WO2023274380A1 - 靶向IL13Rα2的通用型CAR-T细胞及其制备方法和应用 - Google Patents

靶向IL13Rα2的通用型CAR-T细胞及其制备方法和应用 Download PDF

Info

Publication number
WO2023274380A1
WO2023274380A1 PCT/CN2022/103037 CN2022103037W WO2023274380A1 WO 2023274380 A1 WO2023274380 A1 WO 2023274380A1 CN 2022103037 W CN2022103037 W CN 2022103037W WO 2023274380 A1 WO2023274380 A1 WO 2023274380A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
immune effector
amino acid
acid sequence
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/CN2022/103037
Other languages
English (en)
French (fr)
Chinese (zh)
Inventor
尚小云
李甲璐
蒋海娟
王丹
马少文
沈慧
徐凡丽
王世臣
陈伟杰
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ningbo T Maximum Biopharmaceuticals Co Ltd
Original Assignee
Ningbo T Maximum Biopharmaceuticals Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ningbo T Maximum Biopharmaceuticals Co Ltd filed Critical Ningbo T Maximum Biopharmaceuticals Co Ltd
Priority to CN202280004526.XA priority Critical patent/CN115768445A/zh
Priority to JP2023580404A priority patent/JP2024527539A/ja
Priority to US18/575,628 priority patent/US20240376216A1/en
Priority to EP22832192.3A priority patent/EP4364746A4/en
Publication of WO2023274380A1 publication Critical patent/WO2023274380A1/zh
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00—Cellular immunotherapy
    • A61K40/10—Cellular immunotherapy characterised by the cell type used
    • A61K40/11—T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00—Cellular immunotherapy
    • A61K40/30—Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
    • A61K40/31—Chimeric antigen receptors [CAR]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00—Cellular immunotherapy
    • A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41—Vertebrate antigens
    • A61K40/42—Cancer antigens
    • A61K40/4202—Receptors, cell surface antigens or cell surface determinants
    • A61K40/421—Immunoglobulin superfamily
    • A61K40/4211—CD19 or B4
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00—Cellular immunotherapy
    • A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41—Vertebrate antigens
    • A61K40/42—Cancer antigens
    • A61K40/4202—Receptors, cell surface antigens or cell surface determinants
    • A61K40/4214—Receptors for cytokines
    • A61K40/4217—Receptors for interleukins [IL]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00—Cellular immunotherapy
    • A61K40/50—Cellular immunotherapy characterised by the use of allogeneic cells
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/7051—T-cell receptor (TcR)-CD3 complex
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/70539—MHC-molecules, e.g. HLA-molecules
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2866—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for cytokines, lymphokines, interferons
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0636—T lymphocytes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/10—Indexing codes associated with cellular immunotherapy of group A61K40/00 characterized by the structure of the chimeric antigen receptor [CAR]
    • A61K2239/11—Antigen recognition domain
    • A61K2239/13—Antibody-based
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/31—Indexing codes associated with cellular immunotherapy of group A61K40/00 characterized by the route of administration
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/38—Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the dose, timing or administration schedule
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/52—Constant or Fc region; Isotype
    • C07K2317/53—Hinge
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622—Single chain antibody (scFv)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/03—Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/24—Vectors characterised by the absence of particular element, e.g. selectable marker, viral origin of replication

Definitions

  • This application relates to the field of biomedicine, in particular to a universal CAR-T cell targeting IL13R ⁇ 2 and its preparation method and application.
  • IL-13R ⁇ 2 is highly expressed in a variety of tumors, such as malignant glioma, pancreatic cancer, ovarian cancer, breast cancer, and colon cancer.
  • glioma refers to the tumor originating from glial cells, which is the most common primary intracranial tumor.
  • the incidence of primary malignant brain tumors has been increasing year by year.
  • glioblastoma (Glioblastoma, GBM, WHO grade IV) has the highest incidence rate, accounting for 46.1%.
  • glioma the expression of IL-13R ⁇ 2 is positively correlated with the grade of glioma, high-grade glioma has high expression of IL-13R ⁇ 2, low-grade or normal brain tissue has low or no expression of IL-13R ⁇ 2, and IL-13R ⁇ 2 High expression is associated with poor prognosis.
  • high expression of IL-13R ⁇ 2 promotes the proliferation, migration and invasion of glioma cells, and this effect is achieved by activating the SRC/PI3K/ATK/mTOR pathway.
  • the treatment of glioma is mainly based on surgical resection of the tumor, combined with comprehensive treatment methods such as radiotherapy and chemotherapy.
  • Chemotherapy for glioma has always been a single-drug and multi-drug combination regimen.
  • the current treatment effect of glioma is generally poor.
  • the 1-year and 5-year survival rates of adult high-grade glioma are 30% and 13%, respectively, and the median survival time of anamorphic glioma and GBM is 2 ⁇ 3 years and 1 year. Therefore, the establishment of new methods for the treatment of glioma is a clinical need.
  • the team of Christine E. Brown reported a case of treatment with IL-13R ⁇ 2 CAR-T in NEJM magazine.
  • Universal CAR T cells are T cells isolated from healthy donors.
  • the prepared CAR-T cells not only have high expansion efficiency and strong vitality, but also increase the positive rate of infection.
  • universal CAR-T also faces graft-versus-host Problems with disease (GVHD) and immune rejection.
  • GVHD graft-versus-host Problems with disease
  • the CRISPR/Cas9 system is the most commonly used gene editing method, which can be used to generate TCR-deficient and HLA class I molecule-deficient T cells, and reduce the immune rejection immune response caused by allogeneic cell therapy.
  • Universal CAR-T not only expands the recognition range of antigens, but also can change the immunosuppressive microenvironment through gene knockout, and is applied to the treatment of malignant hematological tumors and solid tumors.
  • the purpose of the present invention is to prepare a universal CAR-T cell targeting IL-13R ⁇ 2, recognize tumor cell surface antigens, knock out the TCR and HLA-A genes expressed by the cells, and improve the anti-tumor effect of CAR-T cells
  • the effect is to prolong the survival time of cells, and at the same time reduce the multiple effects of immune rejection caused by allogeneic cell therapy.
  • the present application provides an immune effector cell, wherein the function of T cell antigen receptor (TCR) and major histocompatibility complex (MHCI, MHCII) in the immune effector cell is inhibited in the cell, And the immune effector cells comprise a chimeric antigen receptor (CAR) targeting IL13R ⁇ 2.
  • TCR T cell antigen receptor
  • MHCI major histocompatibility complex
  • MHCII major histocompatibility complex
  • CAR chimeric antigen receptor
  • the chimeric antigen receptor (CAR) targeting IL13R ⁇ 2 comprises a targeting moiety comprising at least one complementarity determining region (CDR) of an antibody heavy chain variable region (VH)
  • the VH comprises the amino acid sequence shown in SEQ ID NO:18.
  • the VH comprises the amino acid sequence shown in SEQ ID NO: 16 or SEQ ID NO: 17.
  • the chimeric antigen receptor (CAR) targeting IL13R ⁇ 2 comprises a targeting moiety comprising a VH comprising a heavy chain complementarity determining region 1 (HCDR1), a heavy chain Chain complementarity determining region 2 (HCDR2) and heavy chain complementarity determining region 3 (HCDR3), said HCDR3 comprising the amino acid sequence shown in SEQ ID NO:3.
  • CAR chimeric antigen receptor
  • the HCDR2 comprises the amino acid sequence shown in SEQ ID NO:2.
  • the HCDR1 comprises the amino acid sequence shown in SEQ ID NO:1.
  • the VH comprises: HCDR1 comprising the amino acid sequence shown in SEQ ID NO:1, HCDR2 comprising the amino acid sequence shown in SEQ ID NO:2 and comprising the amino acid shown in SEQ ID NO:3 Sequence of HCDR3.
  • the VH comprises heavy chain framework region 1 (HFR1), heavy chain framework region 2 (HFR2), heavy chain framework region 3 (HFR3) and heavy chain framework region 4 (HFR4), the HFR1 Comprising the amino acid sequence shown in SEQ ID NO:4.
  • the HFR1 comprises the amino acid sequence shown in SEQ ID NO:8 or SEQ ID NO:12.
  • the HFR2 comprises the amino acid sequence shown in SEQ ID NO:5.
  • the HFR2 comprises the amino acid sequence shown in SEQ ID NO:9 or SEQ ID NO:13.
  • the HFR3 comprises the amino acid sequence shown in SEQ ID NO:6.
  • the HFR3 comprises the amino acid sequence shown in SEQ ID NO: 10 or SEQ ID NO: 14.
  • the HFR4 comprises the amino acid sequence shown in SEQ ID NO:7.
  • the HFR4 comprises the amino acid sequence shown in SEQ ID NO: 11 or SEQ ID NO: 15.
  • said VH comprises HFR1, HFR2, HFR3 and HFR4, and said HFR1, HFR2, HFR3 and HFR4 are selected from
  • HFR1 comprising the amino acid sequence shown in SEQ ID NO:8
  • HFR2 comprising the amino acid sequence shown in SEQ ID NO:9
  • HFR3 comprising the amino acid sequence shown in SEQ ID NO:10, comprising SEQ ID NO:11 HFR4 of the indicated amino acid sequence
  • HFR1 comprising the amino acid sequence shown in SEQ ID NO:12
  • HFR2 comprising the amino acid sequence shown in SEQ ID NO:13
  • HFR3 comprising the amino acid sequence shown in SEQ ID NO:14, comprising SEQ ID NO:15
  • the amino acid sequence of HFR4 is shown.
  • the VH comprises the amino acid sequence shown in SEQ ID NO: 18.
  • the VH comprises the amino acid sequence shown in SEQ ID NO: 16 or SEQ ID NO: 17.
  • the targeting moiety further comprises at least one CDR of an antibody light chain variable region (VL), said VL comprising the amino acid sequence shown in SEQ ID NO:36.
  • VL antibody light chain variable region
  • the VL comprises the amino acid sequence shown in SEQ ID NO:34 or SEQ ID NO:35.
  • the targeting moiety comprises at least one CDR of VH and at least one CDR of VL, and the VH and VL are selected from:
  • VH comprising the amino acid sequence shown in SEQ ID NO:16
  • VL comprising the amino acid sequence shown in SEQ ID NO:34
  • VH comprising the amino acid sequence shown in SEQ ID NO:17
  • VL comprising the amino acid sequence shown in SEQ ID NO:35.
  • the chimeric antigen receptor (CAR) targeting IL13R ⁇ 2 comprises a targeting moiety comprising a VL comprising light chain complementarity determining region 1 (LCDR1), light Chain complementarity determining region 2 (LCDR2) and light chain complementarity determining region 3 (LCDR3), said LCDR1 comprising the amino acid sequence shown in SEQ ID NO:19.
  • the LCDR2 comprises the amino acid sequence shown in SEQ ID NO:20.
  • the LCDR3 comprises the amino acid sequence shown in SEQ ID NO:21.
  • the VL comprises: LCDR1 comprising the amino acid sequence shown in SEQ ID NO:19, LCDR2 comprising the amino acid sequence shown in SEQ ID NO:20 and comprising the amino acid shown in SEQ ID NO:21 Serial LCDR3.
  • said VL comprises light chain framework region 1 (LFR1), light chain framework region 2 (LFR2), light chain framework region 3 (LFR3) and light chain framework region 4 (LFR4), said LFR1 Comprising the amino acid sequence shown in SEQ ID NO:22.
  • the LFR1 comprises the amino acid sequence shown in SEQ ID NO:26 or SEQ ID NO:30.
  • the LFR2 comprises the amino acid sequence shown in SEQ ID NO:23.
  • the LFR2 comprises the amino acid sequence shown in SEQ ID NO:27 or SEQ ID NO:31.
  • the LFR3 comprises the amino acid sequence shown in SEQ ID NO:24.
  • the LFR3 comprises the amino acid sequence shown in SEQ ID NO:28 or SEQ ID NO:32.
  • the LFR4 comprises the amino acid sequence shown in SEQ ID NO:25.
  • the LFR4 comprises the amino acid sequence shown in SEQ ID NO:29 or SEQ ID NO:33.
  • said VL comprises LFR1, LFR2, LFR3 and LFR4, and said LFR1, LFR2, LFR3 and LFR4 are selected from
  • LFR1 comprising the amino acid sequence shown in SEQ ID NO:26
  • LFR2 comprising the amino acid sequence shown in SEQ ID NO:27
  • LFR3 comprising the amino acid sequence shown in SEQ ID NO:28, comprising SEQ ID NO:29 LFR4 of the indicated amino acid sequence
  • LFR1 comprising the amino acid sequence shown in SEQ ID NO:30
  • LFR2 comprising the amino acid sequence shown in SEQ ID NO:31
  • LFR3 of the amino acid sequence shown in SEQ ID NO:32
  • SEQ ID NO:33 The amino acid sequence of LFR4 is shown.
  • the VL comprises the amino acid sequence shown in SEQ ID NO:36.
  • the VL comprises the amino acid sequence shown in SEQ ID NO:34 or SEQ ID NO:35.
  • the targeting moiety comprises VH and VL, wherein the VH comprises the amino acid sequence shown in SEQ ID NO:18, and the VL comprises the amino acid sequence shown in SEQ ID NO:36.
  • the VH and VL are selected from:
  • VH comprising the amino acid sequence shown in SEQ ID NO:16
  • VL comprising the amino acid sequence shown in SEQ ID NO:34
  • VH comprising the amino acid sequence shown in SEQ ID NO:17
  • VL comprising the amino acid sequence shown in SEQ ID NO:35.
  • the targeting moiety comprises a full length antibody, Fab, single chain variable fragment (scFv) or single domain antibody (VHH).
  • the targeting moiety comprises a scFv.
  • the targeting moiety comprises the amino acid sequence shown in SEQ ID NO:41 or SEQ ID NO:44.
  • the targeting moiety comprises the amino acid sequence shown in SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:42 or SEQ ID NO:43.
  • the chimeric antigen receptor (CAR) targeting IL13R ⁇ 2 comprises a targeting moiety comprising at least one complementarity determining region (CDR) of an antibody heavy chain variable region (VH)
  • the VH comprises the amino acid sequence shown in SEQ ID NO:56.
  • the chimeric antigen receptor (CAR) targeting IL13R ⁇ 2 comprises a targeting moiety comprising a VH comprising a heavy chain complementarity determining region 1 (HCDR1), a heavy chain Chain complementarity determining region 2 (HCDR2) and heavy chain complementarity determining region 3 (HCDR3), said HCDR3 comprising the amino acid sequence shown in SEQ ID NO:55.
  • CAR chimeric antigen receptor
  • the HCDR2 comprises the amino acid sequence shown in SEQ ID NO:54.
  • the HCDR1 comprises the amino acid sequence shown in SEQ ID NO:53.
  • the VH comprises: HCDR1 comprising the amino acid sequence shown in SEQ ID NO:53, HCDR2 comprising the amino acid sequence shown in SEQ ID NO:54, and comprising the amino acid sequence shown in SEQ ID NO:55 Sequence of HCDR3.
  • the VH comprises the amino acid sequence shown in SEQ ID NO:56.
  • the targeting moiety further comprises at least one CDR of an antibody light chain variable region (VL), said VL comprising the amino acid sequence shown in SEQ ID NO:60.
  • VL antibody light chain variable region
  • the targeting moiety comprises at least one CDR of VH and at least one CDR of VL, and the VH comprises the amino acid sequence shown in SEQ ID NO:56, and the VL comprises SEQ ID NO:60 Amino acid sequence shown.
  • the chimeric antigen receptor (CAR) targeting IL13R ⁇ 2 comprises a targeting moiety comprising a VL comprising light chain complementarity determining region 1 (LCDR1), light Chain complementarity determining region 2 (LCDR2) and light chain complementarity determining region 3 (LCDR3), said LCDR1 comprising the amino acid sequence shown in SEQ ID NO:57.
  • LCDR1 light chain complementarity determining region 1
  • LCDR2 light Chain complementarity determining region 2
  • LCDR3 light chain complementarity determining region 3
  • the LCDR2 comprises the amino acid sequence shown in SEQ ID NO:58.
  • the LCDR3 comprises the amino acid sequence shown in SEQ ID NO:59.
  • the VL comprises: LCDR1 comprising the amino acid sequence shown in SEQ ID NO:57, LCDR2 comprising the amino acid sequence shown in SEQ ID NO:58, and comprising the amino acid sequence shown in SEQ ID NO:59 Serial LCDR3.
  • the VL comprises the amino acid sequence shown in SEQ ID NO:60.
  • the targeting moiety comprises VH and VL, wherein the VH comprises the amino acid sequence shown in SEQ ID NO:56, and the VL comprises the amino acid sequence shown in SEQ ID NO:60.
  • the targeting moiety comprises a full length antibody, Fab, single chain variable fragment (scFv) or single domain antibody (VHH).
  • the targeting moiety comprises a scFv.
  • the targeting moiety comprises the amino acid sequence shown in SEQ ID NO:61 or SEQ ID NO:62.
  • the CAR includes a transmembrane domain comprising a transmembrane domain derived from one or more proteins selected from the group consisting of: CD8A, CD8B, CD28, CD3 ⁇ (CD3e) , 4-1BB, CD4, CD27, CD7, PD-1, TRAC, TRBC, CD3 ⁇ , CTLA-4, LAG-3, CD5, ICOS, OX40, NKG2D, 2B4, CD244, Fc ⁇ RI ⁇ , BTLA, CD30, GITR, HVEM , DAP10, CD2, NKG2C, LIGHT, DAP12, CD40L (CD154), TIM1, CD226, DR3, CD45, CD80, CD86, CD9, CD16, CD22, CD33, CD37, CD64, and SLAM.
  • proteins selected from the group consisting of: CD8A, CD8B, CD28, CD3 ⁇ (CD3e) , 4-1BB, CD4, CD27, CD7, PD-1, TRAC, TRBC
  • transmembrane domain comprises a transmembrane domain derived from CD8A.
  • transmembrane domain comprises the amino acid sequence shown in any one of SEQ ID NO:69 to SEQ ID NO:117.
  • the CAR includes an intracellular co-stimulatory signaling domain comprising an intracellular co-stimulatory protein derived from one or more proteins selected from the group consisting of: Signal transduction domain: CD28, 4-1BB (CD137), CD27, CD2, CD7, CD8A, CD8B, OX40, CD226, DR3, SLAM, CDS, ICAM-1, NKG2D, NKG2C, B7-H3, 2B4, Fc ⁇ RI ⁇ , BTLA, GITR, HVEM, DAP10, DAP12, CD30, CD40, CD40L, TIM1, PD-1, LFA-1, LIGHT, JAML, CD244, CD100, ICOS, CD40, and MyD88.
  • Signal transduction domain CD28, 4-1BB (CD137), CD27, CD2, CD7, CD8A, CD8B, OX40, CD226, DR3, SLAM, CDS, ICAM-1, NKG2D, NKG2C, B7-H3, 2B4,
  • the intracellular costimulatory signaling domain is derived from a costimulatory signaling domain of 4-1BB.
  • the intracellular co-stimulatory signaling domain comprises the amino acid sequence shown in any one of SEQ ID NO: 118 to SEQ ID NO: 150.
  • the CAR includes an intracellular signaling domain comprising an intracellular signaling structure derived from one or more proteins selected from the group consisting of Domains: CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD79a, CD79b, FceRI ⁇ , FceRI ⁇ , Fc ⁇ RIIa, bovine leukemia virus gp30, Epstein-Barr virus (EBV) LMP2A, simian immunodeficiency virus PBj14Nef, DAP10, DAP-12 and contains at least one ITAM domain.
  • CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD79a, CD79b proteins selected from the group consisting of Domains: CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD79a, CD79b, FceRI ⁇ , FceRI ⁇ , Fc ⁇ RIIa, bovine leukemia virus gp30, Epstein-Barr virus (EBV) LMP2A, simian immunodeficiency virus PBj14Nef,
  • the intracellular signaling domain comprises a signaling domain derived from CD3 ⁇ .
  • said intracellular signal transduction domain comprises any of SEQ ID NO: 134, SEQ ID NO: 138, SEQ ID NO: 139, SEQ ID NO: 151 to SEQ ID NO: 161
  • SEQ ID NO: 134 amino acid sequence shown in item.
  • SEQ ID NO: 138 amino acid sequence shown in item.
  • SEQ ID NO: 139 amino acid sequence shown in item.
  • the CAR includes a hinge region between the targeting moiety and the transmembrane domain, the hinge region comprising a hinge region derived from one or more proteins selected from the group consisting of: CD28, IgG1 , IgG4, IgD, 4-1BB, CD4, CD27, CD7, CD8A, PD-1, ICOS, OX40, NKG2D, NKG2C, Fc ⁇ RI ⁇ , BTLA, GITR, DAP10, TIM1, SLAM, CD30, and LIGHT.
  • proteins selected from the group consisting of: CD28, IgG1 , IgG4, IgD, 4-1BB, CD4, CD27, CD7, CD8A, PD-1, ICOS, OX40, NKG2D, NKG2C, Fc ⁇ RI ⁇ , BTLA, GITR, DAP10, TIM1, SLAM, CD30, and LIGHT.
  • the hinge region comprises a hinge region derived from CD8A.
  • the hinge region comprises the amino acid sequence shown in any one of SEQ ID NO: 162 to SEQ ID NO: 183.
  • the non-targeting portion of the chimeric antigen receptor comprises the transmembrane domain of the CD8A molecule, the hinge region of CD8A, the intracellular co-stimulatory signaling domain of 4-1BB, and the CD3 ⁇ intracellular signaling structure area.
  • the non-targeting portion of the chimeric antigen receptor comprises the amino acid sequence set forth in SEQ ID NO:67.
  • it further comprises a signal peptide fragment, the C-terminus of the signal peptide fragment is connected to the N-terminus of the targeting moiety.
  • the signal peptide fragment comprises a CD8A signal peptide fragment.
  • the signal peptide fragment comprises the amino acid sequence shown in SEQ ID NO: 184.
  • the chimeric antigen receptor comprises the amino acid sequence shown in any one of SEQ ID NO:45 or SEQ ID NO:46.
  • the immune effector cells include human cells.
  • the immune effector cells include T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, monocytes, dendritic cells, granulocytes, lymphocytes, leukocytes and/or peripheral blood mononuclear cells.
  • NK cells natural killer cells
  • macrophages include T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, monocytes, dendritic cells, granulocytes, lymphocytes, leukocytes and/or peripheral blood mononuclear cells.
  • the immune effector cells comprise autologous or non-autologous immune effector cells.
  • the immune effector cells include modified immune effector cells, wherein the modification includes down-regulation of the expression and/or activity of one or more genes associated with immune rejection.
  • the gene related to immune rejection is selected from one or more genes in the group consisting of TRAC, TRBC, HLA-A, HLA-B, B2M and CIITA.
  • the expression and/or activity of the TRAC gene and the HLA-A gene are down-regulated in the modified immune effector cells compared to the unmodified corresponding cells.
  • the expression and/or activity of the CIITA gene is not down-regulated in the modified immune effector cells compared to the corresponding cells without the modification.
  • the expression and/or activity of the B2M gene is not down-regulated in the modified immune effector cells compared to the corresponding cells without the modification.
  • the expression and/or activity of the TRAC gene and the HLA-A gene are down-regulated in the modified immune effector cells compared to the corresponding wild-type cells.
  • the expression and/or activity of the B2M gene is not down-regulated in the modified immune effector cells compared to the corresponding wild-type cells.
  • the expression and/or activity of the CIITA gene is not down-regulated in the modified immune effector cells compared to the corresponding wild-type cells.
  • the expression level and/or activity of the gene is down-regulated, including down-regulating the expression and/or activity of a nucleic acid molecule encoding the gene; and/or down-regulating the expression of a protein product encoded by the gene and/or activity is downregulated.
  • the modification includes: gene knockout, gene mutation and/or gene silencing.
  • the modification comprises the knockout of either of the two TRAC alleles and the knockout of either of the two HLA-A alleles in the immune effector cells.
  • the modification comprises knockout of two TRAC alleles and knockout of either of the two HLA-A alleles in the immune cells.
  • the modification comprises knockout of exon of TRAC gene and knockout of exon of HLA-A gene in the immune cells.
  • said modification comprises administering to said immune effector cells one or more substances selected from the group consisting of antisense RNA, siRNA, shRNA and CRISPR/Cas9 system.
  • said modification comprises administering a CRISPR/Cas9 system to said immune effector cells.
  • the modification further comprises administering to the immune effector cells sgRNA targeting the exon portion of the TRAC gene.
  • the sgRNA targeting the exon portion of the TRAC gene comprises the nucleotide sequence shown in any one of SEQ ID NO:186 to SEQ ID NO:200.
  • the modification comprises administering to the immune effector cells an sgRNA targeting an exon portion of the HLA-A gene.
  • the sgRNA targeting the exon portion of the HLA-A gene comprises the nucleotide sequence shown in any one of SEQ ID NO:201 to SEQ ID NO:241.
  • said modification further comprises administering a Cas enzyme to said cells.
  • the Cas enzyme comprises a Cas9 protein.
  • said antisense RNA comprises the nucleotide sequence shown in any one of SEQ ID NO:242 to SEQ ID NO:245.
  • the immune effector cells are HLA-B homozygous cells.
  • HLA-B homozygote includes HLA-B*40 homozygote, HLA-B*15 homozygote, HLA-B*46 homozygote, HLA-B*13 homozygote, HLA-B* B*51 homozygote, HLA-B*58 homozygote, HLA-B*07 homozygote, HLA-B*35 homozygote, HLA-B*44 homozygote, HLA-B*52 homozygote, HLA-B* 57 homozygous, HLA-B*54 homozygous, HLA-B*55 homozygous.
  • the immune effector cells are HLA-A homozygous or heterozygous cells.
  • HLA-A homozygote or heterozygote comprises HLA-A*02 homozygote, HLA-A*11 homozygote, HLA-A*02/A*11 heterozygote or HLA-A *24 homozygotes.
  • the present application provides a method for preparing the aforementioned immune effector cells, which includes: introducing into the immune effector cells a polynucleotide sequence encoding the aforementioned CAR targeting IL13R ⁇ 2 or comprising a polynucleotide encoding the aforementioned CAR targeting IL13R ⁇ 2 Before/after the carrier of the sequence, the immune effector cells are modified, and the modification includes down-regulation of the expression and/or activity of one or more genes related to immune rejection.
  • the vector is an expression vector.
  • the vector is selected from DNA vectors, RNA vectors, plasmids, lentiviral vectors, adenoviral vectors, adeno-associated viral vectors and retroviral vectors.
  • the gene related to immune rejection is selected from one or more genes in the group consisting of TRAC, TRBC, HLA-A, HLA-B, B2M and CIITA.
  • the expression and/or activity of the TRAC gene and the HLA-A gene in said immune effector cells are down-regulated compared to the expression and/or activity of the corresponding genes in corresponding cells without said modification.
  • the expression and/or activity of the CIITA gene is not down-regulated compared to the expression and/or activity of the corresponding gene in a corresponding cell without said modification.
  • the expression and/or activity of the B2M gene is not down-regulated compared to the expression and/or activity of the corresponding gene in a corresponding cell without said modification.
  • the expression and/or activity of the TRAC gene and the HLA-A gene of the immune effector cells is down-regulated compared to corresponding wild-type cells.
  • the expression and/or activity of the CIITA gene is not downregulated compared to corresponding wild-type cells.
  • the expression and/or activity of the B2M gene is not down-regulated compared to corresponding wild-type cells.
  • the expression level and/or activity of the gene is down-regulated, including down-regulating the expression and/or activity of a nucleic acid molecule encoding the gene; and/or down-regulating the expression of a protein product encoded by the gene and/or activity is downregulated.
  • the modification includes: gene knockout, gene mutation and/or gene silencing.
  • the modification comprises the knockout of either of the two TRAC alleles and the knockout of either of the two HLA-A alleles in the immune effector cells.
  • the modification comprises knockout of two TRAC alleles and knockout of either of the two HLA-A alleles in the immune cells.
  • the modification comprises knockout of exon of TRAC gene and knockout of exon of HLA-A gene in the immune cells.
  • said modification comprises administering to said immune effector cells one or more substances selected from the group consisting of antisense RNA, siRNA, shRNA and CRISPR/Cas9 system.
  • said modification comprises administering a CRISPR/Cas9 system to said immune effector cells.
  • the modification comprises administering to the immune effector cells an sgRNA targeting an exon portion of the TRAC gene.
  • the sgRNA targeting the exon portion of the TRAC gene comprises the nucleotide sequence shown in any one of SEQ ID NO:186 to SEQ ID NO:200.
  • the modification comprises administering to the immune effector cells an sgRNA targeting an exon portion of the HLA-A gene.
  • the sgRNA targeting the exon portion of the HLA-A gene comprises the nucleotide sequence shown in any one of SEQ ID NO:201 to SEQ ID NO:241.
  • said modification further comprises administering a Cas enzyme to said cells.
  • the Cas enzyme comprises a Cas9 protein.
  • said antisense RNA comprises the nucleotide sequence shown in any one of SEQ ID NO:242 to SEQ ID NO:245.
  • the immune effector cells comprise human cells.
  • the immune effector cells include T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, monocytes, dendritic cells, granulocytes, lymphocytes, leukocytes and/or peripheral blood mononuclear cells.
  • NK cells natural killer cells
  • macrophages include T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, monocytes, dendritic cells, granulocytes, lymphocytes, leukocytes and/or peripheral blood mononuclear cells.
  • the immune effector cells comprise autologous or non-autologous immune effector cells.
  • the cells are homozygous for HLA-B.
  • HLA-B homozygote includes HLA-B*40 homozygote, HLA-B*15 homozygote, HLA-B*46 homozygote, HLA-B*13 homozygote, HLA-B* B*51 homozygote, HLA-B*58 homozygote, HLA-B*07 homozygote, HLA-B*35 homozygote, HLA-B*44 homozygote, HLA-B*52 homozygote, HLA-B* 57 homozygous, HLA-B*54 homozygous, HLA-B*55 homozygous.
  • the cells are HLA-A homozygous or heterozygous cells.
  • HLA-A homozygote or heterozygote comprises HLA-A*02 homozygote, HLA-A*11 homozygote, HLA-A*02/A*11 heterozygote or HLA-A *24 homozygotes.
  • the present application also provides the application of the aforementioned immune effector cells in the preparation of CAR-T cells.
  • the present application also provides a pharmaceutical composition, which comprises the aforementioned immune effector cells, and optionally a pharmaceutically acceptable carrier.
  • the present application also provides the aforementioned immune effector cells and/or the aforementioned pharmaceutical composition, which are used for treating diseases or disorders related to the expression of IL13R ⁇ 2.
  • the disease or disorder associated with the expression of IL13R ⁇ 2 comprises a disease or disorder associated with upregulated expression of IL13R ⁇ 2.
  • the disease or disorder associated with expression of IL13R ⁇ 2 comprises cancer.
  • the cancer comprises IL13R ⁇ positive tumors.
  • the IL13R ⁇ -positive tumors include malignant glioma, colorectal cancer, cervical cancer, pancreatic cancer, skin melanoma, ovarian cancer, breast cancer, adrenocortical carcinoma, thymoma, uterine cancer, bladder cancer cancer, esophageal cancer, squamous cell carcinoma of the head and neck, or gastric cancer.
  • the present application also provides the use of the aforementioned immune effector cells and/or the aforementioned pharmaceutical composition in the preparation of medicines for treating diseases or conditions related to the expression of IL13R ⁇ 2.
  • the disease or disorder associated with the expression of IL13R ⁇ 2 comprises a disease or disorder associated with upregulated expression of IL13R ⁇ 2.
  • the disease or disorder associated with expression of IL13R ⁇ 2 comprises cancer.
  • the cancer comprises IL13R ⁇ positive tumors.
  • the IL13R ⁇ -positive tumors include malignant glioma, colorectal cancer, cervical cancer, pancreatic cancer, skin melanoma, ovarian cancer, breast cancer, adrenocortical carcinoma, thymoma, uterine cancer, bladder cancer cancer, esophageal cancer, squamous cell carcinoma of the head and neck, or gastric cancer.
  • the present application also provides a method for preventing or treating a disease or disorder related to the expression of IL13R ⁇ 2, which comprises administering an effective amount of the aforementioned immune effector cells and/or the aforementioned drug combination to a subject in need things.
  • the disease or disorder associated with the expression of IL13R ⁇ 2 comprises a disease or disorder associated with upregulated expression of IL13R ⁇ 2.
  • the disease or disorder associated with expression of IL13R ⁇ 2 comprises cancer.
  • the cancer comprises IL13R ⁇ positive tumors.
  • the IL13R ⁇ -positive tumors include malignant glioma, colorectal cancer, cervical cancer, pancreatic cancer, skin melanoma, ovarian cancer, breast cancer, adrenocortical carcinoma, thymoma, uterine cancer, bladder cancer cancer, esophageal cancer, squamous cell carcinoma of the head and neck, or gastric cancer.
  • Figure 1 shows a schematic diagram of the structure of the anti-IL13R ⁇ 2 CAR described in this application
  • Figure 2 shows the construction strategy of anti-IL13R ⁇ 2 UCAR-T cells described in the present application
  • Figures 3A-3C show the phenotype detection results of anti-IL13R ⁇ 2 UCAR-T cells (mouse source) described in the present application;
  • Figure 4 shows the results of killing target cells by anti-IL13R ⁇ 2 UCAR-T cells (mouse source) described in the present application;
  • Figures 5A-5C show the results of co-culture cytokine secretion detection of IL13R ⁇ 2 UCAR-T cells (mouse source) and target cells described in the present application;
  • Figure 6 shows the anti-tumor effect of the anti-IL13R ⁇ 2 UCAR-T cells (mouse source) described in the application;
  • Figure 7 shows the results of the in vivo half-life detection of anti-IL13R ⁇ 2 UCAR-T cells described in the present application.
  • Figure 8 shows the in vitro GVHD results of anti-IL13R ⁇ 2 UCAR-T cells described in the present application.
  • Figure 9 shows the results of in vitro rejection of anti-IL13R ⁇ 2 UCAR-T cells described in the present application.
  • Figures 10A-10D show the GVHD results of anti-IL13R ⁇ 2 UCAR-T cells described in this application in vivo;
  • Figures 11-12 show the results of in vitro rejection of anti-IL13R ⁇ 2 UCAR-T cells described in this application;
  • Figure 13 shows the off-target analysis of anti-IL13R ⁇ 2 UCAR-T cells described in the present application
  • Figure 14 shows the chromosomal translocation analysis of anti-IL13R ⁇ 2 UCAR-T cells described in the present application
  • Figure 15 shows the karyotype analysis of anti-IL13R ⁇ 2 UCAR-T cells described in the present application.
  • Figure 16 shows the Cas9 residue analysis of anti-IL13R ⁇ 2 UCAR-T cells described in the present application
  • FIG. 17 shows the results of Sanger sequencing of the TRAC gene in this application after Sg9RNA editing
  • Figure 18 shows the results of TA clone detection of the TRAC gene in this application after Sg9RNA editing
  • Figure 19 shows the results of flow cytometry detection of the TRAC gene in the present application after Sg9RNA editing
  • Figure 20 shows the results of Sanger sequencing of the HLA-A02 gene in this application after Sg2RNA editing
  • Figure 21 shows the results of Sanger sequencing of the HLA-A02 gene in this application after Sg5RNA editing
  • Figure 22 shows the results of Sanger sequencing of the HLA-A11 gene in this application after Sg21RNA editing
  • Figure 23 shows the results of Sanger sequencing of the HLA-A11 gene in this application after Rsg2RNA editing
  • Figures 24A-24B show the results of simultaneous knockout of HLA-A02 and TRAC in the modified immune effector cells of the present application
  • FIGS 25A-25B show the protein levels of HLA-A02 and TRAC in the modified immune effector cells of the present application
  • Figure 26 shows the mRNA levels of TRAC, HLA-A, B2M and CIITA in the modified immune effector cells of the present application
  • Figures 27A-27B show the protein levels of B2M and CIITA in the modified immune effector cells of the present application
  • Figures 28A-28D show the protein levels of TRAC, HLA-A, B2M and CIITA in the modified immune effector cells of the present application;
  • Figures 29A-29B show the knockout situation of TRAC and HLA-A mRNA levels in the modified immune effector cells of the present application
  • FIGS 30A-30B show the protein levels of CD69 and CD137 in the modified immune effector cells of the present application
  • Figure 31 shows the co-cultivation of the modified immune effector cells and NK cells of the present application
  • Figure 32 shows the level of IFN- ⁇ expressed by the modified immune effector cells of the present application
  • Figures 33A-33D show the protein levels of TRAC, HLA-A, B2M and CIITA in the modified immune effector cells of the present application;
  • Figure 34 shows the infection efficiency of the modified immune effector cells of the present application to CAR
  • Figure 35 shows the amplification factor of the modified immune effector cells of the present application
  • Figure 36 shows the killing effect of the modified immune effector cells of the present application on CD19 positive target cells
  • Figure 37 shows the dosage regimen for administering the modified immune effector cells of the present application
  • Figure 38 shows the killing effect of the modified immune effector cells of the present application on tumors in mice.
  • chimeric antigen receptor generally refers to a group of polypeptides, usually two in the simplest embodiment, which, when in immune effector cells, provide cellular (usually cancer cells) and generate intracellular signals.
  • the CAR comprises at least one extracellular antigen-binding domain (such as a VHH, scFv, or portion thereof), a transmembrane domain, and a cytoplasmic signaling domain (also referred to herein as an "intracellular signaling domain”). ”) comprising a functional signaling domain derived from a stimulatory molecule and/or a co-stimulatory molecule as defined below.
  • the set of polypeptides are in the same polypeptide chain (eg, comprising chimeric fusion proteins). In some embodiments, the set of polypeptides is discontinuous from each other, eg, in different polypeptide chains. In some aspects, the set of polypeptides includes a dimerization switch that, in the presence of a dimerization molecule, can couple the polypeptides to each other, eg, can couple an antigen binding domain to an intracellular signaling domain. In one aspect, the stimulatory molecule of the CAR is the zeta chain associated with the T cell receptor complex. In one aspect, the cytoplasmic signaling domain comprises a primary signaling domain (eg, the primary signaling domain of CD3-zeta).
  • the cytoplasmic signaling domain further comprises one or more functional signaling domains derived from at least one co-stimulatory molecule as defined below.
  • the co-stimulatory molecule may be selected from 4-1BB (ie CD137), CD27, ICOS and/or CD28.
  • a CAR comprises a chimeric fusion protein that may comprise an extracellular antigen recognition domain, a transmembrane domain and an intracellular signaling domain comprising a functional signaling domain derived from a stimulatory molecule.
  • the CAR comprises a chimeric fusion protein that may comprise an extracellular antigen recognition domain, a transmembrane domain and an intracellular signaling domain comprising a functional signaling structure derived from a co-stimulatory molecule domains and functional signaling domains derived from stimulatory molecules.
  • a CAR comprises a chimeric fusion protein that may comprise an extracellular antigen recognition domain, a transmembrane domain and an intracellular signaling domain comprising functions derived from one or more co-stimulatory molecules Sexual signaling domains and functional signaling domains derived from stimulatory molecules.
  • the CAR comprises a chimeric fusion protein which may comprise an extracellular antigen recognition domain, a transmembrane domain and an intracellular signaling domain comprising at least two co-stimulatory domains derived from one or more co-stimulatory domains.
  • the CAR comprises an optional leader sequence at the amino terminus (N-ter) of the CAR fusion protein.
  • the CAR further comprises a leader sequence at the N-terminus of the extracellular antigen recognition domain, wherein the leader sequence is optionally cleaved from the antigen recognition domain (e.g., VHH) during cellular processing and localizes the CAR to the cell membrane.
  • the antigen recognition domain e.g., VHH
  • IL-13R ⁇ 2 interleukin-13 receptor subunit alpha-2
  • CD213A2, 213A2 cluster of differentiation has its ordinary and conventional meaning and may include, but is not limited to, e.g. An membrane-bound protein encoded by the IL-13RA2 gene.
  • IL-13R ⁇ 2 is closely related to IL-13R ⁇ 1, a subunit of the interleukin-13 receptor complex.
  • IL-13R ⁇ 2 normally binds IL-13 with high affinity, but lacks any distinct cytoplasmic domain and does not appear to act as a signaling mediator. However, it is capable of modulating the action of both IL-13 and IL-4, although it cannot bind directly to the latter. It has also been reported to play a role in the internalization of IL-13.
  • antibody is generally used in the broadest sense and specifically covers monoclonal antibodies, polyclonal antibodies, dimers, multimers, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments as long as they show the desired biological activity (Miller et al (2003) Jour. of Immunology 170:4854-4861).
  • Antibodies can be murine, human, humanized, chimeric, or derived from other species.
  • a full-length antibody typically refers to an antibody consisting of two “full-length antibody heavy chains” and two “full-length antibody light chains”.
  • a “full-length antibody heavy chain” is generally a polypeptide consisting, in the N-terminal to C-terminal direction, of an antibody heavy chain variable domain (VH), an antibody constant heavy chain domain 1 (CH1), an antibody hinge region (HR) , antibody heavy chain constant domain 2 (CH2), and antibody heavy chain constant domain 3 (CH3), abbreviated as VH-CH1-HR-CH2-CH3; and in the case of antibodies of the IgE subclass, optionally It also includes the antibody heavy chain constant domain 4 (CH4).
  • VH antibody heavy chain variable domain
  • CH1 antibody constant heavy chain domain 1
  • HR antibody hinge region
  • CH2 antibody heavy chain constant domain 2
  • CH3 antibody heavy chain constant domain 3
  • a "full-length antibody heavy chain” is a polypeptide consisting of VH, CH1, HR, CH2 and CH3 in an N-terminal to C-terminal direction.
  • a “full-length antibody light chain” is generally a polypeptide consisting of an antibody light chain variable domain (VL) and an antibody light chain constant domain (CL) in the N-terminal to C-terminal direction, abbreviated as VL-CL.
  • the antibody light chain constant domain (CL) may be kappa (kappa) or lambda (lambda).
  • the two full-length antibody chains are linked together by an inter-polypeptide disulfide bond between the CL domain and the CH1 domain and between the hinge region of the full-length antibody heavy chain.
  • Typical examples of full-length antibodies are natural antibodies such as IgG (eg, IgGl and IgG2), IgM, IgA, IgD, and IgE).
  • antigen-binding fragment generally refers to a portion of an antibody molecule that contains the antigen responsible for the specificity between the antibody and the antigen. combined amino acids.
  • the portion of an antigen that is specifically recognized and bound by an antibody is called an "epitope" as described above.
  • An antigen binding domain will typically comprise an antibody light chain variable region (VL) and an antibody heavy chain variable region (VH); however, it need not comprise both.
  • Fd fragments for example, have two VH regions and typically retain some antigen-binding function of the full antigen-binding domain.
  • antigen-binding fragments of antibodies include (1) Fab fragments, monovalent fragments having VL, VH, constant light chain (CL) and CH1 domains; (2) F(ab') 2 fragments, having two Bivalent fragment of two Fab fragments connected by sulfur bridge; (3) Fd fragment with two VH and CH1 domains; (4) Fv fragment with VL and VH domains of antibody single arm, (5) dAb fragment (Ward et al., "Binding Activities of a Repertoire of Single Immunoglobulin Variable Domains Secreted From Escherichia coli," Nature 341:544-546 (1989), which is hereby incorporated by reference in its entirety), which has a VH domain; (6) Isolated Complementarity Determining Regions (CDRs); (7) Single-chain Fv (scFv), for example derived from a scFv-library.
  • Fab fragments monovalent fragments having VL, VH, constant light chain (CL) and CH1 domains
  • the two domains VL and VH of the Fv fragment are encoded by separate genes, they can be joined using recombinant methods by a synthetic linker that allows it to be produced as a single protein in which the VL and VH regions pair to form a monovalent molecule chain (termed single-chain Fv (scFv)) (see, e.g., Huston et al., "Protein Engineering of Antibody Binding Sites: Recovery of Specific Activity in an Anti-Digoxin Single-Chain Fv Analogue Produced in Escherichia coli," Proc.
  • scFv single-chain Fv
  • VHH involves variable antigen binding from heavy chain antibodies from Camelidae (camel, dromedary, llama, alpaca, etc.) domain (see Nguyen VK et al., 2000, The EMBO Journal, 19, 921-930; Muyldermans S., 2001, J Biotechnol., 74, 277-302 and review Vanlandschoot P. et al., 2011, Antiviral Research 92, 389-407). VHHs may also be referred to as Nanobodies (Nb) and/or Single Domain Antibodies.
  • Antigen-binding fragments targeting IL13R ⁇ 2 are also described in International Patent Application Publications WO2014072888A1 and WO2021041725A1, each of which is incorporated herein by reference in its entirety.
  • single domain antibody or “VHH” generally refers to a class of antibodies that lack the light chain of the antibody and only have the variable region of the heavy chain.
  • the single domain antibody can be from a Bactrian camel, a dromedary, an alpaca, a llama, a nurse shark, a great star shark, or a ray (for example, see Kang Xiaozhen et al., Acta Biological Engineering, 2018, 34( 12): 1974-1984).
  • single domain antibodies can be from alpacas.
  • Single domain antibodies can be composed of a heavy chain variable region (VH).
  • heavy chain variable region generally refers to the amino-terminal domain of the heavy chain of an antigen-binding fragment.
  • the heavy chain variable region can be further divided into hypervariable regions called complementarity determining regions (CDRs), which are interspersed in more conserved regions known as the framework regions (FRs).
  • CDRs complementarity determining regions
  • FRs framework regions
  • Each heavy chain variable region may consist of three CDRs and four FR regions, which may be arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4.
  • the heavy chain variable region contains the binding domain that interacts with the antigen.
  • single-chain variable fragment or “scFv” has its plain and conventional meaning and may include, but is not limited to, for example, a heavy chain (VH) chain comprising an immunoglobulin variable region and a light chain (VL ) Fusion proteins of variable regions linked to each other with a short linker peptide.
  • linkers may comprise glycine (for flexibility) and hydrophilic amino acids such as serine or threonine (for solubility). The linker may connect the N-terminus of VH to the C-terminus of VL, or may connect the C-terminus of VH to the N-terminus of VL.
  • the ligand binding domain present on the CAR is a single chain variable fragment (scFv).
  • the CAR of the present application can be constructed in a VH-VL or VL-VH configuration with variations in the linker, hinge, transmembrane domain, co-stimulatory domain and/or transduction domain, and the CAR still maintains its efficacy.
  • the scFv domain present on the CAR is specific for the IL-13 ⁇ 2 receptor (IL13R ⁇ 2) present on tumor cells.
  • the CAR of the present application may contain linker residues between the individual domains added for proper spacing and conformation of the molecule, for example a linker comprising an amino acid sequence that connects the VH and VL domains and provides interaction with the two sub-binding domains.
  • the function of the compatible spacer is such that the resulting polypeptide retains the same specific binding affinity for the same target molecule as an antibody comprising the same light and heavy chain variable regions.
  • the CAR of the present application may comprise one, two, three, four or five or more linkers.
  • the linker is about 1 to about 25 amino acids, about 5 to about 20 amino acids, or about 10 to about 20 amino acids, or any intervening length of amino acids in length.
  • linkers include glycine polymers; glycine-serine polymers; glycine-alanine polymers; alanine-serine polymers; other flexible linkers known in the art, such as Whitlow linkers.
  • Glycine and glycine-serine polymers are relatively unstructured and thus can serve as neutral tethers between domains of fusion proteins such as the CAR of the present application.
  • CDR complementarity determining region
  • CDRs Chothia CDRs
  • Padlan FASEB J.9:133-139 (1995)
  • MacCallum J Mol Biol 262(5):732-45 (1996).
  • CDR boundaries for CDR may not strictly follow one of the above systems, but will still overlap with Kabat CDRs, although they can be shortened according to predictions or experimental findings that specific residues or groups of residues or even CDRs as a whole do not significantly affect antigen binding. or extended. In this application, the IMGT numbering system is used.
  • FR generally refers to the more highly conserved portions of antibody variable domains, known as the framework regions.
  • the variable domains of native heavy and light chains may each comprise four FR regions, four in VH (H-FR1, H-FR2, H-FR3, and H-FR4), and four in VL. (L-FR1, L-FR2, L-FR3 and L-FR4).
  • Framework region generally refers to the art-recognized portion of an antibody variable region that exists between the more divergent (ie hypervariable) CDRs.
  • Framework regions are typically referred to as Frameworks 1 to 4 (FR1, FR2, FR3, and FR4) and provide the backbone for representing the six CDRs (three from the heavy chain and three from the light chain) in three-dimensional space, to Forms the antigen-binding surface.
  • homologous sequences may include amino acid sequences that may be at least 80%, 85%, 90%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% identical to the subject sequence .
  • a homologue will comprise the same active site, etc., as the subject amino acid sequence.
  • Homology can be considered in terms of similarity (ie, amino acid residues having similar chemical properties/functions), or can be expressed in terms of sequence identity.
  • a sequence having a percentage identity of any one of the SEQ ID NOs of the mentioned amino acid sequence or nucleotide sequence means having said percentage identity over the entire length of the mentioned SEQ ID NO the sequence of.
  • sequence alignment can be performed by various means known to those skilled in the art, for example, using BLAST, BLAST-2, ALIGN, NEEDLE or Megalign (DNASTAR) software and the like. Those skilled in the art can determine appropriate parameters for alignment, including any algorithms needed to achieve optimal alignment across the full-length sequences being compared.
  • KD is used interchangeably with “KD”, and generally refers to the dissociation equilibrium constant of a specific antibody-antigen interaction, and the unit is M (mol/L).
  • isolated nucleic acid molecule generally refers to an isolated form of nucleotides, deoxyribonucleotides or ribonucleotides or their analogs of any length, isolated from their natural environment or artificially synthesized .
  • the term "vector” generally refers to a nucleic acid molecule capable of self-replication in a suitable host, which transfers an inserted nucleic acid molecule into and/or between host cells.
  • the vectors may include vectors mainly used for inserting DNA or RNA into cells, vectors mainly used for replicating DNA or RNA, and vectors mainly used for expression of transcription and/or translation of DNA or RNA.
  • the carrier also includes a carrier having various functions as described above.
  • the vector may be a polynucleotide capable of being transcribed and translated into a polypeptide when introduced into a suitable host cell. Typically, the vector produces the desired expression product by culturing an appropriate host cell containing the vector.
  • viral vector is used broadly to refer to nucleic acid molecules (such as transfer plasmids) or viral particles that mediate the transfer of nucleic acid molecules, including virus-derived nucleic acid elements that generally facilitate the transfer or integration of nucleic acid molecules into the genome of a cell .
  • Virions typically include various viral components and sometimes host cell components in addition to nucleic acid.
  • a viral vector may refer to a virus or virus particle capable of transferring nucleic acid into a cell, or the transferred nucleic acid itself.
  • lentivirus generally refers to the group (or genus) of complex retroviruses.
  • exemplary lentiviruses include, but are not limited to: HIV (human immunodeficiency virus; including HIV type 1 and HIV type 2); Visna-maedi virus (visna-maedivirus, VMV) virus; caprine arthritis-encephalitis virus ( CAEV); equine infectious anemia virus (EIAV); feline immunodeficiency virus (FIV); bovine immunodeficiency virus (BIV); and simian immunodeficiency virus (SIV).
  • HIV-based vector backbones ie, HIV cis-acting sequence elements
  • lentiviruses are used to deliver CAR-containing polynucleotides to cells.
  • the term "host cell” or “cell” generally refers to an individual cell, cell lines or cell cultures.
  • the host cells may include progeny of a single host cell. Due to natural, accidental or deliberate mutations, the progeny cells may not necessarily be completely identical in morphology or genome to the original parent cells, but they only need to be able to express the isolated antigen-binding fragments described in this application.
  • the host cells can be obtained by using the vectors described in this application to transfect cells in vitro.
  • the host cell can be a prokaryotic cell (such as Escherichia coli), or a eukaryotic cell (such as yeast cells, such as COS cells, Chinese hamster ovary (CHO) cells, HeLa cells, HEK293 cells, COS-1 cells, NSO cells or myeloma cells).
  • the host cells may be E. coli cells.
  • the host cell may be a yeast cell.
  • the host cell can be a mammalian cell.
  • the mammalian cells may be CHO-K1 cells.
  • T cell or "T lymphocyte” may be any T cell, such as a cultured T cell, such as a primary T cell, or a T cell from a cultured T cell line, such as Jurkat, SupTI, etc., or T cells obtained from a mammal (preferably a primate, species including monkey, dog or human). If obtained from a mammal, T cells can be obtained from a number of sources including, but not limited to, blood, bone marrow, lymph nodes, thymus or other tissues or fluids. T cells can also be enriched or normalized. T cells can be obtained by maturing hematopoietic stem cells into T cells in vitro or in vivo.
  • a cultured T cell such as a primary T cell
  • a T cell from a cultured T cell line such as Jurkat, SupTI, etc.
  • T cells obtained from a mammal preferably a primate, species including monkey, dog or human.
  • T cells can be obtained from a number of sources including, but not
  • the T cells are human T cells.
  • the T cells are T cells isolated from humans.
  • T cells can be of any type, including NKT cells, and can be of any developmental stage, including but not limited to CD4+/CD8+ double positive T cells; CDA+ helper T cells; e.g. Th1 and Th2 cells, CD8+ T cells (e.g. Cytotoxic T cells); peripheral blood mononuclear cells (PBMC); peripheral blood leukocytes (PBL); tumor infiltrating cells (TIL); memory T cells; untreated T cells, etc.
  • the T cells are CD8+ T cells or CD4+ T cells.
  • the T cells are allogeneic (from a different donor of the same species) to the subject receiving the cells or cells to be received (e.g., the cells are in the form of a therapeutic composition); in some alternatives, the T cells are autologous (donor and recipient are identical); in some alternative approaches, T cells are syngeneic (donor and recipient are different, but identical twins).
  • immune effector cells generally refers to immune cells that participate in the immune response and perform effector functions.
  • the exercising effector functions may include clearing foreign antigens or promoting immune effector responses and the like.
  • Immune effector cells may include plasma cells, T cells, B cells, natural killer (NK) cells, natural killer T (NKT) cells, mast cells, and myeloid-derived phagocytes.
  • the immune effector cells of the present application may be autologous/autogeneic ("own") or non-autologous ("non-self", eg allogeneic, syngeneic or allogeneic).
  • autologous generally refers to cells from the same subject.
  • Allogeneic generally refers to cells that are of the same species but are genetically different from those to which they are being compared.
  • Isgeneic generally refers to cells of a different subject that are genetically identical to the cells being compared.
  • Allogeneic generally refers to a cell of a different species than the compared cell.
  • the cells of the present application are autologous or allogeneic.
  • the term "modify” generally refers to altering the state or structure of a cell and/or changing the state or structure of a cell.
  • the change is usually compared with the state or structure of the corresponding unmodified cell, and the change may include a change in the expression level or function of an endogenous gene, such as down-regulating the expression level of an endogenous gene in a cell by means of genetic engineering, Up-regulation or non-expression, the genetic engineering means may include homologous recombination, CRISPR/Cas9 system gene editing, etc.; the change may also include changes in cellular protein expression, structure or function, such as through the endogenous gene expression level or Changes in protein expression, changes in structure or function achieved by changes in function, such as changes in protein expression, changes in structure or function achieved by regulating protein translation, post-translational modification; the changes may also include introducing exogenous Genes, expression of foreign proteins, etc.
  • T cell receptor alpha cons-stant T cell receptor alpha cons-stant
  • T cell receptor T cell receptor
  • MHC major histocompatibility complex
  • ⁇ T cells account for about 95% of the total T cells, and ⁇ T cells account for about 5% of the total T cells. This ratio varies during ontogeny and in disease states (such as leukemia) and also varies between species. different.
  • Each chain that makes up the TCR contains a variable region and a constant region.
  • the gene encoding the ⁇ chain (TRA, such as the information shown in HGNC: 12027) is located on chromosome 14 and consists of multiple gene segments, including variable Segment (V), connecting segment (J) and constant region (C), TRAC gene usually refers to the gene sequence (for example, the information shown in HGNC:12029) encoding T cell receptor ⁇ chain constant region (C), which is located in Chromosome 14 (14q11.2;14:22,547,505-22,552,131).
  • variable segment (V) genes encoding the N-segment antigen recognition domain is rearranged with one of the junction segment (J) to generate a functional V region exon that is transcribed and spliced together with the
  • the constant regions (C) are linked to form the T cell receptor alpha chain coding sequence.
  • MHC major histocompatibility complex antigen
  • HLA human leukocyte antigen
  • HLA class I antigens (A, B, C in humans) allow each cell to be recognized as "self", while HLA class II antigens (DR, DP and DQ in humans) participate in the communication between lymphocytes and antigen-presenting cells reaction between. Both have been implicated in the rejection of transplanted organs.
  • An important aspect of the HLA gene system is its polymorphism. Different alleles exist for each gene, MHC class I (A, B, and C) and MHC class II (DP, DQ, and DR). HLA alleles are indicated by numbers and subscripts. For example, two unrelated individuals may carry the class I HLA-B genes B5 and Bw41, respectively. Allelic products differ in one or more amino acids in the alpha and/or beta domains.
  • HLA-A MHC class I and II proteins
  • HLA-B HLA-DR
  • the HLA genes are clustered in a "superlocus" present on chromosome position 6p21, which encodes six classical Transplantation of HLA genes and at least 132 protein-coding genes. The complete locus measures roughly 3.6Mb, with at least 224 loci.
  • haplotype a set of alleles present on a single chromosome, inherited from one parent, that tends to be inherited as a group.
  • the set of alleles inherited from each parent forms a haplotype, some of which tend to be associated together. Identifying a patient's haplotype can help predict the probability of finding a matching donor and help develop a search strategy because some alleles and haplotypes are more common than others and they are more common in different races and ethnicities The frequencies in the distribution are different.
  • HLA-A generally refers to a type of human leukocyte antigen polypeptide chain, encoded by the HLA-A gene located on human chromosome 6p21.3 (for example, the information shown in HGNC:4931).
  • HLA-A is one of three major polypeptide types that make up MHC class I molecules on the surface of human cells, the others including HLA-B and HLA-C.
  • the heterodimer composed of the ⁇ chain encoded by the HLA-A gene and the ⁇ chain ( ⁇ 2-microglobulin) encoded by the B2M gene is the HLA-A class MHC I molecule.
  • the ⁇ chain encoded by the HLA-A gene may comprise an ⁇ 1 domain, an ⁇ 2 domain, an ⁇ 3 domain, a transmembrane region, and a cytoplasmic region, wherein the ⁇ 1 domain and the ⁇ 2 domain may be combined with peptides to be activated by MHC I Molecules (eg HLA-A class) present the peptides to cells of the immune lineage.
  • MHC I Molecules eg HLA-A class
  • the ⁇ chain of the MHC I molecule is polymorphic, and its primary structure has many changes. As of December 2013, there are 2432 known HLA-A alleles , encoding 1740 active proteins and 117 inactive proteins.
  • HLA-A alleles may include those named by the WHO HLA Factor Nomenclature Committee included in the IMGT/HLA database version 3.38.0 (https://www.ebi.ac.uk/ipd/imgt/hla/) Sequence information of the different HLA-A alleles.
  • HLA-B generally refers to a part of the gene family of the human leukocyte antigen (HLA) complex.
  • HLA is the human version of the major histocompatibility complex (MHC), a family of genes present in many species. The genes in this complex are divided into three basic groups: class I, class II and class III.
  • MHC major histocompatibility complex
  • HLA-B gene and two related genes, HLA-A and HLA-C are the major MHC class I genes.
  • the HLA-B gene is located in band 21.3 of the short (p) arm of chromosome 6, from base pairs 31,353,871 to 31,357,211.
  • HLA-B is one of the three main HLAs that should be matched between donor and recipient.
  • HLA-A HLA-B
  • HLA-DR MHC class II
  • HLA-matched refers to a donor-recipient pair in which there is no mismatch in HLA antigens between the donor and recipient, such as providing hematopoietic stem cell transplantation therapy to a recipient in need of A donor for a stem cell transplant.
  • HLA-matched (i.e., in which all 6 alleles are matched) donor-recipient pairs have a reduced risk of graft rejection because endogenous T cells and NK cells are less likely to enter the graft recognized as foreign and thus less likely to mount an immune response against the graft.
  • HLA-mismatched refers to a donor- A recipient pair, such as a donor who provides a hematopoietic stem cell transplant to a recipient in need of hematopoietic stem cell transplantation therapy.
  • one haplotype is matched while the other is not.
  • HLA-mismatched donor-recipient pairs may have an increased risk of graft rejection relative to HLA-matched donor-recipient pairs because endogenous Sexual T cells and NK cells are more likely to recognize an incoming graft as foreign, and such T cells and NK cells are therefore more likely to mount an immune response against the graft.
  • B2M generally refers to ⁇ 2-microglobulin ( ⁇ 2-microglobulin), which is one of the components of MHC class I molecules.
  • ⁇ 2 microglobulin also known as ⁇ chain
  • B2M is normally expressed in all nucleated cells.
  • ⁇ 2 microglobulin is encoded by the B2M gene located at 15q21.1 (for example, the information shown in HGNC:914).
  • CIITA generally refers to the transactivator of major histocompatibility complex class II (MHC II).
  • the transactivator may be a protein having an acidic transcription activation domain, 4 LRRs (leucine rich repeats) and a GTP binding domain.
  • the protein can be localized in the nucleus and acts as a positive regulator of the transcription of major histocompatibility complex class II (MHC II) genes, known as the "master control factor” for the expression of these genes.
  • MHC II major histocompatibility complex class II
  • the protein also binds GTP and uses the binding to GTP to transport itself into the nucleus where it normally acts in a coactivator-like manner through acetyltransferase (AT) activity.
  • the protein is encoded by a gene located at 16p13.13 (for example the information shown at HGNC:7067), enabling the generation of several transcript variants encoding different isoforms.
  • wild-type cell generally refers to a naturally occurring or naturally derived cell.
  • nucleic acid or “polynucleotide” or “nucleic acid molecule” generally refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) and polymers thereof in single- or double-stranded form. Unless specifically limited, the term may include nucleic acids that contain analogs of natural nucleotides that have similar binding properties to a reference nucleic acid (for example, for which sequence information is shown) and in a manner similar to naturally occurring nucleotides metabolism. Unless otherwise stated, the sequence of a nucleic acid may include conservatively modified variants thereof, such as degenerate codon substitutions, alleles, orthologs, SNPs, and complementary sequences, as well as the sequences explicitly indicated.
  • expression generally refers to the transcription and/or translation of a specific nucleotide sequence.
  • gene mutation generally refers to changes in the composition or sequence of base pairs in the structure of a gene. For example, point mutations caused by single base changes, or deletions, duplications, and insertions of multiple bases.
  • the term "gene silencing” generally refers to preventing the expression of certain genes by regulatory mechanisms. It can mainly include two types: one is transcriptional gene silencing (TGS) at the transcriptional level caused by factors such as DNA methylation, heterochromatinization, and position effects, and the other is post-transcriptional gene silencing (post -transcriptional gene silencing (PTGS), that is, at the post-transcriptional level of the gene, it affects the expression of the gene by specifically interfering with the target RNA.
  • TGS transcriptional gene silencing
  • PTGS post-transcriptional gene silencing
  • the expression of the corresponding gene is downregulated/decreased.
  • Gene silencing is generally considered to be a gene knockdown mechanism, and methods commonly used to silence genes can be RNAi, etc.
  • endogenous refers to any substance derived from or produced within an organism, cell, tissue or system.
  • exogenous refers to any substance introduced from or produced outside of an organism, cell, tissue or system.
  • antisense RNA generally refers to a single-stranded RNA that is complementary to the transcript mRNA (messenger RNA). Antisense RNA can inhibit gene expression by binding to mRNA. For example, the combination of antisense RNA and target mRNA increases the sensitivity of the double-stranded RNA molecule to RNase III and degrades it; for example, antisense RNA binds to the upstream non-coding region of mRNA, thereby directly inhibiting the translation of target mRNA .
  • siRNA generally refers to the abbreviation of Small interfering RNA (small interfering RNA) or short in-terfering RNA (short interfering RNA).
  • siRNA is a type of double-stranded non-coding RNA molecule with a length of about 18-28 base pairs, which can cause mRNA degradation through complementary binding to mRNA, thereby interfering with the expression of specific genes.
  • siRNA may be a product obtained by treating long double-stranded RNA or shRNA with Dicer enzyme.
  • the siRNA enters the cell and forms an RNA-induced silencing complex (RISC) with other proteins, the sense strand is degraded, and the antisense strand can bind to a complementary targeting sequence, thereby achieving gene silencing.
  • RISC RNA-induced silencing complex
  • shRNA generally refers to the abbreviation of short hairpin RNA, namely “short hairpin RNA”.
  • shRNA usually includes two short inverted repeat sequences separated by a stem-loop sequence to form a hairpin structure.
  • 5-6 T bases can also be included as the transcription terminator of RNA polymerase III.
  • shRNA can enter cells through viral vectors or plasmids, and be transcribed under the action of polymerase II or polymerase III, and the transcripts are exported from the nucleus (usually through Exportin 5) and then transported after being treated by Dicer To RISC, the sense strand is degraded, and the antisense strand can bind to a complementary targeting sequence, thereby achieving gene silencing.
  • CRISPR/Cas system generally refers to a group of molecules comprising an RNA-guided nuclease or other effector molecule and a gRNA molecule capable of directing and implementing the RNA-guided nuclease or other effector molecule Nucleic acid is modified at a target sequence, eg, causing degradation of the target sequence.
  • a CRISPR system comprises a gRNA and a Cas protein, e.g., a Cas9 protein.
  • Cas9 systems systems comprising Cas9 or functional mutants thereof are referred to herein as “Cas9 systems” or "CRISPR/Cas9 systems”.
  • the gRNA molecule and the Cas molecule can complex to form a ribonucleoprotein (RNP) complex.
  • RNP ribonucleoprotein
  • gRNA molecule or “guide RNA”, “guide RNA”, “guide RNA”, “guide RNA molecule”, “gRNA” are used interchangeably and generally refer to Nucleases or other effector molecules (generally complexed with gRNA molecules) to nucleic acid molecules on the target sequence. In certain embodiments, this is accomplished by hybridizing a portion of the gRNA to DNA (e.g., via a gRNA guidance domain) and by binding a portion of the gRNA molecule to an RNA-guided nuclease or other effector molecule (e.g., via at least a gRNAtracr). described guide.
  • a gRNA molecule consists of a single contiguous polynucleotide molecule, referred to herein as a "single guide RNA” or “sgRNA” or the like.
  • a gRNA molecule consists of multiple (eg, two) polynucleotide molecules that are themselves capable of associating (typically by hybridization), referred to herein as “dual guide RNA” or “dgRNA” and the like.
  • Cas protein generally refers to the enzyme responsible for cutting DNA in the CRISPR/Cas system. Enzymes from Type I, II, and III CRISPR/Cas systems may be included. For example, Cas3, Cas9, Cas10.
  • Cas9 protein generally refers to the enzyme from the bacterial type II CRISPR/Cas system responsible for cutting DNA. Cas9 can include the wild-type protein and its functional mutants.
  • allele generally refers to the different variations that the gene sequence at a locus may have.
  • a genetic locus also known as a gene locus or site, refers to a fixed location on a chromosome, such as where a certain gene is located. The arrangement of loci in the genome is called a genetic map.
  • homozygous generally refers to a genotyped individual whose two alleles on the same locus of the homologous chromosome are the same.
  • a pair of relative genes can have individuals of both genotypes AA and aa.
  • heterozygote generally refers to a diploid individual whose two alleles at the same site on the homologous chromosome are different, such as Aa. Heterozygous genotypes generally have higher fitness than homozygous dominant or homozygous recessive genotypes, a phenomenon known as heterozygous dominance.
  • tumor and cancer are used interchangeably and generally refer to a disease characterized by the rapid and uncontrolled growth of abnormal cells. Cancer cells can spread to other parts of the body locally or through the bloodstream and lymphatic system. Examples of various cancers are described herein and they include, but are not limited to, breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, kidney cancer, liver cancer, brain cancer, lymphoma, leukemia, Lung cancer, etc.
  • cancer or “tumor” includes pre-malignant as well as malignant cancers and tumors, and also encompasses solid and non-solid tumors.
  • IL-13R ⁇ 2 interleukin 13 receptor alpha 2
  • pancreatic, breast, and ovarian cancers or malignant gliomas such as glioblastoma.
  • IL-13R ⁇ 2 is also overexpressed in the vast majority of human patients with high-grade astrocytoma (see PLoS One. 2013 Oct 16;8(10):e77719; expressly incorporated herein by reference in its entirety ).
  • reducing the amount of IL13RA2 expression in cancer cells significantly slowed tumor growth in the model (Breast Cancer Research, 2015; 17(1); expressly incorporated herein by reference in its entirety).
  • Very few types of normal tissue are expected to express IL13R ⁇ 2, and in such cases only at low levels.
  • glioblastoma multiforme GBM
  • high expression of IL13R ⁇ 2 may be a prognostic marker for tumor progression and poor patient survival.
  • the term "pharmaceutically acceptable” generally refers to a drug that is commensurate with a reasonable benefit/risk ratio, suitable within the scope of sound medical judgment for use in contact with human and animal tissues without undue toxicity, irritation, Those compounds, materials, compositions and/or dosage forms for allergic reactions or other problems or complications.
  • the term "pharmaceutically acceptable carrier” generally refers to any of those conventionally used, and is subject only to physico-chemical considerations such as solubility and reactivity with active binding agents. lack of) and is limited by the route of administration.
  • the pharmaceutically acceptable carriers described herein, such as vehicles, adjuvants, excipients and diluents, are well known to those skilled in the art and are readily available to the public.
  • a pharmaceutically acceptable carrier is one that is chemically inert to the active ingredients of the pharmaceutical composition and that exhibits no adverse side effects or toxicity under the conditions of use. In some embodiments, the carrier does not produce an adverse, allergic or other inappropriate reaction when administered to an animal or a human.
  • compositions are free of pyrogens and other impurities that could be harmful to humans or animals.
  • Pharmaceutically acceptable carriers include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like; their use is well known in the art.
  • Acceptable carriers, excipients, or stabilizers are nontoxic to recipients and are preferably inert at the dosages and concentrations employed, and include buffers such as phosphates, citrates, or other organic acids; antioxidants; , such as ascorbic acid; low-molecular-weight polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulin; hydrophilic polymers, such as polyvinylpyrrolidone; amino acids, such as glycine, glutamine, asparagine, arginine, or lysine amino acids; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrin; chelating agents, such as EDTA; sugar alcohols, such as mannitol or sorbitol; salt-forming counterions, such as sodium; and/or Or nonionic surfactants such as Tween, Pluronics or polyethylene glycol (PEG).
  • buffers such as phosphates, citrates,
  • the term “effective amount” or “effective dose” generally refers to an amount sufficient to achieve, or at least partially achieve, the desired effect.
  • a “therapeutically effective amount” or “therapeutically effective dose” of a drug or therapeutic agent is typically one that, when used alone or in combination with another therapeutic agent, promotes regression of disease (by reducing the severity of disease symptoms, frequency of asymptomatic periods of disease), any amount of drug that is evidenced by an increase in the degree and duration of the disease, or by the prevention of impairment or disability due to the presence of a disease.
  • a “therapeutically effective amount” or “effective amount” of an anti-IL-13R ⁇ 2 CAR-T cell is also an amount or dose in which the therapeutically beneficial effect outweighs any toxic or detrimental effects of the anti-IL-13R ⁇ 2 CAR-T cell, such as CRS.
  • the term "therapeutically effective amount” includes an amount effective to "treat" a subject (eg, a patient).
  • the therapeutically effective dose is the minimum effective dose (MED) of anti-IL-13R ⁇ 2 CAR-T cells used to treat multiple myeloma in a subject.
  • the therapeutically effective dose is the maximum tolerated dose (MTD) of anti-IL-13R ⁇ 2 CAR-T cells that does not result in unresolved CRS in the subject.
  • MED minimum effective dose
  • MTD maximum tolerated dose
  • up-regulation of expression generally refers to an increase in the expression of a nucleic acid at the mRNA level or an increase in the expression of a polypeptide.
  • the term may also refer to post-translational modifications required for increased polypeptide activity and/or function, such as addition of sugar moieties, phosphorylation, and the like.
  • the term "about” generally refers to a range of 0.5%-10% above or below the specified value, such as 0.5%, 1%, 1.5%, 2%, 2.5%, above or below the specified value. 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10%.
  • subject generally refers to human or non-human animals, including but not limited to cats, dogs, horses, pigs, cows, sheep, rabbits, mice, rats or monkeys.
  • Some embodiments of the methods and compositions provided in the application relate to those capable of specifically binding to interleukin 13 receptor subunit ⁇ -2 (IL-13R ⁇ 2) or configured to specifically bind to interleukin 13 receptor subunit ⁇ -2 (IL-13R ⁇ 2) Chimeric antigen receptor (CAR) of IL-13R ⁇ 2).
  • IL-13R ⁇ 2 interleukin 13 receptor subunit ⁇ -2
  • CAR Chimeric antigen receptor
  • Some embodiments include nucleic acids encoding such CARs, immune effector cells containing such CARs, and methods of treatment utilizing immune effector cells with these CARs, for example, by providing these cells as a medicament to a subject in need thereof , for example for the treatment or inhibition of diseases or disorders mediated by interleukin-13 receptor subunit alpha-2 (IL-13R ⁇ 2), such as cancer (such as IL-13Ra2 positive including glioma and glioblastoma malignant tumor).
  • IL-13R ⁇ 2 interleukin-13 receptor subunit alpha-2
  • the present application provides an immune effector cell, wherein the function of T cell antigen receptor (TCR) and major histocompatibility complex (MHCI, MHCII) in the immune effector cell is inhibited in the cell, And the immune effector cells comprise a chimeric antigen receptor (CAR) targeting IL13R ⁇ 2.
  • TCR T cell antigen receptor
  • MHCI major histocompatibility complex
  • MHCII major histocompatibility complex
  • CAR chimeric antigen receptor
  • the chimeric antigen receptor (CAR) targeting IL13R ⁇ 2 comprises a targeting moiety comprising at least one complementarity determining region (CDR) of an antibody heavy chain variable region (VH)
  • said VH comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97% of the amino acid sequence shown in SEQ ID NO: 18 , about 98%, about 99%, about 99.5% identical amino acid sequences.
  • the VH comprises at least about 90%, about 91%, about 92%, about 93%, about 94% of the amino acid sequence set forth in SEQ ID NO: 16 or SEQ ID NO: 17, Amino acid sequences that are about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • the VH may comprise the amino acid sequence shown in SEQ ID NO: 16 or SEQ ID NO: 17.
  • the chimeric antigen receptor (CAR) targeting IL13R ⁇ 2 comprises a targeting moiety comprising a VH comprising a heavy chain complementarity determining region 1 (HCDR1), a heavy chain Chain complementarity determining region 2 (HCDR2) and heavy chain complementarity determining region 3 (HCDR3)
  • said HCDR3 comprising at least about 90%, about 91%, about 92%, about 93% of the amino acid sequence shown in SEQ ID NO:3 %, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% amino acid sequence identity.
  • the HCDR3 may comprise the amino acid sequence shown in SEQ ID NO:3.
  • the HCDR2 comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence shown in SEQ ID NO: 2 %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
  • the HCDR2 can comprise the amino acid sequence shown in SEQ ID NO:2
  • the HCDR1 comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence shown in SEQ ID NO: 1 %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
  • the HCDR1 may comprise the amino acid sequence shown in SEQ ID NO:1.
  • the VH comprises: comprising at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95% of the amino acid sequence shown in SEQ ID NO: 1, HCDR1 having an amino acid sequence of about 96%, about 97%, about 98%, about 99%, about 99.5% identical, comprising at least about 90%, about 91%, about 90%, about 91%, about 99.5% identical to the amino acid sequence shown in SEQ ID NO:2 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical to the amino acid sequence of HCDR2 and comprising the same as SEQ ID NO:3
  • the amino acid sequences shown are at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical Sexual amino acid sequence of HCDR3.
  • TCR T cell antigen receptor
  • MHCI major histocompatibility complex
  • MHCII major histocompatibility complex
  • the immune effector cells contain chimeric cells targeting IL13R ⁇ 2
  • a complex antigen receptor (CAR) the chimeric antigen receptor (CAR) targeting IL13R ⁇ 2 comprises a targeting moiety
  • the targeting moiety comprises an antibody heavy chain variable region (VH)
  • the VH may comprise: comprising HCDR1 having the amino acid sequence shown in SEQ ID NO:1, HCDR2 comprising the amino acid sequence shown in SEQ ID NO:2, and HCDR3 comprising the amino acid sequence shown in SEQ ID NO:3.
  • the VH comprises heavy chain framework region 1 (HFR1), heavy chain framework region 2 (HFR2), heavy chain framework region 3 (HFR3) and heavy chain framework region 4 (HFR4), the HFR1 comprising at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% of the amino acid sequence shown in SEQ ID NO:4, Amino acid sequences of about 99%, about 99.5% identity.
  • HFR1 heavy chain framework region 1
  • HFR2 heavy chain framework region 2
  • HFR3 heavy chain framework region 3
  • HFR4 heavy chain framework region 4
  • the HFR1 comprises at least about 90%, about 91%, about 92%, about 93%, about 94% of the amino acid sequence shown in SEQ ID NO: 8 or SEQ ID NO: 12, Amino acid sequences that are about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • the HFR2 comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence shown in SEQ ID NO:5. %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
  • the HFR2 comprises at least about 90%, about 91%, about 92%, about 93%, about 94% of the amino acid sequence shown in SEQ ID NO: 9 or SEQ ID NO: 13, Amino acid sequences that are about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • the HFR3 comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence shown in SEQ ID NO:6 %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
  • the HFR3 comprises at least about 90%, about 91%, about 92%, about 93%, about 94% of the amino acid sequence shown in SEQ ID NO: 10 or SEQ ID NO: 14, Amino acid sequences that are about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • the HFR4 comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence shown in SEQ ID NO:7. %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
  • the HFR4 comprises at least about 90%, about 91%, about 92%, about 93%, about 94% of the amino acid sequence shown in SEQ ID NO: 11 or SEQ ID NO: 15, Amino acid sequences that are about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • said VH comprises HFR1, HFR2, HFR3 and HFR4, and said HFR1, HFR2, HFR3 and HFR4 are selected from
  • amino acid sequence shown in SEQ ID NO: 11 has at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% of the amino acid sequence shown in SEQ ID NO:8 %, about 99%, about 99.5% of the amino acid sequence of HFR1, comprising at least about 90%, about 91%, about 92%, about 93%, about 94% of the amino acid sequence shown in SEQ ID NO:9 , about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical to the amino acid sequence of HFR2, comprising at least about 90% with the amino acid sequence shown in SEQ ID NO:10, About 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical to the amino acid sequence of HFR3, comprising the same as SEQ
  • the amino acid sequence shown in ID NO: 11 has at least about 90%, about 91%, about 92%
  • amino acid sequence shown in ID NO: 15 has at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% of the amino acid sequence shown in SEQ ID NO: 12 %, about 99%, about 99.5% of the amino acid sequence of HFR1, comprising at least about 90%, about 91%, about 92%, about 93%, about 94% of the amino acid sequence shown in SEQ ID NO: 13 , about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical to the amino acid sequence of HFR2, comprising at least about 90% with the amino acid sequence shown in SEQ ID NO: 14, About 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical to the amino acid sequence of HFR3, comprising the same as SEQ
  • the amino acid sequence shown in ID NO: 15 has at least about 90%, about 91%, about 92%, about 9
  • the VH comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence set forth in SEQ ID NO: 18. %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
  • TCR T cell antigen receptor
  • MHCI major histocompatibility complex
  • MHCII major histocompatibility complex
  • the immune effector cells contain chimeric cells targeting IL13R ⁇ 2
  • a complex antigen receptor (CAR) the chimeric antigen receptor (CAR) targeting IL13R ⁇ 2 comprises a targeting moiety
  • the targeting moiety comprises an antibody heavy chain variable region (VH)
  • the VH may comprise a VH comprising Amino acid sequence shown in SEQ ID NO:18.
  • the VH comprises at least about 90%, about 91%, about 92%, about 93%, about 94% of the amino acid sequence set forth in SEQ ID NO: 16 or SEQ ID NO: 17, Amino acid sequences that are about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • the targeting moiety further comprises at least one CDR of an antibody light chain variable region (VL) comprising at least about 90% of the amino acid sequence shown in SEQ ID NO:36, about Amino acid sequences that are 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • VL antibody light chain variable region
  • the VL comprises at least about 90%, about 91%, about 92%, about 93%, about 94% of the amino acid sequence set forth in SEQ ID NO:34 or SEQ ID NO:35, Amino acid sequences that are about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • the targeting moiety comprises at least one CDR of VH and at least one CDR of VL, and the VH and VL are selected from:
  • amino acid sequence VH comprising at least about 90%, about 91%, about 92%, about 93%, about 94% identical to the amino acid sequence shown in SEQ ID NO:34 , about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% amino acid sequence VL identity;
  • ii) comprising at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% of the amino acid sequence shown in SEQ ID NO: 17 %, about 99%, about 99.5% identical to the VH of an amino acid sequence comprising at least about 90%, about 91%, about 92%, about 93%, about 94% identical to the amino acid sequence shown in SEQ ID NO:35 , about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% amino acid sequence VL identity.
  • the chimeric antigen receptor (CAR) targeting IL13R ⁇ 2 comprises a targeting moiety comprising a VL comprising light chain complementarity determining region 1 (LCDR1), light Chain complementarity determining region 2 (LCDR2) and light chain complementarity determining region 3 (LCDR3)
  • said LCDR1 comprising at least about 90%, about 91%, about 92%, about 93% of the amino acid sequence shown in SEQ ID NO: 19 %, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% amino acid sequence identity.
  • the LCDR1 may comprise the amino acid sequence shown in SEQ ID NO: 19.
  • the LCDR2 comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence shown in SEQ ID NO: 20 %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
  • the LCDR2 may comprise the amino acid sequence shown in SEQ ID NO:20.
  • the LCDR3 comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence shown in SEQ ID NO: 21 %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
  • the LCDR3 may comprise the amino acid sequence shown in SEQ ID NO: 21.
  • the VL comprises: comprising at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95% of the amino acid sequence shown in SEQ ID NO: 19, LCDR1 having an amino acid sequence of about 96%, about 97%, about 98%, about 99%, about 99.5% identity, comprising at least about 90%, about 91%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical to the amino acid sequence of LCDR2 and comprising SEQ ID NO:21
  • the amino acid sequence has at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identity Amino acid sequence of LCDR3.
  • the functions of T cell antigen receptor (TCR) and major histocompatibility complex (MHCI, MHCII) in the immune effector cells are inhibited in the cells, and the immune effector cells contain chimeric cells targeting IL13R ⁇ 2 Combined antigen receptor (CAR), the chimeric antigen receptor (CAR) targeting IL13R ⁇ 2 comprises a targeting moiety, the targeting moiety comprises VH and VL, and the VH may comprise: comprising SEQ ID NO: 1 HCDR1 comprising the amino acid sequence shown in SEQ ID NO:2 and HCDR3 comprising the amino acid sequence shown in SEQ ID NO:2 and HCDR3 comprising the amino acid sequence shown in SEQ ID NO:3; the VL may comprise: comprising the same as shown in SEQ ID NO:19 LCDR1 of the amino acid sequence, LCDR2 comprising the amino acid sequence shown in SEQ ID NO:20 and LCDR3 comprising the amino acid sequence shown in SEQ ID NO:21.
  • TCR T cell antigen receptor
  • said VL comprises light chain framework region 1 (LFR1), light chain framework region 2 (LFR2), light chain framework region 3 (LFR3) and light chain framework region 4 (LFR4), said LFR1 comprising at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% of the amino acid sequence shown in SEQ ID NO: 22, Amino acid sequences of about 99%, about 99.5% identity.
  • LFR1 comprising at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% of the amino acid sequence shown in SEQ ID NO: 22, Amino acid sequences of about 99%, about 99.5% identity.
  • the LFR1 comprises at least about 90%, about 91%, about 92%, about 93%, about 94% of the amino acid sequence shown in SEQ ID NO:26 or SEQ ID NO:30, Amino acid sequences that are about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • the LFR2 comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence shown in SEQ ID NO: 23 %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
  • the LFR2 comprises at least about 90%, about 91%, about 92%, about 93%, about 94% of the amino acid sequence shown in SEQ ID NO:27 or SEQ ID NO:31, Amino acid sequences that are about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • the LFR3 comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence shown in SEQ ID NO:24 %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
  • the LFR3 comprises at least about 90%, about 91%, about 92%, about 93%, about 94% of the amino acid sequence shown in SEQ ID NO:28 or SEQ ID NO:32, Amino acid sequences that are about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • the LFR4 comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence shown in SEQ ID NO: 25 %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
  • the LFR4 comprises at least about 90%, about 91%, about 92%, about 93%, about 94% of the amino acid sequence shown in SEQ ID NO:29 or SEQ ID NO:33, Amino acid sequences that are about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • said VL comprises LFR1, LFR2, LFR3 and LFR4, and said LFR1, LFR2, LFR3 and LFR4 are selected from
  • amino acid sequence shown in ID NO: 29 has at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% of the amino acid sequence shown in SEQ ID NO:26 %, about 99%, about 99.5% of the amino acid sequence of LFR1, comprising at least about 90%, about 91%, about 92%, about 93%, about 94% of the amino acid sequence shown in SEQ ID NO: 27 , about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical to an amino acid sequence of LFR2 comprising at least about 90% with the amino acid sequence shown in SEQ ID NO:28, About 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical to the amino acid sequence of LFR3, comprising the same as SEQ
  • the amino acid sequence shown in ID NO: 29 has at least about 90%, about 91%, about 92%, about
  • amino acid sequence shown in SEQ ID NO: 33 has at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% of the amino acid sequence shown in SEQ ID NO:30 %, about 99%, about 99.5% of the amino acid sequence of LFR1, comprising at least about 90%, about 91%, about 92%, about 93%, about 94% of the amino acid sequence shown in SEQ ID NO: 31 , about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical to an amino acid sequence of LFR2 comprising at least about 90% with the amino acid sequence shown in SEQ ID NO:32, About 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical to the amino acid sequence of LFR3, comprising the same as SEQ
  • the amino acid sequence shown in ID NO: 33 has at least about 90%, about 91%, about 92%
  • the VL comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence shown in SEQ ID NO:36 %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
  • TCR T cell antigen receptor
  • MHCI major histocompatibility complex
  • the immune effector cells contain chimeric cells targeting IL13R ⁇ 2 Combined antigen receptor (CAR), the chimeric antigen receptor (CAR) targeting IL13R ⁇ 2 comprises a targeting moiety, the targeting moiety comprises VH and VL, and the VH may comprise the gene shown in SEQ ID NO:18 Amino acid sequence; the VL may comprise the amino acid sequence shown in SEQ ID NO:36.
  • the VL comprises at least about 90%, about 91%, about 92%, about 93%, about 94% of the amino acid sequence set forth in SEQ ID NO:34 or SEQ ID NO:35, Amino acid sequences that are about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • the targeting moiety comprises VH and VL, wherein the VH comprises at least about 90%, about 91%, about 92%, about 93% of the amino acid sequence shown in SEQ ID NO: 18 , about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% of the amino acid sequence of identity, the VL comprises the amino acid sequence shown in SEQ ID NO:36 has Amino acid sequences that are at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • VH and VL can be selected from:
  • VH comprising the amino acid sequence shown in SEQ ID NO:16
  • VL comprising the amino acid sequence shown in SEQ ID NO:34
  • VH comprising the amino acid sequence shown in SEQ ID NO:17
  • VL comprising the amino acid sequence shown in SEQ ID NO:35.
  • the targeting moiety comprises a full length antibody, Fab, single chain variable fragment (scFv) or single domain antibody (VHH).
  • the targeting moiety includes scFv.
  • the targeting moiety comprises a linker polypeptide between VH and VL.
  • the linker polypeptide is selected from Gly-Ser linker (SEQ ID NO:37), Whitlow (Whitlow) linker (SEQ ID NO:38), and comprises and SEQ ID NO:37 or SEQ ID NO:37
  • the amino acid sequence shown in ID NO: 38 has at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% , a linker of amino acid sequences of about 99.5% identity.
  • the targeting moiety comprises at least about 90%, about 91%, about 92%, about 93%, about 90% of the amino acid sequence shown in SEQ ID NO:41 or SEQ ID NO:44 Amino acid sequences that are 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • targeting moiety may comprise the amino acid sequence shown in SEQ ID NO:41 or SEQ ID NO:44.
  • the targeting moiety may comprise the amino acid sequence shown in SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:42 or SEQ ID NO:43.
  • TCR T cell antigen receptor
  • MHCI major histocompatibility complex
  • MHCII major histocompatibility complex
  • the immune effector cells contain IL13R ⁇ 2-targeted Chimeric antigen receptor (CAR)
  • the chimeric antigen receptor (CAR) targeting IL13R ⁇ 2 comprises a targeting moiety, and the targeting moiety may comprise SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO :42 or the amino acid sequence shown in SEQ ID NO:43.
  • the chimeric antigen receptor (CAR) targeting IL13R ⁇ 2 comprises a targeting moiety comprising at least one complementarity determining region (CDR) of an antibody heavy chain variable region (VH)
  • said VH comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97% of the amino acid sequence shown in SEQ ID NO:56 , about 98%, about 99%, about 99.5% identical amino acid sequences.
  • the VH comprises the amino acid sequence shown in SEQ ID NO:56.
  • the chimeric antigen receptor (CAR) targeting IL13R ⁇ 2 comprises a targeting moiety comprising a VH comprising a heavy chain complementarity determining region 1 (HCDR1), a heavy chain Chain complementarity determining region 2 (HCDR2) and heavy chain complementarity determining region 3 (HCDR3)
  • said HCDR3 comprising at least about 90%, about 91%, about 92%, about 93% of the amino acid sequence shown in SEQ ID NO:55 %, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% amino acid sequence identity.
  • the HCDR3 may comprise the amino acid sequence shown in SEQ ID NO:55.
  • the HCDR2 comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence shown in SEQ ID NO:54 %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
  • the HCDR2 may comprise the amino acid sequence shown in SEQ ID NO:54.
  • the HCDR1 comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence shown in SEQ ID NO:53 %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
  • the HCDR1 may comprise the amino acid sequence shown in SEQ ID NO:53.
  • the VH comprises: comprising at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95% of the amino acid sequence shown in SEQ ID NO: 53, HCDR1 having an amino acid sequence of about 96%, about 97%, about 98%, about 99%, about 99.5% identity, comprising at least about 90%, about 91%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical to the amino acid sequence of HCDR2 and comprising the same as SEQ ID NO:55
  • the amino acid sequences shown are at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical Sexual amino acid sequence of HCDR3.
  • the VH may comprise: HCDR1 comprising the amino acid sequence shown in SEQ ID NO:53, HCDR2 comprising the amino acid sequence shown in SEQ ID NO:54, and HCDR3 comprising the amino acid sequence shown in SEQ ID NO:55.
  • the VH comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence set forth in SEQ ID NO:56. %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
  • the VH can comprise the amino acid sequence shown in SEQ ID NO:56.
  • TCR T cell antigen receptor
  • MHCI major histocompatibility complex
  • MHCII major histocompatibility complex
  • the immune effector cells contain IL13R ⁇ 2-targeted Chimeric antigen receptor (CAR), the chimeric antigen receptor (CAR) targeting IL13R ⁇ 2 comprises a targeting moiety, the targeting moiety comprises VH, and the VH may comprise the amino acid shown in SEQ ID NO:56 sequence.
  • the targeting moiety further comprises at least one CDR of an antibody light chain variable region (VL) comprising at least about 90% of the amino acid sequence shown in SEQ ID NO:60, about Amino acid sequences that are 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • VL antibody light chain variable region
  • the targeting moiety comprises at least one CDR of VH and at least one CDR of VL
  • the VH comprises at least about 90%, about 91% of the amino acid sequence shown in SEQ ID NO:56 , about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequence
  • said VL comprises an amino acid sequence identical to SEQ ID NO :
  • the amino acid sequence shown in 60 has at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about Amino acid sequences with 99.5% identity.
  • the chimeric antigen receptor (CAR) targeting IL13R ⁇ 2 comprises a targeting moiety comprising a VL comprising light chain complementarity determining region 1 (LCDR1), light Chain complementarity determining region 2 (LCDR2) and light chain complementarity determining region 3 (LCDR3)
  • said LCDR1 comprising at least about 90%, about 91%, about 92%, about 93% of the amino acid sequence shown in SEQ ID NO:57 %, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% amino acid sequence identity.
  • the LCDR1 comprises the amino acid sequence shown in SEQ ID NO:57.
  • the LCDR2 comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence shown in SEQ ID NO:58 %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
  • the LCDR2 comprises the amino acid sequence shown in SEQ ID NO:58.
  • the LCDR3 comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence shown in SEQ ID NO:59 %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
  • the LCDR3 comprises the amino acid sequence shown in SEQ ID NO:59.
  • the VL comprises: comprising at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95% of the amino acid sequence shown in SEQ ID NO: 57, LCDR1 having an amino acid sequence of about 96%, about 97%, about 98%, about 99%, about 99.5% identity, comprising at least about 90%, about 91%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical to the amino acid sequence of LCDR2 and comprising the same as SEQ ID NO:59
  • the amino acid sequences shown are at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical Sexual amino acid sequence of LCDR3.
  • the functions of T cell antigen receptor (TCR) and major histocompatibility complex (MHCI, MHCII) in the immune effector cells are inhibited in the cells, and the immune effector cells contain chimeric cells targeting IL13R ⁇ 2 Combined antigen receptor (CAR), the chimeric antigen receptor (CAR) targeting IL13R ⁇ 2 comprises a targeting moiety, the targeting moiety comprises VH and VL, and the VH may comprise: comprising SEQ ID NO:53 HCDR1 of the amino acid sequence shown, HCDR2 comprising the amino acid sequence shown in SEQ ID NO:54 and HCDR3 comprising the amino acid sequence shown in SEQ ID NO:55; the VL may comprise: comprising the amino acid sequence shown in SEQ ID NO:57 LCDR1 of the amino acid sequence, LCDR2 comprising the amino acid sequence shown in SEQ ID NO:58, and LCDR3 comprising the amino acid sequence shown in SEQ ID NO:59.
  • CAR T cell antigen receptor
  • MHCII major histo
  • the VL comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence shown in SEQ ID NO:60. %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
  • the targeting moiety comprises VH and VL, wherein the VH comprises at least about 90%, about 91%, about 92%, about 93% of the amino acid sequence shown in SEQ ID NO:56 , about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% of the amino acid sequence of identity, the VL comprises the amino acid sequence shown in SEQ ID NO:60 has Amino acid sequences that are at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • TCR T cell antigen receptor
  • MHCI major histocompatibility complex
  • the immune effector cells contain chimeric cells targeting IL13R ⁇ 2 Combined antigen receptor (CAR), the chimeric antigen receptor (CAR) targeting IL13R ⁇ 2 includes a targeting moiety, the targeting moiety includes VH and VL, and the VH may include the expression shown in SEQ ID NO:56 Amino acid sequence, the VL may comprise the amino acid sequence shown in SEQ ID NO:60.
  • the targeting moiety comprises a full length antibody, Fab, single chain variable fragment (scFv) or single domain antibody (VHH).
  • the targeting moiety comprises a scFv.
  • the targeting moiety comprises a linker polypeptide between VH and VL.
  • the linker polypeptide is selected from Gly-Ser linker (SEQ ID NO:37), Whitlow (Whitlow) linker (SEQ ID NO:38), and comprises and SEQ ID NO:37 or SEQ ID NO:37
  • the amino acid sequence shown in ID NO: 38 has at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% , a linker of amino acid sequences of about 99.5% identity.
  • the targeting moiety comprises at least about 90%, about 91%, about 92%, about 93%, about Amino acid sequences that are 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • TCR T cell antigen receptor
  • MHCI major histocompatibility complex
  • MHCII major histocompatibility complex
  • the immune effector cells contain chimeric cells targeting IL13R ⁇ 2 Combined antigen receptor (CAR), the chimeric antigen receptor (CAR) targeting IL13R ⁇ 2 comprises a targeting moiety, and the targeting moiety may comprise the amino acid sequence shown in SEQ ID NO:61 or SEQ ID NO:62 .
  • the CAR includes a transmembrane domain comprising a transmembrane domain derived from one or more proteins selected from the group consisting of: CD8A, CD8B, CD28, CD3 ⁇ (CD3e) , 4-1BB, CD4, CD27, CD7, PD-1, TRAC, TRBC, CD3 ⁇ , CTLA-4, LAG-3, CD5, ICOS, OX40, NKG2D, 2B4, CD244, Fc ⁇ RI ⁇ , BTLA, CD30, GITR, HVEM , DAP10, CD2, NKG2C, LIGHT, DAP12, CD40L (CD154), TIM1, CD226, DR3, CD45, CD80, CD86, CD9, CD16, CD22, CD33, CD37, CD64, and SLAM.
  • proteins selected from the group consisting of: CD8A, CD8B, CD28, CD3 ⁇ (CD3e) , 4-1BB, CD4, CD27, CD7, PD-1, TRAC, TRBC
  • the transmembrane domain comprises a transmembrane domain derived from CD8A.
  • the transmembrane domain may comprise a transmembrane domain derived from CD8A.
  • transmembrane domain comprises at least about 90%, about 91%, about 92%, about Amino acid sequences that are 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • the transmembrane domain can comprise the amino acid sequence shown in SEQ ID NO:69.
  • the CAR includes an intracellular co-stimulatory signaling domain comprising an intracellular co-stimulatory protein derived from one or more proteins selected from the group consisting of: Signal transduction domain: CD28, 4-1BB (CD137), CD27, CD2, CD7, CD8A, CD8B, OX40, CD226, DR3, SLAM, CDS, ICAM-1, NKG2D, NKG2C, B7-H3, 2B4, Fc ⁇ RI ⁇ , BTLA, GITR, HVEM, DAP10, DAP12, CD30, CD40, CD40L, TIM1, PD-1, LFA-1, LIGHT, JAML, CD244, CD100, ICOS, CD40, and MyD88.
  • Signal transduction domain CD28, 4-1BB (CD137), CD27, CD2, CD7, CD8A, CD8B, OX40, CD226, DR3, SLAM, CDS, ICAM-1, NKG2D, NKG2C, B7-H3, 2B4,
  • the intracellular costimulatory signaling domain is derived from a costimulatory signaling domain of 4-1BB.
  • the intracellular co-stimulatory signaling domain comprises at least about 90%, about 91%, of the amino acid sequence shown in any one of SEQ ID NO: 118 to SEQ ID NO: 150, Amino acid sequences that are about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • the intracellular co-stimulatory signaling domain may comprise the amino acid sequence shown in SEQ ID NO: 119.
  • the CAR includes an intracellular signaling domain comprising an intracellular signaling structure derived from one or more proteins selected from the group consisting of Domains: CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD79a, CD79b, FceRI ⁇ , FceRI ⁇ , Fc ⁇ RIIa, bovine leukemia virus gp30, Epstein-Barr virus (EBV) LMP2A, simian immunodeficiency virus PBj14Nef, DAP10, DAP-12 and contain at least one ITAM domain.
  • CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD79a, CD79b FceRI ⁇ , FceRI ⁇ , Fc ⁇ RIIa
  • bovine leukemia virus gp30 Epstein-Barr virus (EBV) LMP2A
  • PBj14Nef simian immunodeficiency virus
  • the intracellular signaling domain comprises a signaling domain derived from CD3 ⁇ .
  • said intracellular signal transduction domain comprises any of SEQ ID NO:134, SEQ ID NO:138, SEQ ID NO:139, SEQ ID NO:151 to SEQ ID NO:161
  • a given amino acid sequence has at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about Amino acid sequences with 99.5% identity.
  • the intracellular signal transduction domain may comprise the amino acid sequence shown in SEQ ID NO: 151.
  • the CAR includes a hinge region between the targeting moiety and the transmembrane domain, the hinge region comprising a hinge region derived from one or more proteins selected from the group consisting of: CD28, IgG1 , IgG4, IgD, 4-1BB, CD4, CD27, CD7, CD8A, PD-1, ICOS, OX40, NKG2D, NKG2C, Fc ⁇ RI ⁇ , BTLA, GITR, DAP10, TIM1, SLAM, CD30, and LIGHT.
  • proteins selected from the group consisting of: CD28, IgG1 , IgG4, IgD, 4-1BB, CD4, CD27, CD7, CD8A, PD-1, ICOS, OX40, NKG2D, NKG2C, Fc ⁇ RI ⁇ , BTLA, GITR, DAP10, TIM1, SLAM, CD30, and LIGHT.
  • the hinge region comprises a hinge region derived from CD8A.
  • the hinge region comprises at least about 90%, about 91%, about 92%, about 93% of the amino acid sequence shown in any one of SEQ ID NO: 162 to SEQ ID NO: 183 , about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% amino acid sequence identity.
  • the hinge region can comprise the amino acid sequence shown in SEQ ID NO: 170.
  • the non-targeting portion of the chimeric antigen receptor comprises the transmembrane domain of the CD8A molecule, the hinge region of CD8A, the intracellular co-stimulatory signaling domain of 4-1BB, and the CD3 ⁇ intracellular signaling structure area.
  • the non-targeting portion of the chimeric antigen receptor comprises at least about 90%, about 91%, about 92%, about 93%, about 90% of the amino acid sequence set forth in SEQ ID NO: 67. Amino acid sequences that are 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • the non-targeting portion of the chimeric antigen receptor can comprise the amino acid sequence set forth in SEQ ID NO:67.
  • the chimeric antigen receptor may include a CAR including a signal peptide, an anti-IL13R ⁇ 2 scFv, a CD8A hinge domain, a CD8A transmembrane domain, a 4-1BB co-stimulatory domain, and a CD3 ⁇ main signaling domain.
  • the signal peptide fragment comprises a CD8A signal peptide fragment.
  • the signal peptide fragment comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95% of the amino acid sequence shown in SEQ ID NO: 184, Amino acid sequences that are about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • the signal peptide fragment may comprise the amino acid sequence shown in SEQ ID NO: 184.
  • the chimeric antigen receptor comprises at least about 90%, about 91%, about 92% of the amino acid sequence set forth in any one of SEQ ID NO: 45 or SEQ ID NO: 46, Amino acid sequences that are about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • the chimeric antigen receptor can comprise the amino acid sequence set forth in any one of SEQ ID NO:45 or SEQ ID NO:46.
  • the immune effector cells include human cells.
  • the immune effector cells include T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, monocytes, dendritic cells, granulocytes, lymphocytes, leukocytes and/or peripheral blood mononuclear cells.
  • the immune effector cells may be T cells, such as human T cells.
  • the immune effector cells comprise autologous or non-autologous immune effector cells.
  • the immune effector cells can be non-autologous human T cells.
  • the immune effector cells include modified immune effector cells, wherein the modification includes down-regulation of the expression and/or activity of one or more genes associated with immune rejection.
  • the gene related to immune rejection is selected from one or more genes in the group consisting of TRAC, TRBC, HLA-A, HLA-B, B2M and CIITA.
  • the expression and/or activity of the TRAC gene and the HLA-A gene are down-regulated in the modified immune effector cells compared to the unmodified corresponding cells.
  • the expression and/or activity of the CIITA gene is not down-regulated in the modified immune effector cells compared to the corresponding cells without the modification.
  • the expression and/or activity of the B2M gene is not down-regulated in the modified immune effector cells compared to the corresponding cells without the modification.
  • the expression and/or activity of TRAC gene and HLA-A gene can be down-regulated in the modified immune effector cells, and the expression and/or activity of CIITA gene and B2M gene can be down-regulated. May not be lowered.
  • the expression and/or activity of the TRAC gene and the HLA-A gene are down-regulated in the modified immune effector cells compared to the corresponding wild-type cells.
  • the expression and/or activity of the B2M gene is not down-regulated in the modified immune effector cells compared to the corresponding wild-type cells.
  • the expression and/or activity of the CIITA gene is not down-regulated in the modified immune effector cells compared to the corresponding wild-type cells.
  • the expression and/or activity of TRAC gene and HLA-A gene can be down-regulated, and the expression and/or activity of CIITA gene and B2M gene can be unregulated in the modified immune effector cells. down.
  • the expression level and/or activity of the gene is down-regulated, including down-regulating the expression and/or activity of a nucleic acid molecule encoding the gene; and/or down-regulating the expression of a protein product encoded by the gene and/or activity is downregulated.
  • the modification includes: gene knockout, gene mutation and/or gene silencing.
  • the modification comprises the knockout of either of the two TRAC alleles and the knockout of either of the two HLA-A alleles in the immune effector cells.
  • the modification comprises knockout of two TRAC alleles and knockout of either of the two HLA-A alleles in the immune cells.
  • the modification comprises knockout of exon of TRAC gene and knockout of exon of HLA-A gene in the immune cells.
  • said modification comprises administering to said immune effector cells one or more substances selected from the group consisting of antisense RNA, siRNA, shRNA and CRISPR/Cas9 system.
  • said modification comprises administering a CRISPR/Cas9 system to said immune effector cells.
  • the modification further comprises administering to the immune effector cells sgRNA targeting the exon portion of the TRAC gene.
  • the sgRNA targeting the exon portion of the TRAC gene comprises at least about 90 %, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% amino acid sequence identity.
  • the modification comprises administering to the immune effector cells an sgRNA targeting the exon portion of the HLA-A gene.
  • the sgRNA targeting the exon portion of the HLA-A gene comprises at least one of the nucleotide sequences shown in any one of SEQ ID NO:201 to SEQ ID NO:241 Amino acid sequences that are about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • said modification further comprises administering a Cas enzyme to said cells.
  • the Cas enzyme comprises a Cas9 protein.
  • the antisense RNA comprises at least about 90%, about 91%, about 92% of the nucleotide sequence shown in any one of SEQ ID NO:242 to SEQ ID NO:245 , about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% amino acid sequence identity.
  • the immune effector cells are HLA-B homozygous cells.
  • HLA-B homozygote includes HLA-B*40 homozygote, HLA-B*15 homozygote, HLA-B*46 homozygote, HLA-B*13 homozygote, HLA-B* B*51 homozygote, HLA-B*58 homozygote, HLA-B*07 homozygote, HLA-B*35 homozygote, HLA-B*44 homozygote, HLA-B*52 homozygote, HLA-B* 57 homozygous, HLA-B*54 homozygous, HLA-B*55 homozygous.
  • the immune effector cells are HLA-A homozygous or heterozygous cells.
  • HLA-A homozygote or heterozygote comprises HLA-A*02 homozygote, HLA-A*11 homozygote, HLA-A*02/A*11 heterozygote or HLA-A *24 homozygotes.
  • the immune effector cells can be human T cells, and the human T cells can be HLA-B homozygous cells.
  • the present application provides a method for preparing the aforementioned immune effector cells, which includes: introducing into the immune effector cells a polynucleotide sequence encoding the aforementioned CAR targeting IL13R ⁇ 2 or comprising a polynucleotide encoding the aforementioned CAR targeting IL13R ⁇ 2 Before/after the carrier of the sequence, the immune effector cells are modified, and the modification includes down-regulation of the expression and/or activity of one or more genes related to immune rejection.
  • the method for preparing immune effector cells may include:
  • the modification includes down-regulating the expression and/or activity of one or more genes related to immune rejection.
  • the method for preparing immune effector cells may include:
  • CD3 magnetic beads were added in proportion to collect CD3-T cells (cells not bound to magnetic beads).
  • the vector is an expression vector.
  • the vector is selected from DNA vectors, RNA vectors, plasmids, lentiviral vectors, adenoviral vectors, adeno-associated viral vectors and retroviral vectors.
  • the vector further comprises an EF-1 ⁇ promoter.
  • the vector further comprises a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE).
  • WPRE woodchuck hepatitis virus post-transcriptional regulatory element
  • the gene related to immune rejection is selected from one or more genes in the group consisting of TRAC, TRBC, HLA-A, HLA-B, B2M and CIITA.
  • the genes related to immune rejection may include TRAC and/or HLA-A.
  • the expression and/or activity of the TRAC gene and the HLA-A gene in said immune effector cells are down-regulated compared to the expression and/or activity of the corresponding genes in corresponding cells without said modification.
  • the expression and/or activity of the CIITA gene is not down-regulated compared to the expression and/or activity of the corresponding gene in a corresponding cell without said modification.
  • the expression and/or activity of the B2M gene is not down-regulated compared to the expression and/or activity of the corresponding gene in a corresponding cell without said modification.
  • the expression and/or activity of TRAC gene and HLA-A gene can be down-regulated in the modified immune effector cells, and the expression and/or activity of CIITA gene and B2M gene can be down-regulated. May not be lowered.
  • the expression and/or activity of the TRAC gene and the HLA-A gene of the immune effector cells is down-regulated compared to corresponding wild-type cells.
  • the expression and/or activity of the CIITA gene is not downregulated compared to corresponding wild-type cells.
  • the expression and/or activity of the B2M gene is not down-regulated compared to corresponding wild-type cells.
  • the expression level and/or activity of the gene is down-regulated, including down-regulating the expression and/or activity of a nucleic acid molecule encoding the gene; and/or down-regulating the expression of a protein product encoded by the gene and/or activity is downregulated.
  • the expression and/or activity of TRAC gene and HLA-A gene can be down-regulated, and the expression and/or activity of CIITA gene and B2M gene can be unregulated in the modified immune effector cells. down.
  • the modification includes: gene knockout, gene mutation and/or gene silencing.
  • the modification comprises the knockout of either of the two TRAC alleles and the knockout of either of the two HLA-A alleles in the immune effector cells.
  • the modification comprises knockout of two TRAC alleles and knockout of either of the two HLA-A alleles in the immune cells.
  • the modification comprises knockout of exon of TRAC gene and knockout of exon of HLA-A gene in the immune cells.
  • said modification comprises administering to said immune effector cells one or more substances selected from the group consisting of antisense RNA, siRNA, shRNA and CRISPR/Cas9 system.
  • said modification comprises administering a CRISPR/Cas9 system to said immune effector cells.
  • the modification comprises administering to the immune effector cells an sgRNA targeting an exon portion of the TRAC gene.
  • the sgRNA targeting the exon portion of the TRAC gene comprises at least about 90 %, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% amino acid sequence identity.
  • the modification comprises administering to the immune effector cells an sgRNA targeting an exon portion of the HLA-A gene.
  • the sgRNA targeting the exon portion of the HLA-A gene comprises at least one of the nucleotide sequences shown in any one of SEQ ID NO:201 to SEQ ID NO:241 Amino acid sequences that are about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • said modification further comprises administering a Cas enzyme to said cells.
  • the Cas enzyme comprises a Cas9 protein.
  • the antisense RNA comprises at least about 90%, about 91%, about 92% of the nucleotide sequence shown in any one of SEQ ID NO:242 to SEQ ID NO:245 , about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% amino acid sequence identity.
  • the immune effector cells comprise human cells.
  • the immune effector cells include T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, monocytes, dendritic cells, granulocytes, lymphocytes, leukocytes and/or peripheral blood mononuclear cells.
  • the immune effector cells may be T cells, such as human T cells.
  • the immune effector cells comprise autologous or non-autologous immune effector cells.
  • the cells are homozygous for HLA-B.
  • the immune effector cells can be human cells, and the human cells can be HLA-B homozygous cells.
  • the immune effector cells may be human T cells, and the human cells may be HLA-B homozygous cells.
  • HLA-B homozygote includes HLA-B*40 homozygote, HLA-B*15 homozygote, HLA-B*46 homozygote, HLA-B*13 homozygote, HLA-B* B*51 homozygote, HLA-B*58 homozygote, HLA-B*07 homozygote, HLA-B*35 homozygote, HLA-B*44 homozygote, HLA-B*52 homozygote, HLA-B* 57 homozygous, HLA-B*54 homozygous, HLA-B*55 homozygous.
  • the cells are HLA-A homozygous or heterozygous cells.
  • HLA-A homozygote or heterozygote comprises HLA-A*02 homozygote, HLA-A*11 homozygote, HLA-A*02/A*11 heterozygote or HLA-A *24 homozygotes.
  • the present application also provides the application of the aforementioned immune effector cells in the preparation of CAR-T cells.
  • the present application also provides a pharmaceutical composition, which comprises the aforementioned immune effector cells, and optionally a pharmaceutically acceptable carrier.
  • the present application also provides the aforementioned immune effector cells and/or the aforementioned pharmaceutical composition, which are used for treating diseases or disorders related to the expression of IL13R ⁇ 2.
  • the disease or disorder associated with the expression of IL13R ⁇ 2 comprises a disease or disorder associated with upregulated expression of IL13R ⁇ 2.
  • the disease or disorder associated with expression of IL13R ⁇ 2 comprises cancer.
  • the cancer comprises IL13R ⁇ positive tumors.
  • the IL13R ⁇ -positive tumors include malignant glioma, colorectal cancer, cervical cancer, pancreatic cancer, skin melanoma, ovarian cancer, breast cancer, adrenocortical carcinoma, thymoma, uterine cancer, bladder cancer cancer, esophageal cancer, squamous cell carcinoma of the head and neck, or gastric cancer.
  • the present application also provides the use of the aforementioned immune effector cells and/or the aforementioned pharmaceutical composition in the preparation of medicines for treating diseases or conditions related to the expression of IL13R ⁇ 2.
  • the disease or disorder associated with the expression of IL13R ⁇ 2 comprises a disease or disorder associated with upregulated expression of IL13R ⁇ 2.
  • the disease or disorder associated with expression of IL13R ⁇ 2 comprises cancer.
  • the cancer comprises IL13R ⁇ positive tumors.
  • the IL13R ⁇ -positive tumors include malignant glioma, colorectal cancer, cervical cancer, pancreatic cancer, skin melanoma, ovarian cancer, breast cancer, adrenocortical carcinoma, thymoma, uterine cancer, bladder cancer cancer, esophageal cancer, squamous cell carcinoma of the head and neck, or gastric cancer.
  • the present application also provides a method for preventing or treating a disease or disorder related to the expression of IL13R ⁇ 2, which comprises administering an effective amount of the aforementioned immune effector cells and/or the aforementioned drug combination to a subject in need things.
  • the disease or disorder associated with the expression of IL13R ⁇ 2 comprises a disease or disorder associated with upregulated expression of IL13R ⁇ 2.
  • the disease or disorder associated with expression of IL13R ⁇ 2 comprises cancer.
  • the cancer comprises IL13R ⁇ positive tumors.
  • the IL13R ⁇ -positive tumors include malignant glioma, colorectal cancer, cervical cancer, pancreatic cancer, skin melanoma, ovarian cancer, breast cancer, adrenocortical carcinoma, thymoma, uterine cancer, bladder cancer cancer, esophageal cancer, squamous cell carcinoma of the head and neck, or gastric cancer.
  • the anti-IL13R ⁇ 2 CAR VLVH (mouse) structure includes: an IL13R ⁇ 2 antigen-binding region (derived from the anti-IL13R ⁇ 2 mouse monoclonal antibody Scfv), a CD8A extracellular hinge region, a CD8A transmembrane region, and a 4 -1BB intracellular co-stimulatory domain and a CD3 ⁇ activation signal domain, the DNA sequence of which is shown in SEQ ID NO:51 and the amino acid sequence is shown in SEQ ID NO:45.
  • the anti-IL13R ⁇ 2 CAR VHVL (human) structure includes: an IL13R ⁇ 2 antigen-binding region (derived from the anti-IL13R ⁇ 2 human monoclonal antibody Scfv), a CD8A extracellular hinge region, a CD8A transmembrane region, and a 4-1BB intracellular costimulator domain and a CD3 ⁇ activation signal domain, its DNA sequence is shown in SEQ ID NO:52 and its amino acid sequence is shown in SEQ ID NO:46.
  • the IL13R ⁇ 2 CAR lentiviral expression vector was constructed, and the vector schematic diagram (see Figure 1). Optimization: select the commercial lentiviral expression vector pCDH-CMV-MCS-EF1-copGFP as the backbone, and carry out element transformation on the basis of this vector. First, the ampicillin resistance gene ⁇ -lactamase of the vector was replaced with the aminoglycoside phosphotransferase derived from Tn5, so that the vector had kanamycin resistance. Second, we deleted the CMV promoter and its adjacent downstream multiple cloning sites, which are potentially threatening for in vivo applications.
  • the copGFP gene expressed by the EF1 promoter in the original vector was deleted, the SalI restriction site was retained, and the SmaI restriction site was added at the 5' end of SalI for vector construction to form the final destination vector.
  • the added SmaI restriction site is a single restriction site for the final destination vector, and other sequence parts of the vector do not have this restriction site.
  • the non-limiting design principle of the sgRNA of the CRISPR/Cas9 system used in this example is: 5'-NNN(20)-NGG-3', NGG is called protospacer adjacent motif (PAM), wherein , N represents A, T, C or G.
  • PAM protospacer adjacent motif
  • sgRNAs Since many sgRNAs can be designed on the same exon, and sgRNAs consisting of 20 nucleotide sequences may appear repeatedly in the genome, use the website http://crispr.cos.uni-heidelberg.de to Carry out the design and evaluation of sgRNA, paste the exon sequence to this website, the website designs sgRNA and conducts prediction evaluation, the higher the score in the evaluation, it means that there may be higher editing efficiency and lower off-target risk, from which Select the sgRNA with higher score to test.
  • the sgRNA targeting the TRAC gene is shown in SEQ ID NO:186 to SEQ ID NO:200
  • the sgRNA targeting the HLA-A02 gene is shown in SEQ ID NO:201 to SEQ ID NO:222
  • the targeting HLA-A11 gene The sgRNA of the gene is shown in SEQ ID NO:223 to SEQ ID NO:233
  • the sgRNA targeting the HLA-A24 gene is shown in SEQ ID NO:234 to SEQ ID NO:241, which were synthesized by GenScript Biotechnology Company.
  • HLA-B typing of the recipient select HLA-B homozygotes that match the HLA-B typing of the recipient.
  • the source of the donor is based on the HLA-B homozygote in the population.
  • One of the alleles of the patient's HLA-B is consistent with the donor's HLA-B homozygote.
  • Cells from these donors can cover a high number of patient populations . Reduce the rejection caused by the inconsistency of HLA-B subtypes.
  • HLA-B mainly selects B*40 homozygote, B*15 homozygote, B*46 homozygote, B*13 homozygote, B*51 homozygote, B*58 homozygote, B*07 homozygote with high frequency in the population Homozygote, B*35 homozygote, B*44 homozygote, B*52 homozygote, B*57 homozygote, B*54 homozygote, B*55 homozygote.
  • HLA-A selects A*02 homozygotes, A*11 homozygotes and A*02/A11 heterozygotes with higher frequencies in the population.
  • Peripheral blood was collected from healthy donors and diluted 1:1 with PBS buffer.
  • cell separation solution Ficoll
  • blood cell dilution solution very slowly along the tube wall, and centrifuge at 800g for 20min at room temperature (set the centrifuge to increase speed 1, reduce speed 0).
  • the liquid in the centrifuge tube is divided into PBS and serum layer, white blood cell layer, lymphocyte separation solution, and red blood cell layer from top to bottom.
  • remove the PBS and serum layer move the white blood cell layer to a new 50ml centrifuge tube, add PBS to 40ml to wash the cells, and centrifuge at 450g for 10min. After centrifugation, the supernatant was discarded to obtain peripheral blood mononuclear cells. Cell counts were performed after the cells were resuspended.
  • T cells in peripheral blood mononuclear cells were extracted using EasySep TM Human T Cell Separation Kit (purchased from StemCell Technologies, catalog number: 17951). Adjust the PBMC density to 5 ⁇ 10 ⁇ 7 cells/ml, and add PBS buffer in the range of 0.25-2ml; first add cocktail to mix well, then add isolation cocktail at 50 ⁇ l/ml, mix well and place at room temperature for 5min; vortex RapidSpheres Vortex the shaker for 30s, add 40 ⁇ l/ml to the cells and mix evenly; add buffer to the multiple of 2.5ml, and gently blow up and down 2-3 times; add 2.5ml to each tube, Place the cryopreservation tube on the magnetic stand, and let it stand at room temperature for 3 minutes; gently open the cover of the cryopreservation tube, carefully hold the two sides to pick up the magnetic stand, keep it upside down for 2-3 seconds, and pour the cell solution into a new centrifuge tube at one time; After resuspending the cells in 10-20ml buffer (depending
  • anti-IL13RA2 UCAR-T knocks out T cell TCR and HLA-A through gene editing technology, and makes T cells express anti-IL13R ⁇ 2 CAR molecule through lentiviral transfection.
  • Example 2 Obtain CD3+T cells according to the method of Example 2 (D0 day), and activate with CD3/CD28 antibody magnetic beads, and perform lentiviral vector (IL13R ⁇ 2 CAR lentiviral expression vector prepared in Example 1) transfection on D1 day after activation, On D2, the lentiviral vector was washed away, and on D3, electroporation was performed.
  • lentiviral vector INF13R ⁇ 2 CAR lentiviral expression vector prepared in Example 1
  • TRAC sgRNA AGAGTCTCTCAGCTGGTACA (SEQ ID NO: 186), A02 sgRNA: CTGACCATGAAGCCACCCCTG (SEQ ID NO: 203), A11 sgRNA: GGCCCCTCCTGCTCTATCCA (SEQ ID NO: 233).
  • Sorting CD3-negative T cells centrifuging after counting cells, discarding supernatant; resuspending cells with buffer and mixing, adding CD3 magnetic beads to 20ul CD3 magnetic beads/ 107 cells, mixing evenly, and incubating in a 4-degree refrigerator.
  • Cell harvesting Collect cells in a centrifuge tube and discard after centrifugation, wash the cells again with normal saline, centrifuge, prepare a cryopreservation solution, resuspend the centrifuged cells in the cryopreservation solution, and draw the cell suspension into the final product with a cell freezer In the storage bag, label the cell cryopreservation bag for the next step of freezing.
  • Knockout efficiency (AB)/A ⁇ 100%; A is the positive expression rate of the control group; B is the positive expression rate of the knockout group.
  • IL13R ⁇ 2 target cells U251-LG, luciferase+GFP; adjust the state of the target cells to the logarithmic growth phase, and need to be continuously passaged twice before the experiment;
  • the target cells were resuspended in 1640+10% FBS, and three 24-well plates were taken for each target site, and the target cells were inoculated according to the amount of 2x10 ⁇ 5/well. (Both target cells and effector cells were seeded at a density of 2x10 ⁇ 6/ml). Then add effector cells according to the E/T (effect-to-target ratio, effector cells: target cells) ratio. Replenish each well to the maximum volume (such as 600ul). The control was inoculated with the same number of target cells without adding effector cells (600ul). The well plate was placed in a 5% CO 2 , 37° C. incubator and incubated for 24 hours. E/T: 1:2, 1:1, 2:1, 5:1, 10:1 plank, repeat three times.
  • the supernatant of the above co-culture system was collected to detect the secretion level of cytokines.
  • mice aged 8-10 weeks were subcutaneously injected with tumor cells U251-LG (5x10 ⁇ 6).
  • the mice were divided into three groups with 5 mice in each group.
  • the tumor formation time was generally 2-4 weeks.
  • IL13R ⁇ 2 UCAR-T cells, IL13R ⁇ 2 CAR-T cells, and non-gene-knockout T cells 5E6 were injected intratumorally into each group of mice, with a single point injection and an injection volume of 50ul. Tumor regression in mice was monitored by luciferase.
  • mice Fifteen humanized immune system mice (hHSC-NCG) were prepared and divided into 3 groups. Preparation of cells, experimental group IL13R ⁇ 2 UCAR-T cells (knockout TRAC+HLA-A02); control group 1: IL13R ⁇ 2 CAR-T; control group 2: IL13R ⁇ 2 UCAR-T cells (knockout TRAC+B2M); each mouse 1x10 ⁇ 7 cells were injected, blood was collected at different time points D0, 2h, D3, D7, D14, D21, D28, D35, D42, D49, D56, D60. Genomes were extracted from blood samples at different time points, and the copy/ng genome DNA was calculated by QPCR absolute quantification method. The positive control was UCAR-T cells harvested on the 14th day, and the negative control was DEPC water.
  • GVHD response Prepare TRAC, HLA-A double-knockout T cells, T cells without gene knockout, irradiate allogeneic PBMC, stimulate the two groups of cells prepared respectively, and detect the level of IFN-r.
  • Allogeneic reaction Allogeneic PBMC stimulated the cells of the two groups after irradiation, and detected the level of IFN-r.
  • GVHD response prepare TRAC, HLA-A double knockout T cells, and T cells without gene knockout. 8-10 weeks NSG mice were injected with 1x10 ⁇ 7 respectively, and the graft-versus-host reaction was observed through clinical indicators: survival rate, fur texture and skin integrity, etc. Cytokine detection: Peripheral blood serum was collected to detect the levels of cytokines such as IL6, IL-2, TNF- ⁇ , IFN- ⁇ , etc. Blood collection time: before reinfusion, 24h, D3, D7, D14, D28, 2M.
  • Result analysis (Fig. 10A-10D): three groups of UCAR-T with a knockout efficiency greater than 80% had very low levels of cytokine secretion, especially the two groups with a knockout efficiency greater than 90%; indicating that TRAC, HLA-A double knockout T The cell group largely reduced the GVHD response.
  • Allogeneic reaction preparation of TRAC, HLA-A double-knockout CAR-T cells, and co-injection of 1x10 ⁇ 7 TCR-HLA-A-double-knockout CAR-T cells (irradiated) and 2x10 ⁇ 6 allotype T cells into NSG mice.
  • Control group 1 Inject 5x10 ⁇ 6 TCR-B2M anti-IL13RA2 UCAR-T cells and 5x10 ⁇ 6 allogeneic T cells into NSG mice.
  • Control group 2 Inject 5x10 ⁇ 6 TCR-IL13RA2 UCAR-T cells and 5x10 ⁇ 6 allogeneic T cells into NSG mice.
  • Control group transfer to CAS9+ODN label
  • On-target and off-target-WGS (Whole genome sequencing): 1 ⁇ 10 ⁇ 6 T cells without gene knockout, TRAC, and HLA-A double-knockout T cells were taken respectively and sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for detection .
  • Result analysis double-knockout T cells (TRAC+HLA-A) detected whether chromosomal translocation occurred on D14 (harvest).
  • the detection results the detection values of both translocation methods were close to zero detection value, indicating that no rearrangement of the loci occurred ( See Figure 14).
  • Residual Cas9 protein During cell preparation, 1 ⁇ 10 ⁇ 6 cells at each of the three time points before knockout, after knockout, and before harvest were lysed, and then protein quantification kit (NOVATEINBIO, Cat. No. NB-E1372PR ) for quantification, the samples in each group were adjusted to the same loading volume of 2 ⁇ g, and the CRISPR/Cas9 protein ELISA kit was used for detection according to the instructions.
  • the Cas9 protein in the sample is firmly and stably placed on the test paper well. Then use the detection antibody to recognize the bound Cas9 protein, and then develop with the developer.
  • the Cas9 ratio is proportional to the absorbance, and the absolute amount of Cas9 protein is quantified by comparing with the Cas9 control.
  • Double knockout T cells detected the residue of spCas9 at four time points before electroporation (D3), before electroporation (D5), D9, and D14 (harvest). Trace residues were detected before solution (D5), but not detected at the other three time points. (See Figure 16).
  • the RNP complex was transferred into the activated T cells prepared in Example 2 by electroporation using an electroporation kit (purchased from LONZA, product number V4XXP-3024). Preheat the medium (X-VIVO15 medium + 10% FBS + IL2 (200 U/ml) + IL7 (10 ng/ml) + IL15 (5 ng/ml)) in the well plate 30 minutes in advance.
  • the sgRNA sequence of TRAC is sg9
  • the sgRNA sequence of HLA-A is HLA-A02 Sg2 or HLA-A02 Sg5 or HLA-A11 sg21 or HLA-A11 Rsg2
  • 10 ⁇ g of Cas9 protein purchased from thermo, product number A36499 was added, mixed gently, and incubated at room temperature for 12 min.
  • Example 2 Count the activated T cells cultured in Example 2, centrifuge at 300g for 8min, discard the supernatant, add PBS to resuspend the cells, absorb 1E7 cells and centrifuge again at 300g for 8min, discard the supernatant, and resuspend the cells with 100 ⁇ l of prepared electroporation buffer .
  • Add the preheated medium into the electro-cup then transfer the cells into the preheated medium in the well plate with a matching pipette, and then place them in a 37°C, 5% CO 2 incubator for culture.
  • AxyPrepTM PCR Product Cleaning Kit purchased from AXYGEN
  • kit DNA A-Tailing Kit, purchased from TaKaRa
  • pass DNA Ligation Kit Ver2.1 purchased from TaKaRa
  • the product was connected to the T vector
  • pMDTM19-T Vector Cloning Kit was purchased from TaKaRa
  • the ligated product was transformed into competent cells (DH5 alpha)
  • DH5 alpha competent cells
  • Knockout efficiency number of mutant clones/total number of clones.
  • Knockout efficiency (AB)/A ⁇ 100%; A is the positive expression rate of the control group; B is the positive expression rate of the knockout group.
  • the three detection results of TRAC single gene knockout are shown in Figure 17 to Figure 19, and the knockout efficiency calculation results are shown in Table 1.
  • the three detection methods are basically the same, and only the Sanger sequencing method was used to detect the editing efficiency in subsequent experiments.
  • the RNP complex was transferred into the activated T cells prepared in Example 2 by electroporation using an electroporation kit (purchased from LONZA, product number: V4XXP-3024). Preheat the medium (X-VIVO15 medium + 10% FBS + IL2 (200 U/ml) + IL7 (10 ng/ml) + IL15 (5 ng/ml)) in the well plate 30 minutes in advance.
  • TRAC Sg9 20 ⁇ g TRAC sgRNA (TRAC Sg9), 20 ⁇ g HLA-A sgRNA (HLA-A02 Sg2 or HLA-A02 Sg5 or HLA-A11 sg21 or targeting HLA-A*24:02:01, HLA-A A*30:01:01:01, HLA-A*33:01:01:01, HLA-A*03:01:01:01, HLA-A*01:01:01:01, or HLA-A* 26:01:01:01:01 sgRNA) into PCR tubes (no RNA), and then add 10 ⁇ g Cas9 protein (purchased from thermo, product number A36499) respectively, mix gently, and incubate at room temperature for 12 minutes.
  • Cas9 protein purchased from thermo, product number A36499
  • Example 2 Count the activated T cells cultured in Example 2, centrifuge at 300g for 8min, discard the supernatant, add PBS to resuspend the cells, absorb 1E7 cells and centrifuge again at 300g for 8min, discard the supernatant, and resuspend the cells with 100 ⁇ l of prepared electroporation buffer .
  • Add the preheated medium into the electro-cup then transfer the cells into the preheated medium in the well plate with a matching pipette, and then place them in a 37°C, 5% CO 2 incubator for culture.
  • the double-gene knockout efficiency is detected by sequencing, and TRAC-negative and HLA-A-negative T cells with a double-gene knockout efficiency of not less than 80% can be obtained.
  • the results are shown in Figure 24-25.
  • Figure 24A shows the result of using HLA-A02 Sg5 to knock out HLA-A02, wherein the upper line shows the results of the control group (that is, the knockout is not performed using HLA-A02 Sg5); the next line shows the simultaneous knockout of HLA -The results of A02 and TRAC;
  • Figure 24B shows the results of using TRAC Sg9 to knock out TRAC, where the upper row shows the results of the control group (that is, no TRAC Sg9 is used for knockout); the next row shows simultaneous knockout HLA-A02 and TRAC results.
  • Figure 25A-25B shows the knockout situation of knockout HLA-A02 and TRAC protein levels, wherein NEG refers to the negative control, WT refers to the situation without any knockout treatment, and TRAC+HLA-A double knockout refers to knockout of HLA- Results of A02 and TRAC.
  • Example 13 Differences in the expression of TRAC gene, HLA-A gene, B2M gene and CIITA gene in T cells with double gene knockout and corresponding genes in corresponding cells
  • Example 2 The activated T cells prepared in Example 2 were divided into two groups, one group was used as a control, and the other group prepared TRAC gene and HLA-A gene double gene knockout T cells according to the method in Example 5, according to Sanger sequencing was performed in the manner of step (1) of Example 4. According to the sequencing results, the TRAC and HLA-A double gene knockout cells were obtained.
  • the prepared double gene knockout T cells are incubated with corresponding TRAC and HLA-A antibodies, and the double gene knockout cell lines can be obtained by flow sorting or magnetic bead sorting.
  • RNA extraction kit purchased from QIAGEN, catalog number: 74004
  • reverse transcription kit purchased from Applied Biosystems, catalog number: 4368814
  • Figure 27-28 The results are shown in Figure 27-28.
  • Fig. 26 shows is the mRNA level measurement of gene expression, and wherein Fig. 26 shows the mRNA level of TRAC, HLA-A, B2M and CIITA;
  • WT refers to the situation without any knockout treatment
  • double knockout group refers to TRAC gene and HLA-A gene double knockout T cells results.
  • Figure 27 shows the protein level determination of gene expression, wherein Figure 27A-27B shows the protein expression levels of B2M and CIITA respectively; wherein NEG refers to the negative control, WT refers to the situation without any knockout treatment, TRAC+HLA-A Double knockout refers to the result of T cells with double gene knockout of TRAC gene and HLA-A gene.
  • Example 14 Prepare TRAC gene, HLA-A/B2M gene and CIITA gene knockout T cells and verify the expression changes of the corresponding three genes
  • Example 15 step (1) Prepare the control group and TRAC gene, HLA-A gene and CIITA gene triple gene knockout cells, and TRAC gene, B2M gene and CIITA gene triple gene knockout cells according to the method of Example 15 step (1).
  • TRAC, HLA-A and CIITA genes in TRAC, HLA-A and CIITA gene knockout T cells were down-regulated; compared with control cells, TRAC, B2M and CIITA triple gene knockout The protein expressions of TRAC, HLA-A and CIITA genes were down-regulated in T cells.
  • FIGS 28A-28D show the knockout status of TRAC, HLA-A and B2M protein levels in sequence.
  • WT refers to the situation without any knockout treatment
  • TRAC+HLA-A double knockout refers to the result of T cells with double gene knockout of TRAC gene and HLA-A gene
  • TRAC+HLA-A+CIITA triple knockout refers to TRAC, The result of the T cells with HLA-A and CIITA triple gene knockout
  • TRAC+B2M+CIITA triple knockout refers to the result of the T cells with B2M, CIITA and TRAC triple gene knockout
  • TRAC+HLA-A knockdown refers to Example 18 Results of preparation of TRAC and HLA-A knockdown T cells.
  • Figure 28D shows the knockdown of CIITA protein levels.
  • Embodiment 15 designs antisense RNA sequence
  • RNA sequences of the corresponding genes (TRAC gene and HLA-A gene) through the database https://www.ncbi.nlm.nih.gov/ or www.ensembl.org/, and design siRNA with reference to the following principles:
  • the designed antisense RNA sequences include HLA-A-homo-551; HLA-A-homo-NEG; TRAC-homo-375; TRAC-homo-NEG.
  • Double gene knockdown was performed using the antisense RNA designed by Example 17.
  • the company prepares lentivirus (Gimma) with antisense RNA sequences of TRAC gene and HLA-A gene.
  • CD3 + T cells were prepared according to the method in Example 2 (D0 days), and activated with CD3/CD28 antibody magnetic beads, and the activated T cells were transfected with lentiviruses carrying the antisense RNA sequences of the TRAC gene and the HLA-A gene (D1 day), wash off the lentiviral vector on D2, and continue to culture until D5.
  • the T cells cultured to D5 days were collected, and the gene knockdown efficiency was detected by quantitative PCR or Western Blot and other methods.
  • T cells with TRAC gene and HLA-A gene knockdown can be obtained by flow sorting or magnetic bead sorting.
  • the results showed that the mRNA and protein expression levels of TRAC and HLA-A were down-regulated in the TRAC and HLA-A gene knockdown group.
  • Figures 29A-29B sequentially show the knockout conditions of TRAC and HLA-A mRNA levels.
  • WT refers to the situation without any knockout treatment
  • TRAC+HLA-A double knockout refers to the result of T cells with double gene knockout of TRAC gene and HLA-A gene.
  • the knockout levels of TRAC and HLA-A protein levels can be referred to the results in FIG. 28 .
  • TRAC+HLA-A double knockout refers to the result of T cells with double gene knockout of TRAC gene and HLA-A gene
  • TRAC+HLA-A+CIITA triple knockout refers to TRAC, The result of the T cells with HLA-A and CIITA triple gene knockout
  • TRAC+B2M+CIITA triple knockout refers to the result of the T cells with B2M, CIITA and TRAC triple gene knockout
  • TRAC+HLA-A knockdown refers to Example 18 Results of preparation of TRAC and HLA-A knockdown T cells.
  • T cells without gene knockout, double gene knockout, three gene knockouts and double gene knockdown in Examples 2, 14, 16 and 18 were labeled with CFSE (invitrogen, C34554), and the cell counts were taken as 1 *10 6 cells were co-cultured with NK cells (NK92MI) at a ratio of 1:1. After 24 hours, the co-cultured cells were collected, and the ratio of CFSE-positive cells in the mixed cells was detected by flow cytometry.
  • NK+T refers to the situation in which NK cells are co-cultured with T cells without any knockout treatment
  • NK+TRAC+HLA-A knockdown refers to the combination of NK cells with the TRAC gene and HLA-A gene prepared in Example 18
  • the results of the knockdown T cells co-culture NK+TRAC+HLA-A double knockout refers to the co-culture of NK cells and T cells with TRAC gene and HLA-A gene double gene knockout
  • NK+TRAC+HLA -A+CIITA triple knockout refers to the situation where NK cells are co-cultured with TRAC, HLA-A and CIITA triple knockout T cells
  • NK+TRAC+B2M+CIITA triple knockout refers to the situation where NK cells are combined with B2M
  • No gene knockout, double gene knockout, three gene knockout and double gene knockdown T cells in Examples 2, 14, 16 and 18 were prepared from peripheral blood from donor 1.
  • CD3 + T cells were prepared from peripheral blood from donor 2.
  • Each group of cells prepared from the peripheral blood of donor 1 was mixed with the CD3 + T cells prepared from the peripheral blood of donor 2 in equal proportions, and the expression level of IFN- ⁇ in the cell mixed system was detected 24 hours later. The results showed that the expression level of IFN- ⁇ in the double gene knockout T cell group was lower than that in the triple gene knockout T cell group.
  • TRAC+HLA-A double knockout refers to the result of T cells with double gene knockout of TRAC gene and HLA-A gene
  • TRAC+HLA-A+CIITA Triple knockout refers to the result of T cells knocked out by three genes of TRAC, HLA-A and CIITA
  • TRAC+B2M+CIITA triple knockout refers to the result of T cells knocked out by three genes of B2M, CIITA and TRAC
  • TRAC+HLA-A knockout Low refers to the result of TRAC gene and HLA-A gene knockdown T cells prepared in Example 16.
  • Example 20 Preparation of CAR-T cells with double gene knockout of TRAC gene and HLA-A gene, CAR-T cells with triple gene knockout of TRAC gene, HLA-A gene and CIITA gene, and knockout of TRAC gene, B2M gene and CIITA gene Removed CAR-T cells
  • TRAC gene and HLA-A gene knockout cells Take the CAR-T cells on day D5 as initial cells, prepare TRAC gene and HLA-A gene knockout cells according to the methods in Example 14 and Example 16 respectively, TRAC gene, HLA-A gene and CIITA gene as well as TRAC gene, B2M gene and CIITA gene knockout CAR-T cells.
  • the double-gene knockout and triple-gene knockout CAR-T cells can be obtained through flow cytometry detection, and the yield of double-gene knockout CAR-T cells is higher than that of triple-gene knockout CAR-T cells.
  • FIGS 33A-33D The results are shown in Figures 33A-33D.
  • Figures 33A-33C sequentially show the knockout status of TRAC, HLA-A and B2M protein levels.
  • Figure 33D shows the knockdown of CIITA protein levels.
  • WT refers to the situation without any knockout treatment
  • TRAC+HLA-A double knockout refers to the result of CAR-T cells with double gene knockout of TRAC gene and HLA-A gene
  • TRAC+HLA-A+CIITA triple knockout refers to The results of CAR-T cells with triple gene knockout of TRAC, HLA-A and CIITA
  • TRAC+B2M+CIITA triple knockout refers to the results of CAR-T cells with triple gene knockout of B2M, CIITA and TRAC.
  • the transfection efficiency of CD19CAR is shown in Figure 34.
  • CAR30%+ represents the transfection efficiency of CD19 CAR.
  • Figure 35 shows the expansion factor of different cells. Among them, CAR-T cells with double gene knockout of TRAC gene and HLA-A gene had the highest amplification factor.
  • CAR-T cells targeting CD19, CD20 or BCMA
  • Figure 36 shows the killing effect of Raji-Luciferase on CD19 target cells, among which the killing effect of CAR-T cells with double knockout of TRAC gene and HLA-A gene is the most significant. Among them, each E/T ratio is the result corresponding to the legend of A-D from left to right.
  • NSG mice were injected with tumor cells intravenously. After the tumor was successfully established, CAR-T cells with double gene knockout of TRAC gene and HLA-A gene, CAR-T cells with triple gene knockout, or CAR-T cells without gene knockout were reinfused into the mice. T cells, monitoring tumor volume in mice.
  • the tumor growth rate was significantly slowed down in mice transfused with double-gene knockout CAR-T cells.
  • Figures 37-38 The results are shown in Figures 37-38.
  • Figure 37 shows the way of administration to mice, i.v. indicates intravenous injection
  • CAR-T cells represent double-gene knockout CAR-T cells expressing CD19 CAR and triple-gene knockout CAR-T cells.
  • Figure 38 shows the volume of tumors in mice after administration of CAR-T cells.
  • Figure 38 shows from the left to the right column that the three genes of CD19 CAR-T cells, TRAC, HLA-A and CIITA were administered with normal saline, unmodified T cells, TRAC gene and HLA-A gene double gene knockout respectively.
  • This application is the first to construct high-efficiency double-knockout TCR, HLA-A IL13R ⁇ 2-UCAR-T cells to achieve a safe shelf-type ready-to-use therapeutic agent, which improves the anti-tumor effect and is used for brain glia Tumor and other tumor treatment.
  • the present application provides a lentiviral expression vector.
  • pCDH-CMV-MCS-EF1-copGFP as the backbone, the ampicillin resistance gene ⁇ -lactamase of the vector was replaced with aminoglycoside phosphotransferase derived from Tn5, so that the vector had kanamycin resistance;
  • the potentially threatening CMV promoter and its adjacent downstream multiple cloning sites in in vivo applications; delete the copGFP gene expressed by the EF1 promoter in the original vector, retain the SalI restriction site, and add it at the 5' end of SalI
  • the SmaI restriction site is used for vector construction to form the final destination vector.
  • This application optimizes the protein-RNA complex electrotransfection technology. A double gene knockout efficiency of more than 90% in primary T cells was obtained.
  • the source of donors for this application is based on the high frequency of HLA-B homozygotes in the population.
  • One allele of the patient’s HLA-B is consistent with the donor’s homozygosity.
  • Cells from these donors can cover a high number of patients population, and can reduce the rejection caused by HLA-B.
  • This application screened out the HLA-A molecules that are highly related to rejection and knocked them out, while retaining other HLA-I molecules, which not only reduced the rejection of allogeneic cells, but also avoided the complete knockout of HLA molecules being NK
  • the occurrence of cell clearance greatly prolongs the half-life of allogeneic CAR-T cells in vivo.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Cell Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Hematology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
PCT/CN2022/103037 2021-07-01 2022-06-30 靶向IL13Rα2的通用型CAR-T细胞及其制备方法和应用 Ceased WO2023274380A1 (zh)

Priority Applications (4)

Application Number Priority Date Filing Date Title
CN202280004526.XA CN115768445A (zh) 2021-07-01 2022-06-30 靶向IL13Rα2的通用型CAR-T细胞及其制备方法和应用
JP2023580404A JP2024527539A (ja) 2021-07-01 2022-06-30 ＩＬ１３Ｒα２を標的としたユニバーサルＣＡＲ－Ｔ細胞及びその製造方法と使用
US18/575,628 US20240376216A1 (en) 2021-07-01 2022-06-30 Universal car-t cell targeting il13ralpha2, preparation method therefor and application thereof
EP22832192.3A EP4364746A4 (en) 2021-07-01 2022-06-30 UNIVERSAL CAR-T LYMPHOCYTE TARGETING IL13Ra2, ITS PREPARATION METHOD AND ITS APPLICATION

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN202110749536 2021-07-01
CN202110749536.3 2021-07-01

Publications (1)

Publication Number Publication Date
WO2023274380A1 true WO2023274380A1 (zh) 2023-01-05

Family

ID=84690444

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2022/103037 Ceased WO2023274380A1 (zh) 2021-07-01 2022-06-30 靶向IL13Rα2的通用型CAR-T细胞及其制备方法和应用

Country Status (5)

Country Link
US (1) US20240376216A1 (https=)
EP (1) EP4364746A4 (https=)
JP (1) JP2024527539A (https=)
CN (1) CN115768445A (https=)
WO (1) WO2023274380A1 (https=)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2025025597A1 (zh) * 2023-08-03 2025-02-06 森妙生物科技(西安)有限公司 一种抗体或其抗原结合片段及其应用

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014072888A1 (en) 2012-11-07 2014-05-15 Pfizer Inc. Anti-il-13 receptor alpha 2 antibodies and antibody-drug conjugates
US20140349402A1 (en) * 2011-11-18 2014-11-27 Board Of Regents, The University Of Texas System Car+ t cells genetically modified to eliminate expression of t-cell receptor and/or hla
CN107723275A (zh) * 2017-10-20 2018-02-23 重庆精准生物技术有限公司 通用型car‑t细胞及其制备方法和应用
CN109456943A (zh) * 2017-09-06 2019-03-12 亘喜生物科技（上海）有限公司 通用型嵌合抗原受体t细胞制备技术
CN111094345A (zh) * 2017-06-30 2020-05-01 美国卫生和人力服务部 具有人结构域的抗b细胞成熟抗原嵌合抗原受体
CN112236151A (zh) * 2018-03-14 2021-01-15 西雅图儿童医院（Dba西雅图儿童研究所） 用于肿瘤特异性T细胞免疫疗法的IL-13受体α2(IL13RA2)嵌合抗原受体
WO2021041725A1 (en) 2019-08-27 2021-03-04 The Trustees Of The Univeristy Of Pennsylvania SYNTHETIC CARS TO TREAT IL13Rα2 POSITIVE HUMAN AND CANINE TUMORS

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12083148B2 (en) * 2017-02-22 2024-09-10 H. Lee Moffitt Cancer Center And Research Institute, Inc. IL13Ra2-binding chimeric antigen receptors

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140349402A1 (en) * 2011-11-18 2014-11-27 Board Of Regents, The University Of Texas System Car+ t cells genetically modified to eliminate expression of t-cell receptor and/or hla
WO2014072888A1 (en) 2012-11-07 2014-05-15 Pfizer Inc. Anti-il-13 receptor alpha 2 antibodies and antibody-drug conjugates
CN104936621A (zh) * 2012-11-07 2015-09-23 辉瑞公司 抗IL-13受体α2抗体和抗体-药物缀合物
CN111094345A (zh) * 2017-06-30 2020-05-01 美国卫生和人力服务部 具有人结构域的抗b细胞成熟抗原嵌合抗原受体
CN109456943A (zh) * 2017-09-06 2019-03-12 亘喜生物科技（上海）有限公司 通用型嵌合抗原受体t细胞制备技术
CN107723275A (zh) * 2017-10-20 2018-02-23 重庆精准生物技术有限公司 通用型car‑t细胞及其制备方法和应用
CN112236151A (zh) * 2018-03-14 2021-01-15 西雅图儿童医院（Dba西雅图儿童研究所） 用于肿瘤特异性T细胞免疫疗法的IL-13受体α2(IL13RA2)嵌合抗原受体
WO2021041725A1 (en) 2019-08-27 2021-03-04 The Trustees Of The Univeristy Of Pennsylvania SYNTHETIC CARS TO TREAT IL13Rα2 POSITIVE HUMAN AND CANINE TUMORS

Non-Patent Citations (16)

* Cited by examiner, † Cited by third party
Title
BREAST CANCER RESEARCH, vol. 17, no. 1, 2015
CHOTHIA ET AL., NATURE, vol. 342, 1989, pages 877 - 883
CHOTHIALESK, J. MOL. BIOL., vol. 196, 1987, pages 901 - 917
FANG YALING;DONG YUQIAN;WANG YANAN;WU WEIYI: "Research progress in allogeneic CAR-T cells", TUMOR, vol. 41, 31 May 2021 (2021-05-31), pages 363 - 370, XP093020036, ISSN: 1000-7431, DOI: 10.3781/j.issn.1000-7431.2021.55.827 *
HUSTON ET AL.: "Protein Engineering of Antibody Binding Sites: Recovery of Specific Activity in an Anti-Digoxin Single-Chain Fv Analogue Produced in Escherichia coli", PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 5879 - 5883, XP000872837, DOI: 10.1073/pnas.85.16.5879
KANG XIAOZHEN ET AL., CHINESE JOURNAL OF BIOTECHNOLOGY, vol. 34, no. 12, 2018, pages 1974 - 1984
MACCALLUM, J MOL BIOL, vol. 262, no. 5, 1996, pages 732 - 45
MILLER ET AL., JOUR, OF IMMUNOLOGY, vol. 170, 2003, pages 4854 - 4861
MUYLDERMANS S., JBIOTECHNOL., vol. 74, 2001, pages 277 - 302
NGUYEN V. K. ET AL., THE EMBO JOURNAL, vol. 19, 2000, pages 921 - 930
PADLAN, FASEB J, vol. 9, 1995, pages 133 - 139
PLOS ONE, vol. 8, no. 10, 16 October 2013 (2013-10-16), pages e77719
See also references of EP4364746A4
VANLANDSCHOOT P. ET AL., ANTIVIRAL RESEARCH, vol. 92, 2011, pages 389 - 407
WARD ET AL.: "Binding Activities of a Repertoire of Single Immunoglobulin Variable Domains Secreted From Escherichia coli", NATURE, vol. 341, 1989, pages 544 - 546
XIAOJUAN LIU, YONGPING ZHANG, CHEN CHENG, ALBERT W CHENG, XINGYING ZHANG, NA LI, CHANGQING XIA, XIAOFEI WEI, XIANG LIU, HAOYI WANG: "CRISPR-Cas9-mediated multiplex gene editing in CAR-T cells", CELL RESEARCH, vol. 27, no. 1, 1 January 2017 (2017-01-01), Singapore , pages 154 - 157, XP055555205, ISSN: 1001-0602, DOI: 10.1038/cr.2016.142 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2025025597A1 (zh) * 2023-08-03 2025-02-06 森妙生物科技(西安)有限公司 一种抗体或其抗原结合片段及其应用

Also Published As

Publication number Publication date
US20240376216A1 (en) 2024-11-14
EP4364746A1 (en) 2024-05-08
CN115768445A (zh) 2023-03-07
JP2024527539A (ja) 2024-07-25
EP4364746A4 (en) 2025-07-23

Similar Documents

Publication Publication Date Title
US20250230217A1 (en) Methods for improving the efficacy and expansion of immune cells
CN115916833B (zh) 靶向b7h3的抗原结合多肽及其应用
US20210347851A1 (en) Cd19 chimeric antigen receptor (car) and cd22 car combination therapies
CN115397460A (zh) 制备表达嵌合抗原受体的细胞的方法
CN113646335A (zh) 使用对b细胞成熟抗原具有特异性的嵌合抗原受体的治疗的方法
WO2021136263A1 (zh) 一种经修饰的免疫效应细胞及其制备方法
EP2958942A1 (en) Effective targeting of primary human leukemia using anti-cd123 chimeric antigen receptor engineered t cells
KR20230051677A (ko) 메소텔린 양성 암을 치료하기 위한 조성물 및 방법
WO2023274385A1 (zh) 靶向her2的通用型car-t细胞及其制备方法
EP4620978A1 (en) Universal car-t cell targeting b7h3, and preparation method therefor and use thereof
CN120051298A (zh) Gprc5d和bcma特异性嵌合抗原受体
TW202323521A (zh) 製備表現嵌合抗原受體的細胞之方法
EP4364746A1 (en) UNIVERSAL CAR-T CELL TARGETING IL13Ra2, PREPARATION METHOD THEREFOR AND APPLICATION THEREOF
TW202309294A (zh) 病毒載體生產系統
US20240139321A1 (en) Universal car-t cell targeting gd2, preparation method therefor, and application thereof
WO2023274386A1 (zh) 靶向egfr的通用型car-t细胞及其制备方法
HK40111889A (en) UNIVERSAL CAR-T CELL TARGETING IL13Rα2, PREPARATION METHOD THEREFOR AND APPLICATION THEREOF
HK40085140A (en) UNIVERSAL CAR-T CELL TARGETING IL13Rα2, PREPARATION METHOD THEREFOR AND APPLICATION THEREOF
HK40087387A (zh) 靶向b7h3的抗原结合多肽及其应用
HK40087387B (zh) 靶向b7h3的抗原结合多肽及其应用
HK40109832A (zh) 靶向b7h3的通用型car-t细胞及其制备方法和应用
TWI915404B (zh) 用於治療ｅｇｆｒ陽性癌症之組合物及方法
EA050876B1 (ru) Антигенсвязывающий полипептид, нацеленный на b7h3, и его применение
EP4620974A1 (en) Anti-afp/hla02 tcr-like antibody and use thereof
RU2841244C2 (ru) Химерные антигенные рецепторы и пути их применения

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22832192

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2023580404

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 18575628

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 2022832192

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2022832192

Country of ref document: EP

Effective date: 20240201