WO2023277610A1 - 안티센스 올리고뉴클레오타이드 기반 약물이 탑재된 세포 유래 자연 또는 인공 나노소포체를 함유하는 약학 조성물 - Google Patents

안티센스 올리고뉴클레오타이드 기반 약물이 탑재된 세포 유래 자연 또는 인공 나노소포체를 함유하는 약학 조성물 Download PDF

Info

Publication number
WO2023277610A1
WO2023277610A1 PCT/KR2022/009415 KR2022009415W WO2023277610A1 WO 2023277610 A1 WO2023277610 A1 WO 2023277610A1 KR 2022009415 W KR2022009415 W KR 2022009415W WO 2023277610 A1 WO2023277610 A1 WO 2023277610A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
cell
pharmaceutical composition
aso
galectin
Prior art date
Application number
PCT/KR2022/009415
Other languages
English (en)
French (fr)
Inventor
이재용
안희진
이대한
이동열
나규흠
Original Assignee
주식회사 프리모리스
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 프리모리스 filed Critical 주식회사 프리모리스
Priority to CN202280058972.9A priority Critical patent/CN117940117A/zh
Priority to EP22833664.0A priority patent/EP4364728A1/en
Publication of WO2023277610A1 publication Critical patent/WO2023277610A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/51—Nanocapsules; Nanoparticles
    • A61K9/5107—Excipients; Inactive ingredients
    • A61K9/5176—Compounds of unknown constitution, e.g. material from plants or animals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/88—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microencapsulation, e.g. using amphiphile liposome vesicle
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/5005—Wall or coating material
    • A61K9/5063—Compounds of unknown constitution, e.g. material from plants or animals
    • A61K9/5068—Cell membranes or bacterial membranes enclosing drugs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/31—Combination therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/32—Special delivery means, e.g. tissue-specific

Definitions

  • the present invention relates to a pharmaceutical composition characterized by containing a cell-derived natural or artificial nano-ER loaded with a nucleic acid-based drug.
  • the present invention relates to the development of anti-cancer drugs using natural or artificial nano-endoplasmic reticulum derived from human cells loaded with antisense oligonucleotides for cancer-inducing gene base sequences.
  • liver cancer Depending on the location of the body organ where the cancer occurs, it is called liver cancer, stomach cancer, uterine cancer, etc. In other words, it refers to cancer that has occurred in lung tissue such as bronchi, bronchioles, and alveoli.
  • lung tissue such as bronchi, bronchioles, and alveoli.
  • breast cancer, liver cancer, etc. when it has metastasized to the lungs from other organs, is called metastatic lung cancer and is treated differently from primary lung cancer.
  • Lung cancer is the most common cause of death from cancer. It progresses slowly, so if detected early, it can be treated surgically. Lung cancer is divided into Non Small Cell Lung Cancer (NSCLS) and Small Cell Lung Cancer (SCLC) according to the size and shape of cancer cells microscopically because the clinical course and treatment are different. Of these, NSCLS accounts for 85% of lung cancer patients. Non-small cell lung cancer is further divided into non-squamous non-small cell lung cancer (NSCLC) and squamous cell lung cancer (NSCLC). Non-squamous non-small cell lung cancer accounts for 70-75% of cases, and squamous non-small cell lung cancer accounts for about 25%. Although some drugs currently used as target anticancer drugs for non-small cell lung cancer have high therapeutic effects, there is no treatment method for resistant cancer caused by EGFR T790M mutation.
  • EVs extracellular vesicles
  • Bacterial exosomes also contain lipopolysaccharides or lipoteichoic acids.
  • Extracellular endoplasmic reticulum is a nano-sized endoplasmic reticulum secreted by all cells into the external environment for intercellular information exchange.
  • Extracellular endoplasmic reticulum contains various substances that exhibit biological activity, such as proteins, lipids, nucleic acids, and metabolites.
  • the components of the extracellular endoplasmic reticulum reflect the type and state of the derived cell, and are present in various body fluids such as cell culture medium, blood, urine, saliva, tears, semen, breast milk, ascites, and cerebrospinal fluid.
  • Extracellular vesicles derived from various cells can perform various physiological and pathological functions while interacting with target cells.
  • stem cell-derived extracellular vesicles can induce tissue regeneration, and cancer cell-derived extracellular vesicles can affect cancer growth, metastasis, angiogenesis, and the like.
  • Bacteria-derived extracellular vesicles can perform functions such as antibiotic resistance, elimination of competing bacteria, delivery of virulence factors, and regulation of immune responses.
  • proteins commonly found in extracellular endoplasmic reticulum derived from various cells and body fluids there are proteins commonly found in extracellular endoplasmic reticulum derived from various cells and body fluids, and through this, it can be confirmed that proteins do not enter the extracellular endoplasmic reticulum in a disorderly manner but enter through a regulated mechanism.
  • Proteins commonly found in mammalian cell-derived extracellular vesicles can be used as marker proteins used when separating extracellular vesicles.
  • marker proteins used when separating extracellular vesicles.
  • cell-type specific proteins derived from the extracellular endoplasmic reticulum which are related to performing physiological/pathological functions related to the cell type.
  • Extracellular endoplasmic reticulum is composed of various substances having biological activity and can perform various biological functions.
  • Mechanisms by which extracellular vesicles interact with target cells include ligand-receptor interactions, fusion, and endocytosis. While interacting with target cells, extracellular vesicles derived from various cells perform physiological functions under normal circumstances, and sometimes perform pathological functions that cause diseases. Accordingly, it can be used for diagnosis and treatment of various diseases.
  • extracellular vesicles Various physiological functions performed by mammalian cell-derived extracellular vesicles include hemostasis, tissue regeneration, stem cell maintenance, inflammatory/immune response regulation, and embryonic development.
  • extracellular vesicles derived from various cells such as monocytes, endothelial cells, and platelets.
  • Extracellular vesicles containing phosphatidylserine promote blood coagulation.
  • extracellular vesicles derived from stem cells can mediate tissue regeneration and inflammatory response control in injury models such as kidney/liver/skin.
  • extracellular vesicles derived from immune cells may promote immune responses, such as delivering inflammatory cytokines such as IL-1 ⁇ or presenting antigens directly or indirectly. It is also possible to suppress the immune response by delivering inhibitory cytokines such as TGF- ⁇ or suppressing T cell activation. Extracellular vesicles with membrane-bound morphogens such as Wnt attach to corresponding receptors and promote signaling pathways involved in embryonic development.
  • mammalian cell-derived extracellular vesicles also perform pathological functions that cause various diseases.
  • cancer cell-derived extracellular vesicles perform very diverse functions in a tumor microenvironment.
  • Cancer cell-derived extracellular vesicles act on endothelial cells through sphingomyelin and promote angiogenesis by promoting division, migration, and tube formation. It also differentiates monocytes into myeloid-derived suppressor cells. Along with this, it also acts on other immune cells, promoting the death of cytotoxic T cells or promoting the differentiation of regulatory T cells to suppress anti-cancer immunity. Through this, it can be seen that cancer cell-derived extracellular vesicles perform a function to promote cancer progression in a tumor microenvironment.
  • Nucleic acid medicines are medicines using nucleic acids that function as substances mainly responsible for genetic information in vivo.
  • 'siRNA' that inhibits gene expression or 'Aptamer' that specifically binds to target molecules are attracting attention. there is.
  • Nucleic acid medicines are medicines whose main component is nucleic acid (DNA or RNA, etc.), which are genetic components, and include 'antisense', 'siRNA', 'aptamer' and 'CpG oligo'. Because it exerts its effect by acting on disease-causing genes and proteins, it can act on intracellular molecules that were difficult to target with existing drugs, so it is expected to have excellent effects and fewer side effects.
  • RNA-based therapeutics such as small interfering RNAs (siRNAs), microRNAs (miRNAs), antisense oligonucleotides (ASOs), aptamers, synthetic mRNAs, and CRISPR Cas9 target many genes and gene products that cannot be controlled by current drugs.
  • siRNAs small interfering RNAs
  • miRNAs microRNAs
  • ASOs antisense oligonucleotides
  • aptamers target many genes and gene products that cannot be controlled by current drugs.
  • CRISPR Cas9 CRISPR Cas9 target many genes and gene products that cannot be controlled by current drugs.
  • siRNAs small interfering RNAs
  • miRNAs microRNAs
  • ASOs antisense oligonucleotides
  • aptamers synthetic mRNAs
  • CRISPR Cas9 CRISPR Cas9
  • RNA bilayers allow passive diffusion of neutral, slightly hydrophobic molecules ⁇ 1,000 Daltons (Da) smaller than 1,000 Daltons (Da), while limiting the migration of large molecules such as RNA.
  • RNA is also rapidly cleared from the blood by the kidneys and by capture receptors on hepatocytes.
  • TLRs Toll like receptors
  • PKR double-stranded RNA receptor
  • Extracellular vesicles which are defined as structures surrounded by a biological membrane present in cells, come in a wide variety of sizes and production methods. What is called 'exosome' refers to something that is derived from endosomes in cells, released into cells, and has a diameter of about 30 to 200 nm.
  • exosomes which are responsible for absorbing and secreting substances within cells.
  • endosomes which are responsible for absorbing and secreting substances within cells.
  • multivesicular bodies an endosome containing small vesicles called multivesicular bodies, and when they fuse with the cell membrane, the vesicles present inside are released, and these become exosomes.
  • Exosomes have different properties depending on their size, biomarker proteins present on the surface, function, and tissue from which they are derived. In other words, exosomes are a general term for structures surrounded by biological membranes found outside cells with a wide variety of sizes and characteristics.
  • Components of exosomes can be divided into biological membranes and components contained inside biological membranes.
  • various membrane proteins, lipids, and sugar chains exist together, just like the components of the biomembrane inside the cell.
  • proteins present in the exosome biomembrane there are several proteins that are specifically present in the exosome and are considered exosome biomarkers, and these include CD63, CD9, and CD81.
  • Components inside the exosome include various cell-derived proteins, RNA (miRNA, mRNA, etc.), various metabolites, and the like.
  • exosomes move to other cells and exchange substances to transmit signals between cells. It carries out physiological and pathological roles by transmitting signals to other cells and influencing other cells.
  • exosomes have various protein components in addition to lipids constituting a biological membrane, and are naturally used as a means of exchanging substances within cells, more efficient mass transfer is possible. It is also expected to have less immunity induction or toxicity.
  • exosomes Virtually all mammalian cells are known to release exosomes.
  • the outside of an exosome with a size of 30 ⁇ 200 nm is composed of a phospholipid bilayer together with membrane proteins, and the inside contains proteins, mRNA, miRNA, and non-coding RNA. That is, the structure of exosomes can stably store genetic information.
  • Exosomes are biological nanoparticles with a size of 30 to 200 nm secreted by most cells, and contain proteins and genetic information of secreting cells. Exosomes have been found to be mediators that transmit information to neighboring or distant cells and regulate the microenvironment around cells.
  • Exosomes have the advantage of easy internal loading of drugs. Furthermore, exosomes can transmit information through fusion with cell membranes. In this way, it is possible to reduce the degradation of genetic information and drugs delivered to cells by the digestive system inside the cells.
  • the present invention is to provide a method for developing an anticancer drug by loading an antisense oligonucleotide for Galectin-3, a cancer-promoting gene, into cell-derived natural or artificial nano-endoplasmic reticulum.
  • a first aspect of the present invention provides a pharmaceutical composition characterized in that it contains cell-derived natural or artificial nano-endoplasmic reticulum loaded with an anti-sense oligonucleotide (ASO)-based drug.
  • ASO anti-sense oligonucleotide
  • a second aspect of the present invention provides a pharmaceutical composition containing cell-derived natural or artificial nano-endoplasmic reticulum loaded with a Galectin-3 target nucleic acid drug.
  • a third aspect of the present invention provides a pharmaceutical composition for oral or nasal inhalation or intravenous injection, characterized in that it contains cell-derived natural or artificial nano-endoplasmic reticulum loaded with a nucleic acid-based drug.
  • a fourth aspect of the present invention provides a pharmaceutical composition for preventing or treating cancer, characterized in that it contains natural or artificial nano-endoplasmic reticulum derived from cord blood stem cells loaded with a nucleic acid-based drug.
  • a fifth aspect of the present invention provides a Galectin-3 targeting anti-sense oligonucleotide (ASO), which is characterized by being designed using a nucleotide sequence in a Galectin-3 coding sequence (CDS).
  • ASO Galectin-3 targeting anti-sense oligonucleotide
  • CDS Galectin-3 coding sequence
  • Exosome treatment methods include a method of developing exosomes that resemble parent cells as a treatment method and a method of using exosomes in a drug delivery system (DDS).
  • DDS drug delivery system
  • the regenerative ability of stem cells is due to exosomes.
  • Stem cell-derived exosomes have many strengths as a therapeutic agent compared to stem cells. First of all, since it is not a living cell, it is easy to store and transport for a long time. In addition, since it does not divide, the risk of tumor and infection is low. If the efficacy is similar, it is much easier to develop a treatment.
  • Galectins were isolated from animals in the 1970s and belong to the lectin family. A total of 15 subtypes have been identified so far, and they induce cell-cell or cell-matrix interactions to be involved in various intracellular signal transduction. Galectin expression affects apoptosis, embryonic development, inflammatory response, and cancer development. Among them, in the case of Galectin-3, it is known to promote cancer metastasis by promoting the growth of cancer cells in cancer tissues and suppressing the immune response while highly expressed in non-small cell lung cancer tissues (FIG. 17).
  • Conventional gene therapy involves introducing DNA fragments, miRNAs, siRNAs and lncRNAs into target cells to reverse abnormal gene expression, induce expression of suicide genes, modulate immune responses, and inhibit angiogenesis.
  • antisense nucleotides attach to the nucleotide sequence of a specific gene and act as a mechanism for inducing loss of function of the gene, thereby enabling targeting.
  • FIG. 13 a single strand strand
  • the stability of the drug is low when treated alone, limiting its use as a general-purpose drug, and it cannot be delivered into cells in most tissues and cell types through the current ASO delivery method.
  • the present invention has the effect of inhibiting the proliferation and migration of cancer cells normally by increasing the stability of the drug by mounting these antisense nucleotides on exosomes, which are natural nano-vesicles, or artificial nano-vesicles obtained by extruding and pulverizing cells. confirmed.
  • the present invention developed a gene-targeted drug using anti-sense oligonucleotide (ASO) and confirmed the effect of inhibiting the expression of Galectin-3, a gene involved in the proliferation and metastasis of non-small cell lung cancer.
  • ASO anti-sense oligonucleotide
  • Galectin-3 ASO as an inhibitor of cancer cell proliferation and metastasis was confirmed, and the possibility of loading Galectin-3 ASO into nano-ERs (including exosomes and artificial nano-ERs) was confirmed. In addition, it was confirmed that there is an effect of inducing the death of cancer cells more effectively by increasing sensitivity when administered in combination with existing anticancer drugs. Therefore, through the present invention, it is possible to produce an anticancer drug using the antisense oligonucleotide loaded with nano-ER, and it can also be used as a co-administered drug with an existing anticancer drug.
  • the present invention is characterized in that, as a nucleic acid delivery system, cell-derived nanovesicles are used instead of viral vectors, and/or various nucleic acid-based drugs, especially ASO-based drugs, can be used with high bioavailability.
  • the present invention can distribute the nucleic acid-based drug into the intracellular fluid by loading the nucleic acid-based drug on cell-derived natural or artificial nano-endoplasmic reticulum.
  • cell-derived nanovesicles are used as a tool for delivering therapeutic nucleic acids to target cells according to the present invention, it is possible to improve therapeutic efficacy and avoid side effects.
  • the present invention as well as cell-derived natural nano-ER, as well as artificial nano-ER can be used as a nucleic acid delivery system.
  • cell-derived nanoendoplasmic reticulum formulations are of major interest, so when using stem cells as parental cells, cord blood stem cell-derived natural Alternatively, it is preferable to use artificial nano-endoplasmic reticulum, and it is preferable to use cells suitable for the disease to be treated other than stem cells when the intrinsic property of stem cells, such as promoting regeneration, affects the proliferation of cancer cells.
  • Stem cell exosome itself has the effect of promoting the proliferation and migration of other cells, so it also promotes the proliferation and migration of cancer cells. Nevertheless, surprisingly, unlike the increase in the proliferative and migratory abilities of cancer cells when treated with exosomes derived from cord blood stem cells alone, when combined with exosomes derived from cord blood stem cells and anti-cancer substances that inhibit the proliferative and migratory abilities of cancer cells, It was found that the proliferation and migration of cancer cells were reduced (FIGS. 8 and 9).
  • exosomes derived from umbilical cord blood stem cells are five times greater than exosomes derived from other tissues.
  • Inflammatory substances secreted by inflammatory cells are closely related to the proliferation, survival, and induction of metastasis of cancer cells. This is because it stimulates the immune system, disrupts the adaptive immune response, and alters responsiveness to hormones and drugs.
  • cord blood stem cell-derived natural or artificial nano-endoplasmic reticulum according to the present invention can be used in a pharmaceutical composition for preventing or treating cancer, and can be used as a drug delivery system (DDS) for preventing or treating cancer.
  • DDS drug delivery system
  • cell-derived natural nano-endoplasmic reticulum is an extracellular endoplasmic reticulum (Extracellular Vesicles) or exosomes (exosomes, 30 to 200 nm in size).
  • Extracellular endoplasmic reticulum is a nano-sized endoplasmic reticulum surrounded by a lipid bilayer secreted by all cells to the external environment for intercellular information exchange.
  • extracellular vesicles have a membrane and a lumen and have the same membrane topology as cells
  • various membrane proteins can be expressed through genetic manipulation, and drugs can be relatively accurately delivered to target cells or tissues.
  • various drugs can be loaded into the membrane and lumen of the extracellular endoplasmic reticulum. When a drug is loaded into the lumen, it can be safely delivered to target cells. Because it has the same membrane as the cell, it is possible to deliver drugs to the lumen through membrane fusion.
  • extracellular vesicles are cell-derived, immunogenicity is low.
  • extracellular vesicles derived from mesenchymal stem cells (MSC) are known to have a very low risk of immunogenicity. Therefore, it contributes to increasing the lifespan of extracellular vesicles and increasing the bioavailability of loaded drugs.
  • MSC mesenchymal stem cells
  • the extracellular endoplasmic reticulum contains various substances showing biological activity, such as proteins, lipids, nucleic acids, and metabolites, and its components are different depending on the type and state of cells from which it is derived. Although there are components commonly detected in the extracellular endoplasmic reticulum, there are also components detected specifically for cell types.
  • Mammalian cell-derived extracellular vesicles contain more phosphatidylserine, cholesterol, sphingomyelin, and GM3 ganglioside than cells derived from mammalian cells.
  • Lipids present in the extracellular vesicle contribute to the production, stability, and function of the extracellular vesicle.
  • Phosphatidylserine is involved in the formation of extracellular vesicles, and cholesterol, sphingomyelin, and GM3 ganglioside increase the stability of extracellular vesicles as a whole.
  • extracellular vesicles derived from cancer cells promote angiogenesis through sphingomyelin.
  • RNAs present in the extracellular endoplasmic reticulum in a similar degree to the cell from which they originate, but there are also specific RNAs present in a higher amount in the extracellular endoplasmic reticulum than in the cell from which they originate. can be inferred.
  • Extracellular vesicles can perform physiological functions and deliver to specific cells or tissues. Therefore, it can be used as a disease treatment, drug delivery, and vaccine.
  • extracellular vesicles are not living cells, they can be stored and transported for a long time. And, since it does not divide, the concern about the occurrence of tumors in the case of mammalian-derived extracellular vesicles is low.
  • Extracellular endoplasmic reticulum uptake is highly efficient due to membrane proteins such as tetraspanin, fibronectin, and proteoglycan, but can also be tailored to target cells.
  • Extracellular vesicles enriched in vascular cell adhesion molecule 1- and integrin ⁇ 4 enhance nanovesicle docking and uptake through endothelial cells.
  • extracellular endoplasmic reticulum can cross the blood-brain barrier in a bidirectional manner via transcytosis (endocytosis followed by multivesicular body formation and release on the other side) or junctions between endothelial cells.
  • Extracellular vesicle-mediated transport appears to be very effective and can release higher amounts of therapeutic agents into tumors, reducing the amount in the blood and reducing side effects.
  • Extracellular vesicles have functional utility in delivering therapeutic agents. Signals can be sent through a variety of modalities by activating receptors on the cell surface, delivering content to the interior of the cytoplasm, delivering hydrophilic molecules to the interior, and delivering lipophilic molecules in the lipid bilayer and amphiphilic molecules on the surface.
  • Natural or artificial nano-endoplasmic reticulum may be secreted or prepared from cells.
  • Nanovesicle is an expression for a substance in the form of a sac with a diameter in the unit of nanometers. Exosomes can be cited as a representative material of the nano-endoplasmic reticulum, and it is in the spotlight as a bio-friendly drug delivery system that can replace cell therapy agents.
  • Exosomes secreted from adult stem cells have been extensively studied to show excellent efficacy in the regeneration of surrounding cells and anti-inflammatory effects.
  • Nanoendoplasmic reticulum-based formulations are critical to the success of clinical translation.
  • the amount of naturally secreted extracellular vesicles is limited. Therefore, treatment using artificial nano-ER as an extracellular mimetic has been attempted.
  • Artificial nano-endoplasmic reticulum is made in the form of exosomes by crushing the cells themselves, and has the advantage of being able to efficiently load drugs during the process of forming nano-ERs in addition to solving the problem of mass production, which is the biggest drawback of exosomes.
  • Methods for producing artificial nanovesicles include sequential extrusion or repetitive extrusion using a porous membrane.
  • the present invention can produce artificial nano-ER by utilizing a high pressure homogenizer or a high pressure homogenizer (Nano Disperser).
  • the diameter of small cells is around 20 ⁇ m, and their movement in the body is limited.
  • exosomes due to their small size, they can pass through the cerebrovascular membrane, and thus have the advantage of being able to deliver internal active ingredients to all parts of the body. Therefore, if the cell itself is used and pulverized to the size of an exosome, it is possible to secure the advantage of being able to reach all parts of the body while containing a high content of active ingredients within the cell.
  • cells which are the basic structural and active units of organisms, can be cultured in vitro and used in pharmaceuticals, tissue engineering, and the development of therapeutics. Since cells have characteristics of adapting to the surrounding environment, even in the same cell type, adhesion, growth, migration, differentiation, etc. of the cells may vary depending on the culture environment. Furthermore, stem cells, which have recently attracted great attention in relation to the field of regenerative medicine, can induce differentiation into desired cells and promote growth by applying appropriate stimuli during cultivation.
  • the artificial nanoendoplasmic reticulum contains various molecular components (eg, proteins and RNA) of the cell from which the artificial nanoendoplasmic reticulum is derived. Therefore, the protein composition in the artificial nano-endoplasmic reticulum can be variously controlled according to the culture conditions of the cells from which the artificial nano-endoplasmic reticulum is derived (eg, molecular signals received by the cells during culture).
  • the artificial nano-ER produced from stem cells according to the present invention has a unique lipid bilayer structure and can provide a large amount of nano-sized artificial nano-ER, and because it contains a large amount of various growth factors in the artificial nano-ER, fibroblast cells It can exert tissue regeneration and anti-aging effects, increase in collagen synthesis, and wound healing effects through proliferation and activation of
  • Methods for loading drugs into the nano-endoplasmic reticulum can be classified into three major categories.
  • the first is to utilize an ultracentrifuge, which is placed in a solvent. It is a method that induces the drug to enter the endoplasmic reticulum by centrifugal force.
  • the second method uses electroporation, and when the charge on the outside of the membrane is instantaneously induced to become negative and the charge on the inside of the membrane becomes positive, a hole is formed in the membrane and the drug is introduced into the endoplasmic reticulum through the hole.
  • the drug suspended in the suspension is naturally incorporated into the endoplasmic reticulum sphere.
  • the anti-sense oligonucleotide (ASO)-based drug includes an ASO-based drug in which part or all of at least one base in the nucleotide sequence is modified with a phosphorothioate and/or 2'-O-methyl group. can do.
  • ASO targets the DNA sequence of ASO to the mRNA sequence of a specific gene and induces degradation of the corresponding site, thereby preventing the translation process from proceeding and inducing loss of function. Since its function was first revealed in 1978, 4 trillion drugs based on ASO have been approved by the US FDA. However, due to the nucleotide structure of 8-50 base pairs, the safety in the body is weak, and the usability compared to the efficacy as a drug is low.
  • the 2' hydroxyl (OH) can be chemically modified to enhance the potency and pharmacological properties of ASOs. This may increase the binding affinity to the target mRNA and thus reduce the overall length of the ASO.
  • PMO neutral phosphorodiamidate morpholino oligomer
  • PNA peptide nucleic acid
  • Nucleic acid-based drugs loaded into the cell-derived natural or artificial nano-endoplasmic reticulum of the present invention may be mRNAs, miRNAs, rRNAs, tRNAs, and DNAs in addition to the above-described ASO.
  • nucleic acid-based drugs include natural or artificially synthesized nucleic acids as well as modified nucleic acids.
  • the mRNAs delivered through the cell-derived natural or artificial nano-endoplasmic reticulum of the present invention may increase the expression of the protein encoded by the mRNAs in the target cell, and when miRNAs are delivered, the mRNAs targeted by the miRNAs in the target cell. expression may also decrease.
  • RNA-based therapy due to its high selective specificity for target RNA or DNA, targets non-coding RNAs (ncRNA) involved in suppressing the expression of human and viral genes, regulating mRNA splicing, and regulating epigenetics, which are not applicable to drugs, and targeting genes It selectively enables tasks such as increase in the number of genes, expression of genes, and genome editing. These parts are therapeutic actions in a form that could not be realized through small molecule inhibitors or antibodies. Also, RNA-based therapies are the only ones with the advancing ability to keep pace with cancer mutations and epidemic viral infections. Second-generation RNA chemistry technologies greatly improve the stability of RNA therapeutics, reduce unintended side effects, and maximize pharmacological activity towards the target.
  • ncRNA non-coding RNAs
  • the type of drug that can be loaded into the nano-ER is not limited. It is also possible to mount ASOs targeting cancer-related genes other than Galectin-3 along with chemical anti-cancer drugs such as cisplatin or 5-FU, which have been traditionally used. Specific gene-targeting siRNAs whose efficacy has already been proven through extensive in vitro experiments can also be used. In addition, it is possible to mount miRNA series that regulate gene expression.
  • the exosomes can be used as a drug delivery system.
  • siRNA targeting the cancer gene KRAS G12D can be introduced into exosomes derived from mesenchymal stem cells by electroporation.
  • Exosomes can be made based on genetically engineered cells to deliver exosomes specifically to specific cells or to put specific mRNAs into exosomes.
  • a protein fused with a peptide that binds to 'integrin ⁇ V', a marker of breast cancer cells is put into exosomes, and drugs that can kill cancer cells, such as doxorubicin, are added to exosomes. or by fusing an RNA-binding portion to CD63, an exosome marker protein, to package mRNA into exosomes and deliver specific mRNAs through exosomes.
  • the cell origin of the natural or artificial nanoendoplasmic reticulum of the present invention is a cell line (e.g., HEK293 cells, etc.).
  • MSCs are the main source of natural or artificial nanoendoplasmic reticulum production of the present invention for clinical trials.
  • MSC-derived extracellular vesicles can be easily scalable and safe for patients.
  • Types of stem cells include embryonic stem cells, adult stem cells, and dedifferentiated stem cells, among which adult stem cells are extracted from blood, bone marrow, fat, etc., and are free from ethical problems unlike embryonic stem cells.
  • Adult stem cells are cells in an undifferentiated state that differentiate into cells of a specific tissue when needed.
  • Adult stem cells may be mesenchymal stem cells, mesenchymal stromal cells, or multipotent stem cells, but are not limited thereto.
  • Mesenchymal stem cells secrete various growth factors and cytokines, such as epidermal growth factor and fibroblast growth factor, to produce collagen and fibroblasts from fibroblasts. It plays an important role in regeneration by promoting the production of ronectin and elastin.
  • MSCs Mesenchymal stem cells
  • adipocytes chondrocytes
  • osteoblasts muscle cells
  • cardiac tissue e.g., adipocytes
  • endothelial or epithelial cells e.g., adipocytes
  • chondrocytes chondrocytes
  • osteoblasts muscle cells
  • cardiac tissue e.g., adipocytes
  • endothelial or epithelial cells e.g., fibroblasts, fibroblasts, fibroblasts, fibroblasts, fibroblasts, fibroblasts, fibroblasts, fibroblasts, fibroblasts, fibroblasts, fibroblasts, fibroblasts, fibroblasts, fibroblasts, fibroblasts, fibroblasts, fibroblasts, fibroblasts, fibroblasts, fibroblasts, fibroblasts, fibroblasts, fibroblasts, fibroblasts, fibroblasts, fibroblasts,
  • adult stem cells Unlike embryonic stem cells extracted from human embryos, adult stem cells have the advantage of avoiding ethical disputes because they are extracted from already grown body tissues such as bone marrow or brain cells.
  • adult stem cells may be derived from umbilical cord, umbilical cord blood, bone marrow, fat, muscle, nerve, skin, amnion, or placenta, but are not limited thereto.
  • Exosomes generated from mesenchymal stem cells or dendritic cells have physiological activity by themselves and are being sought for use for therapeutic purposes.
  • mesenchymal stem cells exhibiting repair or regeneration activity of damaged tissue is due to growth factors transmitted from mesenchymal stem cells through exosomes rather than mesenchymal stem cells themselves. It has been reported that exosomes derived from mesenchymal stem cells are effective in treating graft-versus-host diseases, which are side effects of hematopoietic stem cell transplantation.
  • Bone marrow and adipose-derived stem cells are extracted from donors by an invasive method, whereas umbilical cord blood stem cells are extracted from umbilical cord blood discarded after childbirth.
  • stem cells When utilizing stem cells for the production of natural or artificial nano-endoplasmic reticulum of the present invention, they may be secreted or prepared from cord blood stem cells. Unlike adipose or bone marrow-derived adult stem cells, umbilical cord blood-derived stem cells have the advantage that there is no difference in efficacy depending on the donor's condition because they use umbilical cord blood formed during the donor's gestational cycle (40 weeks).
  • Cord blood mesenchymal stem cells contain various growth factors such as EGF, VEGF, TGF, HGF, FGF, IGF and PDGF. Therefore, growth factors such as EGF, which are loaded in artificial nanovesicles produced from cord blood mesenchymal stem cells, promote proliferation of fibroblasts, and promote cell migration and collagen synthesis.
  • exosomes isolated from cord blood contain the most regenerative and anti-inflammatory factors.
  • Anti-inflammatory substances contained in exosomes derived from umbilical cord blood stem cells reach 5 times that of exosomes derived from other tissues.
  • Nano-endoplasmic reticulum produced according to the present invention can be formulated in various ways depending on the purpose of use.
  • the formulation of cell-derived natural or artificial nano-endoplasmic reticulum loaded with a nucleic acid-based drug according to the present invention can be concentrated, gelated, freeze-dried, and reconstituted in an aqueous solution without significantly changing its properties.
  • Drug nanoformulations hold remarkable potential to efficiently deliver therapeutic agents to diseased sites.
  • artificial nanocarriers mostly liposomes and polymeric nanoparticles, show limited applications due to unfavorable pharmacokinetics and rapid clearance from the blood circulation by the reticuloendothelial system (RES).
  • RES reticuloendothelial system
  • many of them have high cytotoxicity, low biodegradability, and cannot cross biological barriers including the blood-brain barrier.
  • Cell-derived natural or artificial nano-ER used as a drug delivery system in the present invention has high bioavailability, excellent biocompatibility and low immunogenicity.
  • Cell-derived natural or artificial nano-ER used as a drug delivery system in the present invention can deliver nucleic acid-based drugs loaded thereon to target tissues, cells and organs. Similar to artificial nanocarriers, the cell-derived natural or artificial nanovesicles of the present invention can improve basic properties of free nucleic acid-based drugs, such as stability and solubility, and protect nucleic acid-based drugs from degradation in the bloodstream. In addition, it can be protected from degrading enzymes outside the cell.
  • the membrane of the cell-derived natural or artificial nanoendoplasmic reticulum of the present invention is a relatively rigid lipid bilayer, it can provide sustained and long-term release of the integrated nucleic acid-based drug.
  • the cell-derived natural or artificial nanovesicles of the present invention can pass through biological barriers including the blood-brain barrier (BBB), and thus are particularly useful for treating neurodegenerative diseases.
  • BBB blood-brain barrier
  • the cell-derived natural or artificial nano-endoplasmic reticulum of the present invention has low immunogenicity and low cytotoxicity. Therefore, the cell-derived natural or artificial nano-endoplasmic reticulum of the present invention is preferably prepared as an isolated autologous cell.
  • the cell-derived natural or artificial nano-endoplasmic reticulum of the present invention can be designed to exert a tissue orientation that enables migration to specific cell types or inflammatory tissues.
  • the natural or artificial nanoendoplasmic reticulum of the present invention may have a unique biological activity that reflects its origin, that is, the parental cell, which may provide additional therapeutic efficacy to integrated nucleic acid-based drugs.
  • the biological activities of natural or artificial nanovesicles secreted/prepared from various types of cells are vast and promising.
  • the cell-derived natural or artificial nanovesicles of the present invention be prepared according to the characteristics of the disease to be treated. Do.
  • the main function of the respiratory system is to deliver oxygen by supplying blood containing oxygen to the whole body. Respiration occurs through the mouth, nose, trachea, lungs, and diaphragm. Oxygen enters the respiratory system first through the nose and mouth, then enters the chest cavity through the larynx and trachea. Inside the thoracic cavity, the trachea divides into two smaller tubes called bronchi. Each bronchus is further divided to form a twig-like shape. The bronchi, which enter directly into the lungs, further divide into many bronchioles, at the ends of which connect into tiny sacs called alveoli.
  • alveoli which are air sacs surrounded by capillaries.
  • the total cross-sectional area of the alveoli is 70 to 90 m2, which is about 50 times the total cross - sectional area of the skin in our body.
  • Pulmonary surfactant a combination of phospholipids and proteins secreted by type II alveolar cells, weakens the hydrogen bonding force between water molecules and sufficiently lowers the surface tension, so surface tension usually causes alveolar collapse. do not cause
  • epithelial tissue is to surround the inner surface and inner surface of organs.
  • Epithelial tissue is a layered array of cells densely arranged in one or several layers.
  • Epithelial tissue surrounds organs or covers the inner surface of hollow organs or body cavities.
  • Epithelial tissue always has a apical surface exposed to the outside of the body or inside the body cavity, and the opposite basal surface is connected to other tissues by a non-cellular basement membrane.
  • Epithelial tissue provides a covering that separates one tissue from another and separates the body from the external environment.
  • the structure of epithelial tissue has a close relationship with its function.
  • the alveoli of the lungs and the glomeruli of the kidneys, it is a single-layer squamous epithelial tissue in which flat cells are arranged in a single layer, and performs filtration and diffusion functions, and the alveolar epithelial tissue of the lung facilitates gas exchange very thin (FIG. 16).
  • cell-derived natural or artificial nanovesicles loaded with nucleic acid-based drugs can be directly delivered to the alveoli through the trachea (airway) by inhalation through the mouth/nose, and after intravenous administration It can also be delivered to the alveoli through the capillaries.
  • Cancer is a group of abnormal cells (cancer cells) caused by mutations in normal cells in the body. Cancer cells proliferate chaotically, escaping from the control of the normal control mechanism in the human body. In addition, it metastasizes to other organs (normal tissues), repeats proliferation, and eventually damages the functions of the organs (tissues).
  • the cell-derived natural or artificial nano-endoplasmic reticulum loaded with a nucleic acid-based drug can reduce the proliferation and/or migration ability of target cells, particularly cancer cells, as well as oral or nasal inhalation or intravenous injection.
  • Lung cancer through the intravenous injection route of administration, lung cancer through inhalation, and especially non-small cell lung cancer can be intensively prevented or treated.
  • Inhalation occurs when air or other gases enter the lungs.
  • Inhalation through the oral or nasal cavity causes rapid absorption of the drug through the large surface area of the airway mucosa and lung epithelium, and exhibits a rapid effect almost identical to that of intravenous injection.
  • cell-derived natural or artificial nanovesicles loaded with nucleic acid-based drugs can be directly transported locally to the site of action, thereby minimizing systemic side effects.
  • the inhalation route of administration shows rapid absorption and immediate effect, so that the dose can be titrated and the local effect targeted to the lungs is exhibited. Therefore, lower doses may be used compared to oral or parenteral doses.
  • the cell-derived natural or artificial nano-ER loaded with a nucleic acid-based drug can be formulated in a gaseous state or in a state dispersed in an aerosol.
  • an aerosolized metered container (called an inhaler) may be used, or gas administration may be used.
  • the lung cancer treatment containing cell-derived natural or artificial nano-endoplasmic reticulum loaded with a nucleic acid-based drug can solve the limitation that the drug acts throughout the body, reducing the therapeutic effect and causing serious side effects by using exosomes. there is.
  • the pharmaceutical composition may further include pharmaceutically acceptable concentrations of salts, buffers, preservatives, compatible carriers, and/or other (ie, secondary) therapeutic agents.
  • Each component of the pharmaceutical composition must be in a pharmaceutically acceptable form.
  • a pharmaceutically acceptable carrier is a pharmaceutically acceptable substance, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material used to carry or transport prophylactically or therapeutically active agents. get involved Each carrier must be “acceptable” in that it is compatible with the other ingredients of the formulation and is not injurious to the subject.
  • materials that can serve as pharmaceutically acceptable carriers include sugars such as lactose, glucose and sucrose; glycols such as propylene glycol; polyols such as glycerin, sorbitol, mannitol and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; buffering agents such as magnesium hydroxide and aluminum hydroxide; distilled water for injection; isotonic saline; Ringer's solution; ethyl alcohol; phosphate buffer solution; and other non-toxic compatible substances used in pharmaceutical formulations.
  • sugars such as lactose, glucose and sucrose
  • glycols such as propylene glycol
  • polyols such as glycerin, sorbitol, mannitol and polyethylene glycol
  • esters such as ethyl oleate and ethyl laurate
  • buffering agents such as magnesium hydroxide and aluminum hydroxide
  • distilled water for injection is
  • the pharmaceutical composition may be formulated for the treatment of lung diseases. Accordingly, the pharmaceutical composition may further include other therapeutic agents (secondary agents) that may be used to treat lung diseases.
  • therapeutic agent refers to any agent that can be used for the prevention, treatment and/or management of lung diseases such as those discussed herein. These include, but are not limited to, surfactants, inhaled nitric oxide, almitrin bismesylate, immunomodulators, and antioxidants. Examples of immunomodulators include steroids and corticosteroids, such as but not limited to methylprednisolone. Examples of antioxidants include, but are not limited to, superoxide dismutase.
  • the second agent may be a pulmonary surfactant.
  • a "pulmonary surfactant” is a mixture of lipoproteins useful for keeping the lung airways open (eg, by preventing alveolar walls from sticking together).
  • Pulmonary surfactants include phospholipids such as dipalmitoylphosphatidylcholine (DPPC), phosphotidylcholine (PC), phosphotidylglycerol (PG); cholesterol; and proteins such as SP-A, B, C and D.
  • Lung surfactants may be derived from naturally occurring sources, such as bovine or porcine lung tissue.
  • Lung surfactants can also be synthetic.
  • ExosurfTM Consisting of DPPC with hexadecanol and tyloxapol
  • PumacantTM or Artificial Lung Expansion Compound (ALEC) (consisting of DPPC and PG)
  • KL-4 Consisting of DPPC, palmitoyl-oleoyl phosphatidylglycerol, palmitic acid, and a synthetic peptide mimicking SP-B
  • VenticuteTM includes Lung surfactants can be obtained from commercial suppliers.
  • an “effective amount” is that amount of an agent that achieves a desired outcome.
  • the absolute amount will depend on a variety of factors, including the substance selected for administration, whether administration is a single dose or multiple doses, and individual patient parameters including age, physical condition, size, weight, and stage of disease. These factors are well known to those skilled in the art and can be addressed with no more than routine experimentation.
  • an effective amount is a dosage of an agent that does not cause toxicity to a subject. In one embodiment, an effective amount is a dosage of an agent that reduces toxicity to a subject.
  • Methods for measuring toxicity are well known in the art (e.g., biopsy/histology of liver, spleen and/or kidney; alanine transferase, alkaline phosphatase and bilirubin assays for liver toxicity; and for renal toxicity). creatinine level).
  • the effective amount level depends on the type and severity of the subject, age, sex, type of disease, activity of the drug, sensitivity to the drug, time of administration, route of administration and excretion rate, duration of treatment, factors including drugs used concurrently, and other medical disciplines. It can be determined according to known factors. In addition, the effective amount may vary depending on the route of treatment, the use of excipients and the possibility of use with other agents, as recognized by those skilled in the art.
  • Treat” or “treatment” includes, but is not limited to, preventing, reducing or arresting the occurrence of a disease, reducing or eliminating symptoms of a disease, or preventing a disease.
  • Subjects include, but are not limited to, rodents such as rats or mice, dogs, cats, horses, cows, pigs, sheep, goats, turkeys, chickens, and primates such as monkeys, humans or vertebrates. will mean an animal or mammal.
  • the methods of the present disclosure are useful for treating a subject in need of treatment.
  • a subject in need of treatment may be a subject at risk of developing a disease (ie, through genetic testing) or a subject with a disease.
  • a composition comprising cell-derived natural or artificial nanovesicles loaded with a nucleic acid-based drug is administered to a subject as a bolus dose.
  • a "bolus dose” refers to a single administration of discrete amounts of a medicament, drug or other compound to achieve a therapeutically effective level.
  • repeated administration of the nucleic acid-based drug-loaded nano-ER is contemplated, including administration of 2, 3, 4, 5 or more of the nano-ER loaded with the nucleic acid-based drug.
  • the nano-ER loaded with the nucleic acid-based drug may be administered continuously.
  • Repeated or continuous administration may take several hours (eg, 1-2, 1-3, 1-6, 1-12, 1-18, or 1-24 hours), several days (eg, 1-24 hours) depending on the severity of the condition being treated. eg, 1-2, 1-3, 1-4, 1-5, 1-6 days, or 1-7 days) or several weeks (eg, 1-2 weeks, 1-3 weeks, or 1 -4 weeks).
  • the time between administrations may be several hours (eg, 4 hours, 6 hours, or 12 hours), several days (eg, 1 day, 2 days, 3 days, 4 days). , 5 days, or 6 days), or several weeks (eg, 1 week, 2 weeks, 3 weeks, or 4 weeks). The time between administrations may be the same or different.
  • Nanovesicles loaded with nucleic acid-based drugs can be administered by any route that achieves delivery to the lungs or other tissues.
  • Systemic routes of administration are suitable, such as intravenous bulk single injection or continuous infusion. More direct routes are contemplated, such as intranasal administration, intratracheal administration (eg, via intubation), and inhalation (eg, via an aerosol through the mouth or nose), particularly where rapid action is desired. may be appropriate
  • An aerosol is a suspension of a liquid dispersed as small particles in a gas, and includes fine mists or sprays containing such particles. Aerosolization is the process of producing an aerosol by converting a liquid suspension into small particles or droplets.
  • the nebulizer may be, for example, an air jet (i.e., pneumatic pressure) using a suitable propellant such as, but not limited to, dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. ), ultrasonic and vibrating mesh nebulizers.
  • a suitable propellant such as, but not limited to, dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • a suitable propellant such as, but not limited to, dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • a suitable propellant such as, but not limited to, dichlorodifluoromethane, trichlorofluoromethane, dichlorotetra
  • Capsules and cartridges, for example of gelatin, for use in an inhaler or insufflator may be formulated containing nanovesicles loaded with lyophilized nucleic acid based drug and a suitable powder base such as lactose or starch.
  • Nanovesicles loaded with nucleic acid-based drugs can be formulated for parenteral administration by injection, including when systemic delivery is desired, for example, large single injections or continuous infusions.
  • Formulations for injection may be presented in unit dosage form, eg, in ampoules or in multi-dose containers, with or without the added preservative.
  • the composition may take the form of an aqueous suspension, solution or emulsion in an oily or aqueous vehicle, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters such as ethyl oleate or triglycerides.
  • Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
  • the suspension may also contain suitable stabilizers or agents which increase solubility.
  • nanovesicles loaded with nucleic acid-based drugs may be lyophilized or in other powder or solid form for constitution with a suitable vehicle, eg, sterile distilled water for injection, prior to use.
  • agents administered to a subject treated according to the present disclosure may be administered by any suitable route, including oral administration, intranasal administration, intratracheal administration, inhalation, intravenous administration, and the like.
  • suitable route including oral administration, intranasal administration, intratracheal administration, inhalation, intravenous administration, and the like.
  • a person of ordinary skill in the art would be aware of common routes of administration for such secondary agents.
  • the nanovesicles loaded with the nucleic acid-based drug can be used immediately or, alternatively, stored for a short and/or long term, eg cryopreservation prior to use.
  • Proteinase inhibitors are typically included in the freezing medium as they provide nanovesicular integrity during long-term storage. Freezing under -20 °C is not preferred because it is associated with increased loss of nano-ER activity. Rapid freezing at -80°C is more preferred because it preserves activity.
  • additives to the freezing medium may be used. Such additives are similar to those used for cryopreservation of intact cells and may include, but are not limited to, DMSO, glycerol and polyethylene glycol.
  • the pharmaceutical formulations of the present invention are typically prepared for parenteral administration, i.e., bolus, intravenous, and intratumoral injection, in unit dose injectable form with a pharmaceutically acceptable parenteral vehicle.
  • Cell-derived natural or artificial nanovesicles loaded with a nucleic acid-based drug having a desired degree of purity are optionally mixed in the form of a lyophilized preparation or aqueous solution with pharmaceutically acceptable diluents, carriers, excipients or stabilizers.
  • natural or artificial nanovesicles loaded with antisense oligonucleotides inhibit the proliferation and migration of cancer cells and exhibit characteristics of increasing drug sensitivity when administered in combination with conventional chemotherapy.
  • cell-derived natural or artificial nano-endoplasmic reticulum is a modality that is expected to be able to be produced at a relatively low price while taking advantage of the strengths of cell therapy products, and to target cancer cells with a completely different mechanism from existing immuno-anticancer drugs.
  • FIG. 1 is a graph analyzing the decrease in Galectin-3 gene expression in a lung cancer cell line (A549) upon treatment with Galectin-3 ASO.
  • FIG. 2 is a graph analyzing the decrease in Galectin-3 protein expression in lung cancer cell line (A549) upon treatment with Galectin-3 ASO.
  • FIG. 3 is a graph confirming that cell proliferation of lung cancer cell lines is reduced upon treatment with Galectin-3 ASO and a photograph taken after staining cells to confirm that cell migration is inhibited.
  • Figure 5 is a photograph taken after analysis to confirm whether the Galectin-3 ASO is loaded into the nano-endoplasmic reticulum by electrophoration and porous membrane cell extrusion, and then the degree of efficiency.
  • Figure 6 is a graph for the method and results of securing a purely ASO-loaded nano-ER by purifying non-loaded ASO after loading Galectin-3 ASO in the nano-ER.
  • FIG. 7 is a graph confirming that Galectin-3 gene expression is reduced in a lung cancer cell line (A549) when artificial nano-ER loaded with Galectin-3 ASO is treated.
  • Figure 8 is a photograph taken after staining proliferating cells to confirm that the cell proliferation ability of lung cancer cells is reduced after treatment with Galectin-3 ASO-loaded umbilical cord blood stem cell exosomes and artificial nano-endoplasmic reticulum; And it is a graph confirming the cell proliferation ability of lung cancer cells after treatment with Galectin-3 ASO-loaded exosomes and artificial nano-ER.
  • Figure 9 is a photograph taken after staining the migrated cells to confirm that the cell migration ability of lung cancer cells is reduced after treatment with Galectin-3 ASO-loaded umbilical cord blood stem cell exosomes and artificial nano-endoplasmic reticulum; And it is a graph confirming the cell migration ability of lung cancer cells after treatment with Galectin-3 ASO-loaded exosomes and artificial nano-ER.
  • Figure 10 is a photograph taken after staining proliferating cells to confirm that the cell proliferation ability of lung cancer cells is reduced after treatment with Galectin-3 ASO-loaded HEK293 cell exosomes and artificial nano-ER; And it is a graph confirming the cell proliferation ability of lung cancer cells after treatment with Galectin-3 ASO-loaded exosomes and artificial nano-ER.
  • Figure 11 is a photograph taken after staining the migrated cells to confirm that the cell migration ability of lung cancer cells is reduced after treatment with Galectin-3 ASO-loaded HEK293 cell exosomes and artificial nano-ER; And it is a graph confirming the cell migration ability of lung cancer cells after treatment with Galectin-3 ASO-loaded exosomes and artificial nano-ER.
  • FIG. 12 is a schematic diagram of the mechanism of ASO that induces loss of gene function by binding to and degrading mRNA of a target gene (Science 27 Mar 2020; vol.367, Issue 6485).
  • Figure 13 shows a 4-billion-year-old lipid bilayer protective film that prevents RNA invasion.
  • Figure 14 is a chart summarizing the characteristics and disadvantages of each method of loading the drug in the nano-ER.
  • 15 is a schematic diagram showing the structure and function of the respiratory system.
  • 16 is a schematic diagram showing the structure of alveoli.
  • Galectin 17 shows the function of Galectin, which is highly expressed in lung cancer cells and promotes cancer cell proliferation and metastasis (Chang WA, 2017, Oncology Letters).
  • Figure 18 is the result of confirming the organ of accumulation in the body after intravenous administration of extracellular vesicles (Sci Rep. 2019 Jul 11;9(1):10041).
  • Target site Site 1 cat gat gcg tta tct ggg tc Site 2 (SEQ ID NO: 2) ggc cac tga ttg tgc ctt at Site 3 (SEQ ID NO: 3) act ggg gaa ggg aag aa ga
  • nucleotide sequences of SEQ ID NOs: 1 to 3 were prepared by randomly selecting three places among the entire Galectin-3 coding sequence, nucleotide sequences in other regions besides SEQ ID NOs 1 to 3 among the entire Galectin-3 coding sequences were used to generate Galectin -3 ASO production is possible.
  • Exosomes isolated from the cell culture medium of cord blood stem cells were purified and concentrated using ultra-high-speed centrifugation (50,000-150,000 xg, 1-3 h). After counting exosomes through Nanoparticle Tracking Analysis, 1 ⁇ 4x10 ⁇ 10 were diluted in 100 ⁇ l of Invitrogen Neon TM R buffer. 100-1,000 pmol of Galectin-3 ASO was added to 100 ⁇ l of prepared exosomes. Electroporation transfection was performed using an Invitrogen Neon TM Electroporator under conditions of 100 ⁇ l of exosomes, 1000-2000 V, 5-20 ms, and 1-3 pulses. Residual ASO was removed through IZON qEV original size exclusion chromatography (SEC) purification.
  • SEC original size exclusion chromatography
  • Cord blood stem cells in culture were harvested using TrypLE and washed twice with PBS. After cell counting, cell suspension was prepared by resuspension in PBS to 1 ⁇ 10x10 ⁇ 5 cells/ml. Galectin-3 ASO was added to the cell suspension to a concentration of 100 to 1,000 pmol/ml. Using an Avanti mini extruder, 1 ml of the cell suspension was extruded using a 0.1 to 0.8 ⁇ m Whatman TM Membrane Filter. The cells were extruded and pulverized by reciprocating a total of 2 to 10 times. The extruded and pulverized sample was purified and concentrated using an ultra-high-speed centrifuge (50,000-150,000 xg, 1-3 h). Residual ASO was removed through IZON qEV original size exclusion chromatography (SEC) purification.
  • SEC original size exclusion chromatography
  • A549 cells a non-small cell lung cancer cell line, were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) and Primocin TM (100 ⁇ g/ml) in a 37°C, 5% CO 2 incubator. The medium was replaced every 2 to 3 days, and subculture was performed when the cells reached 80% of the bottom area of the culture dish.
  • FBS fetal bovine serum
  • Primocin TM 100 ⁇ g/ml
  • A549 cells were seeded in a culture dish at 4,000 to 8,000 cells/cm2 and cultured for 24 hours in a 37°C, 5% CO 2 incubator. Incorporation of 100 ⁇ 1,000 pmol Galectin-3 ASO into cells was induced using Lipofectamine. After culturing for 24 to 48 hours in a 37°C, 5% CO 2 incubator, the cells were washed with PBS and cells were collected using TrypLE. After removing the supernatant by centrifuging the cells, the cell pellet was resuspended in PBS and centrifuged to remove the supernatant.
  • the synthesized A579 cDNA was subjected to real-time PCR with the primers in Table 2 to confirm the expression level of Galectin-3.
  • GAPDH a kind of house keeping gene, was used as a loading control.
  • Galectin-3 ASO prepared with the nucleotide sequence of Table 1 works normally and reduces the gene expression of Galectin-3 in lung cancer cells
  • lung cancer cells are treated with ASO and analyzed using the nucleotide sequence of Table 2.
  • Galectin-3 gene expression in the lung cancer cell line A549 was reduced by Galectin-3 ASO treatment (FIG. 1).
  • Galectin-3 protein expression in the lung cancer cell line A549 was reduced by the treatment with Galectin-3 ASO (FIG. 2).
  • Figure 2 confirms the level of protein expression on the 1st and 4th days after ASO treatment, and it was confirmed that the protein expression was suppressed for a long period of time for more than 4 days after Galectin-3 ASO treatment, confirming that the drug was sufficiently functioning.
  • A549 cells were seeded in a culture dish at 4,000 to 8,000 cells/cm2 and cultured for 24 hours in a 37°C, 5% CO 2 incubator. After removing all the existing culture medium, 100-1,000 pmol Galectin-3 ASO was induced to enter cells using Lipofectamine in 1% FBS medium. Cells were counted after 24 hours and 48 hours of culture in an incubator at 37°C and 5% CO 2 .
  • Example 5 As a result of the analysis, it was confirmed that the cell proliferation ability of the lung cancer cell line A549 was reduced by the treatment with Galectin-3 ASO (Fig. 3 left). In the case of Example 5 (FIG. 2), it was confirmed that the amount of protein expression decreased by the treatment with Galectin-3 ASO, and it can be seen that the reduction in cell proliferation and migration ability was induced as a result of the decrease in protein expression.
  • the graph of FIG. 3 is a relative comparison of the degree of cell proliferation, and the degree of cell proliferation of the experimental group is compared with the degree of proliferation of the control group set to “1”, rather than quantification of cell numbers.
  • H-358 is one of the same non-small cell lung cancer lines as A549, and as shown in Figure 3, Galectin-3 ASO does not specifically react only to the A549 cell line, but also shows the same efficacy in other non-small cell lung cancer lines. It showed that it can be used in general non-small cell lung cancer.
  • A549 cells were seeded at 0.5-2 x 10 ⁇ 4 cells/well into insert wells in a trans-well and cultured in a 37°C, 5% CO 2 incubator for 24 hours. After removing all the existing culture medium, 100 ⁇ 1,000 pm Galectin-3 ASO was induced into cells using Lipofectamine in a serum-free medium condition. After culturing for 2 hours in an incubator at 37°C, 5% CO 2 , 500 ⁇ l of RPMI 1640 medium supplemented with 10% FBS and Primocin TM (100 ⁇ g/ml) was dispensed to the lower plate of the insert well. After culturing for 48 hours in an incubator at 37°C and 5% CO 2 , crystal violet staining was performed. Cells migrating to the opposite side of the insert well membrane were observed under an optical microscope.
  • Example 8 Analysis of sensitivity to cancer cells after treatment with Galectin-3 ASO
  • A549 lung cancer cells were attached to the culture dish at a cell count of 2 ⁇ 10 x 10 ⁇ 4 cell/cm 2 , and then influx into the cells was induced using Lipofectamine with Galectin-3 ASO at a concentration of 100 ⁇ 1,000 pmol. After 24 hours of treatment with 10-50 uM Cisplatin, the degree of apoptosis was confirmed using a Live & Dead Assay Kit 24 hours later through a fluorescence microscope.
  • Example 9 Analysis of Galectin-3 gene expression in lung cancer cells after treatment with Galectin-3 ASO-loaded artificial nanoendoplasmic reticulum
  • A549 cells were seeded in a culture dish at 4,000 to 8,000 cells/cm2 and cultured for 24 hours in a 37°C, 5% CO 2 incubator. The next day, 0.5 ⁇ 2 x 10 ⁇ 9 artificial nano-endoplasmic reticulum loaded with Galectin-3 ASO were treated. Galectin-3 gene expression was analyzed in the same manner as in Example 4 after culturing for 24 hours in a 37°C, 5% CO 2 incubator.
  • Galectin-3 gene expression in the lung cancer cell line A549 was reduced by treatment with Galectin-3 ASO-loaded artificial nano-ER (FIG. 7).
  • FIG. 1 is a result of confirming the level of Galectin-3 gene expression in cells after injecting Galectin-3 ASO into cells using lipofectamine reagent without loading nano-ER.
  • Lipofectamine reagent has a function of artificially inducing liposome formation so that the substance can be introduced into cells, but it is impossible to use in the actual drug production process due to inherent toxicity and processing problems. Therefore, through the results of Figure 1, it is primarily confirmed that Galectin-3 ASO has a normal function, and in the case of Figure 7, Galectin-3 ASO is loaded into artificial nano-endoplasmic reticulum naturally without treatment with reagents such as Lipofectamine. This is the result of confirming the effect of inhibiting the expression of Galectin-3 after being introduced into the cell.
  • Example 10 Effects of umbilical cord blood stem cell exosomes without or with Galectin-3 ASO and artificial nano-endoplasmic reticulum on proliferation and migration of lung cancer cell line (A549)
  • Exosome Cord blood stem cell exosome treatment group
  • GAL-3 Exosome Cord blood stem cell exosome treatment group loaded with Galectin-3 ASO
  • ANV umbilical cord blood stem cell artificial nano endoplasmic reticulum treatment group containing nothing
  • GAL-3 ANV Cord blood stem cell artificial nano-endoplasmic reticulum treatment group containing Galectin-3 ASO
  • A549 cells were seeded in a culture dish at 4,000 to 8,000 cells/cm2 and cultured for 24 hours in a 37°C, 5% CO 2 incubator. After removing all the existing culture medium, 0.5 to 2 x 10 ⁇ 9 exosomes and artificial nano-endoplasmic reticulum were treated with 1% FBS medium. Cells were counted after 24 hours and 48 hours of culture in an incubator at 37°C and 5% CO 2 .
  • FIG. 8 compares the relative values for the cell proliferation rate.
  • Galectin-3 ASO was loaded on both exosomes and artificial nanoendoplasmic reticulum made by crushing cells to confirm the efficacy. Confirmed.
  • A549 cells were seeded at 0.5-2 x 10 ⁇ 4 cells/well into insert wells in a trans-well and cultured in a 37°C, 5% CO 2 incubator for 24 hours. After removing all the existing culture medium, 0.5 ⁇ 2 x 10 ⁇ 9 exosomes and artificial nano-ER were treated in serum free medium conditions. After culturing for 2 hours in an incubator at 37°C, 5% CO 2 , 500 ⁇ l of RPMI 1640 medium supplemented with 10% FBS and Primocin TM (100 ⁇ g/ml) was dispensed to the lower plate of the insert well. After culturing for 48 hours in an incubator at 37°C and 5% CO 2 , crystal violet staining was performed. Cells migrating to the opposite side of the insert well membrane were observed under an optical microscope.
  • cord blood stem cell exosomes and artificial nano-endoplasmic reticulum that do not contain Galectin-3 ASO, they promote the proliferation and migration of lung cancer cell lines according to the inherent characteristics of stem cells that promote the proliferation and migration of surrounding cells.
  • cord blood stem cell exosomes and artificial nano-endoplasmic reticulum loaded with Galectin-3 ASO have stem cell-specific properties (promotion of cell proliferation/migration) by inhibiting Galectin-3 gene expression (promotion of proliferation/migration of non-small cell lung cancer).
  • Example 11 Effects of exosomes and artificial nano-endoplasmic reticulum of HEK293 cells without or with Galectin-3 ASO on proliferation and migration of lung cancer cell line (A549)
  • Non-Treat (NC): Experimental group not treated with anything (Negative control)
  • Control_ANV Artificial nanoendoplasmic reticulum derived from HEK293 cells containing nothing
  • GAL-3_ANV Artificial nanoendoplasmic reticulum derived from HEK293 cells loaded with Galectin-3 ASO

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Molecular Biology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Botany (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nanotechnology (AREA)
  • Optics & Photonics (AREA)
  • Oncology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicinal Preparation (AREA)

Abstract

본 발명은 세포 유래 자연 또는 인공 나노소포체에 핵산 기반 약물을 탑재시킴으로써, 핵산 기반 약물을 세포안으로 도입할 수 있는 약학 조성물 및 이의 제조방법에 관한 것이다. 본 발명에 따라 안티센스 올리고뉴클레오타이드를 탑재한 자연 또는 인공 나노소포체는 암세포의 증식과 이동을 억제하고 기존 화학항암제와의 병용 투여 시 약물 감수성을 증가시키는 특성을 보인다.

Description

안티센스 올리고뉴클레오타이드 기반 약물이 탑재된 세포 유래 자연 또는 인공 나노소포체를 함유하는 약학 조성물
본 발명은 핵산 기반 약물이 탑재된 세포 유래 자연 또는 인공 나노소포체를 함유하는 것이 특징인 약학 조성물에 관한 것이다. 일례로, 본 발명은 암 발생 유도 유전자 염기 서열에 대한 안티센스 올리고뉴클레오타이드를 탑재한 인체세포 유래 자연 또는 인공 나노소포체를 활용한 항암 약물 개발에 관한 것이다.
암이 발생한 신체 장기의 위치에 따라 간암, 위암, 자궁암 등등으로 불리며 폐에 발생한 암을 폐암이라고 하고 정확하게는 원발성(폐에서 시작된) 폐암이라고 부른다. 즉, 기관지, 세기관지, 폐포 등의 폐조직에서 발생한 암을 말한다. 이에 반해, 예를 들어 유방암, 간암 등 다른 장기에서 발생하여 폐로 전이된 경우는 전이성 폐암이라고 부르며 원발성 폐암과는 달리 취급하게 된다.
폐암은 암으로 사망 중 가장 확률이 높다. 서서히 진행하므로 조기에 발견하면 수술로 치료가 가능하다. 폐암은 임상적 경과와 치료가 다르기 때문에 현미경적으로 암세포의 크기와 형태에 따라 비소세포폐암(Non Small Cell Lung Cancer, NSCLS)과 소세포 폐암(Small Cell Lung Cancer, SCLC)으로 구분되며, 이 중 NSCLS가 폐암 환자의 85%를 차지한다. 이 비소세포폐암은 다시 비편평 비소세포폐암(NSCLC)과 편평세포폐암(NSCLC)으로 나뉜다. 비편평 비소세포폐암이 70~75%로 대부분이고 편평 비소세포폐암이 25% 정도로 알려져 있다. 현재 비소세포폐암에 대한 표적항암제로 사용되는 일부 약들은 높은 치료효과에도 불구하고, EGFR T790M 변이에 의해 발생되는 내성암에 대해서는 치료방법이 없다.
모든 세포들은 다른 세포들 또는 외부 환경과 정보 교환을 한다. 이러한 정보교환을 위해 세포들은 다양한 물질들을 외부 환경으로 분비하는데, 성장인자(growth factors), 사이토카인(cytokines), 케모카인(chemokines), 호르몬, 신경전달물질 등이 있다. 최근에는, 이러한 단일 물질 외에도 세포외소포체(extracellular vesicles, EVs)를 통한 정보교환이 점차 주목받고 있다. 박테리아 엑소좀의 경우 지질 다당류(lipopolysaccharides) 또는 지질테이코산(lipoteichoic acid)를 포함하기도 한다.
세포외소포체는 세포 간 정보교환을 위해 모든 세포들이 외부 환경으로 분비하는 나노 크기의 소포체이다. 세포외소포체는 단백질, 지질, 핵산, 대사 물질 등 생물학적 활성을 보이는 다양한 물질들을 포함하고 있다. 또한, 세포외소포체의 구성 성분들은 유래하는 세포의 종류와 상태를 반영하고 있으며, 세포 배양액, 혈액, 소변, 타액, 눈물, 정액, 모유, 복수(ascites), 뇌척수액 등 다양한 체액에서 존재한다. 다양한 세포에서 유래하는 세포외소포체가 표적세포와 상호 작용하면서 다양한 생리적병리적 기능을 수행할 수 있다. 예를들어 줄기세포 유래 세포외소포체는 조직 재생을 유도할 수 있고, 암세포 유래 세포외소포체는 암의 성장과 전이, 혈관신생 등에 영향을 줄 수 있다. 박테리아 유래 세포외소포체는 항생제 내성, 경쟁 박테리아 제거, 독성 인자(virulence factor) 전달, 면역반응 조절 등의 기능을 수행할 수 있다.
한편, 다양한 세포와 체액에서 유래한 세포외소포체에서 공통으로 많이 발견되는 단백질들이 있고, 이를 통해 단백질들이 세포외소포체로 무질서하게 들어가는 것이 아니라 조절되는 기작을 통해 들어가는 것을 확인할 수 있다.
유래하는 세포소기관에 따라 세포외소포체 단백체를 분석한 결과, 주로 원형질막 (plasma membrane)이나 세포내액(cytosol)에서 유래하는 단백질이 많았고, 상대적으로 미토콘드리아나 세포핵에서 유래하는 단백질은 적었다. 세포외소포체 공통으로 발견되는 단백질들은 세포외소포체의 구조, 생성, 이동에 관여하는데, 대표적으로 테트라스파닌(tetraspanins: CD9, CD63, CD81 등), 인테그린(integrins), 엔도좀 정렬 복합체(endosomal sorting complex) 단백질 (TSG101, Alix), 세포골격 단백질(cytoskeletal proteins: actins, tubulin), 열 충격 단백질(heat shock proteins: HSP70, HSP90) 등이 있다. 포유류 세포 유래 세포외소포체에 공통으로 발견되는 단백질들은 세포외소포체를 분리했을 때 사용하는 표지 단백질들로 활용할 수 있다. 한편, 세포외소포체에는 유래하는 세포 종류 특이적 단백질도 존재하는데, 이들은 세포 종류와 관련된 생리적/ 병리적 기능을 수행하는 것과 관련 있다.
세포외소포체는 생물학적 활성을 가지고 있는 다양한 물질로 구성되어 있어 다양한 생물학적 기능을 수행할 수 있다. 세포외소포체가 표적 세포와 상호작용하는 기작으로는 리간드-수용체 상호작용(ligand-receptor interactions), 결합(fusion) 그리고 내포 작용(endocytosis) 등이 있다. 다양한 세포에서 유래하는 세포외소포체가 표적 세포와 상호작용하면서 정상적인 상황에서 생리적 기능을 수행하기도 하고, 질병을 유발하는 병리적 기능을 수행하기도 한다. 이에 따라 다양한 질병의 진단과 치료에 활용될 수 있다.
포유류 세포 유래 세포외소포체가 수행하는 다양한 생리적 기능으로는 지혈, 조직 재생, 줄기세포 유지, 염증/ 면역 반응 조절, 배아 발달 등이 있다. 혈관 내에는 단핵구, 내피세포, 혈소판 등 다양한 세포에서 유래하는 세포외소포체들이 존재하는데, phosphatidylserine을 가지고 있는 세포외소포체는 혈액 응고를 촉진한다. 또한, 줄기세포에서 유래하는 세포외소포체는 신장/ 간/ 피부 등 손상 모델에서 조직 재생과 염증 반응 조절을 매개할 수 있다. 한편, 면역세포에서 유래한 세포외소포체는 IL-1β 같은 염증성 사이토카인을 전달하거나, 직간접적으로 항원 제시하는 등 면역 반응을 촉진할 수도 있다. TGF-β 같은 억제성 사이토카인을 전달하거나, T 세포 활성화를 억제하는 방식 등을 통해 면역 반응을 억제할 수도 있다. Wnt 등의 막 부착 형태 형성 물질 (membrane-bound morphogen)을 가진 세포외소포체는 대응하는 수용체에 붙어 배아 발달에 관여하는 신호 전달 경로를 촉진하기도 한다.
한편, 포유류 세포 유래 세포외소포체는 다양한 질병을 유발하는 병리적 기능을 수행하기도 한다. 특히, 종양 미세 환경(tumor microenvironment)에서 암세포 유래 세포외소포체는 매우 다양한 기능을 수행한다. 암세포 유래 세포외소포체는 sphingomyelin을 통해 내피세포에 작용하여 분열, 이동, 관 형성을 촉진하여 혈관 신생을 증진시킨다. 그리고 단핵구를 골수 유래 억제 세포 (myeloid-derived suppressor cells)로 분화시키기도 한다. 이와 함께, 다른 면역 세포에도 작용하는데, 세포독성 T 세포의 사멸을 촉진하거나 조절 T 세포의 분화를 촉진하여 항암 면역 작용을 억제시키기도 한다. 이를 통해, 암세포 유래 세포외소포체는 종양 미세 환경에서 암의 진행을 촉진하도록 하는 기능을 수행한다는 것을 알 수 있다.
핵산의약품은 생체 내에서 주로 유전정보를 담당하는 물질로서 기능하는 핵산을 이용한 의약품으로, 유전자 발현을 억제하는 'siRNA'나 표적분자와 특이적으로 결합하는 '압타머(Aptamer)' 등이 주목되고 있다.
핵산의약이란 유전자 구성성분인 핵산(DNA나 RNA 등)을 주성분으로 하는 의약품으로, '안티센스' 'siRNA' '압타머' 'CpG올리고' 등 종류가 있다. 질환 원인유전자와 단백질에 작용해 효과를 발휘하기 때문에 기존 의약품에서는 표적으로 삼기 어려웠던 세포내 분자에 작용할 수 있어 효과가 우수하고 부작용이 적을 것으로 기대되고 있다.
특히, Small interfering RNAs (siRNAs), microRNAs (miRNAs), antisense oligonucleotides (ASOs), aptamers, 합성 mRNAs 및 CRISPR Cas9 와 같이 RNA를 기반하는 치료제들은 현재 약물을 통해서 조절할 수 없는 많은 유전자 및 유전자 산물들을 표적하고, 암에서부터 유행성 인플루엔자, 알츠하이머, 자가면역 질환에 이르는 질병들에서 새로운 치료 패러다임을 창출할 수 있는 중대한 잠재력이 있다. 그러나 이러한 RNA의 잠재력이 최대한으로 발휘되려면 먼저 세포 외부의 RNA를 세포 내부로 침투하지 못하게 하는 오랜 시간 동안 진화적으로 완성된 방어체계를 극복해야 한다. 지질 이중층을 뚫고 RNA를 세포로 전달하는 것이 RNA 치료제의 광범위한 개발을 위한 주요 과제이며, 오래 전부터 제기되어왔던 약물 전달 문제는 지속적으로 지적되고 있다.
생명체는 원시 RNA 와 고분자 용액들이 지질 이중층에 의해 캡슐화되어 외부의 RNA 와 거대 분자들의 간섭 없이 독자적인 화학 반응이 가능해짐에 따라 발생되었다. 지질 이중층은 1,000 Daltons (Da) 보다 작은 중성, 약간의 소수성 분자 <1,000 Daltons (Da)의 수동적 확산을 허용하는 반면, RNA 와 같은 큰 분자의 이동은 제한한다.
따라서, 지질 이중층은 생명을 창조하고, 침입하는 RNA 로부터 방어하는데 있어서 기본적인 것이었다. 이 오래된 장벽 위에는 RNases 와 선천적인 면역 패턴 인식 Toll like receptors (TLRs) 3, 7, 8, 이중나선 RNA 수용체 PKR 등을 포함하여, 침입하는 RNA 로부터 metazoan 세포를 더욱 보호하기 위해 고안된 일련의 진화적 방어 장치가 있다. 또한, RNA는 신장과 간세포의 포획 수용체에 의해 혈액으로부터 빠르게 제거된다. 이러한 장벽들 중에서도 지질 이중층을 통한 전달은 해결해야 할 문제로 남아 있다. 저분자 억제제는 분자량이 적고, 낮은 전하량 및 충분한 소수성 성질을 통해 세포막의 지질 이중층을 부드럽게 미끄러져 넘어갈 수 있다. 이와 대조적으로, 모든 RNA 기반 치료제는 지질 이중층을 가로 지를 수 있는 능력이 없으며 크기가 크고 고전하량의 거대분자 물질이다 (도 13).
그러나, 기존 약물전달체인 리포좀에 비해 엑소좀이 췌장암 발병에 관여하는 유전자인 KRAS의 발현을 억제하는 유전자 치료제의 치료 효과를 크게 증가시킨 것을 확인한 2017년 네이처 논문은 엑소좀을 활용한 치료제 후속 연구 및 개발에 토대가 되었다.
세포 내에 존재하는 생체막으로 둘러싸인 구조물로 정의되는 세포외소포체 는 크기와 생성방식에서 매우 다양한 종류가 있다. '엑소좀'이라고 부르는 것은 세포 내의 엔도솜(endosome)에서 유래돼 세포 내로 방출되고, 지름이 30 ~ 200 nm 정도인 것을 말한다.
엑소좀의 생성 과정은 세포 내에서 물질을 흡수하고 분비하는 역할을 하는 부분인 엔도솜과 밀접하게 관련돼 있다. 후기 엔도솜(date endosome)에는 다포체(multivesicular body)라고 불리는 작은 소포체(vesicle)들을 함유하고 있는 엔도솜이 있는데, 이들이 세포막과 융합되면 내부에 존재하는 소포체가 방출되고, 이것이 엑소좀이 된다.
엑소좀은 크기, 표면에 존재하는 바이오마커 단백질, 기능, 유래되는 조직에 따라서 서로 상이한 성질을 가진다. 즉 엑소좀은 매우 다양한 크기와 특성을 가진 세포 외부에서 발견되는 생체막로 둘러싸인 구조물을 두루 통칭하는 용어다.
엑소좀의 구성성분은 생체막과 생체막 내부에 담긴 구성성분으로 나눌 수 있다. 엑소좀과 외부를 구분하는 생체막에는 세포 내부의 생체막 구성성분과 마찬가지로 여러가지 막단백질과 지질, 당쇄가 같이 존재한다. 엑소좀 생체막에 존재하는 단백질 중에서는 엑소좀에 특이적으로 존재해 엑소좀의 바이오마커로 간주되는 여러 가지 단백질이 있는데 이들에는 CD63, CD9, CD81 등이 있다. 엑소좀 내부의 구성성분에는 여러가지 세포 유래의 단백질, RNA(miRNA, Mrna 등), 각종 대사물질 등이 있다.
결국 엑소좀은 다른 세포로 이동해 물질을 교환함으로써 세포 간의 신호를 전달하는 역할을 한다. 다른 세포에 신호를 전달해 다른 세포에 영향을 주게 됨으로써 생리적,병리적 역할을 수행하게 된다.
엑소좀은 생체막을 구성하는 지질 이외에도 여러가지 단백질 성분을 가지고 있고, 자연적으로 세포 내에서 물질을 교환하는 수단으로 사용되는 것이기에 보다 효율적인 물질전달이 가능하다. 또 면역 유도나 독성이 덜할 것으로 기대되고 있다.
사실상 거의 모든 포유류 세포가 엑소좀을 방출한다고 알려져 있다. 30 ~ 200 nm 크기를 가지는 엑소좀의 외부는 막단백질과 함께 인지질 이중층으로 구성되며, 내부에는 단백질 및 mRNA, miRNA, non-coding RNA 등이 포함돼 있다. 즉, 엑소좀의 구조가 유전정보를 안정적으로 보관할 수 있다.
엑소좀은 대부분의 세포에서 분비되는 30 ~ 200 nm 크기의 생체 나노입자로, 분비세포의 단백질과 유전정보 등을 포함하고 있다. 엑소좀은 인접 세포 또는 원거리 세포에 정보를 전달하고 세포주변 미세환경을 조절하는 매개체로 밝혀졌다.
기존 약물전달시스템은 인위적으로 합성한 물질들이 주로 이루었기 때문에 생물학적 이질성으로 인해 수용 세포 흡수 및 뇌혈관장벽(BBB) 통과에 한계가 있었다. 반면, 엑소좀은 우리 몸의 세포에서 생성되기에 생체적합성이 우수하고 세포 독성이 낮아 면역 거부 반응이나 기타 합병증을 유발하지 않는다.
엑소좀은 약물의 내부 탑재가 수월하다는 장점이 있다. 나아가, 엑소좀은 세포막과의 융합을 통해 정보를 전달할 수 있다. 이 방법으로 세포에 전달된 유전정보 및 약물이 세포 내 소화기관에 의해 분해되는 것을 줄일 수 있다.
본 발명은 암 발생 촉진 유전자인 Galectin-3에 대한 안티센스 올리고뉴클레오타이드를 세포 유래 자연 또는 인공 나노소포체에 탑재하여 항암 약물로 개발하는 방법을 제공하고자 한다.
본 발명의 제1양태는 안티센스 올리고뉴클레오타이드(anti-sense oligonucleotide, ASO) 기반 약물을 탑재시킨 세포 유래 자연 또는 인공 나노소포체를 함유하는 것이 특징인 약학 조성물을 제공한다.
본 발명의 제2양태는 Galectin-3 표적 핵산 약물이 탑재된 세포 유래 자연 또는 인공 나노소포체를 함유하는 약학 조성물을 제공한다.
본 발명의 제3양태는 핵산 기반 약물이 탑재된 세포 유래 자연 또는 인공 나노소포체를 함유하는 것이 특징인 구강 또는 비강 흡입 (Inhalation)용 또는 정맥주사용 약학 조성물을 제공한다.
본 발명의 제4양태는 핵산 기반 약물이 탑재된 제대혈 줄기세포 유래 자연 또는 인공 나노소포체를 함유하는 것이 특징인 암 예방 또는 치료용 약학 조성물을 제공한다.
본 발명의 제5양태는 Galectin-3 코딩 서열(coding sequence, CDS) 내 염기서열을 사용하여 설계된 것이 특징인 Galectin-3 표적화 안티센스 올리고뉴클레오타이드(anti-sense oligonucleotide, ASO)를 제공한다.
이하, 본 발명을 설명한다.
엑소좀 치료제는 모세포를 꼭 빼닮은 엑소좀 자체를 치료제로 개발하는 방식, 엑소좀을 약물전달시스템(DDS)에 활용하는 방식 등이 있다. 한편, 줄기세포가 가진 재생능력은 엑소좀에 의한 것이다. 줄기세포 유래 엑소좀은 줄기세포에 비해 치료제로서 많은 강점을 가진다. 우선 살아 있는 세포가 아니므로, 오래 보관하고 운송하기 용이하다는 점이 있다. 또 분열하지 않기 때문에 종양 및 감염 발생 우려가 낮다. 효능이 비슷하다면 치료제로 개발하기가 훨씬 용이하다.
Galectin은 1970년대 동물로부터 분리되었으며 lectin family에 속한다. 지금까지 총 15개의 아종(subtype)이 밝혀져 있으며 cell-cell 혹은 cell-matrix interaction을 유도하여 세포 내 다양한 신호 전달에 관여한다. Galectin의 발현은 세포사멸, 배아의 발생, 염증 반응, 암 발생 등에 영향을 미친다. 그 중에서도 Galectin-3의 경우 비소세포폐암 조직에서 높게 발현하면서 암 조직 내에서 암세포의 성장을 촉진시키고 면역 반응을 억제함으로써 암의 전이를 촉진하는 것으로 알려져 있다(도 17).
통상 유전자 치료는 표적 세포에 DNA 단편, miRNA, siRNA 및 lncRNA를 도입하여 비정상적인 유전자 발현을 되돌리고, 자살 유전자의 발현을 유도하고, 면역 반응을 조절하고, 혈관 신생을 억제하는 것을 포함한다.
도 12에 도시된 바와 같이, 안티센스 뉴클레오타이드는 특정 유전자의 염기서열에 부착하여 유전자의 기능 상실을 유도하는 기전으로 작용하여 타겟팅이 가능한 장점을 가지고 있다. 그러나, 도 13에 도시된 바와 같이, 단일 가닥(single strand)이라는 구조적 특성상 단독 처리 시 약물의 안정성이 떨어져 범용적 약물로 활용하는 데에 한계가 있을 뿐만 아니라, 현재의 ASO 전달 방법을 통해서는 대부분의 조직 및 세포 유형들에서 세포 내로 전달될 수가 없다.
상기 문제점을 해결하기 위해, 본 발명은 이러한 안티센스 뉴클레오타이드를 자연 나노소포체인 엑소좀이나 세포를 압출 분쇄한 인공 나노소포체에 탑재함으로써, 약물의 안정성을 높여 정상적으로 암세포의 증식과 이동을 억제시키는 효과가 있음을 확인하였다. 일례로, 본 발명은, Anti-sense oligonucleotide(ASO)를 활용한 유전자 타겟 약물을 개발하여 비소세포폐암의 증식과 전이에 관여하는 유전자인 Galectin-3의 발현 억제 시 효과를 확인하였다. 즉, 암세포 증식 및 전이 억제 약물로써의 Galectin-3 ASO 기능을 확인하였으며, Galectin-3 ASO의 나노소포체(엑소좀과 인공 나노소포체 포함) 내 탑재 가능성을 확인하였다. 더불어 기존 항암제와 병용 투여했을 때 감수성을 증가시켜 암세포의 사멸을 보다 효과적으로 유도하는 효능이 있음을 확인하였다. 따라서, 본 발명을 통해 나노소포체 탑재 안티센스 올리고뉴클레오타이드를 활용한 항암제를 생산할 수 있을 뿐만 아니라, 기존 항암제와의 병용 투여 약물로써 사용가능 하다.
요컨대, 본 발명은 핵산 전달 시스템으로서 바이러스 벡터 대신 세포 유래 나노소포체를 사용하고/하거나, 이로 인해 다양한 핵산 기반 약물뿐만 아니라 특히 ASO 기반 약물도 높은 생체 이용률로 사용할 수 있다는 것이 특징이다. 본 발명은 세포 유래 자연 또는 인공 나노소포체에 핵산 기반 약물을 탑재시킴으로써, 핵산 기반 약물을 세포내 액으로 분포(Distribution)시킬 수 있다. 또한, 본 발명에 따라 표적 세포로의 치료 핵산 전달을 위한 도구로 세포 유래 나노소포체를 사용하면, 치료 효능을 개선하고 부작용을 피할 수 있다.
본 발명은, 핵산 전달 시스템으로서 세포 유래 자연 나노소포체 뿐만 아니라, 인공 나노소포체를 사용할 수 있다.
세포 유래 나노소포체 제형의 신뢰성(Reliability), 재현성(reproducibility), 기증자-기증자 변형(donor-donor variations) 및 모세포의 고유 특성 반영 등은 중요한 관심사이므로, 줄기세포를 모세포로 활용 시 제대혈 줄기세포 유래 자연 또는 인공 나노소포체를 사용하는 것이 바람직하며, 재생 촉진이라는 줄기세포 고유 특성이 암세포의 증식에 영향을 미칠 경우 줄기세포 외 치료하고자 하는 질환에 적합한 세포를 활용하는 것이 바람직하다.
줄기세포 엑소좀 자체는 다른 세포의 증식과 이동을 촉진시키는 효능이 있어 암세포의 증식과 이동도 촉진시킨다. 그럼에도 불구하고, 놀랍게도 제대혈 줄기세포에서 유래한 엑소좀 단독 처리시 암세포의 증식능 및 이동능이 커지는 것과 달리, 제대혈 줄기세포에서 유래한 엑소좀과 암세포의 증식능 및 이동능을 억제하는 항암 물질과 병용 투여시 암세포의 증식과 이동이 감소하는 것을 발견하였다(도 8 및 도 9).
제대혈 줄기세포에서 유래한 엑소좀에 포함된 항염 물질은 타 조직 유래 엑소좀의 5배에 달하는 것과 관련 있다고 유추된다. 염증세포들이 분비하는 염증성 물질들이 암세포의 증식, 생존 및 전이 유도와 밀접한 관계에 있으며, 종양의 미시적 환경에서 염증은 종양을 촉진하는 효과를 가지며, 암세포의 생존과 증식을 도울 뿐만 아니라 혈관 생성과 전이를 촉진하며, 적응면역반응을 파괴하고 호르몬과 약물에 대한 반응성을 변화시키기 때문이다.
따라서, 상기 발견에 기초하여, 본 발명에 따라 제대혈 줄기세포 유래 자연 또는 인공 나노소포체는 암 예방 또는 치료용 약학 조성물에 사용될 수 있으며, 암 예방 또는 치료용 약물전달시스템(DDS)로 사용할 수 있다.
본 명세서에서, 세포 유래 자연 나노소포체는 세포외소포체(Extracellular Vesicles) 또는 엑소좀(exosome, 30~200nm 크기의 세포외소포체)로 혼용하여 지칭되어 있다.
[세포외소포체(Extracellular Vesicles)]
세포외소포체는 세포 간 정보교환을 위해 모든 세포가 외부 환경으로 분비하는 지질 이중층으로 둘러 쌓인 나노 크기의 소포체이다.
세포외소포체는 막과 내강이 존재하고 세포와 동일한 막 위상(membrane topology)을 갖고 있기 때문에 유전자 조작을 통해 다양한 막 단백질을 발현시킬 수 있고, 타겟 세포나 조직으로 비교적 정확하게 약물을 전달할 수 있다. 또한, 세포외소포체의 막과 내강에 다양한 약물을 탑재할 수 있다. 내강에 약물을 탑재하는 경우 안전하게 타겟 세포로 전달할 수도 있다. 세포와 동일한 막을 가지기 때문에 막융합을 통해 내강의 약물로 전달이 가능하다.
세포외소포체의 치료적 사용에서 가장 큰 장점 중 하나는 저 등급 면역원성에서 비롯된다. 세포외소포체는 세포에서 유래했기 때문에 면역원성이 낮다. 예를 들어, 중간엽 줄기세포 (MSC)에서 파생된 세포외소포체는 면역원성의 위험이 매우 낮은 것으로 알려져 있다. 따라서, 세포외소포체의 수명을 늘리고 탑재된 약물의 생체 이용률을 높이는데 기여한다. 또한, 크기 때문에 혈액 뇌 장벽(Blood brain barrier)까지 통과 가능하여 체내 모든 조직으로 이동이 가능하다.
세포외소포체는 단백질, 지질, 핵산, 대사물질(metabolites) 등 생물학적 활성을 보이는 다양한 물질을 포함하고 있고, 유래하는 세포들의 종류, 상태에 따라 그 구성 성분이 다르다. 세포외소포체에서 공통으로 검출되는 구성 성분도 있지만, 세포 종류 특이적으로 검출되는 구성 성분도 존재한다.
포유류 세포 유래 세포외소포체에는 유래하는 세포에 비해서 phosphatidylserine, cholesterol, sphingomyelin, GM3 ganglioside가 많이 있다. 세포외소포체에 존재하는 지질은 세포외소포체의 생성과 안정성, 기능에 기여한다. Phosphatidylserine은 세포외소포체가 생성되는 데 관여하고, cholesterol, sphingomyelin, GM3 ganglioside는 전체적으로 세포외소포체의 안정성을 높인다. 또한, 암세포에서 유래하는 세포외소포체는 sphingomyelin을 통해 혈관 신생을 촉진함이 알려져 있다.
세포외소포체에는 mRNAs와 miRNAs 외에도 rRNAs, tRNAs, DNAs도 존재하는 것이 알려져 있다. 세포외소포체에는 유래하는 세포와 비슷한 정도로 존재하는 RNAs도 있지만, 유래하는 세포에 비해 세포외소포체에 많이 존재하는 특정한 RNAs도 있기 때문에, RNAs도 단백질과 마찬가지로 조절되는 기작을 통해 세포외소포체를 구성하게 됨을 추정할 수 있다.
세포외소포체는 생리적 기능을 수행하고, 특정 세포나 조직으로 전달할 수 있도록 할 수 있기 때문에 질병 치료제, 약물 전달, 백신으로 활용할 수 있다.
세포외소포체는 살아있는 세포가 아니기 때문에 오래 보관하고 운송할 수 있다. 그리고, 분열하지 않기 때문에 포유류 유래 세포외소포체의 경우 종양 발생 우려가 낮다.
세포외소포체 흡수는 테트라 스파닌, 피브로넥틴, 프로테오글리칸과 같은 막 단백질로 인해 매우 효율적이지만 표적 세포에 따라 맞춤화 할 수도 있다.
혈관 세포 부착 분자 1- 및 인테그린 α4가 풍부한 세포외소포체는 내피 세포(endothelial cells)를 통한 나노소포체 도킹 및 흡수를 향상시킨다.
세포외소포체는 크기가 작기 때문에 트랜스 사이토시스(transcytosis, endocytosis followed by multivesicular body formation and release on the other side) 또는 내피 세포 사이의 접합부를 통해 양방향 방식으로 혈액-뇌 장벽을 통과할 수 있다.
세포-세포 통신에서 세포외소포체의 타고난 고유한 특성은 핵산 전달 시스템으로서 유용하다. 세포외소포체 매개 수송은 매우 효과적인 것으로 보이며, 더 많은 양의 치료제를 종양으로 방출할 수 있어 혈액 내 양을 줄이고 부작용을 줄일 수 있다. 세포외소포체는 치료제를 전달하는데다 기능적 유용성을 가지고 있다. 세포 표면의 수용체를 활성화하고, 세포질 내부에 내용물을 전달하고, 내부에 친수성 분자를 전달하고, 지질 이중층에 있는 친유성 분자 및 표면 상의 양친매성 분자를 전달함으로써 다양한 양식을 통해 신호를 보낼 수 있다.
[세포 유래 자연 또는 인공 나노소포체 (exosomes + artificial nanovesicles) 준비]
자연 또는 인공 나노소포체는 세포에서 분비 또는 준비된 것일 수 있다.
나노소포체(Nanovesicle)은 직경이 나노미터 단위의 주머니 형태의 물질에 대한 표현이다. 나노소포체의 대표적인 물질로 엑소좀(exosome)을 들 수 있으며, 세포치료제를 대체할 수 있는 생체 친화적 약물 전달체로 각광받고 있다.
자연적으로 분비되는 엑소좀의 양이 제한적이어서, 생산성이 떨어진다. 엑소좀의 분리,정제 기술을 개발해 수율을 높이거나 배양 조건을 달리해 증식 속도를 높이는 등의 접근법이 있다.
인공 나노소포체는 세포로부터 인공적으로 만든 엑소좀으로서, 자연적으로 분비되는 엑소좀에 비해 생산성이 훨씬 높다.
엑소좀을 분리하는 방법으로는 Ultracentrifuge, Ultrafiltration, Chromatography 등의 방법이 존재하며 분리 방법에 따라 엑소좀의 기능적 특성, 순도, 농도, 크기가 달라지게 된다.
성체줄기세포에서 분비되는 엑소좀은 주변 세포의 재생과 항염 효과에 우수한 효능을 보이는 많은 연구가 진행되어 있다.
대규모 생산 나노소포체 기반 제형은 임상 해석(clinical translation)의 성공에 중요하다. 그런데, 자연적으로 분비되는 세포외소포체의 양은 제한적이기 때문에, 세포외소포체 모사체로 인공 나노소포체를 이용한 치료가 시도되고 있다. 인공 나노소포체는 세포 자체를 분쇄하여 엑소좀 형태로 만든 것으로 엑소좀의 가장 큰 단점인 양산의 문제를 해결하고 더불어 나노소포체를 형성하는 과정 중에 약물을 효율적으로 탑재할 수 있는 장점이 있다.
인공 나노소포체 생산 방법은 다공성막(porous membrane)을 활용한 순차적 압출(serial extrusion) 혹은 반복적 압출(repetitive extrusion) 방식이 있다. 또한, 본 발명은 고압분산기(High Pressure Homogenizer) 혹은 고압균질기(Nano Disperser)를 활용하여 인공 나노소포체를 생산할 수 있다.
보통 작은 세포의 직경은 20 um 전후로 체내에서 이동이 제한적이다. 하지만 엑소좀의 경우 고유의 작은 크기의 특성으로 뇌혈관막까지 통과가 가능하여 내부 유효성분을 체내 모든 곳에 전달할 수 있는 장점을 가지고 있다. 따라서, 세포 자체를 활용하여 엑소좀 크기로 분쇄하게 되면 세포 내 효능 성분을 고함량으로 포함하면서 체내 모든 부위에 도달할 수 있는 특장점을 확보할 수 있다.
게다가, 유기체의 기본 구조 및 활동 단위인 세포는 체외(in vitro)에서 배양할 수 있으며, 약학, 조직공학, 치료제 개발에 사용될 수 있다. 세포는 주변 환경에 따라 적응하는 특성이 있기 때문에 동일한 세포 종이라 할지라도 배양 환경에 따라 세포의 접착력, 성장, 이동, 분화 등이 달라질 수 있다. 나아가, 재생의학(regenerative medicine) 분야와 관련하여 최근 큰 주목을 받고 있는 줄기 세포는 배양 시 적절한 자극을 인가함으로써 원하는 세포로의 분화(differentiation) 및 성장 촉진을 유도할 수 있다. 또한, 인공 나노소포체는 해당 인공 나노소포체가 유래된 세포의 다양한 분자 구성성분들(예, 단백질들 및 RNA)을 함유한다. 따라서, 인공 나노 소포체 내 단백질 조성은 해당 인공 나노소포체가 유래된 세포의 배양조건(예, 배양 시 세포가 받은 분자 신호)에 따라 다양하게 조절할 수 있다.
예컨대, 본 발명에 따라 줄기세포로부터 생산된 인공 나노 소포체는 특유의 지질 이중층 구조로 나노사이즈의 인공 나노소포체도 다량으로 제공할 수 있으며, 인공 나노소포체 내에 다양한 성장인자를 다량 함유하고 있기 때문에 섬유아세포의 증식과 활성화를 통한 조직 재생 및 항노화 효과, 콜라겐합성 증가 및 상처치유 효과를 발휘할 수 있다.
[약물의 탑재 방법]
나노소포체 안에 약물을 탑재하는 방법은 크게 세가지로 구분할 수 있다.
첫번째는 초고속원심분리기(ultracentrifuge)를 활용하는 것으로 용매 안에 있던 약물이 원심력에 의해 소포체 안으로 유입되도록 유도하는 방식이다.
두번째는 전기자극(electroporation)을 활용한 것으로 순간적으로 막(membrane) 바깥의 전하는 음성으로 막 안쪽의 전하는 양성이 되도록 유도했을 때 막에 구멍이 생기고 구멍을 통해 약물이 소포체 안으로 유입 되는 방식이다.
세번째 방법으로 세포가 분쇄되었다가 다시 구형을 형성하는 과정에서 현탁액 안에 부유하고 있던 약물이 자연스럽게 소포체 구형 안에 함입되는 방식을 활용한 것이다.
인공 나노소포체는 자연적으로 분비되는 세포외소포체보다 수율이 훨씬 높고, 약물 전달 효율은 유사하다.
[단일가닥 Anti-Sense Oligonucleotide (ASO)의 변형]
본 발명에서, 안티센스 올리고뉴클레오타이드(anti-sense oligonucleotide, ASO) 기반 약물은 염기서열 중 적어도 하나의 염기(base) 일부 또는 모두가 phosphorothioate 및/또는 2'-O-methyl 기로 수정된 ASO 기반 약물을 포함할 수 있다.
도 12에 도시된 바와 같이, ASO는 특정 유전자의 mRNA 염기서열에 ASO의 DNA 염기서열이 타겟하여 해당 부위의 분해를 유도함으로써 해독(translation) 과정이 진행되지 않아 기능 상실을 유도한다. 1978년 처음 기능이 밝혀진 이후 현재까지 ASO를 기반으로 한 4조의 약물이 미국 FDA로부터 승인을 받은 바 있다. 하지만 8~50 base pair의 nucleotide 구조상 체내 안전성이 미약하여 약물로써의 효능 대비 활용도가 낮은 단점이 있다.
단일 가닥 ASO 분야는 1978 년 phosphodiester 골격을 가지는 ASO의 합성으로 시작되었다. 불행히도, phosphodiester 결합은 높은 전하를 가지며 친수성이고 핵산 분해효소에 의해 쉽게 분해된다. 인산염 그룹 중 하나의 산소가 황 원자로 치환된 모노뉴클레오타이드 (phosphorothioate)로 변형하면 인산디에스터 분해효소 (phosphodiesterases)에 대한 저항성을 크게 증가시키고 소수성을 증가시킬 수 있다. 1984 년에 최초의 완전 phosphorothioate ASO를 합성하여 안정성과 전달 가능성을 극적으로 향상시켰다.
ASO의 효능 및 약리학적 특성을 향상시키기 위해 2' hydroxyl (OH)를 화학적으로 변형시킬 수 있다. 이는 표적 mRNA에 대한 결합 친화성을 증가시키고, 이에 따라 ASO의 전체 길이를 감소시킬 수 있다.
두 가지 대안적인 안티센스 화합물 접근법은 전하가 걸린 phosphate 결합과 리보오스 당골격을 중성 phosphorodiamidate morpholino oligomer (PMO) 또는 peptide nucleic acid (PNA) 골격으로 대체하여 올바른 핵 염기 간격을 유지하는 것이다. 그 결과로 표적 mRNA에 선택적이고 강하게 결합하는 고도로 안정화된 분자가 된다. 그러나 PMOs 와 PNAs는 phosphodiester 골격이 없기 때문에 RNase H (유전자 억제에 필요함)를 활성화시킬 수 없으며, 대신에 입체 차단제(Steric blocker)와 엑손 건너뛰기를 위한 SSO 로 사용될 수 있다.
[핵산 기반 약물]
본 발명의 세포 유래 자연 또는 인공 나노소포체에 탑재되는 핵산 기반 약물은 전술한 ASO 외에도, mRNAs, miRNAs, rRNAs, tRNAs, DNAs일 수 있다.
ASO, miRNA에 비해 크기가 큰 mRNA를 엑소좀에 봉입하기가 쉽지 않다. 그러나, 인공 나노소포체의 경우 소포체 크기를 쉽게 조절할 수 있기 때문에 비교적 수월하게 mRNA를 소포체 내부에 탑재할 수 있다.
본 명세서에서, 핵산 기반 약물은 자연 또는 인공적으로 합성된 핵산 뿐만 아니라 변형 핵산도 포함한다.
본 발명의 세포 유래 자연 또는 인공 나노소포체를 통해 전달되는 mRNAs는 표적 세포에서 해당 mRNAs가 암호화하는 단백질의 발현을 증가시킬 수도 있으며, miRNAs가 전달될 경우, 표적 세포에서 해당 miRNAs가 표적으로 하는 mRNAs의 발현이 감소하기도 한다.
RNA 기반 치료법은 표적 RNA 나 DNA에 대한 높은 선택적 특이성으로 인해, 약물 적용이 되지 않는 인간 및 바이러스 유전자의 발현 억제, mRNA의 splicing 조절, 후성유전 조절에 관여하는 비암호화 RNAs(ncRNA) 표적, 표적 유전자의 증가, 유전자의 발현 그리고 유전체 교정 등의 작업을 선택적으로 가능하도록 해준다. 이러한 부분들은 저분자 억제제나 항체를 통해 실현될 수 없었던 형태의 치료적인 작용이다. 또한 RNA 기반 치료법은 암 돌연변이 및 전염병 바이러스 감염과 속도를 맞출 수 있는 발전 능력을 가진 유일한 방법이다. 2 세대 RNA 화학 기술들은 RNA 치료제의 안정성을 크게 향상시키고, 의도하지 않은 부작용을 감소시키며, 표적을 향한 약리 활성을 최대화시킨다.
[탑재 약물의 종류 (핵산 기반 약물 및 기존 항암제)]
전술한 핵산 기반 약물 이외 추가로 나노소포체에 탑재 가능한 약물은 종류에 제한을 두지 않는다. 기존에 전통적으로 활용해 온 cisplatin이나 5-FU와 같은 화학항암제와 함께 Galectin-3 외의 암 관련 유전자를 타겟으로 하는 ASO의 탑재도 가능하다. 이미 광범위한 체외 실험을 통해 효능이 입증된 특정 유전자 타겟 siRNA도 활용 가능하다. 더불어 유전자의 발현을 조절하는 miRNA 계열의 탑재 또한 가능하다.
예컨대, 엑소좀에 특정한 유전자의 발현을 엑제하기 위한 짧은 간섭 RNA(siRNA) 혹은 miRNA를 인위적으로 도입한 후, 엑소좀을 약물전달체로 사용할 수 있다. 예컨대, 암 유전자인 KRAS(G12D)를 타게팅하는 siRNA를 중간엽 줄기세포 유래의 엑소좀에 전기충격법으로 도입할 수 있다.
특정한 세포에 특이적으로 엑소좀을 전달하거나 엑소좀 내에 특정한 mRNA를 넣으려는 경우, 유전자 조작된 세포를 기반으로 엑소좀을 만들 수 있다. 예컨대, 유방암 세포에 엑소좀을 특이적으로 전달하기 위해 유방암 세포의 마커인 '인테그린 αV'에 결합하는 펩타이드가 융합된 단백질을 엑소좀에 넣고, 엑소좀에 독소류비신과 같이 암세포를 죽일 수 있는 약물을 넣거나, mRNA를 엑소좀에 패키징하기 위해 엑소좀 마커 단백질인 CD63에 RNA 결합 부분을 융합해 특정한 Mrna를 엑소좀을 통해 전달하는 등과 같은 것이 있다.
[나노소포체의 세포 기원 및 제대혈 줄기세포]
본 발명의 자연 또는 인공 나노소포체의 세포 기원은 수지상 세포, 망상 적혈구, 적혈구, 단핵구, 대식세포에서 중간엽 줄기세포(MSC) 및 인간 iPSC를 포함하여 유전자 조작을 통해 영구 계대가 가능한 세포주(예, HEK293 세포 등)에 이르기까지 다양하다. MSC는 임상 시험을 위해 본 발명의 자연 또는 인공 나노소포체 생산의 주요 원천이다. MSC 파생 세포외소포체는 환자에게 쉽게 확장 가능하고 안전할 수 있다.
줄기세포의 종류로는 배아줄기세포, 성체줄기세포, 역분화 줄기세포가 있으며, 이들 중 성체줄기세포는 혈액, 골수, 지방 등에서 추출하여 배아줄기세포와 달리 윤리적인 문제에서 자유롭다.
성체줄기세포는 필요한 때에 특정한 조직의 세포로 분화하게 되는 미분화상태의 세포이다. 성체줄기세포는 중간엽 줄기세포, 중간엽 기질세포(mesenchymal stromal cell) 또는 다분화능 줄기세포일 수 있으며, 이에 제한되지 않는다.
중간엽 줄기세포(Mesenchymal stem cell)는 표피세포성장인자(Epithelial growth factor), 섬유아세포성장인자(Fibroblast growth factor)와 같은 다양한 성장인자(growth factor)와 사이토카인을 분비하여 섬유아세포로부터 콜라겐, 파이브로넥틴, 엘라스틴의 생성을 촉진시켜 재생에 중요한 역할을 한다.
중간엽 줄기 세포 (MSC)는 뉴런 세포, 지방세포, 연골세포, 조골 세포, 근육 세포, 심장 조직, 및 다른 내피 또는 상피 세포로 분화될 수 있는 능력을 갖는 전구 세포이다. 이들 세포는 유전자 또는 단백질 발현에 의해 표현형적으로 정의될 수 있다.　따라서, MSC는 그들의 분화 잠재력에 따라 표현형적으로 및/또는 기능적으로 특징지을 수 있다. MSC는 골수, 혈액, 골막, 진피, 제대혈 및/또는 매트릭스 (예를 들어, 와튼 젤리) 및 태반을 포함하나 이에 제한되지는 않는 다수의 공급원으로부터 수거될 수 있다. MSC는 조직 배양 플라스틱에 대한 부착성에 근거하여, 다수의 공급원, 예를 들어, 골수 단핵 세포, 제대혈, 지방 조직, 태반 조직으로부터 단리 될 수 있다.　
성체줄기세포는 인간 배아에서 추출한 배아 줄기세포와 달리 골수나 뇌세포 등 이미 성장한 신체조직에서 추출하기 때문에 윤리논쟁을 피할 수 있는 장점이 있다. 본 명세서에서 성체줄기세포는 제대, 제대혈, 골수, 지방, 근육, 신경, 피부, 양막 또는 태반으로부터 유래된 것일 수 있으나, 이에 제한되지 않는다.
중간엽 줄기세포(mesenchymal stem cells)나 수지상세포(dendritic cell)에서 생성되는 엑소좀은 그 자체만으로 생리적인 활성을 가지고 있어서 치료 목적으로 이용이 모색되고 있다.
특히 손상된 조직의 복구나 재생 활성을 보이는 중간엽 줄기세포의 활성은 중간엽 줄기세포 자체보다는 중간엽 줄기세포에서 엑소좀을 통해 전달되는 성장인자 등에 의한 것으로 알려져 있다. 중간엽 줄기세포 유래의 엑소좀은 조혈모세포 이식에서 발생하는 부작용인 이식편대숙주질환(Graft-versus-host diseases) 등의 치료에 효과적이라는 보고가 나온 적이 있다.
골수, 지방 유래 줄기세포의 경우 공여자로부터 침습적인 방법으로 추출되는 반면, 제대혈 줄기세포의 경우 출산 후 폐기되는 제대혈에서 추출하여 공여자에게 침습적인 방법을 사용하지 않으며 공여자 간의 제대혈 줄기세포 효능 차이가 작은 장점이 있다.
본 발명의 자연 또는 인공 나노소포체 생산을 위해 줄기세포를 활용할 경우 제대혈 줄기세포에서 분비 또는 준비된 것일 수 있다. 제대혈 유래 줄기세포는 지방 또는 골수 유래 성체줄기세포와는 달리 공여자의 임신주기(40주) 동안 형성된 제대혈을 사용하기 때문에 공여자의 상태에 따른 효능차이가 발생하지 않는다는 장점이 있다.
제대혈 중간엽 줄기세포(UCB-MSC)는 EGF, VEGF, TGF, HGF, FGF, IGF 및 PDGF 등의 다양한 성장 인자들을 함유하고 있다. 따라서, 제대혈 중간엽 줄기세포에서 생산된 인공 나노 소포체에 담지되어 있는 EGF 등의 성장 인자는 섬유아세포의 증식을 촉진하며, 세포의 이동 및 콜라겐 합성 등을 촉진한다.
성체 줄기세포를 얻을 수 있는 조직(지방, 골수, 제대혈) 중 제대혈에서 분리한 엑소좀은 재생 인자와 항염 인자를 가장 많이 함유하고 있다. 제대혈 줄기세포에서 유래한 엑소좀에 포함된 항염 물질은 타 조직 유래 엑소좀의 5배에 달한다.
[핵산 기반 약물 탑재된 나노소포체의 제형]
본 발명에 따라 생산되는 나노소포체는 사용 목적에 따라 다양하게 제형화 할 수 있다. 본 발명에 따른 핵산 기반 약물이 탑재된 세포 유래 자연 또는 인공 나노소포체의 제형은 그 특성을 크게 변경하지 않고 농축, 겔화(gelation), 동결 건조 및 수용액에서 재구성할 수 있다.
약물 나노 제형은 질병 부위에 치료제를 효율적으로 전달할 수 있는 놀라운 가능성을 갖고 있다. 불행히도 인공 나노 캐리어, 대부분 리포솜 및 고분자 나노 입자는 불리한 약동학 및 망상 내피 시스템 (reticuloendothelial system, RES)에 의한 혈액 순환으로부터의 빠른 제거로 인해 제한된 응용을 보여준다. 게다가, 그들 중 많은 것들은 높은 세포 독성, 낮은 생분해성, 그리고 혈액 뇌 장벽을 포함한 생물학적 장벽을 넘지 못한다.
본 발명에서 약물 전달 시스템으로 사용하는 세포 유래 자연 또는 인공 나노소포체는 높은 생체 이용률, 탁월한 생체 적합성 및 낮은 면역원성을 가진다.
본 발명에서 약물 전달 시스템으로 사용하는 세포 유래 자연 또는 인공 나노소포체는 이에 탑재한 핵산 기반 약물을 표적 조직, 세포 및 기관으로 전달할 수 있다. 본 발명의 세포 유래 자연 또는 인공 나노소포체는 인공 나노 캐리어와 유사하게 안정성 및 용해도와 같은, 유리된 핵산 기반 약물의 기본 특성을 개선하고 혈류의 분해로부터 핵산 기반 약물을 보호할 수 있다. 또한, 세포밖에 있는 분해효소로부터 보호할 수 있다.
본 발명의 세포 유래 자연 또는 인공 나노소포체의 막은 상대적으로 단단한 지질 이중층이므로 통합된 핵산 기반 약물의 지속적이고 장기간 방출을 제공할 수 있다. 또한, 대부분의 합성 나노 캐리어와 달리 본 발명의 세포 유래 자연 또는 인공 나노소포체는 혈액 뇌 장벽 (BBB)을 포함한 생물학적 장벽을 통과할 수 있어 신경 퇴행성 질환 치료에 특히 유용하다.
더욱이, 본 발명의 세포 유래 자연 또는 인공 나노소포체는 낮은 면역원성과 낮은 세포 독성을 가지고 있다. 따라서, 본 발명의 세포 유래 자연 또는 인공 나노소포체는 분리된 자가 세포로 준비하는 것도 바람직하다.
본 발명의 세포 유래 자연 또는 인공 나노소포체는 특정 세포 유형 또는 염증 조직으로의 이동을 가능하게 하는 조직 향성을 발휘하도록 설계할 수 있다. 본 발명의 자연 또는 인공 나노소포체는 그 기원, 즉 모세포를 반영하는 고유한 생물학적 활성을 가질 수 있으며, 이는 통합된 핵산 기반 약물에 추가 치료 효능을 제공할 수 있다.
다양한 유형의 세포에서 분비/준비되는 자연 또는 인공 나노소포체의 생물학적 활동은 방대하고 유망하다. 그러나, 제형의 신뢰성(Reliability), 재현성(reproducibility) 및 기증자-기증자 변형(donor-donor variations)이 중요하므로, 본 발명의 세포 유래 자연 또는 인공 나노소포체는 치료하고자 하는 질환의 특징에 맞게 준비된 것이 바람직하다.
[폐포의 구조 및 투여경로]
도 15에 도시된 바와 같이, 호흡계(respiratory system)의 주기능은 산소가 포함된 혈액을 온 몸으로 공급하여 산소를 전달하는 것이다. 호흡작용은 입, 코, 기관, 폐, 횡격막을 통해 일어난다. 먼저 산소가 코와 입을 통해 호흡계로 들어오게 되고, 후두와 기관을 통해 흉강으로 들어간다. 흉강 안에서 기관은 기관지라고 부르는 두 개의 더 작은 관으로 나누어진다. 각 기관지는 더 나누어지면서 나뭇가지 같은 형태를 이룬다. 폐 안으로 직접 들어가는 기관지는 다시 아주 많은 세기관지로 나누어지고, 그 끝에 폐포(alveoli)라 부르는 아주 작은 주머니와 연결된다.
성인남성은 모세혈관을 둘러싸인 공기주머니인 폐포를 600만개 정도 가지고 있다. 폐포의 총 단면적은 70~90m2으로 우리 몸의 총피부 단면적의 50배 정도가 된다.
도 16에는 폐포의 구조가 도시되어 있다. 폐포세포(Type II alveolar cell)에서 분비되는 인지질과 단백질의 조합물인 폐의 표면활성제(pulmonary surfactant)는 물 분자 사이의 수소결합력을 약화시켜 표면장력을 충분하게 낮추기 때문에 표면장력은 보통 폐포의 붕괴를 일으키지 않게 한다.
한편, 상피조직의 기능은 기관의 내면과 표면을 둘러싸는 것이다. 상피조직은 층상 배열 세포들이 한 층 또는 여러 층으로 조밀하게 배열한 것으로, 상피조직은 기관을 둘러싸거나 속이 빈 기관이나 체강의 내면을 싸고 있다. 상피조직은 항상 몸의 바깥쪽이나 체강의 안쪽에 노출된 정단면을 가지며, 반대편인 기저면은 비세포성 물질인 기저막에 의해 다른 조직과 이어진다.
상피조직은 하나의 조직을 다른 조직과 구분하고, 몸을 외부 환경과 구분하는 덮개를 제공한다. 상피조직의 구조는 기능과 밀접한 관계를 가진다.
예컨대, 심장 및 혈관의 내면, 폐의 폐포, 신장의 사구체의 경우, 편평한 세포들이 단층배열한 단층 편평상피조직으로, 여과, 확산기능을 수행하며, 폐의 폐포 상피조직은 기체교환이 쉽게 이루어지도록 매우 얇다(도 16).
따라서, 도 16에 도시된 바와 같이, 본 발명에 따라 핵산 기반 약물이 탑재된 세포 유래 자연 또는 인공 나노소포체는 입/코로 흡입하여 기관(기도)을 통해 폐포로 직접 전달될 수 있고, 정맥 투여 후 모세혈관을 통해 폐포로 전달될 수도 있다.
[타겟 세포의 증식능 및/또는 이동능 억제]
암이란 몸 속의 정상적인 세포가 돌연변이를 일으켜 발생한 이상세포(암세포)들의 집단이다. 암세포는 인간의 몸에 갖추어져 있는 정상적인 조절 기구의 통제에서 벗어나, 무질서하게 증식한다. 또한, 다른 장기(정상 조직)로 전이되어 증식을 반복하고, 결국 그 장기(조직)의 기능을 훼손시켜 버린다.
본 발명에 따라 핵산 기반 약물이 탑재된 세포 유래 자연 또는 인공 나노소포체는 타겟 세포, 특히 암세포의 증식능 및/또는 이동능을 감소시킬 수 있을 뿐만 아니라, 구강 또는 비강을 통한 흡입 (Inhalation) 또는 정맥 주사(intravenous injection) 투여 경로를 통해 폐암, 흡입을 통한 폐암, 특히 비소세포폐암을 집중적으로 예방 또는 치료할 수 있다.
[구강 또는 비강을 통한 흡입 (Inhalation)]
공기 또는 다른 가스가 폐로 들어갈 때 흡입(inhalation, inspiration)이 발생한다.
구강 또는 비강을 통한 흡입 (Inhalation)은 기도점막 및 폐 상피의 거대한 표면적을 통한 약물의 신속한 흡수를 일으키며, 정맥내 주사와 거의 동일하게 신속한 효과를 나타낸다. 이 경로는 본 발명에 따라 핵산 기반 약물이 탑재된 세포 유래 자연 또는 인공 나노소포체가 작용부위에 국소적으로 직접 수송됨으로써 전신 부작용을 최소화할 수 있다. 또한, 흡입 투여경로는, 흡수가 신속하고 즉시 효과를 나타낼 수 있으므로, 용량을 적정할 수 있고, 폐를 표적으로 하는 국소효과를 나타낸다. 따라서 경구 또는 비경구 투여용량과 비교해서 보다 낮은 용량이 사용될 수 있다.
따라서, 본 발명에 따라 핵산 기반 약물이 탑재된 세포 유래 자연 또는 인공 나노소포체는 기체 상태 또는 에어로졸(aerosol)에 분산시킨 상태로 제형화할 수 있다.
입을 통해 흡입하여 투여되는 경우, 기관(기도)을 통해 폐로 전달될 수 있도록 코 경로를 통해 투여되는 경우보다 작은 비말로 분사되어야 한다. 폐 깊숙이 전달되는 정도는 비말의 크기에 따라 달라진다. 비말이 작을수록 더 깊이 전달되어 흡수되는 양이 늘어난다. 이 경우 본 발명에 따라 핵산 기반 약물이 탑재된 세포 유래 자연 또는 인공 나노소포체는 폐 내부에서 혈류로 들어갈 수 있다.
흡입은 지정된 시간 내에 적절한 양이 투여되었는지 확인하기 위해 주의 깊게 모니터링해야 하므로 이러한 방식으로 투여되는 약물은 상대적으로 적다. 또한 흡입 경로로 약물을 투여하려면 특수 장비가 필요할 수 있다. 폐에 특이하게 작용하도록 투여하기 위해, 에어로졸화　계량 용기(흡입기라 함)를 사용하거나, 가스 투여 방식을 사용할 수 있다.
한편, 흡입 경로와 유사하게, 분무로 투여하는 경우 폐에 도달할 수 있도록 작은 입자로 분사해야 한다. 분무를 위해서는 특수 기기, 가장 일반적으로 초음파 또는 제트 분무기 시스템을 사용할 수 있다. 기기의 적절한 사용은 폐로 전달되는 약물의 양을 극대화시키는 데 도움이 된다.
[정맥 주사(intravenous injection)를 통한 주입]
기존 연구 결과에 따르면 정맥주사를 통해 체내 주입된 세포외소포체는 혈류를 따라 체내에서 순환하면서 간과 폐에 도달하여 머무는 것으로 확인되었다(도 18). 따라서 세포외소포체 외부에 특이적인 조작 없이 특정 조직에 타겟팅 기능을 부여하지 않아도 자연스럽게 폐에 작용하는 기전을 활용하여 소포체 내부의 물질을 폐조직 내부에 전달하는 효과를 유도할 수 있다. 따라서, 본 발명에 따라 핵산 기반 약물이 탑재된 세포 유래 자연 또는 인공 나노소포체를 함유하는 폐암 치료제는 약물이 전신에 작용해 치료 효과가 감소하고 심각한 부작용이 발생하는 한계점을 엑소좀을 활용해 해결할 수 있다.
[약학 조성물]
약학 조성물은 제약상 허용되는 농도의 염, 완충제, 보존제, 상용성 담체 및/또는 다른 (즉, 2차) 치료제를 추가로 포함할 수 있다.
약학 조성물의 각 구성성분은 약학적으로 허용 가능한 형태이어야 한다.
약학적으로 허용되는 담체는 약학적으로 허용되는 물질, 조성물 또는 비히클, 예컨대 액상 또는 고형 충전제, 희석제, 부형제, 용매 또는 캡슐화 물질로서, 예방적으로 또는 치료적으로 활성인 작용제를 운반 또는 수송하는 데 관여한다. 각각의 담체는 제형의 다른 성분과 상용성이고 대상체에 유해하지 않다는 점에서 "허용되어"야만 한다. 제약상 허용되는 담체로서 작용할 수 있는 물질의 일부 예는 당, 예컨대 락토스, 글루코스 및 수크로스; 글리콜, 예컨대 프로필렌 글리콜; 폴리올, 예컨대 글리세린, 소르비톨, 만니톨 및 폴리에틸렌 글리콜; 에스테르, 예컨대 에틸 올레에이트 및 에틸 라우레이트; 완충제, 예컨대 수산화 마그네슘 및 수산화 알루미늄; 주사용 증류수; 등장 식염수; 링거 용액; 에틸 알콜; 인산염 완충 용액; 및 제약 제형에 이용되는 다른 비-독성 상용성 물질을 포함한다.
본 명세서에서, 약학 조성물은 폐 질환의 치료를 위해 제형화될 수 있다. 따라서, 약학 조성물은 폐 질환을 치료하기 위해 사용될 수 있는 다른 치료제 (2차 작용제)를 추가로 포함할 수 있다. 본원에 사용된 바와 같이, 치료제는 본원에 논의된 것과 같은 폐 질환의 예방, 치료 및/또는 관리에 사용될 수 있는 임의의 작용제를 지칭한다. 이들은 계면활성제, 흡입된 산화질소, 알미트린 비스메실레이트, 면역조정제 및 항산화제를 포함하나 이에 제한되지는 않는다. 면역조정제의 예는, 예컨대 메틸프레드니솔론이나 이에 제한되지는 않는, 스테로이드 및 코르티코스테로이드를 포함한다. 항산화제의 예는 슈퍼옥시드 디스무타제를 포함하나 이에 제한되지는 않는다.
폐 질환의 치료를 위해, 제2 작용제는 폐 계면활성제일 수 있다. "폐 계면활성제"는 폐기도를 개방 상태로 유지하는 데 유용한 (예를 들어, 폐포 벽이 서로 부착되는 것을 방지함으로써) 지단백질 혼합물이다. 폐 계면활성제는 인지질, 예컨대 디팔미토일포스파티딜콜린 (DPPC), 포스포티딜콜린 (PC), 포스포티딜글리세롤 (PG); 콜레스테롤; 및 단백질, 예컨대 SP-A, B, C 및 D로 구성될 수 있다. 폐 계면활성제는 자연적으로 발생하는 공급원, 예컨대 소 또는 돼지 폐 조직으로부터 유래될 수 있다. 그 예는 알베오팩트(Alveofact™) (소 폐 세척액으로부터의 것), 쿠로수르프(Curosurf™) (다진 돼지 폐로부터의 것), 인파수르프(Infasurf™) (송아지 폐 세척액으로부터의 것) 및 수르반타(Survanta™) (다진 소 폐로부터의 것; DPPC, 팔미트산 및 트리팔미틴을 포함한 부가 성분을 수반함)를 포함한다. 폐 계면활성제는 또한 합성일 수 있다. 그 예는 엑소수르프(Exosurf™) (헥사데칸올 및 티록사폴과 함께 DPPC로 구성됨), 푸막탄트(Pumactant™) 또는 인공 폐 확장 화합물 (ALEC) (DPPC 및 PG로 구성됨), KL-4 (DPPC, 팔미토일-올레오일 포스파티딜글리세롤, 팔미트산, 및 SP-B를 모방하는 합성 펩티드로 구성됨), 벤티쿠테(Venticute™) (DPPC, PG, 팔미트산 및 재조합 SP-C로 구성됨)를 포함한다. 폐 계면활성제는 상업적 공급업체로부터 수득될 수 있다.
"유효량"은 원하는 성과를 달성하는 작용제의 양이다. 절대량은 투여를 위해 선택된 물질, 투여가 단일 용량인지 아니면 다수 용량인지의 여부, 및 연령, 신체 조건, 크기, 체중 및 질환의 병기를 포함한 개별 환자 파라미터를 포함한 다양한 요인에 좌우될 것이다. 이들 요인은 관련 기술 분야의 통상의 기술자에게 널리 공지되어 있으며, 단지 일상적인 실험만으로 해결될 수 있다.
일 실시양태에서, 유효량은 대상체에게 독성을 유발하지 않는 작용제의 투여량이다. 일 실시양태에서, 유효량은 대상체에게 독성을 감소시키는 작용제의 투여량이다. 독성을 측정하는 방법은 관련 기술 분야에 널리 공지되어 있다 (예를 들어, 간, 비장 및/또는 신장의 생검/조직학; 간 독성에 대한 알라닌 트랜스퍼라제, 알칼리성 포스파타제 및 빌리루빈 검정; 및 신장 독성에 대한 크레아티닌 수준).
유효량 수준은 개체 종류 및 중증도, 연령, 성별, 질환의 종류, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료 기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 또한, 유효량은 당업자에게 인식되어 있듯이 처리의 경로, 부형제의 사용 및 다른 약제와 함께 사용할 수 있는 가능성에 따라 변할 수 있다.
"치료하다" 또는 "치료"는 질환의 발생을 예방, 감소 또는 정지시키거나, 질환의 증상을 감소 또는 제거하거나, 질환을 예방하는 것을 포함하나, 이에 제한되지는 않는다.
　대상체는 설치류, 예를 들어, 래트 또는 마우스, 개, 고양이, 말, 소, 돼지, 양, 염소, 칠면조, 닭, 및 영장류, 예를 들어, 원숭이를 포함하나 이에 제한되지는 않는, 인간 또는 척추 동물 또는 포유동물을 의미할 것이다. 본 개시내용의 방법은 치료를 필요로 하는 대상체를 치료하는 데 유용하다. 치료를 필요로 하는 대상체는 질환이 발생할 위험이 있는 대상체 (즉, 유전자 검사를 통해) 또는 질환이 있는 대상체일 수 있다.
일 실시양태에서, 핵산 기반 약물이 탑재된 세포 유래 자연 또는 인공 나노소포체를 포함하는 조성물은 볼루스 용량으로 대상체에게 투여된다. "볼루스 용량"은 치료상 유효한 수준을 달성하기 위해 별개의 양의 의약, 약물 또는 다른 화합물의 단일 투여를 지칭한다.　 일 실시양태에서, 상기 핵산 기반 약물이 탑재된 나노소포체의 2회, 3회, 4회, 5회 또는 그 초과의 투여를 포함한, 상기 핵산 기반 약물이 탑재된 나노소포체의 반복 투여가 고려된다. 일부 경우에, 상기 핵산 기반 약물이 탑재된 나노소포체는 연속적으로 투여될 수 있다. 반복 또는 연속 투여는 치료되는 병태의 중증도에 따라 수 시간 (예를 들어, 1-2, 1-3, 1-6, 1-12, 1-18, 또는 1-24시간), 수 일 (예를 들어, 1-2, 1-3, 1-4, 1-5, 1-6일, 또는 1-7일) 또는 수 주 (예를 들어, 1-2주, 1-3주, 또는 1-4주)의 기간에 걸쳐 일어날 수 있다. 투여가 반복되지만 연속적이지 않은 경우, 투여 사이의 시간은 수 시간 (예를 들어, 4시간, 6시간, 또는 12시간), 수 일 (예를 들어, 1일, 2일, 3일, 4일, 5일, 또는 6일), 또는 수 주 (예를 들어, 1주, 2주, 3주, 또는 4주)일 수 있다. 투여 사이의 시간은 동일하거나 상이할 수 있다.
핵산 기반 약물이 탑재된 나노소포체는 폐 또는 다른 조직으로의 전달을 수행하는 임의의 경로에 의해 투여될 수 있다. 전신 투여 경로, 예컨대 정맥내 대량 단일 주사 또는 연속 주입이 적합하다. 보다 직접적인 경로, 예컨대 비강내 투여, 기관지내 투여 (예를 들어, 삽관을 통함), 및 흡입 (예를 들어, 입 또는 코를 통한 에어로졸을 통함)이 고려되며, 특히 신속한 작용이 필요한 경우에 더 적절할 수 있다. 에어로졸은 기체 중의 작은 입자로서 분산된 액체의 현탁액이며, 미세한 미스트 또는 그러한 입자를 함유하는 스프레이를 포함한다. 에어로졸화는 액체 현탁액을 작은 입자 또는 비말로 변환시킴으로써 에어로졸을 생산하는 프로세스이다. 이것은 에어로졸 전달 시스템, 예컨대 가압 팩 또는 네뷸라이저를 사용하여 수행될 수 있다. 네뷸라이저는, 예를 들어, 예컨대 디클로로디플루오로메탄, 트리클로로플루오로메탄, 디클로로테트라플루오로에탄, 이산화탄소 또는 다른 적합한 기체이나 이에 제한되지는 않는 적합한 추진제를 사용하는, 에어 제트 (즉, 공압), 초음파 및 진동 메시 네뷸라이저를 포함한다. 네뷸라이저 이외에, 폐 전달을 위한 다른 장치는 계측된 양 흡입기 (MDI) 및 건조 분말 흡입기 (DPI)를 포함하나 이에 제한되지는 않는다. 흡입기 또는 취입기에 사용하기 위한, 예를 들어 젤라틴의 캡슐 및 카트리지는 동결 건조된 핵산 기반 약물이 탑재된 나노소포체 및 적합한 분말 기제, 예컨대 락토스 또는 전분을 함유하여 제형화될 수 있다.
핵산 기반 약물이 탑재된 나노소포체는 전신으로 전달하는 것이 바람직한 경우, 예를 들어 대형 단일 주사 또는 연속 주입을 포함한 주사에 의한 비경구 투여용으로 제형화 될 수 있다. 주사용 제형은 보존제를 부가하거나 부가하지 않으면서, 단위 투여 형태, 예를 들어, 앰플 또는 다회 투여 용기에 제공될 수 있다. 조성물은 유성 또는 수성 비히클 중의 수용성 현탁액, 용액 또는 에멀션과 같은 형태를 취할 수 있으며, 제형화제, 예컨대 현탁제, 안정화제 및/또는 분산제를 함유할 수 있다. 적합한 친유성 용매 또는 비히클은 지방 오일, 예컨대 참깨유, 또는 합성 지방산 에스테르, 예컨대 에틸 올레에이트 또는 트리글리세리드를 포함한다. 수성 주사 현탁액은 현탁액의 점도를 증가시키는 물질, 예컨대 소듐 카르복시메틸 셀룰로스, 소르비톨 또는 덱스트란을 함유할 수 있다. 임의로, 현탁액은 또한, 적합한 안정화제, 또는 용해도를 증가시키는 작용제를 함유할 수 있다. 대안적으로, 핵산 기반 약물이 탑재된 나노소포체는 사용 전에 적합한 비히클, 예를 들어, 멸균 주사용 증류수로 구성하기 위한 동결 건조되거나 또는 다른 분말 또는 고체 형태일 수 있다.
본 개시내용에 따라 치료되는 대상체에게 투여되는 다른 작용제는 경구 투여, 비강내 투여, 기관지내 투여, 흡입, 정맥내 투여 등을 포함한 임의의 적합한 경로에 의해 투여될 수 있다는 것을 이해해야 한다. 관련 기술 분야의 통상의 기술자는 이러한 2차 작용제에 대한 통상적인 투여 경로를 알고 있을 것이다.
핵산 기반 약물이 탑재된 나노소포체는 즉시 사용될 수 있거나, 또는 대안적으로, 단기간 및/또는 장기간, 예를 들어 사용 전에 냉동 보존된 상태로 저장될 수 있다. 프로테이나제 억제제는 전형적으로, 장기간 저장 동안 나노소포체 완전성을 제공하기 때문에 동결 배지에 포함된다. -20℃ 하에서의 동결은 나노소포체 활성의 상실 증가와 연관이 있기 때문에 바람직하지 않다. 활성을 보존하기 때문에 -80℃ 하에서의 급속 동결이 더 바람직하다. 핵산 기반 약물이 탑재된 나노소포체의 생물학적 활성의 보존을 증강시키기 위해, 동결 배지에 대한 부가제가 사용될 수 있다. 이러한 부가제는 무손상 세포의 냉동 보존에 사용되는 것과 유사하며, DMSO, 글리세롤 및 폴리에틸렌 글리콜을 포함할 수 있으나, 이에 제한되지는 않는다.
본 발명의 제약 제제는 전형적으로 제약상 허용되는 비경구 비히클과 함께 단위 투여 주사가능한 형태로, 비경구 투여, 즉 볼루스, 정맥내, 및 종양내 주사를 위해 제조된다. 원하는 정도의 순도를 갖는 핵산 기반 약물이 탑재된 세포 유래 자연 또는 인공 나노소포체는 제약상 허용되는 희석제, 담체, 부형제 또는 안정화제와 함께 동결건조 제제 또는 수용액 형태로 임의로 혼합된다.
본 발명에 따라 안티센스 올리고뉴클레오타이드를 탑재한 자연 또는 인공 나노소포체는 암세포의 증식과 이동을 억제하고 기존 화학항암제와의 병용 투여 시 약물 감수성을 증가시키는 특성을 보인다. 또한, 세포 유래 자연 또는 인공 나노소포체는 세포치료제의 강점을 살리면서도 비교적 저렴한 가격으로 생산이 가능하고, 기존 면역항암제와 전혀 다른 기전으로 암세포를 공략할 수 있을 것으로 기대되는 모달리티이다.
도 1은 Galectin-3 ASO 처리 시 폐암세포주(A549)에서의 Galectin-3 유전자 발현이 감소됨을 분석한 그래프이다.
도 2는 Galectin-3 ASO 처리 시 폐암세포주(A549)에서의 Galectin-3 단백질 발현이 감소됨을 분석한 그래프이다.
도 3은 Galectin-3 ASO 처리 시 폐암세포주의 세포 증식이 감소됨을 확인한 그래프와 세포 이동능이 억제되는 것을 확인하기 위해 세포를 염색 후 촬영한 사진이다.
도 4는 Galectin-3 ASO와 항암제 Cisplatin을 병용 투여 시 암세포 사멸이 촉진되어 항암제에 대한 감수성이 증가됨을 확인하기 위해 사멸 세포를 염색 후 촬영한 사진이다.
도 5는 전기자극 방식(electgrophoration)과 다공성막 세포 압출 방식(extrusion)으로 Galectin-3 ASO를 나노소포체 안에 탑재 후 탑재 여부 및 효율 정도를 확인하기 위해 분석 후 촬영한 사진이다.
도 6은 나노소포체 내에 Galectin-3 ASO 탑재 후 미탑재 ASO를 정제하여 순수하게 ASO 탑재 나노소포체를 확보하는 방법 및 결과에 대한 그래프이다.
도 7은 Galectin-3 ASO 탑재 인공나노소포체 처리 시 폐암세포주(A549)에서의 Galectin-3 유전자 발현이 감소됨을 확인한 그래프이다.
도 8은 Galectin-3 ASO 탑재 제대혈 줄기세포 엑소좀과 인공 나노소포체 처리 후 폐암세포의 세포 증식능이 감소됨을 확인하기 위해 증식한 세포를 염색한 후 촬영한 사진; 및 Galectin-3 ASO 탑재 엑소좀과 인공 나노소포체 처리 후 폐암세포의 세포 증식능을 확인한 그래프이다.
도 9는 Galectin-3 ASO 탑재 제대혈 줄기세포 엑소좀과 인공 나노소포체 처리 후 폐암세포의 세포 이동능이 감소됨을 확인하기 위해 이동한 세포를 염색한 후 촬영한 사진; 및 Galectin-3 ASO 탑재 엑소좀과 인공 나노소포체 처리 후 폐암세포의 세포 이동능을 확인한 그래프이다.
도 10은 Galectin-3 ASO 탑재 HEK293 세포 엑소좀과 인공 나노소포체 처리 후 폐암세포의 세포 증식능이 감소됨을 확인하기 위해 증식한 세포를 염색한 후 촬영한 사진; 및 Galectin-3 ASO 탑재 엑소좀과 인공 나노소포체 처리 후 폐암세포의 세포 증식능을 확인한 그래프이다.
도 11는 Galectin-3 ASO 탑재 HEK293 세포 엑소좀과 인공 나노소포체 처리 후 폐암세포의 세포 이동능이 감소됨을 확인하기 위해 이동한 세포를 염색한 후 촬영한 사진; 및 Galectin-3 ASO 탑재 엑소좀과 인공 나노소포체 처리 후 폐암세포의 세포 이동능을 확인한 그래프이다.
도 12는 타겟 유전자의 mRNA에 결합하여 분해함으로써 유전자 기능 상실을 유도하는 ASO의 기작에 대한 모식도이다(Science 27 Mar 2020; vol.367, Issue 6485).
도 13은 RNA의 침입을 막는 40 억년 된 지질 이중층 보호막을 도시한 것이다.
도 14는 나노소포체 내 약물을 탑재하는 방법 별 특징과 단점에 관해 정리한 도표이다.
도 15는 호흡계 구조 및 기능을 도시한 모식도이다.
도 16는 폐포의 구조를 도시한 모식도이다.
도 17은 폐암 세포에서 높게 발현하여 암세포의 증식과 전이를 촉진하는 Galectin의 기능을 도시한 것이다(Chang WA, 2017, Oncology Letters).
도 18은 세포외소포체 정맥 투여 후 체내 축적 기관을 확인한 결과이다 (Sci Rep. 2019 Jul 11;9(1):10041).
이하, 본 발명을 실시예를 통하여 보다 구체적으로 설명한다. 다만, 하기 실시예는 본 발명의 기술적 특징을 명확하게 예시하기 위한 것일 뿐 본 발명의 보호범위를 한정하는 것은 아니다.
실시예 1. Galectin-3 ASO 제작
Galectin-3를 타겟으로 하는 ASO를 제작하기 위해, Galectin-3의 코딩 서열(coding sequence) 내에서 한 사이트당 연속되는 20개의 염기서열을 포함하는 ASO 염기서열 3종을 임의로 선정하였다. Galectin-3 표적화 하기 위해, 서열번호 1 ~ 3 의 각 서열을 사용하여 ASO를 설계한 후, ASO의 세포 내 유입 및 세포 안에서의 안정성을 높이기 위해 각 염기서열 base에 phosphorothioate와 2'-O-methyl 기를 붙여주었다.
No. Target site
Site 1(서열번호 1) cat gat gcg tta tct ggg tc
Site 2(서열번호 2) ggc cac tga ttg tgc ctt at
Site 3(서열번호 3) act ggg gaa ggg aag aaa ga
각 서열번호 1 ~ 3 으로 설계된 Galectin-3 ASO 에 대해 예비 실험을 통해 ASO 3종 모두 Galectin-3 발현 감소 측면에서 정상적으로 동일 기능을 갖는 것을 확인하였다. 따라서, 하기 실시예들에서는 대표적으로 서열번호 1로 설계된 ASO에 대해 실험한 결과들을 도면으로 제시하였다.
또한, 서열번호 1 ~ 3 의 염기서열은 전체 Galectin-3 coding sequence 중 임의로 세 군데를 선정하여 제작한 것이므로, 전체　Galectin-3 coding sequence 중 서열번호 1~3 이외에 다른 부위의 염기서열들을 활용하여 Galectin-3 ASO 제작이 가능하다.
실시예 2. Galectin-3 ASO의 nanovesicle 내 탑재
2-1) By electroporation
제대혈 줄기세포의 세포 배양액으로부터 분리한 엑소좀을 초고속원심분리기(50,000~150,000 x g, 1~3 h)를 사용하여 정제, 농축하였다. 나노입자추적분석기(Nanoparticle Tracking Analysis)을 통해 엑소좀을 계수 한 후 1~4x10^10개를 Invitrogen NeonTM R buffer 100 μl에 희석하였다. 준비된 엑소좀 100 μl에 Galectin-3 ASO 100~1,000 pmol을 첨가하였다. Invitrogen NeonTM Electroporator를 사용해 엑소좀 100 μl, 1000~2000 V, 5~20 ms, 1~3 pulse의 조건으로 electroporation transfection을 진행하였다. IZON qEV original size exclusion chromatography(SEC) 정제를 통해 잔여 ASO를 제거하였다.
2-2) Extruder
배양 중인 제대혈 줄기세포를 TrypLE을 이용하여 포집한 후 PBS를 활용하여 2회 수세하였다. 세포 계수 후에 PBS에 1~10x10^5 cells/ml이 되도록 resuspension 하여 세포 현탁액을 준비하였다. 세포 현탁액에 Galectin-3 ASO를 100~1,000 pmol/ml이 되도록 첨가하였다. Avanti mini Extruder를 사용하여 1 ml의 세포 현탁액을 0.1 ~ 0.8 μm WhatmanTM Membrane Filter를 사용하여 extrusion하였다. 총 2 ~ 10회 왕복하여 세포를 압출 분쇄하였다. 압출 분쇄한 시료를 초고속원심분리기(50,000~150,000 x g, 1~3 h)를 사용하여 정제, 농축하였다. IZON qEV original size exclusion chromatography(SEC) 정제를 통해 잔여 ASO를 제거하였다.
엑소좀과 인공 나노소포체에 Galectin-3 ASO의 탑재 여부를 확인하기 위해 electroporation 전후와 exclusion 전후의 잔여 ASO를 전기영동 및 밴드를 확인한 결과 실험군에서 밴드가 두께가 줄어듦으로써 ASO가 나노소포체 내로 탑재되었음을 확인하였다(도 5).
Galectin-3 ASO를 탑재한 엑소좀과 인공 나노소포체의 분리 및 정제 결과, SEC 과정 중 3~6 fraction 사이의 시료를 획득하면 잔여 ASO 없이 순수하게 정제된 상태의 엑소좀과 인공나노소포체를 확보할 수 있음을 확인하였다(도 6).
실시예 3. 폐암세포주 배양
비소세포 폐암 세포주인 A549 세포를 37℃, 5% CO2 인큐베이터에서 10% fetal bovine serum(FBS), PrimocinTM (100 μg/ml)이 첨가된 RPMI 1640 배지에 배양하였다. 배지는 2~3일 간격으로 교체하며 세포가 배양접시 바닥면적의 80% 정도 증식했을 때 계대 배양하였다.
실시예 4. Galectin-3 ASO 처리 후 폐암세포에서의 Galectin-3 유전자 발현량 분석
A549 세포를 배양 접시에 4,000 ~8,000 cells/cm²으로 seeding하여 37℃, 5% CO2 인큐베이터에서 24시간 배양하였다. 100~1,000 pmol Galectin-3 ASO를 Lipofectamine을 활용해 세포 내 유입을 유도하였다. 37℃, 5% CO2인큐베이터에서 24~48시간 배양 후 PBS로 세척하고 TrypLE를 활용해 세포를 포집하였다. 세포를 원심분리하여 상층액을 제거 후 세포 펠렛(pellet)을 PBS로 재현탁 후 원심분리하여 상층액을 제거하였다.
PureLinkTM RNA Mini Kit(Invitrogen)으로 Total RNA를 분리 후 정량하여 cDNA를 합성하였다.
합성된 A579 cDNA를 표 2의 primer로 Real-Time PCR을 진행하여 Galectin-3의 발현량을 확인하였다. 이때, 로딩 대조군(loading control)으로 일종의 하우스키핑유전자(house keeping gene)인 GAPDH를 사용하였다.
Gene Primer Sequence
Galectin-3 F- GTCCGGAGCCAGCCAAC
R- AGGCCATCCTTGAGGGTTTG
GAPDH F- GGGTGTGAACCATGAGAA
R- GTCTTGGGGTGGCAGTGAT
표 1의 염기서열로 제작한 Galectin-3 ASO가 정상적으로 작용하여 폐암세포 내 Galectin-3의 유전자 발현을 감소시키는지 여부를 확인하기 위해 폐암세포에 ASO를 처리 후 표 2의 염기서열을 활용해 분석한 결과, Galectin-3 ASO 처리에 의해 폐암세포주 A549 내의 Galectin-3 유전자 발현이 감소되는 것을 확인하였다(도 1).
실시예 5. Galectin-3 ASO 처리 후 폐암세포에서의 Galectin-3 단백질 발현량 분석
실시예 4와 동일한 방법으로 Galectin-3 ASO를 담지를 유도한 폐암 세포를 획득한 후, 세포 내 Galectin-3의 단백질 발현을 확인하기 위해 웨스턴블롯(western blot)을 수행하였다. 세포 펠렛을 phaspatease inhibitor cocktail(sigma)이 포함된 세포 용해용 용액(200 ng/ml phenylmethylsulfony fluoride, 1% Triton X-100, 150 mM NaCl, 50 mM Tris)을 활용해 세포 내 단백질 용출을 유도하였다. 10% SDS polyacrylamide gel에 전기영동 시킨 후 Immobilon P membrane에 transfer하였다. 이후 Galectin-3 antibody를 membrane에 처리한 후, ECL kit를 활용해 발색 시켜 Galectin-3 밴드를 확인하였다.
분석 결과, Galectin-3 ASO 처리에 의해 폐암세포주 A549 내의 Galectin-3 단백질 발현이 감소되는 것을 확인하였다(도 2).
RNA 단계에서의 반응 후 최종적으로 단백질 수준에서 효과가 보여지는 데에는 몇 시간에서 수 일이 소요될 수도 있으며 단시간(24 시간 미만) 내에 ASO에 의한 감소 반응을 보인 후 다시 원래 상태대로 회복되는 경우도 있다. 도 2는 ASO 처리 후 1일째와 4일째의 단백질 발현 정도를 확인한 것으로 Galectin-3 ASO 처리 후 4일 이상, 장기간 동안 단백질 발현 억제 현상을 보임으로써 약물로써 충분한 기능을 수행하고 있음을 확인하였다.
실시예 6. Galectin-3 ASO 처리 후 폐암세포 증식능 분석
A549 세포를 배양 접시에 4,000 ~8,000 cells/cm²으로 seeding하여 37℃, 5% CO2 인큐베이터에서 24시간 배양하였다. 기존의 배양액을 모두 제거한 후 1% FBS 배지 조건으로 100~1,000 pmol Galectin-3 ASO를 Lipofectamine을 활용해 세포 내 유입을 유도하였다. 37℃, 5% CO2 인큐베이터에서 24시간, 48시간 배양 후 세포 계수를 하였다.
분석 결과, Galectin-3 ASO 처리에 의해 폐암세포주 A549의 세포 증식능이 감소되는 것을 확인하였다(도 3 좌). 실시예 5(도 2)의 경우 Galectin-3 ASO 처리에 의한 단백질 발현량의 감소를 확인한 것으로 단백질 발현 감소의 결과로 세포 증식능 및 이동능 감소가 유도된 것임을 알 수 있다.
도 3의 그래프는 세포증식에 정도를 상대적으로 비교한 것으로, 세포 숫자에 대한 정량이 아닌 대조군의 증식 정도를 "1"로 두고 실험군의 세포 증식 정도를 비교한 것이다.
한편, H-358은 A549와 동일한 비소세포폐암주 중의 하나로, 도 3에 도시된 바와 같이 Galectin-3 ASO가 A549 세포주에만 특이적으로 반응을 보이는 것이 아닌 다른 비소세포폐암주에도 동일한 효능을 보임으로써 비소세포폐암 전반적으로 활용 가능함을 보여주었다.
실시예 7. Galectin-3 ASO 처리 후 폐암세포 이동능 분석
A549 세포를 0.5~2 x 10^4 cells/well으로 trans-well 내 insert well에 seeding하여 37℃, 5% CO2 인큐베이터에서 24시간 배양하였다. 기존의 배양액을 모두 제거한 후 serum free 배지 조건으로 100~1,000 pm Galectin-3 ASO를 Lipofectamine을 활용해 세포 내 유입을 유도하였다. 37℃, 5% CO2 인큐베이터에서 2 시간 배양 후 insert well 아래쪽 plate에 10% FBS, PrimocinTM (100 μg/ml)이 첨가된 RPMI 1640 배지를 500 μl 분주하였다. 37℃, 5% CO2 인큐베이터에서 48시간 배양 후 crystal violet staining을 하였다. 광학현미경으로 insert well membrane의 반대편으로 이동한 세포를 관찰하였다.
분석 결과, Galectin-3 ASO 처리에 의해 폐암세포주 A549의 세포 이동능이 감소되는 것을 확인하였다(도 3 우).
도 3에 도시된 바와 같이, Galection-3 ASO 처리 후 이틀째 까지도 폐암세포의 이동이 억제됨을 확인할 수 있다.
실시예 8. Galectin-3 ASO 처리 후 암세포 항암제 감수성 분석
A549 폐암세포를 2~ 10 x 10^4 cell/cm2의 세포수로 배양접시에 부착 후 Galectin-3 ASO를 100 ~ 1,000 pmol 농도로 Lipofectamine을 활용하여 세포내 유입을 유도하였다. 24 시간 후에 10~50 uM Cisplatin을 처리한 후 24 시간 뒤에 Live & Dead Assay Kit를 활용하여 세포 사멸 정도를 형광현미경을 통해 확인하였다.
분석 결과, Galectin-3 ASO와 기존 화학항암제의 병용 투여 시 폐암세포주 A549의 세포 사멸이 증가하여 항암제에 대한 감수성이 증가하는 것을 확인하였다(도 4).
실시예 9. Galectin-3 ASO 탑재 인공나노소포체 처리 후 폐암세포에서의 Galectin-3 유전자 발현량 분석
A549 세포를 배양 접시에 4,000 ~8,000 cells/cm²으로 seeding하여 37℃, 5% CO2 인큐베이터에서 24시간 배양하였다. 다음날 Galectin-3 ASO를 탑재한 0.5~2 x 10^9개의 인공 나노소포체를 처리하였다. 37℃, 5% CO2 인큐베이터에서 24시간 배양 후 실시예 4와 동일하게 Galectin-3 유전자 발현을 분석하였다.
분석 결과, Galectin-3 ASO 탑재 인공 나노소포체 처리에 의해 폐암세포주 A549 내의 Galectin-3 유전자 발현이 감소되는 것을 확인하였다(도 7).
도 1은 Galectin-3 ASO를 나노소포체에 탑재하지 않고 lipofectamine 시약을 활용하여 세포에 주입 후 세포 내 Galectin-3 유전자 발현 정도를 확인한 결과이다. Lipofectamine 시약은 인공적으로 liposome 형성을 유도하여 물질을 세포 내로 유입될 수 있도록 하는 기능을 하나, 고유 독성과 처리 방법 상 문제 때문에 실제 약물 생산 과정에서 활용하는 것은 불가능한 시약이다. 따라서, 도 1의 결과를 통해 Galectin-3 ASO가 정상적인 기능을 갖고 있음을 1차적으로 확인한 것이고, 도 7의 경우, Galectin-3 ASO를 인공나노소포체에 탑재하여 Lipofectamine과 같은 시약의 처리 없이 자연적으로 세포 내로 유입된 후 Galectin-3의 발현억제 효능을 확인한 결과이다.
실시예 10: Galectin-3 ASO를 담지하지 않거나 혹은 담지한 제대혈 줄기세포 엑소좀과 인공나노소포체의 폐암세포주(A549)의 증식과 이동에 미치는 영향
(실험군 설명)
Control : 아무것도 처리 하지 않은 실험군(Negative control)
Exosome : 제대혈 줄기세포 엑소좀 처리군
GAL-3 Exosome : Galectin-3 ASO 담지한 제대혈 줄기세포 엑소좀 처리군
ANV : 아무것도 담지하지 않은 제대혈 줄기세포 인공나노소포체 처리군
GAL-3 ANV : Galectin-3 ASO를 담지한 제대혈 줄기세포 인공나노소포체 처리군
10-1. Galectin-3 ASO 탑재 nano-vesicles 처리 후 폐암세포 증식능 분석
A549 세포를 배양 접시에 4,000 ~8,000 cells/cm²으로 seeding하여 37℃, 5% CO2 인큐베이터에서 24시간 배양하였다. 기존의 배양액을 모두 제거한 후 1% FBS 배지 조건으로 0.5~2 x 10^9개 엑소좀 및 인공 나노소포체를 처리하였다. 37℃, 5% CO2 인큐베이터에서 24시간, 48시간 배양 후 세포 계수를 하였다.
분석 결과, Galectin-3 ASO 탑재 나노소포체 처리에 의해 폐암세포주 A549의 증식이 감소되는 것을 확인하였다(도 8). 도 8의 그래프는 세포 증식률에 대한 상대적 수치를 비교한 것이다.
도 8의 엑소좀 / 인공 나노소포체의 그래프에서 알 수 있는 바와 같이, Galectin-3 ASO를 엑소좀과 세포를 분쇄하여 만든 인공나노소포체 두 가지 모두에 탑재하여 효능을 확인했을 때 동일한 효능을 나타냄을 확인하였다.
10-2. Galectin-3 ASO 탑재 nano-vesicles 처리 후 폐암세포 이동능 분석
A549 세포를 0.5~2 x 10^4 cells/well으로 trans-well 내 insert well에 seeding하여 37℃, 5% CO2 인큐베이터에서 24시간 배양하였다. 기존의 배양액을 모두 제거한 후 serum free 배지 조건으로 0.5~2 x 10^9개 엑소좀 및 인공 나노소포체를 처리하였다. 37℃, 5% CO2 인큐베이터에서 2 시간 배양 후 insert well 아래쪽 plate에 10% FBS, PrimocinTM (100 μg/ml)이 첨가된 RPMI 1640 배지를 500 μl 분주하였다. 37℃, 5% CO2 인큐베이터에서 48시간 배양 후 crystal violet staining을 하였다. 광학현미경으로 insert well membrane의 반대편으로 이동한 세포를 관찰하였다.
분석 결과, 실시예 2에서 준비한 Galectin-3 ASO 탑재 인공 나노소포체 처리에 의해 폐암세포주 A549의 이동능이 감소되는 것을 확인하였다(도 9).
(결론)
Galectin-3 ASO를 담지 하지 않은 제대혈 줄기세포 엑소좀과 인공나노소포체의 경우, 주변 세포의 증식과 이동을 촉진시키는 줄기세포 고유의 특성에 따라 폐암세포주의 증식과 이동을 촉진한다. 하지만 Galectin-3 ASO를 담지한 제대혈 줄기세포 엑소좀과 인공나노소포체는 Galectin-3 유전자 발현(비소세포폐암의 증식/이동 촉진) 억제 효과에 의해 줄기세포 고유의 특성(세포 증식/이동 촉진)이 상쇄됨으로써 Galectin-3를 담지하지 않은 엑소좀과 인공나노소포체를 처리한 실험군(Exosome & ANV) 보다 증식/이동 효과가 억제되어 아무것도 처리하지 않은 control 실험군과 비슷한 정도의 폐암세포 증식 및 이동능을 보인다.
실시예 11: Galectin-3 ASO를 담지하지 않거나 혹은 담지한 HEK293 세포 엑소좀과 인공나노소포체의 폐암세포주(A549)의 증식과 이동에 미치는 영향
Galectin-3 ASO 탑재 인공나노소포체의 폐암세포주의 증식과 이동에 미치는 영향에서 줄기세포 고유 특성을 배제하기 위해 줄기세포가 아닌 HEK293 cells을 활용해 Galectin-3 ASO 담지 인공나노소포체를 생산 후, 실시예 10과 동일한 방법으로 폐암세포주에 처리, Galectin-3 ASO의 효능을 관찰하였다. 폐암세포주의 증식능 및 이동능에 미치는 영향은 도 10 및 도 11에 도시하였다.
(실험군 설명)
Non-Treat(NC) : 아무것도 처리하지 않은 실험군(Negative control)
Control_ANV : 아무것도 담지하지 않은 HEK293 cells 유래 인공나노소포체
GAL-3_ANV : Galectin-3 ASO를 담지한 HEK293 cells 유래 인공나노소포체
(결론)
Galectin-3 ASO를 담지하지 않은 HEK293 cells 유래 인공나노소포체는 아무것도 처리하지 않은 Negative control와 비슷한 처리 양상을 보이나, Galectin-3 ASO를 담지한 HEK293 cells 인공나노소포체는 폐암세포주의 증식과 이동을 억제하였다. 이를 통해 HEK293 cells이 세포 자체 특성의 영향 없이 ASO의 효능을 그대로 재현할 수 있는 담지체로써 역할을 한다는 것을 확인하였다.
<110> PRIMORIS Co.Ltd.
<120> Pharmaceutical composition containing cell-derived natural or artificial nanovesicles loaded with anti-sense oligonucleotide-based drugs
<130> P2021-0009
<150> KR 2021/085716
<151> 2021-06-30
<160> 3
<170> KoPatentIn 3.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> anti-sense oligonucleotide
<400> 1
catgatgcgt tatctgggtc 20
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> anti-sense oligonucleotide
<400> 2
ggccactgat tgtgccttat 20
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> anti-sense oligonucleotide
<400> 3
actggggaag ggaagaaaga

Claims (16)

  1. 안티센스 올리고뉴클레오타이드(anti-sense oligonucleotide, ASO) 기반 약물을 탑재시킨 세포 유래 자연 또는 인공 나노소포체를 함유하는 것이 특징인 약학 조성물.
  2. Galectin-3 표적 핵산 약물이 탑재된 세포 유래 자연 또는 인공 나노소포체를 함유하는 약학 조성물.
  3. 핵산 기반 약물이 탑재된 세포 유래 자연 또는 인공 나노소포체를 함유하는 것이 특징인 구강 또는 비강 흡입 (Inhalation)용 또는 정맥주사용 약학 조성물.
  4. 핵산 기반 약물이 탑재된 제대혈 줄기세포 유래 자연 또는 인공 나노소포체를 함유하는 것이 특징인 암 예방 또는 치료용 약학 조성물.
  5. 제1항 내지 제3항 중 어느 한 항에 있어서, 자연 또는 인공 나노소포체는 인간 배아 신장 세포 또는 제대혈 줄기세포에서 분비 또는 준비된 것이 특징인 약학 조성물.
  6. 제1항 내지 제4항 중 어느 한 항에 있어서, ASO 기반 약물 또는 핵산 기반 약물은 염기서열 중 적어도 하나의 염기(base) 일부 또는 모두가 phosphorothioate 및/또는 2'-O-methyl 기로 수정된 ASO 기반 약물인 것이 특징인 약학 조성물.
  7. 제1항 내지 제3항 중 어느 한 항에 있어서, 암 예방 또는 치료용 약학 조성물인 것이 특징인 약학 조성물.
  8. 제1항, 제3항 또는 제4항에 있어서, ASO 기반 약물 또는 핵산 기반 약물은 Galectin-3 표적인 것이 특징인 약학 조성물.
  9. 제1항 내지 제4항 중 어느 한 항에 있어서, ASO 기반 약물 또는 핵산 기반 약물은 Galectin-3 표적화로 서열번호 1 ~ 3 중 어느 하나 이상의 서열을 사용하여 설계된 것이 특징인 약학 조성물.
  10. 제1항, 제2항 또는 제4항에 있어서, 구강 또는 비강 흡입 (Inhalation)용 또는 정맥주사용 제형인 것이 특징인 약학 조성물.
  11. 제1항 내지 제4항 중 어느 한 항에 있어서, 폐암 예방 또는 치료용 인 것이 특징인 약학 조성물.
  12. 제1항 내지 제4항 중 어느 한 항에 있어서, 비-핵산 기반 약물과 병용 투여되는 것이 특징인 약학 조성물.
  13. 제1항 내지 제4항 중 어느 한 항에 있어서, 타겟 세포의 증식능 및/또는 이동능을 감소시키는 것이 특징인 약학 조성물.
  14. 제1항 내지 제4항 중 어느 한 항에 있어서, 병용 투여되는 항암제에 대한 감수성을 증가시키는 것이 특징인 약학 조성물.
  15. Galectin-3 코딩 서열(coding sequence, CDS) 내 염기서열을 사용하여 설계된 것이 특징인 Galectin-3 표적화 안티센스 올리고뉴클레오타이드(anti-sense oligonucleotide, ASO).
  16. 제15항에 있어서, 서열번호 1 ~ 3 중 어느 하나 이상의 서열을 사용하여 설계된 것이 특징인 Galectin-3 표적화 안티센스 올리고뉴클레오타이드(ASO).
PCT/KR2022/009415 2021-06-30 2022-06-30 안티센스 올리고뉴클레오타이드 기반 약물이 탑재된 세포 유래 자연 또는 인공 나노소포체를 함유하는 약학 조성물 WO2023277610A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN202280058972.9A CN117940117A (zh) 2021-06-30 2022-06-30 含有负载有基于反义寡核苷酸的药物的细胞源性天然或人工纳米囊泡的药物组合物
EP22833664.0A EP4364728A1 (en) 2021-06-30 2022-06-30 Pharmaceutical composition containing cell-derived natural or artificial nanovesicles loaded with antisense oligonucleotide-based drug

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2021-0085716 2021-06-30
KR20210085716 2021-06-30

Publications (1)

Publication Number Publication Date
WO2023277610A1 true WO2023277610A1 (ko) 2023-01-05

Family

ID=84690596

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/009415 WO2023277610A1 (ko) 2021-06-30 2022-06-30 안티센스 올리고뉴클레오타이드 기반 약물이 탑재된 세포 유래 자연 또는 인공 나노소포체를 함유하는 약학 조성물

Country Status (4)

Country Link
EP (1) EP4364728A1 (ko)
KR (1) KR20230004342A (ko)
CN (1) CN117940117A (ko)
WO (1) WO2023277610A1 (ko)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180005546A (ko) * 2016-07-06 2018-01-16 인천대학교 산학협력단 약물이 탑재된 엑소좀 또는 나노베지클을 이용한 약학적 조성물
US20190054192A1 (en) * 2017-08-16 2019-02-21 City University Of Hong Kong ISOLATION OF EXTRACELLULAR VESICLES (EVs) FROM RED BLOOD CELLS FOR GENE THERAPY

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180005546A (ko) * 2016-07-06 2018-01-16 인천대학교 산학협력단 약물이 탑재된 엑소좀 또는 나노베지클을 이용한 약학적 조성물
US20190054192A1 (en) * 2017-08-16 2019-02-21 City University Of Hong Kong ISOLATION OF EXTRACELLULAR VESICLES (EVs) FROM RED BLOOD CELLS FOR GENE THERAPY

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
KIM SUJIN: "[Interview] Primoris,"The only company in Korea that has both exosome and drug delivery technology" ", BIOTIMES, 27 May 2022 (2022-05-27), XP093018202, Retrieved from the Internet <URL:www.biotimes.co.kr/news/articleView.html?idxno=7923> [retrieved on 20230126] *
LEE UI-JEONG: " [BioS Letter] Developing ASO, Global Approval & Development Status?", BIOS LETTER, 12 January 2021 (2021-01-12), XP093018206, Retrieved from the Internet <URL:www.biospectator.com/view/news_view.php?varAtcId=12265> [retrieved on 20230126] *
SCI REP, vol. 9, no. 1, 11 July 2019 (2019-07-11), pages 10041
SCIENCE, vol. 367, 27 March 2020 (2020-03-27)
TSUTOMU KOBAYASHI; TATSUO SHIMURA; TOSHIKI YAJIMA; NORIO KUBO; KENICHIRO ARAKI; SOICHI TSUTSUMI; HIDEKI SUZUKI; HIROYUKI KUWANO; A: "Transient gene silencing of galectin‐3 suppresses pancreatic cancer cell migration and invasion through degradation of β‐catenin", INTERNATIONAL JOURNAL OF CANCER, JOHN WILEY & SONS, INC., US, vol. 129, no. 12, 29 March 2011 (2011-03-29), US , pages 2775 - 2786, XP071286333, ISSN: 0020-7136, DOI: 10.1002/ijc.25946 *
ZHANG DONG, CHEN ZHENG-GANG, LIU SHAO-HUA, DONG ZUO-QING, DALIN MARTIN, BAO SHI-SAN, HU YING-WEI, WEI FENG-CAI: "Galectin-3 gene silencing inhibits migration and invasion of human tongue cancer cells in vitro via downregulating β-catenin", ACTA PHARMACOLOGICA SINICA, NATURE PUBLISHING GROUP, GB, vol. 34, no. 1, 1 January 2013 (2013-01-01), GB , pages 176 - 184, XP093018203, ISSN: 1671-4083, DOI: 10.1038/aps.2012.150 *

Also Published As

Publication number Publication date
CN117940117A (zh) 2024-04-26
EP4364728A1 (en) 2024-05-08
KR20230004342A (ko) 2023-01-06

Similar Documents

Publication Publication Date Title
Dong et al. MSC-derived exosomes-based therapy for peripheral nerve injury: a novel therapeutic strategy
US20230027864A1 (en) Compositions and methods for delivery of agents to immune cells
Matthay et al. Concise review: mesenchymal stem (stromal) cells: biology and preclinical evidence for therapeutic potential for organ dysfunction following trauma or sepsis
US20240173354A1 (en) Methods of inhibiting aging and treating aging-related disorders
WO2016133254A1 (ko) 세포의 지질막에서 유래된 나노소포체 및 이의 용도
US20230112857A1 (en) Methods of making tolerogenic dendritic cells
JP7336769B2 (ja) 骨格筋ジストロフィーを治療する方法及び組成物
WO2019050071A1 (ko) 엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 조성물
WO2017179840A1 (ko) 트롬빈 처리 줄기세포에서 유래된 엑소좀을 포함하는 만성폐질환 치료용 조성물
WO2019198995A1 (ko) 엑소좀 기반의 면역세포의 교차분화 방법
WO2023277610A1 (ko) 안티센스 올리고뉴클레오타이드 기반 약물이 탑재된 세포 유래 자연 또는 인공 나노소포체를 함유하는 약학 조성물
WO2022045813A1 (ko) 엑소좀을 유효성분으로 포함하는 폐암 치료, 예방 또는 전이 억제용 약학적 조성물
WO2022035243A1 (ko) 치료제가 봉입된 우유 엑소좀을 포함하는 경구형 조성물 및 이의 제조 방법
WO2021261891A1 (ko) 박테리아 세포밖 소포체의 암 치료 효능 증진 방법 및 조성
EP4190338A1 (en) Composition including stem cell-derived exosome, and method for producing same
WO2019031729A2 (ko) 줄기세포 유래의 엑소좀을 유효성분으로 포함하는 조성물의 비알콜성 단순 지방간 또는 비알콜성 지방간염의 개선 용도
Rather et al. Therapeutic efficacy and promise of stem cell-derived extracellular vesicles in Alzheimer’s disease and other aging-related disorders
Kelly et al. On the distant horizon—medical therapy for sensorineural hearing loss
WO2021040473A1 (ko) 혈류 변화 부위 타겟팅 나노베지클을 이용한 동맥경화의 진단 및 치료 방법
KR102285913B1 (ko) 담즙산을 이용한 표면 개질 엑소좀, 그 생산 방법 및 세포 증식 유도 방법
WO2024049164A1 (ko) 세포막 유래 핵산 전달용 나노소낭 및 이의 제조 방법
WO2016178519A1 (ko) 근육 노화 억제용 또는 근육 노화 관련 질환 치료용 조성물
Boulikas Cancer gene therapy and immunotherapy
Lokanathan et al. Mesenchymal stem cells and their role in hypoxia-induced injury
WO2023153832A1 (ko) 병소에 대한 표적능이 강화된 엑토좀-생분해성 고분자 나노입자 복합체 및 그의 제조방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22833664

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2023580907

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2022833664

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2022833664

Country of ref document: EP

Effective date: 20240130

WWE Wipo information: entry into national phase

Ref document number: 202280058972.9

Country of ref document: CN