (SCMV), Maize Dwarf Mosaic Virus (MDMV), Wheat Streak Mosaic Virus (WSMV), which results in combination with MCMV Maize Chlorotic Mottle Virus (Machlomovirus genus in the Tombusviridae family) to Maize Lethal Necrosis Disease (MLND).
  • SCMV Sugarcane Mosaic Virus
  • MDMV Maize Dwarf Mosaic Virus
  • WSMV Wheat Streak Mosaic Virus
  • MCMV Maize Chlorotic Mottle Virus
  • achlomovirus genus in the Tombusviridae family to Maize Lethal Necrosis Disease (MLND).
  • Insecticide treatments are efficient to protect maize culture from MNLD and, until recently, there was few research to find alternatives to these treatments.
  • insecticide regulations become more stringent in some parts of the world, this leads to increased insect pressure and indirectly to an increase in plant viruses, since insects are important vectors of viruses.
  • Plant genetic resistance to some viruses does exist in nature. Introgression of this genetic resistance in commercial varieties is an alternative to chemical treatments generating no impact on the environment. Resistance to these viruses can be acquired by example using natural variability, or introgression of QTLs known to confer a resistance to such diseases (see Murithi et al., Frontiers in Genetics, 2021 , 12, 767883: 1 -17) or by using favorable allele of genes known to be involved in resistance to SCMV for example (see Leng et al. Molecular Plant, 2017, 10:1357-1359).
  • elF4E proteins Natural resistance is not always available in some crops. However, similar resistance can be created by mutagenesis, transgenesis or new breeding techniques. elF4E proteins have been used as genetic target to improve genetic resistance of many vegetable crops. elF4E proteins are indeed known to have a role in virus replication in plants. It was first demonstrated that elF4E knock-out (KO) vegetable plants did confer a tolerance to several viruses of the potyviridae family. However, the plant phenotype associated with elF4E knocking-out was shown to be often impaired, such as for example bolting delay, slow growth, affected fertility or even lethality (see Bastet et al., Trends in Plant Science, 2017, 22(5):411 -419).
  • W02004/057941 discloses a method for imparting virus resistance to plants, said method comprising silencing a gene encoding elF4E in the plant under conditions effective to impart virus resistance to the plant. Silencing is for example performed using an antisense oligonucleotide complementary to a mRNA encoding elF4E, in Capsicum and tomato. There is therefore a need to provide maize plants resistant to viral diseases, such as diseases caused by potyvirus and/or machlomovirus, as an alternative to the use of insecticide treatments.
  • viral diseases such as diseases caused by potyvirus and/or machlomovirus
  • elF4E knocking out confers virus resistance to maize, in particular resistance to at least one potyvirus and/or machlomovirus, without affecting the growth, yield and fertility of said maize plants.
  • elF4E1 and/or elF4E2 genes are knocked out to confer virus resistance to maize.
  • elFiso4E proteins are eukaryotic translation initiation factor 4E isoforms.
  • virus resistance in the maize plant according to the invention is not circumvented by recruitment of these isoforms by the virus infecting maize.
  • elF4E gene knockout is obtained by gene editing, preferably using CRISPR-Cas.
  • a first object of the invention is a genetically modified maize cell, comprising at least one knocked out elF4E gene.
  • Said elF4E gene may be elF4E1 gene or elF4E2 gene.
  • the genetically modified maize cell as defined above may comprise a knocked out elF4E1 gene and a knocked out elF4E2 gene.
  • Another object of the invention is a genetically modified maize plant resistant to at least one virus infecting maize or a part of said plant, wherein said plant or said part comprises cells as defined above. Said plant is not obtained by means of an essentially biological process.
  • Another object of the invention is a genetically modified maize seed resistant to at least one virus infecting maize, wherein said seed comprises cells as defined above.
  • Another object of the invention is a progeny of a genetically modified maize plant as defined above.
  • Said virus is preferably a potyvirus or a machlomovirus.
  • Said potyvirus is preferably selected from the group consisting of Sugarcane Mosaic Virus (SCMV), Maize Dwarf Mosaic Virus (MDMV) and Wheat Streak Mosaic Virus (WSMV).
  • Said machlomovirus is preferably MCMV Maize Chlorotic Mottle Virus).
  • the genetically modified maize plant as defined above, the part of said plant as defined above or the genetically modified maize seed as defined above may be resistant to at least two viruses infecting maize as defined above.
  • Another object of the invention is a vector suitable for knocking out at least one maize elF4E gene, wherein said vector comprises: a) at least one gRNA expression cassette, wherein said gRNA expression cassette comprises a nucleic acid encoding a gRNA under the control of a promoter and wherein said gRNA comprises a region complementary to a target region of said maize elF4E gene, and b) optionally, at least one CRISPR-Cas endonuclease expression cassette.
  • Another object of the invention is a method for obtaining a genetically modified maize plant resistant to at least one virus infecting maize, wherein said method comprises: a) knocking out at least one elF4E gene in a maize cell or maize tissue, to obtain a knocked out maize cell or a knocked out maize tissue, and b) regenerating a maize plant from the knocked out maize cell or knocked out maize tissue.
  • the step of knocking out at least one elF4E gene may comprise introducing at least one vector as defined above into said maize cell or maize tissue.
  • Another object of the invention is a method for identifying a maize plant resistant to at least one virus infecting maize, wherein said method comprises assessing (i) the expression of at least one elF4E protein and/or (ii) the sequence of at least one elF4E gene, wherein a maize plant is identified as resistant to at least one maize virus (i) in the absence of expression of said at least one elF4E protein and/or (ii) in the presence of mutation(s) in the sequence of said at least one elF4E gene leading to a non-functional elF4E gene.
  • elF4E refers to Eukaryotic Translation Initiation Factor 4E.
  • elF4E protein is a translation initiation factor encoded by the elF4E gene.
  • maize elF4E proteins There are two maize elF4E proteins: protein elF4E1 , which is encoded by an elF4E1 gene and protein elF4E2, which is encoded by an elF4E2 gene.
  • a reference sequence for native maize protein elF4E1 is for example sequence SEQ ID NO: 1 , also referred to as Zm00001 d041682_elF4E1 in B73 genome version 4 (identified as ZmA188v1 aHC012309_elF4E1 in J1A genome derived from A188).
  • the maize protein elF4E1 may comprise or consist of a sequence at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, at least 98% or at least 99% identical to sequence SEQ ID NO: 1 .
  • the maize protein elF4E1 preferably comprises or consists of sequence SEQ ID
  • the elF4E1 gene is located on chromosome 3, more precisely at positions chr3:133075625 to 133080137 in B73 genome version 4.
  • the elF4E1 gene comprises 5 exons.
  • Exon 1 is located in chr3: 133075814 to 133076061 in strain B73.
  • Exon 2 is located in chr3: 133077529 to 133077694 in strain B73.
  • a reference sequence for native elF4E1 gene is for example sequence SEQ ID NO: 8.
  • a reference sequence for native maize protein elF4E2 is for example sequence SEQ ID NO: 2, also referred to as Zm00001d041973_elF4E2 in B73 genome version 4, (identified as ZmA188v1 aHC012641_elF4E2 in J1 A genome derived from A188).
  • the maize protein elF4E2 may comprise or consist of a sequence at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, at least 98% or at least 99% identical to sequence SEQ ID NO: 2.
  • the maize protein elF4E1 preferably comprises or consists of sequence SEQ ID NO: 2.
  • the elF4E2 gene is located on chromosome 3, more precisely at positions chr3: 146285064 to 146288191 (reverse strand) in B73 genome version 4.
  • the elF4E2 gene comprises 5 exons.
  • Exon 1 is located on chr3: 146288074 to 146287821 in strain B73.
  • Exon 2 is located chr3: 146286386 to 146286221 in strain B73 (reverse strand).
  • a reference sequence for native elF4E2 gene is for example sequence SEQ ID NO: 9.
  • Maize comprises a single copy of the elF4E1 gene and a single copy of the elF4E2 gene.
  • the apb1 gene is located on chromosome 3 in maize, more precisely at positions chr3: 3:134550012 to 134554530 in B73 genome version 4.
  • a reference sequence for the apb1 gene is for example sequence SEQ ID NO: 10.
  • the apb1 gene encodes protein APB1 .
  • a reference sequence for native maize protein APB1 is sequence SEQ ID NO: 11 , also referred to as Zm00001 d04171 1 APB1 in B73 genome version 4.
  • Apb1 gene is located between eif4e1 and eif4e2 loci.
  • regulator sequences in the promoter of the apb1 gene have been identified as responsible for resistance to the Sugarcane Mosaic Virus (SCMV), a potyvirus (see Leng et al. 2017).
  • SCMV Sugarcane Mosaic Virus
  • maize virus or “virus infecting maize”, it is herein meant a virus able to infect maize.
  • the maize virus as defined above is preferably a potyvirus or a Machlomovirus.
  • the potyvirus may for example be selected from the group consisting of Sugarcane Mosaic Virus (SCMV), Maize Dwarf Mosaic Virus (MDMV) and Wheat Streak Mosaic Virus (WSMV).
  • SCMV Sugarcane Mosaic Virus
  • MDMV Maize Dwarf Mosaic Virus
  • WSMV Wheat Streak Mosaic Virus
  • the machlomovirus is for example MCMV Maize Chlorotic Mottle Virus).
  • resistance to at least one maize virus thus means resistance to the disease resulting from an infection with said at least one virus infecting maize.
  • the disease may for example be Maize Lethal Necrosis Disease (MLND), which is caused by the combination of (i) MCMV and (ii) SCMV, MDMV, WSMV or others potyvi ruses.
  • MLND Maize Lethal Necrosis Disease
  • the present invention thus relates to a genetically modified maize cell, wherein said cell comprises at least one knocked out elF4E gene.
  • maize cell or “maize plant cell” means a maize cell obtained from or found in a seed, suspension culture, embryo, meristematic region, callus tissue, leave, root, shoot, gametophyte, sporophyte, pollen, or microspore.
  • the genetically modified maize cell also includes a protoplast, in particular obtained from a tissue as defined above, as well as a cell from or found in a plant cell tissue culture from which plants can be regenerated or plant calli.
  • the elF4E gene which is knocked out, is an endogenous elF4E gene.
  • endogenous gene it is herein meant a gene naturally present in the maize cell.
  • the elF4E gene is particularly as defined above.
  • the elF4E gene which is knocked out in the genetically modified maize cell, for example comprises or consists of a sequence having at least 75%, preferably at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, identity to sequence SEQ ID NO: 8 or SEQ ID NO: 9.
  • the elF4E gene which is knocked out in the genetically modified maize cell comprises or consists of sequence SEQ ID NO: 8 or SEQ ID NO: 9.
  • the elF4E gene may be elF4E1 gene of sequence SEQ ID NO: 8 or elF4E2 gene of SEQ ID NO: 9.
  • the cell as defined above may thus comprise a knocked out elF4E1 gene and/or a knocked out elF4E2 gene.
  • the cell as defined above preferably comprises a knocked out elF4E1 gene and a knocked out elF4E2 gene.
  • knock out gene it is herein meant a non-functional gene.
  • a knocked-out gene can no longer express the full length-protein initially encoded by the gene.
  • a knocked-out gene can no longer express a functional protein, meaning that full length protein initially encoded by the gene is not translated anymore, but that a non-functional protein can be translated from said knocked-out gene.
  • nonfunctional protein it is herein meant a protein lacking at least one function of the functional protein, in particular of the native protein.
  • the gene may be knocked out by any suitable method well-known by the skilled person, such as using:
  • nucleic acid comprising a mutation or a gene to be inserted in the elF4E gene by homologous recombination
  • a zinc-finger nuclease comprising a DNA binding domain targeting the elF4E gene and a restriction endonuclease, thereby resulting in double stranded break in the elF4E gene
  • TALEN ⁇ Transcription activator-like effector nuclease comprising a DNA binding domain targeting the elF4E gene and a nuclease, thereby resulting in double stranded break in the elF4E gene, and/or - gene editing, for example using CRISPR/cas system, comprising a guide RNA complementary to a target sequence in the elF4E gene, said guide RNA being complexed with a Cas protein, thereby resulting in a double stranded break in the elF4E gene and optionally introducing a desired sequence.
  • gene editing includes insertion, deletion, or substitution of at least one base pair and leads to knock-out, change in the reading frame, specific amino acid change (including STOP codon creation) or a combination thereof.
  • Gene editing involves breaking of DNA strands and DNA damages repair mechanism such as non-homologous end joining or homologous recombination.
  • INDELs may change the reading-frame and/or introduce non-sense mutation(s), thereby leading to a non-functional elF4E gene and thus to a disrupted or truncated protein.
  • Gene silencing is indeed the regulation of gene expression in a cell, to prevent the expression of a given gene. Gene silencing generally reduces the expression of a gene but does not suppress totally (or entirely) its expression into a functional protein, contrary to gene knockout. Most popular gene silencing method is RNAi.
  • the expression “knocked-out gene” thus does not encompass a gene mutation resulting in a decrease in the level of expression of the protein encoded by said gene.
  • the expression “knocked-out gene” does not encompass a mutation in the promoter of said gene resulting in a decrease in the level of expression of the protein encoded by said gene.
  • the knock-out can be done by introducing at least one mutation, at least one other gene or sequence and/or at least a double stranded break in any part of the genomic sequence, including 5’ UTR, 3’IITR, introns, exons and promoter region of the eif4e gene.
  • the knock-out is preferably done by introducing at least one mutation, at least one other gene or sequence and/or at least a double stranded break in any part of the eif4e gene, more preferably inside introns and/or exons.
  • the maize cells comprising a knocked out elF4E1 gene thus do not express any elF4E1 protein.
  • the maize cells comprising a knocked out elF4E2 gene thus do not express any elF4E2 protein.
  • the maize cells comprising a knocked out elF4E1 gene and a knocked out elF4E2 gene thus do not express any elF4E1 protein, nor any elF4E2 protein.
  • the maize cells as defined above may express a non-functional protein from the knocked-out elF4E gene.
  • non-functional protein encoded by the knocked-out elF4E gene it is herein meant a protein, which is not able to participate in protein synthesis.
  • Any suitable method may be used to assess if a protein encoded by a knocked-out elF4E gene is non-functional, such as a yeast complementation test or any known standard methods.
  • the yeast is made deficient for the elF4E protein. Said deficient yeast will not grow if the protein encoded by a knocked-out elF4E gene is non-functional.
  • the non-functional protein as defined above encoded by the knocked-out elF4E gene preferably has a length lower than 150 amino acids, preferably lower than 100 amino acids.
  • the non-functional protein as defined above may for example comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 and SEQ ID NO: 17.
  • the non-functional protein has a length lower than 100 amino acids and (ii) comprises or consists of an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, at least 98% or at least 99% identity to sequence SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 16, or SEQ ID NO: 17.
  • the maize cell as defined above preferably does not comprise any exogenous nucleic acid encoding a maize elF4E protein, an elF4E protein from a plant other than maize and/or a variant thereof.
  • exogenous nucleic acid a nucleic acid, which is not naturally present in the maize cell.
  • An exogenous nucleic acid can for example be introduced in a cell by genetic engineering.
  • the maize cell as defined above has not been further genetically modified to express a maize elF4E protein, an elF4E protein from a plant other than maize, nor a variant thereof.
  • the maize cell as defined above preferably expresses at least one endogenous elFiso4E eukaryotic translation initiation factor isoform 4E) protein.
  • the maize cell as defined above thus preferably expresses protein elFiso4E1 and/or protein elFiso4E2.
  • the maize cells as defined above confer to said plant resistance to at least one maize virus.
  • the maize cell as defined above further comprises at least one apbt mutated gene.
  • the apbt gene is as defined above.
  • mutated gene includes at least one mutation, such as an insertion, deletion and/or substitution, by comparison the wild-type gene, such as the apbt gene of sequence SEQ ID NO: 10. This at least one mutation can occur in promoter, untranslated region, coding region (exon) and/or or non-coding region (intron) of the gene. Said mutated apbt gene expression preferably increases the resistance to at least one maize virus conferred by the at least one knocked-out elF4E gene or leads to another virus infection resistance.
  • the apbt promoter comprises Boxll motif and three SP1 motifs.
  • the present invention particularly relates to a genetically modified maize plant resistant to at least one virus infecting maize, a part thereof or a genetically modified maize seed resistant to at least one virus infecting maize.
  • the part of the maize plant as defined above may be any part of the maize plant.
  • tissue part means a cell, a protoplast, a tissue or an organ from said maize plant (such as embryo, pollen, ovule, seed, flower, kernel, ears cob, leaf, stalk, stem, root, root tips, anthers, silk, branch, husks or stalk).
  • plant means whole plant.
  • Said plant is not obtained by means of an essentially biological process.
  • the genetically modified maize plant comprises genetically modified maize cells as defined above in the section “Genetically modified maize cell”.
  • Said cells thus comprise at least one knocked out elF4E gene.
  • a genetically modified maize seed resistant to at least one virus infecting maize means that the plant grown from said seed is resistant to said at least one virus.
  • Said maize virus is particularly as defined above.
  • the genetically modified maize plant or genetically modified maize seed as defined above may for example be resistant to at least one potyvirus (such as SCMV, MDMV or WSMV) and/or at least one Machlomovirus (such as MCMV).
  • at least one potyvirus such as SCMV, MDMV or WSMV
  • Machlomovirus such as MCMV
  • Said genetically modified maize plant or genetically modified maize seed is thus resistant to the disease caused by said at least one virus infecting maize.
  • Said disease is for example as defined above.
  • the genetically modified maize plant or genetically modified maize seed as defined above may for example be resistant to MNLD.
  • the genetically modified maize plant or the genetically modified maize seed as defined above may be resistant to at least two viruses infecting maize, for example to at least three viruses infecting maize or at least four viruses infecting maize.
  • the genetically modified maize plant or the genetically modified maize seed as defined above may for example be resistant to SCMV, MDMV, WSMV and MCMV.
  • the genetically modified maize plant or the genetically modified maize seed as defined above may, for example, be resistant to SCMV and MCMV.
  • the genetically modified maize plant or the genetically modified maize seed as defined above may thus for example be resistant to MNLD.
  • the maize plant or seed as defined above is preferably an agronomic plant or agronomic seed.
  • agronomic plant or agronomic seed it is herein meant a plant or seed suitable for production on a large scale, in particular for human and animal food or for industrial purposes.
  • the plant as defined above is regenerated from a genetically modified tissue or cell, wherein said tissue or cell comprises at least one knocked out elF4E gene as described above.
  • Said plant is for example obtained by the method described below.
  • the plant as defined above is regenerated from a genetically modified maize seed as defined above.
  • the present invention thus also relates to the progeny of a genetically modified maize plant as defined above, in particular the progeny of a genetically modified maize plant resistant to at least one virus infecting maize or a part of said plant, wherein said plant is not obtained by means of an essentially biological process and wherein said plant comprises cells comprising at least one knocked out elF4E gene.
  • the plant is a generational descendant of a plant not obtained by means of an essentially biological process as described hereinabove.
  • the present invention also relates to the progeny, variants and/or mutants of said regenerated plants, provided that they comprise cells comprising at least one knocked out elF4E gene.
  • Resistance to a maize virus may for example be assessed in vivo by monitoring the development (or absence of development) of the maize disease resulting from an infection with said maize virus in the genetically modified maize plant to be assessed.
  • the maize virus is preferably inoculated to the plants, for example by mechanical inoculation.
  • the results are preferably compared to wild-type maize plants placed in the same conditions.
  • a decreased development of the maize viral disease or the absence of development of the maize viral disease in the genetically modified maize plants to be assessed by comparison to wild-type maize plants indicates that the genetically modified maize plant is resistant to said maize virus.
  • Resistance to a maize virus may also be assessed by virus quantification, for example using Elisa method or qPCR, which allows determining virus presence or absence and/or the quantity of virus present in the genetically modified maize plant to be assessed by comparison to wild-type maize plants.
  • the ELISA method is particularly able to measure the degree of virus accumulation, for example using antibodies specific for said maize virus.
  • Anti-SCMV, anti-MDMV and anti- MCMV antibodies may for example be used.
  • the maize seed as defined above may be produced from the maize plant as defined above.
  • the maize plant as defined above may be produced by growing the maize seed as defined above.
  • the present invention also relates to a vector suitable for knocking out at least one maize elF4E gene, for example maize elF4E1 gene and/or maize elF4E2 gene.
  • the vector as defined above may be a plasmid.
  • the vector as defined above may comprise: a) at least one CRISPR Clustered Regularly Interspaced Short Palindromic Repeats)-Cas endonuclease expression cassette and/or b) at least one gRNA expression cassette.
  • the vector as defined above preferably comprises: a) at least one gRNA expression cassette, wherein said gRNA expression cassette comprises a nucleic acid encoding a gRNA under the control of a promoter and wherein said gRNA comprises a region complementary to a target region of the maize elF4E gene, and b) optionally, at least one CRISPR-Cas endonuclease expression cassette.
  • Said at least one CRISPR-Cas endonuclease expression cassette and said at least one gRNA expression cassette may be provided in the same vector or in separate vectors.
  • the CRISPR-Cas endonuclease expression cassette comprises a nucleic acid encoding a Cas endonuclease under the control of a promoter.
  • the Cas endonuclease is an enzyme, which uses a gRNA as a guide to recognize and performs a double-stranded break at a specific position in a DNA sequence.
  • the Cas endonuclease generally requires the presence of a Protospacer Adjacent Motif (PAM) sequence in the vicinity of the specific targeted position.
  • PAM sequence is preferably spaced from the targeted position by at most 20 nucleotides.
  • the PAM sequence can differ depending on the Cas endonuclease.
  • the elF4E gene comprises a PAM sequence downstream the targeted region.
  • the Cas endonuclease may be selected from the group consisting of Cas9, Cas12a, Cas12b, C2c1 and C2c2.
  • the Cas endonuclease is preferably Cas9 (CRISPR-associated protein 9) endonuclease.
  • Cas9 endonuclease may for example comprise or consist of sequence SEQ ID NO: 7.
  • the promoter of the CRISPR-Cas endonuclease expression cassette may be a constitutive promoter selected from the group consisting of Zmllbi promoter, the 35S promoter or the 19S promoter (Kay et al., 1987), the rice actin promoter (McElroy et al., 1990), the pCRV promoter (Depigny-This et al., 1992), the CsVMV promoter (Verdaguer et al., 1998) and the ubiquitin promoter from rice or sugarcane.
  • the promoter of the CRISPR- Cas endonuclease expression cassette is preferably Zmllbi promoter.
  • the CRISPR-Cas endonuclease expression cassette preferably comprises a terminator, for example SbHSP.
  • the gRNA expression cassette comprises a nucleic acid encoding a gRNA under the control of a promoter.
  • the gRNA comprises: a) a region complementary to a target region of the elF4E gene, preferably to a target region in an exon of the elF4E gene, and b) a scaffold region, which allows binding to the CRISPR-Cas endonuclease encoded by the CRISPR-Cas endonuclease expression cassette.
  • the elF4E gene is particularly as defined above.
  • the target region of the elF4E gene is preferably located in exon 1 or exon 2 of the elF4E gene.
  • Exons 1 and 2 of elF4E1 gene and those of elF4E2 gene are particularly as defined above in the section “Maize elF4E genes and proteins”.
  • the promoter of the gRNA expression cassette may for example be selected from the group consisting of an RNA polymerase III promoter (for example Tall6 promoter, Zmll6 promoter or Zmll3), or an RNA polymerase II promoter, such as a constitutive promoter (for example Zmllbi or TaUbi).
  • the promoter of the gRNA expression cassette is preferably ZmU6 promoter.
  • the gRNA produced by the gRNA expression cassette is thus able to recognize a target region of the elF4E gene, so that, when complexed to CRISPR-CAS endonuclease, a double-stranded break in introduced in the target region of the elF4E gene through the action of the CRISPR-CAS endonuclease.
  • the gRNA preferably comprises at least 15 nucleotides, preferably at least 17 nucleotides, more preferably at least 18 nucleotides and/or at most 25 nucleotides, preferably at most 24 nucleotides, more preferably at most 23 nucleotides.
  • the gRNA may for example comprise or consist of sequence SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6.
  • the present invention also relates to a method for obtaining a genetically modified maize plant resistant to at least one maize virus, wherein said method comprises: a) knocking out at least one elF4E gene in a maize cell or maize tissue, to obtain a knocked out maize cell or a knocked out maize tissue, and b) regenerating a maize plant from the knocked out maize cell or knocked out maize tissue.
  • Said maize virus is particularly as defined above.
  • Resistance to said at least one maize virus particularly confers resistance to the disease caused by said virus infecting maize.
  • Said disease is particularly as defined above.
  • Said maize plant resistant to at least one maize virus is particularly as defined above.
  • Step a) comprises knocking out at least one elF4E gene in a maize cell or maize tissue, to obtain a knocked out maize cell or a knocked out maize tissue.
  • the elF4E gene is an endogenous elF4E gene, in particular as defined above.
  • the elF4E gene may be knocked out by any suitable method well-known by the skilled person as defined above, such:
  • the elF4E gene is preferably knocked out by gene editing, more preferably using CRISPR/Cas system.
  • the maize cell may be a protoplast.
  • the maize tissue may be an apical meristem, cotyledon, embryo (preferably an immature embryo), pollen and/or microspores.
  • the maize tissue is preferably an immature embryo of 10 days after fertilization.
  • the step of knocking out at least one elF4E gene preferably comprises introducing into said maize cell or maize tissue at least one nucleic acid of interest, preferably at least one vector suitable for knocking out at least one maize elF4E gene.
  • Any method for introducing a nucleic acid in a cell or a tissue may be used, such as transformation or using a haploid inducer line.
  • Said vector suitable for knocking out at least one maize elF4E gene is for example as defined above.
  • the maize cell or maize tissue is preferably transformed with the different vectors at the same time.
  • Any technique suitable for plant cell or plant tissue transformation may be used, such as biolistic particle delivery, PEG transformation, electroporation or agrobacterium transgene delivery.
  • the vector is first transferred into Agrobacterium, to obtain a transformed Agrobacterium and the maize cell or maize tissue is then transformed with said transformed Agrobacterium.
  • the Agrobacterium is preferably Agrobacterium tumefaciens.
  • Transformation with said transformed Agrobacterium for example comprises coculturing the maize cell or maize tissue with Agrobacterium, for example for at least 5 minutes.
  • introduction of the vector can be done by using haploid inducer line and associated technologies.
  • step a) particularly results in:
  • NHEJ non-homologous end joining
  • Step b) comprises regeneration of a maize plant from the knocked out maize cell or knocked out maize tissue. Regeneration of a plant from a plant cell or plant tissue is well known by the skilled person.
  • the maize cell or maize tissue may be placed in a culture medium suitable for maize plant growth.
  • the regeneration of a maize plant from a maize cell or a maize tissue may comprise:
  • the growth of the maize cell into a callus and the regeneration of shoots are carried out in any suitable culture media, in particular comprising plant growth regulators.
  • the growth of the maize tissue into a callus and the regeneration of shoots from the maize tissue may be carried out in any suitable culture media, in particular comprising plant growth regulators.
  • the method as defined above may further comprise a subsequent step of assessing whether the elF4E gene is knocked out in the obtained maize plant.
  • This subsequent step may for example be performed by assessing the resistance of the obtained maize plant to at least one maize virus, for example as defined above. If the obtained maize plant is resistant to at least one maize virus, contrary to the corresponding non-transformed maize plant, the elF4E gene is knocked out in the obtained maize plant.
  • This subsequent step may also be performed by assessing the expression of the protein encoded by the target elF4E gene. If the cells of the maize plant do not express the protein encoded by the target elF4E gene, the el4E gene is knocked out in the obtained maize plant.
  • Detecting the expression of the protein encoded by the elF4E gene may be performed according to any method well-known by the skilled person, such as western-blot or an immunoassay.
  • the present invention also relates to a method for identifying a maize plant resistant to at least one maize virus, wherein said method comprises assessing (i) the expression of at least one elF4E protein and/or (ii) the sequence of at least one elF4E gene, wherein a maize plant is identified as resistant to at least one maize virus (i) in the absence of expression of said at least one elF4E protein and/or (ii) in the presence of mutation(s) in the sequence of said at least one elF4E gene leading to a non-functional elF4E gene.
  • the present invention also relates to a method for identifying a maize plant resistant to at least one maize virus, wherein said method comprises assessing (i) the expression of elF4E1 and elF4E2 proteins and/or (ii) the sequence of elF4E1 and elF4E2 genes, wherein a maize plant is identified as resistant to at least one virus infecting maize (i) in the absence of expression of said elF4E1 and elF4E2 proteins and/or in the presence of mutation(s) in the sequence of said elF4E1 and elF4E2 gene leading to non-functional elF4E1 and elF4E2 genes.
  • Said maize virus is particularly as defined above.
  • the elF4E protein and elF4E gene are particularly as defined above.
  • Assessing the expression of an elF4E protein may be performed by any method well known by the skilled person, such as western-blot or an immunoassay.
  • Assessing the sequence of at least one elF4E gene may be performed by any method well known by the skilled person, such as sequencing.
  • the obtained sequence may then be analyzed, in order to identify the possible presence of mutation(s), for example by comparing said sequence with the sequence of the endogenous elF4E gene, and to analyze if said mutation(s), when present, lead to the non-functional elF4E gene.
  • SEQ ID NO: 1 corresponds to the sequence of a native maize elF4E1 protein (also referred to as ZmA188v1 aHC012309_elF4E1 in Figure 2A).
  • SEQ ID NO: 2 corresponds to the sequence of a native maize elF4E2 protein.
  • SEQ ID NO: 3 corresponds to the sequence of gRNA14
  • SEQ ID NO: 4 corresponds to the sequence of gRNA47
  • SEQ ID NO: 5 corresponds to the sequence of gRNA
  • SEQ ID NO: 6 corresponds to the sequence of gRNA ZmelF4E_a367&b373_SpCas9_gRNA targeting a region in exon 2 of elF4E1 and elF4E2.
  • SEQ ID NO: 7 corresponds to the sequence of a Cas9 (CRISPR-associated protein 9) endonuclease.
  • SEQ ID NO: 8 correspond to genomic sequence of elF4E1 gene.
  • SEQ ID NO: 9 corresponds to genomic sequence of elF4E2 gene.
  • SEQ ID NO: 10 corresponds to genomic sequence of apb1 gene.
  • SEQ ID NO: 11 corresponds to the sequence of a native APB1 protein.
  • SEQ ID NO: 12 corresponds to the sequence of the elF4E1 protein encoded by mutatype 9_16 (AlleleE1_a_short in Figure 2A).
  • SEQ ID NO: 13 corresponds to the sequence of the elF4E1 protein encoded by mutatype 10_30 (AlleleE1_b_short in Figure 2A).
  • SEQ ID NO: 14 corresponds to the sequence of the elF4E1 protein encoded by mutatypes 15_19 (AlleleE1_c_short in Figure 2A).
  • SEQ ID NO: 15 corresponds to the sequence of the elF4E2 protein encoded by mutatype 14 15 (alleleE2_a in Figure 2B).
  • SEQ ID NO: 16 corresponds to the sequence of the elF4E2 protein encoded by mutatypes 58_77 (AlleleE2_b_short in Figure 2B).
  • SEQ ID NO: 17 corresponds to the sequence of the elF4E2 protein encoded by mutatypes 59_83 or 59_74 (AlleleE2_c_short in Figure 2B).
  • Sequences SEQ ID NO: 18 to 43 are detailed in Table 1 .
  • Figure 1 Nucleic sequence alignments between reference sequences elF4E1 and elF4E2 in J1 A lines (public gene IDs are ZmA188v1 aHC012309_elF4E1 and ZmA188v1 aHC012641_elF4E2) and those of the GE edited plants focused on the edited sequences in exon 1 and 2 of elF4E genes.
  • the first line corresponds to the physical position on J1 A map.
  • the final code corresponds to internal reference for the mutation in Exon 1 , followed by internal reference for Exon 2 (example “AlleleE1a_MutE1_9_16” correspond to an allele with the mutation with internal reference “9” in Exon 1 of elF4E1 and mutation with internal reference “16” in Exon 2 of elF4E1 .
  • Some alleles can cumulate more than one mutation
  • AlleleE2c mutE2_13_14_15_16 contains mutations with references “13”, “14” and “15” in Exon 1 and “16” in Exon 2.
  • Figure 2 Protein sequence alignments between reference sequences elF4E1 and elF4E2 in J1 A lines (public gene IDs are ZmA188v1 aHC012309_elF4E1 and ZmA188v1 aHC012641_elF4E2) and those of the GE edited plants leading to a nonfunctional elF4E protein(s).
  • A elF4E1 protein sequences of reference and GE plants mutated form
  • B elF4E2 protein sequences of reference and GE plants mutated form.
  • Figure 3 Phenotyping of GE plants after viral infection as described in example 4.
  • A MCMV and SCMV
  • B MCMV and MDMV.
  • Set of 7 independent elF4E GE lines Plants 1 to 7, see table 2) and Control lines J1 A and PA405.
  • Example 2 Design of guides RNA to create knock-out mutants of maize elF4E1 and elF4E2 genes
  • ZmelF4E_a324&b330_SpCas9_gRNA / Exon2 of elF4E1 and elF4E2 CAAATAGGGTCTTCCCATTTTGG (SEQ ID NO: 5)
  • the three underlined nucleotides in 3’ of the above sequences are PAM sequences.
  • Example 3 Production of GE plants using CRISPR Cas9 by KO/SDN1 methodology
  • Zmll6 promoter from Zea mays was used to drive expression of each gRNA described above.
  • the DNA fragment of the 2 gRNA transcription system Zmll6::ZmelF4E_a324&b330_SpCas9_gRNA and ZmU6::ZmelF4E_a_SpCas9_gRNA47 was synthetized by GenScript Biotech (The Netherlands) and cloned into pUC57 to obtain the plasmid geBGA_12189.
  • the DNA fragment of the 2 gRNA transcription Zmll6::ZmelF4E_a_SpCas9_gRNA14 and Zmll6::ZmelF4E_a367&b373_SpCas9_gRNA was synthetized in the same way to give the plasmid geBGA_12190.
  • the 4 gRNA transcription units from plasmids geBGA_12189 and geBGA_12190 were cloned via Golden Gate reactions into the binary plasmid pBIOS11975 to obtain the final plasmid pBIOS12487.
  • the T-DNA part of this vector contains three cassettes.
  • Another cassette consisting of the Zmllbi promoter and first intron, ZsGreen coding sequence (green fluorescent protein derived from Zoanthus sp.
  • the binary vector pBIOS12487 described above was transferred Into Agrobacterium LBA4404.
  • Agrobacterium tumefaciens Genetic transformation is done by Agrobacterium tumefaciens, according to the protocol of Ishida et al. (1996, Nat Biotechnol, 14(6):745-50) on J1 A, in particular on 10 days after fertilization immature embryos. All the media used are referenced in the reference cited.
  • the transformation begins with a co-culturing phase in which the maize immature embryos are brought into contact for at least 5 minutes with Agrobacterium tumefaciens LBA 4404 containing a binary vector containing the genetic element for editing the target genes. The embryos are then placed on LSAs medium for 3 days in the dark and at 25°C.
  • a first selection is carried out on the transformed calli: the embryogenic calli are transferred on medium containing phosphinotricin LSD5 5 mg/l and cefotaxime at 250 mg/l (for contamination removal by limiting Agrobacterium tumefaciens). This step is carried out 2 weeks in the dark at 25°C.
  • the second selection step is performed by transferring the embryos which developed on LSD5 medium, to LSD10 medium (10 mg/l of phosphinotricin) in the presence of cefotaxime, during 3 weeks in the same conditions (temperature and light) as above.
  • the third selection step consists in excising the calli to type I (fragments of 1 to 2 mm) and transferred on LSD 10 medium, at 25°C in the dark for 3 weeks to 25°C in the presence of cefotaxime.
  • the regeneration of the plantlets is carried out by excising the calli of type I which proliferated and transferring them from LSZ on medium in the presence of 5 Mg/I of phosphinotricin to cefotaxime for 2 weeks and to 22°C and under continuous light.
  • the plantlets having regenerated are transferred on medium containing 100mg/l of RM + G2 for 2 weeks to 22°C and Augmentin and under continuous illumination for the development step. Plants obtained are then transferred to the phytotron for acclimatation.
  • Primers were designed around elF4E edited sites to produce amplicons that were sequenced to determine sequence modifications. The objective was then to identify deletions, insertions, or substitutions in gene sequences. TO plants were selected when GE mutation(s) in elF4E gene(s) were able to create a modification of the sequence leading to a non-functional elF4E protein(s). Alignments were performed between reference sequences (elF4E1 & elF4E2) and mutated elF4E1 & elF4E2 genes in GE edited plants to select mutations impacting protein sequence.
  • elF4E1 For elF4E1 , we have selected 5 different mutatypes: 9_16; 10_30; 1 11 ; 15_19; 15_30, which differ from reference sequence at the nucleic level (reference sequence of elF4E1 in J1 A line is public gene ID ZmA188v1 aHC012309_elF4E1 ) (see Figure 1). These nucleic mutatypes give different types of mutated proteins leading to non-functional protein.
  • mutatypes 14 15; 59_83; 59_74; 58_77; 12 14 15_16 which differ from reference sequence at the nucleic level (reference sequences elF4E2 in J1A line is public gene ID ZmA188v1 aHC012641_elF4E2) (see Figure 1).
  • This nucleic mutatypes give different types of mutated proteins leading to nonfunctional protein.
  • Table 2 Description of the truncated protein version corresponding to alleles mutation for elF4E1 and elF4E2 for the 7 plants of the figure 3.
  • Example 4 Phenotypinq of GE plants after viral infection by SCMV, MDMV and/or
  • the maize inbred line J1 A was used as a susceptible control and the maize inbred line PA405 as a potyvirus resistant reference. For each event (code Plantsl to 7, 7 plants were infected, and 2 controls plants were uninfected).
  • Plants were grown on separate cultivation tables for each modality of viral infection (5 in total) to avoid cross-contamination. Growing conditions were 24°C Day/19°C Night with light cycle of 16h day/8h night.
  • PA405 plants did not show mosaic symptoms when infected with a potyvirus, as expected, but showed severe symptoms when infected with MCMV alone or in combination with potyvirus. No symptoms were observed on all infected plants from the 7 independent events for all virus infection modalities: SCMV, MDMV, MCMV, SCMV+MCMV, MDMV+MCMV (Table 3 and Figure 3).
  • Table 3 Results of phenotyping of 7 independent events evaluated for resistance to 3 different viruses: SCMV & MDMV (Potyviridae) and MCMV (Tombusviridae) alone or by combining MCMV and a potyvirus to mimic Maize Lethal Necrosis Disease.
  • R Resistant;
  • S Susceptible

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Virology (AREA)
  • Botany (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

La présente invention concerne une plante de maïs génétiquement modifiée résistante à au moins un virus de maïs, ladite plante de maïs comprenant des cellules de maïs à inactivation d'au moins un gène eIF4E. Le virus du maïs peut être un potyvirus ou un machlomovirus. La présente invention concerne également un procédé d'obtention d'une plante de maïs génétiquement modifiée résistante à au moins un virus du maïs, ledit procédé comprenant a) l'inactivation d'au moins un gène eIF4E dans une cellule ou un tissu de maïs, afin d'obtenir une cellule ou un tissu de maïs inactivé, et b) la régénération d'une plante de maïs à partir de la cellule ou du tissu de maïs inactivé. La présente invention concerne également un vecteur permettant d'inactiver au moins un gène eIF4E du maïs.
PCT/EP2023/070825 2022-07-29 2023-07-27 Plantes de maïs à inactivation d'eif4e pour résistance virale WO2024023208A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP22306144.1 2022-07-29
EP22306144 2022-07-29

Publications (1)

Publication Number Publication Date
WO2024023208A1 true WO2024023208A1 (fr) 2024-02-01

Family

ID=83271269

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2023/070825 WO2024023208A1 (fr) 2022-07-29 2023-07-27 Plantes de maïs à inactivation d'eif4e pour résistance virale

Country Status (1)

Country Link
WO (1) WO2024023208A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004057941A2 (fr) 2002-12-17 2004-07-15 Cornell Research Foundation, Inc. Resultats de resistance de plante recessive issus de mutations du facteur d'initiation de la traduction eif4e
US20180273972A1 (en) * 2015-12-06 2018-09-27 The State of Israel, Ministry of Agriculture & Rural Development, Argricultural Research Organiza Methods of increasing virus resistance in cucumber using genome editing and plants generated thereby
US20190174706A1 (en) * 2016-08-26 2019-06-13 Japan Tobacco Inc. Virus-resistant tobacco and breeding method therefor

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004057941A2 (fr) 2002-12-17 2004-07-15 Cornell Research Foundation, Inc. Resultats de resistance de plante recessive issus de mutations du facteur d'initiation de la traduction eif4e
US20060294618A1 (en) * 2002-12-17 2006-12-28 Jahn Margaret M Recessive plant viral resistance results from mutations in translation initiation factor eIf4e
US20180273972A1 (en) * 2015-12-06 2018-09-27 The State of Israel, Ministry of Agriculture & Rural Development, Argricultural Research Organiza Methods of increasing virus resistance in cucumber using genome editing and plants generated thereby
US20190174706A1 (en) * 2016-08-26 2019-06-13 Japan Tobacco Inc. Virus-resistant tobacco and breeding method therefor

Non-Patent Citations (17)

* Cited by examiner, † Cited by third party
Title
BASTET ET AL., TRENDS IN PLANT SCIENCE, vol. 22, no. 5, 2017, pages 411 - 419
CHRISTENSEN ET AL.: "Maize polyubiquitin genes: structure, thermal perturbation of expression and transcript splicing, and promoter activity following transfer to protoplasts by electroporation", PLANT MOL BIOL, vol. 18, no. 4, February 1992 (1992-02-01), pages 675 - 89, XP009002808, DOI: 10.1007/BF00020010
DATABASE UniProt [online] 25 May 2022 (2022-05-25), "RecName: Full=Eukaryotic translation initiation factor 4E-1 {ECO:0000303|PubMed:10417723}; Short=ZmeIF4E {ECO:0000303|PubMed:23474695}; Short=eIF-4E-1 {ECO:0000303|PubMed:10417723}; Short=eIF4E-1 {ECO:0000303|PubMed:10417723}; AltName: Full=eIF-4F 25 kDa subunit {ECO:0000305}; AltName: Full=eIF-4F p", XP002808355, retrieved from EBI accession no. UNIPROT:O81481 Database accession no. O81481 *
DATABASE UniProt [online] 25 May 2022 (2022-05-25), "RecName: Full=mRNA cap-binding protein {ECO:0000256|ARBA:ARBA00030245};", XP002808356, retrieved from EBI accession no. UNIPROT:C0PAV8 Database accession no. C0PAV8 *
DEPICKER ASTACHEL SDHAESE PZAMBRYSKI PGOODMAN HM: "Nopaline synthase: transcript mapping and DNA sequence", J MOL APPL GENET., vol. 1, no. 6, 1982, pages 561 - 73, XP009031592
HOFFIE ROBERT ERIC ET AL: "Targeted Knockout of Eukaryotic Translation Initiation Factor 4E Confers Bymovirus Resistance in Winter Barley", FRONTIERS IN GENOME EDITING, vol. 3, 29 November 2021 (2021-11-29), XP093021306, DOI: 10.3389/fgeed.2021.784233 *
ISHIDA ET AL., NAT BIOTECHNOL, vol. 14, no. 6, 1996, pages 745 - 50
ISHIDA YSAITO HOHTA SHIEI YKOMARI TKUMASHIRO T: "High efficiency transformation of maize (Zea mays L.) mediated by Agrobacterium tumefaciens", NAT BIOTECHNOL, vol. 14, no. 6, June 1996 (1996-06-01), pages 745 - 50, XP002046364, DOI: 10.1038/nbt0696-745
JEONGBIN PARKSANGSU BAEJIN-SOO KIM: "Cas-Designer: a web-based tool for choice of CRISPR-Cas9 target sites", BIOINFORMATICS, vol. 31, 15 December 2015 (2015-12-15), pages 4014 - 4016
LENG ET AL., MOLECULAR PLANT, vol. 10, 2017, pages 1357 - 1359
MARK W JONES ET AL: "Identification of quantitative trait loci controlling resistance to maize chlorotic dwarf virus", THEORETICAL AND APPLIED GENETICS ; INTERNATIONAL JOURNAL OF PLANT BREEDING RESEARCH, SPRINGER, BERLIN, DE, vol. 110, no. 1, 1 December 2004 (2004-12-01), pages 48 - 57, XP019321770, ISSN: 1432-2242, DOI: 10.1007/S00122-004-1757-Y *
MATZ, M.FRADKOV, A.LABAS, Y. ET AL.: "Fluorescent proteins from nonbioluminescent Anthozoa species", NAT BIOTECHNOL, vol. 17, 1999, pages 969 - 973
MURITHI ET AL., FRONTIERS IN GENETICS, vol. 12, no. 767883, 2021, pages 1 - 17
PENGFEI LENGQING JITORBEN ASPURSULA K. FREICHRISTINA R. INGVARDSENONGZHONG XINGBRUNO STUDERMARGARET REDINBAUGHMARK JONESPRIYANKA G: "Auxin Binding Protein 1 Reinforces Resistance to Sugarcane Mosaic Virus in Maize", MOLECULAR PLANT, vol. 10, October 2017 (2017-10-01), pages 1357 - 1360
SHI LIYU ET AL: "Identification of promoter motifs regulatingZmeIF4Eexpression level involved in maize rough dwarf disease resistance in maize (Zea MaysL.)", MOLECULAR GENETICS AND GENOMICS, SPRINGER BERLIN HEIDELBERG, BERLIN/HEIDELBERG, vol. 288, no. 3, 10 March 2013 (2013-03-10), pages 89 - 99, XP035341598, ISSN: 1617-4615, [retrieved on 20130310], DOI: 10.1007/S00438-013-0737-9 *
THOMPSON CJMOVVA NRTIZARD RCRAMERI RDAVIES JELAUWEREYS MBOTTERMAN J: "Characterization of the herbicide-resistance gene bar from Streptomyces hygroscopicus", EMBO J., vol. 6, no. 9, September 1987 (1987-09-01), pages 2519 - 23
WANG SMLUE WLYU TSLONG JHWANG CNEIMERT KCHEN J: "Characterization of ADG1, an Arabidopsis locus encoding for ADPG pyrophosphorylase small subunit, demonstrates that the presence of the small subunit is required for large subunit stability", PLANT J, vol. 13, no. 1, January 1998 (1998-01-01), pages 63 - 70

Similar Documents

Publication Publication Date Title
JP7239266B2 (ja) 一過性遺伝子発現により植物を正確に改変するための方法
US10487336B2 (en) Methods for selecting plants after genome editing
JP6505599B2 (ja) 遺伝子標的化および形質スタッキングのための特別設計の導入遺伝子組み込みプラットフォーム（ｅｔｉｐ）
US20170114361A1 (en) Modified plants
BR112016003776B1 (pt) Polinucleotídeo, planta ou semente, complexo de polinucleotídeo,método para modificação de um sítio-alvo no genoma de uma célula, método para introduzir um polinucleotídeo de interesse, método para editar uma sequência de nucleotídeos, célula vegetal, método para selecionar uma planta
US20200216853A1 (en) Method for rapidly and efficiently creating directed gene mutated non-transgenic plants and its applications
JP2002529096A (ja) 転写アクチベータｌｅｃ１核酸、ポリペプチドおよびそれらの使用
JP5731201B2 (ja) 植物細胞プロトプラストにおける二本鎖アクセプタｄｎａ配列の標的化改変の方法
JP2021510069A (ja) 遺伝子改変された植物体の再生
US7022894B2 (en) Methods of transforming plants and identifying parental origin of a chromosome in those plants
CN111819285A (zh) 防碎基因和突变
US7164056B2 (en) Gene targeting using replicating DNA molecules
WO2019129145A1 (fr) Gène cmp1 de régulation de l'époque de floraison et constructions associées et applications correspondantes
US20030154518A1 (en) Removal of selectable markers from transformed cells
US20150315601A1 (en) Methods of site-directed transformation
US20050066386A1 (en) Method of modifying genome in higher plant
CN113544256A (zh) 改善植物再生
WO1999010514A1 (fr) Resistance a la fumonosine
CN111154767A (zh) 根长调控基因logl5及相应的构建体和其应用
CN102131932A (zh) 人工植物微染色体
WO2024023208A1 (fr) Plantes de maïs à inactivation d'eif4e pour résistance virale
CN112166189A (zh) 植物基因组编辑
JP2001514856A (ja) 植物における遺伝子の選択的発現
CN110959043A (zh) 利用bcs1l基因和向导rna/cas核酸内切酶系统改良植物农艺性状的方法
WO2024023207A1 (fr) Variants de la protéine eif(iso)4e pour la résistance aux maladies virales du maïs

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23750592

Country of ref document: EP

Kind code of ref document: A1