WO2023243689A1 - 新規な炎症性疾患治療剤およびそのスクリーニング方法 - Google Patents
新規な炎症性疾患治療剤およびそのスクリーニング方法 Download PDFInfo
- Publication number
- WO2023243689A1 WO2023243689A1 PCT/JP2023/022262 JP2023022262W WO2023243689A1 WO 2023243689 A1 WO2023243689 A1 WO 2023243689A1 JP 2023022262 W JP2023022262 W JP 2023022262W WO 2023243689 A1 WO2023243689 A1 WO 2023243689A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- human
- compound
- stat1
- threonine
- human stat1
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6803—General methods of protein analysis not limited to specific proteins or families of proteins
- G01N33/6842—Proteomic analysis of subsets of protein mixtures with reduced complexity, e.g. membrane proteins, phosphoproteins, organelle proteins
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/33—Crossreactivity, e.g. for species or epitope, or lack of said crossreactivity
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2440/00—Post-translational modifications [PTMs] in chemical analysis of biological material
- G01N2440/14—Post-translational modifications [PTMs] in chemical analysis of biological material phosphorylation
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
- G01N2500/02—Screening involving studying the effect of compounds C on the interaction between interacting molecules A and B (e.g. A = enzyme and B = substrate for A, or A = receptor and B = ligand for the receptor)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
- G01N2500/04—Screening involving studying the effect of compounds C directly on molecule A (e.g. C are potential ligands for a receptor A, or potential substrates for an enzyme A)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/06—Gastro-intestinal diseases
- G01N2800/067—Pancreatitis or colitis
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/10—Musculoskeletal or connective tissue disorders
- G01N2800/101—Diffuse connective tissue disease, e.g. Sjögren, Wegener's granulomatosis
- G01N2800/104—Lupus erythematosus [SLE]
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/24—Immunology or allergic disorders
Definitions
- the present invention relates to a novel therapeutic agent for inflammatory diseases and a screening method thereof.
- Standard JAK-STAT signaling involves the STAT protein remaining dormant in the cytoplasm until a critical tyrosine residue within the transactivation domain (TAD) at the C-terminus of the STAT protein is phosphorylated; It is thought to be mediated by associated JAK complexes.
- TAD transactivation domain
- Stat1 In mammals, the STAT family consists of seven evolutionarily conserved proteins: Stat1, 2, 3, 4, 5a, 5b, and 6.
- Stat1 is ubiquitously expressed and consists of the full-length ⁇ isoform and its splice variant ⁇ isoform.
- the ⁇ isoform lacks the last 38 amino acids of the TAD, and these amino acids are thought to contribute to the specificity of Stat1's transcriptional activity.
- JAK-mediated tyrosine 701 phosphorylation of Stat1 is essential for IFN signaling and transcription of IFN-stimulated genes (ISGs).
- ISGs IFN-stimulated genes
- An object of the present invention is to provide a novel therapeutic agent for inflammatory diseases and a screening method for the same.
- the present invention provides a novel therapeutic agent for sepsis and a screening method thereof, a novel therapeutic agent for colitis and a screening method thereof, and a novel therapeutic agent for systemic lupus erythematosus and a screening method thereof. That is the issue.
- a further object of the present invention is to provide an antibody that binds to human STAT1 in which the threonine at position 749 is phosphorylated, and an antibody that binds to mouse STAT1 in which the threonine at position 748 is phosphorylated.
- a therapeutic agent for sepsis and/or septic shock which contains as an active ingredient a compound that suppresses the phosphorylation of threonine at position 749 of human STAT1.
- the therapeutic agent according to [A6], wherein the compound is a compound that inhibits the function of human STAT1.
- [A9] A method for screening candidate compounds for active ingredients of sepsis and/or septic shock therapeutic agents, the method comprising the step of selecting a compound that suppresses the phosphorylation of threonine at position 749 of human STAT1.
- the compound is a compound that inhibits a protein kinase that phosphorylates threonine at position 749 of human STAT1.
- [A11] (a) Measuring phosphorylation of human STAT1 by a protein kinase that phosphorylates threonine at position 749 of human STAT1 in the presence and absence of a test compound, and (b) in the absence of a test compound
- the method according to [A10] comprising the step of selecting the test compound as a candidate compound when the phosphorylation of the human STAT1 is suppressed in the presence of the test compound as compared to the above.
- [A12] The method according to [A9], wherein the compound is a compound that inhibits the binding between human STAT1 and a protein kinase that phosphorylates threonine at position 749 of human STAT1.
- [A13] (a) Measuring the binding between human STAT1 and a protein kinase that phosphorylates threonine at position 749 of human STAT1 in the presence and absence of the test compound; [A12], comprising the step of selecting the compound as a candidate compound when the binding between the protein kinase and human STAT1 is suppressed in the presence of the test compound as compared to the absence thereof; Method described. [A14] The method according to any one of [A10] to [A13], wherein the protein kinase is human TBK1 and/or human IKK ⁇ .
- [A15] The method according to [A9], wherein the compound is a compound that specifically binds to threonine at position 749 of human STAT1.
- [A16] (a) A step of contacting a test compound with each of wild-type human STAT1 and mutant human STAT1 in which threonine at position 749 is replaced with alanine, and measuring the amount of the bound test compound, and (b) when the amount of the test compound that binds to mutant human STAT1 is small compared to the amount of the test compound that binds to wild-type human STAT1, selecting the compound as a candidate compound; The method described in [A15].
- [A17] A method for screening candidate compounds for active ingredients of sepsis and/or septic shock therapeutic agents, the method comprising the step of selecting a compound that inhibits human STAT1.
- [A19] (a) Measuring the function of human STAT1 in the presence and absence of a test compound; and (b) a step of measuring the function of human STAT1 in the presence of the test compound as compared to the absence of the test compound.
- the method according to [A18] comprising the step of selecting the compound as a candidate compound when the function is inhibited.
- [A20] The method according to [A17], wherein the compound is a compound that inhibits the expression of human STAT1.
- [A21] (a) Measuring the expression of human STAT1 in the presence and absence of a test compound, and (b) the step of measuring the expression of human STAT1 in the presence of the test compound as compared to the absence of the test compound.
- the method according to [A20] comprising the step of selecting the compound as a candidate compound when expression is inhibited.
- [A22] The method according to [A9] or [A18], wherein the test compound is a cyclic polypeptide.
- a method for treating sepsis and/or septic shock comprising administering a compound that inhibits phosphorylation of threonine at position 749 of human STAT1.
- a method for treating sepsis and/or septic shock comprising the step of administering a compound that inhibits human STAT1.
- [A27] Compounds that inhibit human STAT1 for use in the treatment of sepsis and/or septic shock.
- [A28] Use of a compound that inhibits STAT1 in the manufacture of a medicament for the treatment of sepsis and/or septic shock.
- [B1] A colitis therapeutic agent containing as an active ingredient a compound that promotes phosphorylation of threonine at position 749 of human STAT1.
- the compound is a compound that promotes binding between human STAT1 and a protein kinase that phosphorylates threonine at position 749 of human STAT1.
- [B4] The therapeutic agent according to [B2] or [B3], wherein the protein kinase is human TBK1 and/or human IKK ⁇ .
- the colitis is inflammatory bowel disease, ulcerative colitis, Crohn's disease, collagenous colitis, lymphocytic colitis, ischemic colitis, emptying colitis, Behcet's disease, infectious colitis, and
- [B6] A method for screening candidate compounds for active ingredients of colitis therapeutic agents, the method comprising the step of selecting a compound that promotes phosphorylation of threonine at position 749 of human STAT1.
- the compound is a compound that activates a protein kinase that phosphorylates threonine at position 749 of human STAT1.
- the method according to [B7] which comprises the step of selecting the compound as a candidate compound when the phosphorylation of the human STAT1 is promoted in the presence of the test compound as compared to the above.
- the compound is a compound that promotes binding between human STAT1 and a protein kinase that phosphorylates threonine at position 749 of human STAT1.
- [B10] (a) Measuring the binding between human STAT1 and a protein kinase that phosphorylates threonine at position 749 of human STAT1 in the presence and absence of the test compound, and (b) [B9] comprising the step of selecting the compound as a candidate compound when the binding between the protein kinase and human STAT1 is promoted in the presence of the test compound as compared to the absence thereof; [B9] The method described in. [B11] The method according to any one of [B7] to [B10], wherein the protein kinase is human TBK1 and/or human IKK ⁇ .
- the colitis is inflammatory bowel disease, ulcerative colitis, Crohn's disease, collagenous colitis, lymphocytic colitis, ischemic colitis, empty space colitis, Behcet's disease, infectious colitis, and The method according to any one of [B6] to [B11], which is one or more diseases selected from the group consisting of indeterminate colitis.
- [B14] A method for treating colitis, comprising administering a compound that promotes phosphorylation of threonine at position 749 of human STAT1.
- [B15] A compound that promotes the phosphorylation of threonine at position 749 of human STAT1 for use in the treatment of colitis.
- [B16] Use of a compound that promotes phosphorylation of threonine at position 749 of human STAT1 in the manufacture of a medicament for the treatment of colitis.
- [C1] A therapeutic agent for systemic lupus erythematosus containing a compound that inhibits human STAT1 as an active ingredient.
- [C2] The therapeutic agent according to [C1], wherein the compound is a compound that inhibits the function of human STAT1.
- [C3] The therapeutic agent according to [C1], wherein the compound is a compound that inhibits the expression of human STAT1.
- [C4] A method for screening candidate compounds for the active ingredient of a therapeutic agent for systemic lupus erythematosus, the method comprising the step of selecting a compound that inhibits human STAT1.
- [C5] The method according to [C4], wherein the compound is a compound that inhibits the function of human STAT1.
- [C6] (a) Measuring the function of human STAT1 in the presence and absence of a test compound, and (b) measuring the function of human STAT1 in the presence of the test compound compared to the absence of the test compound.
- the method according to [C5] comprising the step of selecting the compound as a candidate compound when the function is inhibited.
- [C7] The method according to [C4], wherein the compound is a compound that inhibits the expression of human STAT1.
- [C8] (a) measuring the expression of human STAT1 in the presence and absence of a test compound; and (b) measuring the expression of human STAT1 in the presence of the test compound as compared to the absence of the test compound.
- Method comprising the step of selecting the compound as a candidate compound when expression is inhibited.
- the method according to [C6] or [C8], wherein the measurement is performed using cells expressing human STAT1.
- [C10] The method according to [C4], wherein the test compound is a cyclic polypeptide.
- An antibody characterized by [D3] An antibody that binds to mouse STAT1 in which threonine at position 748 is phosphorylated, and the binding affinity for mouse STAT1 in which threonine at position 748 is phosphorylated is higher than that for wild-type mouse STAT1.
- An antibody characterized by [D4] The antibody according to any one of [D1] to [D3], which is a rabbit monoclonal antibody.
- [D5] A method for screening candidate compounds for active ingredients of sepsis and/or septic shock therapeutic agents, the method comprising: (a) phosphorylation of threonine at position 749 of human STAT1 in the presence and absence of a test compound; using the antibody described in [D1] or [D2], and (b) phosphorylation of the human STAT1 is suppressed in the presence of the test compound compared to the absence of the test compound. If the compound is a candidate compound, the method includes the step of selecting the compound as a candidate compound.
- [D6] A method for screening candidate compounds for active ingredients of colitis therapeutic agents, the method comprising: (a) phosphorylating threonine at position 749 of human STAT1 in the presence and absence of a test compound; the step of measuring using the antibody described in [D2]; and (b) when the phosphorylation of the human STAT1 is promoted in the presence of the test compound compared to the absence of the test compound; Selecting a compound as a candidate compound.
- a step of providing a human cell into which has been knocked in (b) A step of contacting each of the cells described in (1) and (2) with a test compound and measuring the phosphorylation state of human STAT1 in each cell, and (c) when the phosphorylation state of human STAT1 in the cells described in (1) is equal to the phosphorylation state of human STAT1 in the cells described in (2), selecting the compound as a candidate compound; How to include.
- the present invention can provide a novel therapeutic agent for sepsis and a method for screening the same, a novel therapeutic agent for colitis and a method for screening the same, and a novel therapeutic agent for systemic lupus erythematosus and a method for screening the same. Furthermore, the present invention can provide an antibody that binds to human STAT1 in which the threonine at position 749 is phosphorylated, and an antibody that binds to mouse STAT1 in which the threonine at position 748 is phosphorylated.
- FIG. 2 is a diagram showing the results of evaluating the survival rate of litter mate Wt/Wt mice, Wt/Stat1T748A mice, and Stat1T748A/Stat1T748A mice by intraperitoneal administration of LPS (12.5 mg/kg).
- FIG. 2 is a diagram showing the results of evaluating the survival rate of LPS (12.5 mg/kg) administered intraperitoneally to Stat1KO/Stat1KO mice and Stat1T748A mice, which are littermates obtained by crossing Stat1KO/Stat1T748A.
- FIG. 1 is a diagram showing the results of evaluating the survival rate of litter mate Wt/Wt mice, Wt/Stat1T748A mice, and Stat1T748A/Stat1T748A mice by intraperitoneal administration of LPS (12.5 mg/kg).
- FIG. 2 is a diagram showing the results of evaluating the survival rate of LPS (12.5 mg/kg) administered intraperitoneally to Stat1KO
- FIG. 2 is a diagram showing the results of Western blotting detection of the expression of endogenous STAT-related proteins in the spleens of Wt/Wt mice and Stat1T748A/Stat1T748A mice (littermate) to which LPS was not administered.
- Figure 2 shows the results of evaluating acute colitis induced by administering dextran sodium sulfate (DSS) in drinking water to Wt/Wt mice and Stat1T748A/Stat1T748A mice (littermate) for 7 days, with (A) showing the results during the DSS administration period. (B) shows the body weight on day 7, (C) shows the length of the colon, and (D) shows the severity score of colitis in histopathological examination of the colon.
- DSS dextran sodium sulfate
- Figure 2 shows the results of evaluating acute colitis induced by administering dextran sodium sulfate (DSS) in drinking water to Stat1KO/Stat1KO mice and Stat1T748A mice (Littermate) for 7 days;
- A shows the body weight during the DSS administration period.
- B shows the body weight on day 7,
- C shows the length of the colon, and
- D shows the severity score of colitis in histopathological examination of the colon.
- 0.5 ml of pristane was intraperitoneally administered to Wt/Wt mice and Stat1T748A/Stat1T748A mice (littermate), the progress was observed for 6 months, and lupus pathology was evaluated.
- FIG. 1 shows the results of intraperitoneally administering 0.5 ml of pristane to Stat1KO/Stat1KO mice and Stat1T748A mice (littermate), observing the progress for 6 months, and evaluating the pathology of lupus.
- A shows the results for 6 months after pristane administration.
- B is the anti-dsDNA serum titer 6 months after pristane administration
- C is a microscopic image of a hematoxylin and eosin specimen of a kidney section.
- FIG. 2 is a diagram showing the results of measuring proteinuria in Wt/Wt mice, Stat1T748A/Stat1T748A mice, and Stat1KO/Stat1KO mice after 6 months of intraperitoneal administration of 0.5 ml of pristane or without administration of pristane. .
- FIG. 9 is a diagram showing the results of purifying clones selected from the reactivity analysis of FIG. 9 and analyzing the phosphorylation selectivity and cross-reactivity of serial dilutions of monoclonal antibodies produced by these clones using an ELISA method. Diagram showing the results of co-introducing both ⁇ chain and ⁇ chain expression vectors encoding the entire selected antibody molecule into HEK293T cells, and separating monoclonal antibodies in the culture supernatant by electrophoresis under non-reducing and reducing conditions. It is.
- FIG. 2 is a diagram showing the results of detecting human STAT1 in which threonine is phosphorylated.
- the present invention provides therapeutic agents for inflammatory diseases.
- the inflammatory diseases to be treated by the therapeutic agent of the present invention are inflammatory diseases in which phosphorylation of threonine at position 749 of human STAT1 (hereinafter referred to as "threonine 749") affects the expression and severity of the disease state. That's fine.
- threonine 749 inflammatory diseases in which phosphorylation of threonine at position 749 of human STAT1
- Examples of inflammatory diseases to be treated by the therapeutic agent of the present invention include sepsis, septic shock, colitis, and systemic lupus erythematosus.
- Sepsis is a disease characterized by Systemic Inflammatory Response Syndrome (SIRS) caused by pathogens. Sepsis manifests as symptoms such as fever, tachypnea, tachycardia, and increased white blood cells, and if it progresses, it can lead to impaired consciousness, circulatory failure such as a drop in blood pressure, and organ dysfunction such as abnormalities in kidney, lung, liver, and coagulation functions. . In severe cases, complications such as acute respiratory distress syndrome (ARDS) and disseminated intravascular coagulation (DIC) can occur, leading to cardiac arrest and death due to septic shock. As sepsis progresses, the prognosis worsens and the mortality rate increases, so it is necessary to perform early diagnosis and early treatment at the earliest possible stage.
- SIRS Systemic Inflammatory Response Syndrome
- Septic shock is a severe form of sepsis, with organ hypoperfusion and hypotension that is poorly responsive to initial fluid composition, and is mostly caused by gram-negative bacilli or gram-positive cocci due to nosocomial infections. Septic shock frequently occurs in immunocompromised patients and those with chronic and debilitating diseases, with an average mortality rate of approximately 40%.
- Colitis is not particularly limited as long as it is an inflammatory disease of the large intestine, but examples include inflammatory bowel disease, ulcerative colitis, Crohn's disease, collagenous colitis, lymphocytic colitis, ischemic colitis, and emptying colitis. , Behcet's disease, infectious colitis, and indeterminate colitis.
- SLE Systemic lupus erythematosus
- Examples of the therapeutic agent of the present invention include compounds that suppress phosphorylation of threonine 749 of human STAT1, compounds that promote phosphorylation of threonine 749 of human STAT1, and compounds that inhibit human STAT1.
- the amino acid sequence of human STAT1 includes, for example, the amino acid sequence of NCBI accession number NP_009330.1 (SEQ ID NO: 1).
- Examples of the nucleotide sequence encoding human STAT1 include the nucleotide sequence (SEQ ID NO: 2) with NCBI accession number NM_007315.4.
- the compound that suppresses phosphorylation of threonine 749 of human STAT1 may be a compound that inhibits protein kinase that phosphorylates threonine 749 of human STAT1.
- the compound that inhibits the protein kinase that phosphorylates threonine 749 of human STAT1 may be a compound that inhibits the expression of the protein kinase, or a compound that inhibits the function of the protein kinase.
- the compound that inhibits the binding between human STAT1 and a protein kinase that phosphorylates threonine 749 of human STAT1 may be a compound that inhibits the binding between human STAT1 by binding to the protein kinase.
- the compound may also be a compound that inhibits the binding of human STAT1 by competitively binding to the protein kinase.
- the protein kinase that phosphorylates threonine 749 of human STAT1 may be human TBK1 (TANK Binding Kinase 1), human IKK ⁇ (I kappa B kinase beta), or a combination of human TBK1 and human IKK ⁇ . It may be a complex. It is known that TBK1 and IKK ⁇ mediate the phosphorylation of threonine at position 749 of human STAT1 (eg, Non-Patent Document 1).
- Examples of the amino acid sequence of human TBK1 include the amino acid sequence (SEQ ID NO: 3) with NCBI accession number NP_037386.1, and examples of the nucleotide sequence encoding human TBK1 include the nucleotide sequence with NCBI accession number NM_013254.4. (SEQ ID NO: 4) is mentioned.
- Examples of the amino acid sequence of human IKK ⁇ include the amino acid sequence (SEQ ID NO: 5) with NCBI accession number NP_001547.1, and examples of the nucleotide sequence encoding human IKK ⁇ include the nucleotide sequence with NCBI accession number NM_001556.3. (SEQ ID NO: 6) is mentioned.
- Compounds that inhibit the expression or function of human TBK1 and compounds that inhibit the expression or function of human IKK ⁇ include, for example, proteins that target human TBK1 or human IKK ⁇ , such as anti-human TBK1 antibodies and anti-human IKK ⁇ antibodies.
- proteins that target human TBK1 or human IKK ⁇ include, but are not limited to, polypeptides, nucleic acid oligos targeting human TBK1 or human IKK ⁇ , and low molecular weight compounds targeting human TBK1 or human IKK ⁇ .
- Preferred examples include proteins, and more preferably antibodies (anti-human TBK1 antibody or anti-human IKK ⁇ antibody).
- Another preferred example is nucleic acid oligo, more preferably siRNA.
- another preferred example is a polypeptide, more preferably a cyclic polypeptide.
- RNA interference is a method reported to suppress gene expression using RNA (Genes and Development, 16, 948-958 (2002)). When stranded RNA is introduced into cells, the expression of both the introduced foreign gene and the target endogenous gene is suppressed.
- siRNA and antisense nucleic acids that have an RNA interference effect on the expression of the human TBK1 gene
- siRNA and antisense nucleic acids that have an RNA interference effect on the expression of the human IKK ⁇ gene.
- Sense nucleic acids can be used to inhibit expression of the human IKK ⁇ gene.
- Nucleic acid oligo means a nucleic acid oligomer that controls the function of a target gene or protein. Nucleic acid oligos may be comprised of natural and non-natural RNA or DNA. Examples of nucleic acid oligos include siRNA, shRNA, antisense nucleic acids, decoy nucleic acids, nucleic acid aptamers, ribozymes, and the like. Preferably, siRNA or shRNA is used. siRNA means a double-stranded RNA consisting of a short chain that is not toxic to cells, and can be, for example, 15 bp to 49 bp, preferably 15 bp to 35 bp, and more preferably 21 bp to 30 bp. Furthermore, shRNA is RNA in which single-stranded RNA forms double-stranded RNA through a hairpin structure.
- siRNA and shRNA do not need to be completely identical to the target gene, but have at least 70% or more, preferably 80% or more, more preferably 90% or more, and most preferably 95% or more sequence identity.
- the double-stranded RNA portion of siRNA and shRNA in which the RNAs are paired with each other is not limited to perfect pairing, but also includes mismatches (corresponding bases are not complementary), bulges (corresponding bases on one strand), etc. There may also be unmatched portions, such as due to the absence of
- Antisense nucleic acid is an antisense nucleic acid that is complementary to a transcription product of DNA encoding a target protein.
- the effect of antisense nucleic acids on suppressing the expression of target genes is due to multiple factors, such as those listed below. In other words, degradation by RNase activity due to RNA double-strand recognition, inhibition of transcription initiation by triple strand formation, transcription suppression by hybridization with a site where an open loop structure is locally created by RNA polymerase, and RNA in progress of synthesis.
- transcription inhibition by hybridization with intron-exon junctions include translational suppression by hybridization with factor binding sites, inhibition of peptide chain elongation by hybridization with mRNA translation regions and polysome binding sites, and gene expression suppression by hybridization with nucleic acid and protein interaction sites. Among these, they suppress the expression of target genes by inhibiting transcription, splicing, or translation processes.
- the antisense sequence used in the present invention may suppress the expression of a target gene by any of the above-mentioned effects.
- designing an antisense sequence complementary to the untranslated region near the 5' end of the target mRNA is considered to be effective in inhibiting gene translation.
- sequences complementary to the coding region or 3' untranslated region may also be used. In this way, sequences complementary to not only the translated region of a gene but also the untranslated region can be used.
- the antisense nucleic acids used in the present invention include not only the translated region of a gene but also the antisense sequence of the untranslated region.
- the antisense nucleic acid preferably has a complementarity of 90% or more, most preferably 95% or more, to the transcription product of the target gene. There are no particular limitations on the length of antisense RNA that can effectively inhibit target gene expression using an antisense sequence.
- Ribozyme refers to, for example, something that cleaves target mRNA and inhibits translation of target protein. Ribozymes can be designed from gene sequences encoding target proteins; for example, for hammerhead ribozymes, the method described in FEBS Letter, Vol. 228, pp. 228-230 (1988) can be used. Can be done. In addition, regardless of the type of ribozyme, such as not only hammerhead ribozymes but also hairpin ribozymes and delta ribozymes, ribozymes are included as long as they cleave the mRNA of a target protein and inhibit translation of the target protein.
- Decoy means “decoy” in English, and a decoy is a substance that has a structure that resembles something that a substance should originally bind or act on.
- “Decoy nucleic acid” refers to a short nucleic acid molecule that contains a double-stranded region that binds to a targeted transcription factor and inhibits its biological function. Usually, a double-stranded oligonucleotide having the same base sequence as the binding region of a transcription factor on genomic DNA is mainly used as a decoy nucleic acid.
- the decoy nucleic acid may contain a non-complementary single-stranded region in addition to mutually complementary double-stranded regions.
- nucleic acid aptamer is an isolated or purified nucleic acid that binds to a target with high specificity and affinity through interactions other than Watson-Crick base pairing.
- Aptamers have a three-dimensional structure suitable for forming specific bonds to a target.
- aptamer binding does not rely on primary base sequence, but rather on specific secondary or tertiary structure.
- Typical aptamers are 5-15 kDa in size (15-45 nucleotides), bind targets with nanomolar to subnanomolar affinity, and can discriminate between closely related targets (e.g., aptamers can (does not bind to other proteins from the same gene family or functional family).
- Some aptamers can specifically bind to a selected target, inhibiting or activating the target's function.
- Cyclic polypeptide means a polypeptide containing a cyclic structure formed by four or more amino acids and/or amino acid analogs.
- the cyclic polypeptide may have a linear part in addition to the cyclic part.
- the bonding mode of the cyclized portion is not particularly limited, and may be a bond other than an amide bond or an ester bond.
- the bonding mode of the cyclized portion includes, for example, an amide bond, a carbon-carbon bond, a disulfide bond, an ester bond, a thioester bond, a thioether bond, a lactam bond, a bond via an azoline skeleton, a bond via a triazole structure, and a fluorophore bond.
- a preferred example is a covalent bond such as a bond via a structure.
- the position of a functional group such as a carboxy group or an amino group used for cyclization may be on the main chain or on a side chain, and is not particularly limited as long as it is at a position where cyclization is possible.
- the term "bonding mode of the cyclized portion” refers to the bonding mode of the cyclized portion formed by the cyclization reaction.
- hydroxycarboxylic acid hydroxy acid
- the molecular weight of the cyclic polypeptide may be 500 to 4000, 500 to 3000, or 500 to 2000.
- the cyclic polypeptide may include at least one selected from the group consisting of natural amino acids, unnatural amino acids, and amino acid analogs. The ratio of these amino acids is not particularly limited.
- the total number of amino acids and amino acid analogs contained in the cyclic polypeptide of the present invention may be 4-20, 4-15, 6-15, 8-15, 9-13, 10-13, 5-15, May be 7-12, 9-11.
- the number of amino acids and/or amino acid analogs in the linear portion may be 1 to 8, 1 to 5, or 1 to 3.
- the method for producing a cyclic polypeptide is not particularly limited, and for example, it may be identified using a known method from a cyclic polypeptide library, and chemical methods such as liquid phase synthesis, solid phase synthesis using Fmoc, Boc, etc. It may also be produced by a synthetic method.
- the polypeptide may be modified to increase its ability to migrate into cells. Such modification is not particularly limited as known methods can be used, but an example is a method of binding a cell membrane permeable peptide.
- Known sequences can be used as cell membrane-penetrating peptides, such as the Tat peptide derived from the HIV Tat protein (Brooks, H. et al. Advanced Drug Delivery Reviews, Vol 57, Issue 4, 2005, p.559-577 ), or polyarginine consisting of 6 to 12 arginine residues (Nakase, I. et al. Advanced Drug Delivery Reviews, Vol 60, 2008, p.598-607).
- Compounds that promote phosphorylation of threonine at position 749 of human STAT1 include compounds that activate protein kinases that phosphorylate threonine 749 of human STAT1. It may be a compound that promotes the binding between human STAT1 and a protein kinase that phosphorylates threonine 749 of human STAT1.
- the compound that activates the protein kinase that phosphorylates threonine 749 of human STAT1 may be a compound that promotes the expression of the protein kinase, or a compound that enhances the function of the protein kinase.
- Examples of compounds that promote the expression of protein kinases that phosphorylate threonine 749 of human STAT1 include nucleic acid molecules encoding the protein kinases.
- Compounds that promote the function of protein kinase that phosphorylates threonine 749 of human STAT1 include, for example, bispecific antibodies that bind to both the protein kinase and its substrate human STAT1, and both human TBK1 and human IKK ⁇ . bispecific antibodies that bind to.
- Compounds that promote the binding between human STAT1 and a protein kinase that phosphorylates threonine 749 of human STAT1 include bispecific antibodies that bind to both the protein kinase and its substrate, human STAT1. .
- the compound that inhibits human STAT1 may be a compound that inhibits the function of human STAT1 or a compound that inhibits the expression of human STAT1.
- Compounds that inhibit the function or expression of human STAT1 include, for example, proteins such as anti-human STAT1 antibodies, polypeptides that target human STAT1, nucleic acid oligos that target human STAT1, and low molecular weight compounds that target human STAT1. Examples include, but are not particularly limited to. Preferred examples include proteins, and more preferably antibodies (anti-human STAT1 antibody). Another preferred example is nucleic acid oligo, more preferably siRNA. Furthermore, another preferred example is a polypeptide, more preferably a cyclic polypeptide. The details of each compound are as explained in (1) above, and the explanation here will be omitted.
- a compound that suppresses phosphorylation of threonine 749 of human STAT1 and a compound that inhibits human STAT1 can be used as an active ingredient of the therapeutic agent for sepsis and/or septic shock. Furthermore, a compound that promotes phosphorylation of threonine at position 749 of human STAT1 can be used as an active ingredient of a therapeutic agent for colitis. Furthermore, a compound that inhibits human STAT1 can be used as an active ingredient of a therapeutic agent for systemic lupus erythematosus.
- the therapeutic agent for inflammatory diseases of the present invention may contain pharmaceutically acceptable materials such as preservatives and stabilizers.
- Formulationally acceptable may be a material that itself has a therapeutic effect on inflammatory diseases, or may be a material that does not have a therapeutic effect on inflammatory diseases, and the inflammatory disease of the present invention means a pharmaceutically acceptable material that can be administered with a therapeutic agent. It may also be a material that has no therapeutic effect but has a synergistic or additive stabilizing effect when used in combination with an active ingredient.
- pharmaceutically acceptable materials include sterile water, physiological saline, stabilizers, excipients, buffers, preservatives, surfactants, chelating agents (EDTA, etc.), binders, and the like.
- surfactant examples include nonionic surfactants, such as sorbitan fatty acid esters such as sorbitan monocaprylate, sorbitan monolaurate, and sorbitan monopalmitate; glycerin monocaprylate, glycerin monomiltate, and glycerin monostear Typical examples include those having HLB 6 to 18, such as glycerin fatty acid esters such as esters.
- surfactants include anionic surfactants, such as alkyl sulfates having an alkyl group having 10 to 18 carbon atoms, such as sodium cetyl sulfate, sodium lauryl sulfate, and sodium oleyl sulfate; polyoxyethylene Polyoxyethylene alkyl ether sulfates, such as sodium lauryl sulfate, in which the average number of moles of ethylene oxide added is 2 to 4 and the number of carbon atoms in the alkyl group is 10 to 18; carbon atoms in the alkyl group, such as sodium lauryl sulfosuccinate Typical examples include alkyl sulfosuccinate salts having a number of 8 to 18; natural surfactants such as lecithin, glycerophospholipids; fingophospholipids such as sphingomyelin; sucrose fatty acid esters of fatty acids having 12 to 18 carbon atoms; It can be mentioned as follows.
- Preferred surfactants for use in the formulations of the invention are polyoxyethylene sorbitan fatty acid esters such as polysorbate 20, 40, 60, 80, with polysorbate 20 and 80 being particularly preferred. Also preferred are polyoxyethylene polyoxypropylene glycols typified by poloxamers (Pluronic F-68 (registered trademark), etc.).
- Buffers include phosphate buffer, citrate buffer, acetate buffer, malate buffer, tartrate buffer, succinate buffer, lactate buffer, potassium phosphate buffer, gluconate buffer, caprylate buffer. buffer, deoxycholate buffer, salicylate buffer, triethanolamine buffer, fumarate buffer, etc., other organic acid buffers, carbonate buffer, Tris buffer, histidine buffer, imidazole buffer, etc. can be mentioned.
- a solution formulation may also be prepared by dissolving it in an aqueous buffer solution known in the field of solution formulations.
- concentration of the buffer is generally 1-500mM, preferably 5-100mM, and more preferably 10-20mM.
- the therapeutic agent for inflammatory diseases of the present invention may also contain other low molecular weight polypeptides, proteins such as serum albumin, gelatin and immunoglobulin, amino acids, saccharides such as polysaccharides and monosaccharides, carbohydrates, and sugar alcohols. good.
- sugars and carbohydrates such as polysaccharides and monosaccharides include dextran, glucose, fructose, lactose, xylose, mannose, maltose, sucrose, trehalose, and raffinose.
- sugar alcohols include mannitol, sorbitol, inositol, and the like.
- examples include physiological saline, isotonic solutions containing glucose and other adjuvants, such as D-sorbitol, D-mannose, D-mannitol, and sodium chloride, with appropriate dissolution. It may be used in combination with adjuvants such as alcohols (ethanol, etc.), polyalcohols (propylene glycol, PEG, etc.), nonionic surfactants (polysorbate 80, HCO-50), etc. If desired, the composition may further contain a diluent, a solubilizing agent, a pH adjuster, a soothing agent, a sulfur-containing reducing agent, an antioxidant, and the like.
- microcapsules microcapsules of hydroxymethyl cellulose, gelatin, poly[methyl methacrylic acid], etc.
- colloidal drug delivery systems liposomes, albumin microspheres, microemulsions, nanoparticles, nanocapsules, etc.
- methods for making drugs into sustained-release drugs are also known and can be applied to the present invention (Langer et al., J. Biomed. Mater. Res. 1981, 15: 167-277; Langer, Chem. Tech 1982, 12: 98-105; US Patent No. 3,773,919; European Patent Application (EP) No. 58,481; Sidman et al., Biopolymers 1983, 22: 547-556; EP 133,988).
- the pharmaceutically acceptable carriers to be used are selected from the above as appropriate or in combination depending on the dosage form, but are not limited to these.
- the active ingredients of the inflammatory disease therapeutic agent of the present invention are used as a medicine for humans or other animals, these active ingredients can be formulated and administered by known pharmaceutical methods, in addition to being directly administered to patients. It is also possible to do this.
- the above-mentioned pharmaceutically acceptable materials may be added.
- the therapeutic agent for inflammatory diseases of the present invention can be administered in the form of a pharmaceutical, and can be administered orally or parenterally, systemically or locally.
- intravenous injections such as drips, intramuscular injections, intraperitoneal injections, subcutaneous injections, suppositories, enema, oral enteric-coated agents, etc.
- Effective dosages are selected in the range of 0.001 mg to 100 mg per kg body weight per dose.
- a dosage of 0.1 to 1000 mg, preferably 0.1 to 50 mg per patient can be chosen.
- 0.1 mg to 40 mg preferably 1 mg to 20 mg per 1 kg of body weight per month (4 weeks), divided into once to several times, such as 2 times/week, 1 time/week, 1 Administration methods include intravenous injections such as intravenous drips, subcutaneous injections, etc., on a dosing schedule such as once per 2 weeks or once per 4 weeks.
- the administration schedule can be changed from 2 times/week or 1 time/week to 1 time/2 weeks, 1 time/3 weeks, 1 time/4 weeks, etc. while monitoring the condition after administration and trends in blood test values. It is also possible to make adjustments such as extending the administration interval.
- the present invention provides a method for screening candidate compounds for active ingredients in therapeutic agents for sepsis and/or septic shock, a method for screening candidate compounds for active ingredients in therapeutic agents for colitis, and a method for screening candidate compounds for active ingredients in therapeutic agents for systemic lupus erythematosus.
- the "test compound” is not particularly limited, and includes, for example, a single substance such as a natural compound, an organic compound, an inorganic compound, a nucleic acid oligo, a protein, a polypeptide, a cyclic polypeptide, or a compound library.
- nucleic acid oligo libraries nucleic acid oligo libraries, polypeptide libraries, gene library expression products, cell extracts, cell culture supernatants, fermentation microbial products, marine biological extracts, plant extracts, prokaryotic cell extracts, eukaryotic single cell extracts Alternatively, animal cell extracts and the like can be mentioned.
- the above test compound can be appropriately labeled and used if necessary. Examples of the label include radiolabels, fluorescent labels, and the like. In addition to the above-mentioned test compounds, mixtures of a plurality of these test compounds are also included.
- the present invention relates to methods for screening candidate compounds for active ingredients in therapeutic agents for sepsis and/or septic shock (hereinafter referred to as "the therapeutic agent for sepsis of the present invention"). ⁇ Screening method'').
- the first aspect of the method for screening sepsis therapeutic agents of the present invention includes the step of selecting a compound that inhibits a protein kinase that phosphorylates threonine 749 of human STAT1 as a compound that suppresses phosphorylation of threonine 749 of human STAT1.
- human TBK1 and/or human IKK ⁇ can be suitably used as the protein kinase.
- Human STAT1, human TBK1, and human IKK ⁇ used in step (a) are prepared using known genetic recombination techniques and recombinant protein expression based on the above sequence information or sequence information registered in known databases (NCBI, etc.). It can be produced as a recombinant protein using techniques. Additionally, commercially available recombinant human STAT1, recombinant human TBK1 and recombinant human IKK ⁇ may be used. The same applies when used in other embodiments described below.
- the method for measuring the phosphorylation of threonine 749 of human STAT1 is not particularly limited, and any known method can be appropriately selected and used.
- the reaction is started by adding recombinant human STAT1 as a substrate, recombinant human TBK1 and/or recombinant human IKK ⁇ as protein kinases, and ATP to a buffer suitable for phosphoryl transfer reaction.
- radiolabeled ATP eg, 32P- ⁇ -ATP
- measurement can be performed using a liquid scintillation counter, autoradiography, phosphorimaging, etc.
- radiolabeled ATP is not used, measurement can be performed by a known immunochemical assay (e.g., ELISA, Western blotting, etc.) using an antibody that specifically binds to human STAT1 in which threonine 749 is phosphorylated. It's okay. Specifically, for example, the method described in Wen et al., Cell (1995) 82: 241-250, the method described in Ng et al., Proc Natl Acad Sci USA (2011) 108: 21170-21175, etc. Can be used. As the antibody that specifically binds to human STAT1 in which threonine 749 is phosphorylated, the antibody of the present invention (described later) can be preferably used. For example, the rabbit monoclonal antibody established by the present inventors described in Examples may be used.
- a known immunochemical assay e.g., ELISA, Western blotting, etc.
- step (b) if the phosphorylation of the human STAT1 is suppressed in the presence of the test compound compared to the absence of the test compound, the compound is selected as a candidate compound.
- the selected compounds include compounds that inhibit protein kinases that phosphorylate threonine 749 of human STAT1, and the compounds inhibit sepsis and/or septic shock by inhibiting the phosphorylation of human STAT1 at threonine 749. This is considered to indicate the effectiveness of treatment.
- the second embodiment of the method for screening sepsis therapeutic agents of the present invention is a compound that suppresses the phosphorylation of threonine 749 of human STAT1, which suppresses the binding between human STAT1 and a protein kinase that phosphorylates threonine 749 of human STAT1.
- This method includes the step of selecting an inhibiting compound.
- the specific steps are not particularly limited, and for example, the screening method may include the following steps (a) and (b).
- the method for measuring the binding between protein kinase and human STAT1 is not particularly limited, and any known method can be appropriately selected and used. Examples include ELISA, fluorescence polarization, immunostaining, mass spectrometry, immunoprecipitation, and surface plasmon resonance (SPR).
- SPR surface plasmon resonance
- recombinant human STAT1 or a recombinant protein kinase (human TBK1 or human IKK ⁇ ) is immobilized, and the other and a test compound are added thereto and reacted. Binding levels can be detected using appropriate primary and secondary antibodies.
- step (b) if the binding between the protein kinase and human STAT1 is suppressed in the presence of the test compound compared to the absence of the test compound, the compound is selected as a candidate compound.
- the selected compounds include compounds that inhibit the binding between human STAT1 and protein kinases that phosphorylate threonine 749 of human STAT1; It is believed to be effective in treating sepsis and/or septic shock.
- a third embodiment of the method for screening sepsis therapeutic agents of the present invention includes the step of selecting a compound that specifically binds to threonine at position 749 of human STAT1 as a compound that suppresses phosphorylation of threonine 749 of human STAT1. It's a method.
- the specific steps are not particularly limited, and for example, the screening method may include the following steps (a) and (b).
- the method for measuring the binding between wild-type human STAT1 or mutant human STAT1 and the test compound is not particularly limited, and any known method can be appropriately selected and used. For example, it can be measured by using a labeled test compound (radiolabel, fluorescent label, etc.).
- a labeled test compound radiolabel, fluorescent label, etc.
- a method of measuring the binding by contacting the protein and mutant human STAT1, a surface plasmon resonance (SPR) method, etc. can be used.
- step (b) if the amount of the test compound that binds to the mutant human STAT1 is small compared to the amount of the test compound that binds to the wild type human STAT1, the compound is selected as a candidate compound.
- Selected compounds include compounds that specifically bind to threonine at position 749 of human STAT1, and the compounds treat sepsis and/or septic shock by inhibiting phosphorylation of threonine 749 of human STAT1. This is considered to indicate the effect of
- the fourth aspect of the method for screening sepsis therapeutic agents of the present invention is to screen for compounds that suppress the phosphorylation of threonine 749 of human STAT1.
- This method uses genetically modified human cells in which the gene encoding the .
- the specific steps are not particularly limited, and for example, the screening method may include the following steps (a), (b), and (c).
- a step of providing a genetically modified human cell in which is knocked in (b) contacting each of the cells described in (1) and (2) with a test compound, and (c) When the phosphorylation state of human STAT1 in the cell described in (1) is equal to the phosphorylation state of human STAT1 in the cell described in (2), selecting the compound as a candidate compound.
- step (a) (1) human cells expressing wild-type human STAT1, and (2) a gene encoding a mutant human STAT1 in which threonine at position 749 is replaced with alanine are introduced into the human cells. Knock-in genetically modified human cells are provided.
- the human cells expressing wild-type human STAT1 used in step (a) are not particularly limited, but include, for example, human primary cells or human cell lines that naturally express human STAT1, or human cells that express the gene encoding human STAT1 externally. Examples include genetically modified human cell lines that have been modified to express human STAT1 by introducing it from a human cell line.
- Genetically modified human cells into which a gene encoding a mutant human STAT1 in which threonine at position 749 is replaced with alanine are knocked in are transformed into human cells expressing the above-mentioned wild-type human STAT1 using known genome editing technology. It can be created by introducing the T749A mutation into the STAT1 gene.
- each of the cells in (1) and (2) is contacted with a test compound.
- the method of contacting cells with a test compound is not particularly limited, and any known method can be selected and used as appropriate. For example, a method of adding a test compound to a medium in which cells are cultured can be mentioned.
- the method for measuring the phosphorylation state of human STAT1 in cells that have come into contact with the test compound is not particularly limited, and any known method can be appropriately selected and used.
- proteins are extracted from cells by a known method, and using an antibody that specifically binds to human STAT1 in which threonine 749 is phosphorylated, a known immunochemical assay (e.g., ELISA, Western blotting, etc.), It can be measured by a peptide mapping method or the like.
- step (c) the phosphorylation state of human STAT1 in human cells expressing wild-type human STAT1 in (1) is changed to the mutant human STAT1 in which threonine at position 749 is replaced with alanine in (2).
- a test compound is selected as a candidate compound when the phosphorylation state of human STAT1 is equal to the phosphorylation state of human STAT1 in a genetically modified human cell into which the gene encoding has been knocked in.
- the selected compounds are capable of inhibiting the phosphorylation of threonine at position 749 of human STAT1 and are therefore considered to be effective in treating sepsis and/or septic shock.
- a fifth embodiment of the method for screening a sepsis therapeutic agent of the present invention is a method including the step of selecting a compound that inhibits the function of human STAT1 as a compound that inhibits human STAT1.
- the specific steps are not particularly limited, and for example, the screening method may include the following steps (a) and (b). (a) Measuring the function of human STAT1 in the presence and absence of a test compound, and (b) A step of selecting the compound as a candidate compound when the function of human STAT1 is inhibited in the presence of the test compound compared to the absence of the test compound.
- step (a) the method for measuring the function of human STAT1 is not particularly limited, and any known method can be appropriately selected and used. For example, there is a method of measuring the function of STAT1 as a transcription factor using a reporter gene assay.
- step (b) if the function of human STAT1 is inhibited in the presence of the test compound compared to the absence of the test compound, the compound is selected as a candidate compound. It is believed that the selected compounds exhibit efficacy in treating sepsis and/or septic shock by inhibiting human STAT1.
- a sixth embodiment of the method of screening for a therapeutic agent for sepsis of the present invention is a method including the step of selecting a compound that inhibits the expression of human STAT1 as a compound that inhibits human STAT1.
- the specific steps are not particularly limited, and for example, the screening method may include the following steps (a) and (b). (a) measuring the expression of human STAT1 in the presence and absence of a test compound, and (b) If the expression of human STAT1 is inhibited in the presence of the test compound compared to the absence of the test compound, selecting the compound as a candidate compound.
- the method for measuring the expression of human STAT1 is not particularly limited, and any known method can be appropriately selected and used.
- a method may be used in which cells expressing human STAT1 are cultured in a medium containing or not containing a test compound, and the amount of mRNA or protein of human STAT1 is measured.
- RNA can be extracted from cells by a known method and quantified using a known method for measuring the amount of mRNA.
- Known methods for measuring mRNA amount include Northern blotting, RT-PCR, quantitative RT-PCR, RNase protection assay, and the like.
- protein can be extracted from cells by a known method and quantified using a known method for measuring protein amount.
- Known methods for measuring protein amount include, for example, Western blotting, EIA, ELISA, RIA, and methods using protein measurement reagents.
- a compound that activates a protein kinase that phosphorylates threonine 749 of human STAT1 is selected as a compound that promotes phosphorylation of threonine 749 of human STAT1. It is a method that includes steps. The specific steps are not particularly limited, and for example, the screening method may include the following steps (a) and (b).
- step (a) human TBK1 and/or human IKK ⁇ can be suitably used as the protein kinase. Furthermore, in step (a), home-produced or commercially available recombinant human STAT1, recombinant human TBK1, and recombinant human IKK ⁇ can be used.
- step (a) the method for measuring the phosphorylation of threonine 749 of human STAT1 is not particularly limited, and any known method can be appropriately selected and used. For example, it can be measured by a method similar to the first embodiment of the method for screening sepsis therapeutic agents of the present invention.
- step (b) if phosphorylation of human STAT1 is promoted in the presence of the test compound compared to the absence of the test compound, the compound is selected as a candidate compound.
- the selected compounds include compounds that activate protein kinases that phosphorylate threonine 749 of human STAT1, and the compounds have the effect of treating colitis by promoting the phosphorylation of threonine 749 of human STAT1. This is considered to be an indication.
- a second embodiment of the screening method for a therapeutic agent for colitis of the present invention is a compound that promotes the phosphorylation of threonine 749 of human STAT1, which is characterized by the binding between human STAT1 and a protein kinase that phosphorylates threonine 749 of human STAT1.
- the method includes the step of selecting a compound that promotes.
- the specific steps are not particularly limited, and for example, the screening method may include the following steps (a) and (b).
- step (a) the method for measuring the binding between protein kinase and human STAT1 is not particularly limited, and any known method can be appropriately selected and used. It can be measured by the same method as in the second embodiment of the method for screening sepsis therapeutic agents of the present invention.
- step (b) if the binding between the protein kinase and human STAT1 is promoted in the presence of the test compound compared to the absence of the test compound, the compound is selected as a candidate compound.
- the selected compounds include compounds that promote binding between human STAT1 and protein kinases that phosphorylate threonine 749 of human STAT1; It is considered to be effective in treating colitis.
- Method for screening candidate compounds for active ingredients in therapeutic agents for systemic lupus erythematosus The present invention relates to methods for screening candidate compounds for active ingredients in therapeutic agents for systemic lupus erythematosus (hereinafter referred to as "method for screening for therapeutic agents for systemic lupus erythematosus of the present invention"). )I will provide a.
- a first embodiment of the method of screening for a therapeutic agent for systemic lupus erythematosus of the present invention is a method that includes the step of selecting a compound that inhibits the function of human STAT1 as a compound that inhibits human STAT1.
- the specific steps are not particularly limited, and for example, the screening method may include the following steps (a) and (b). (a) Measuring the function of human STAT1 in the presence and absence of a test compound, and (b) A step of selecting the compound as a candidate compound when the function of human STAT1 is inhibited in the presence of the test compound compared to the absence of the test compound.
- step (a) the method for measuring the function of human STAT1 is not particularly limited, and any known method can be appropriately selected and used. For example, it can be measured by a method similar to the fifth embodiment of the method for screening sepsis therapeutic agents of the present invention.
- a second embodiment of the method of screening for a therapeutic agent for systemic lupus erythematosus of the present invention is a method comprising the step of selecting a compound that inhibits the expression of human STAT1 as a compound that inhibits human STAT1.
- the specific steps are not particularly limited, and for example, the screening method may include the following steps (a) and (b). (a) measuring the expression of human STAT1 in the presence and absence of a test compound, and (b) If the expression of human STAT1 is inhibited in the presence of the test compound compared to the absence of the test compound, selecting the compound as a candidate compound.
- step (a) the method for measuring the expression of human STAT1 is not particularly limited, and any known method can be appropriately selected and used. For example, it can be measured by a method similar to the sixth embodiment of the method for screening sepsis therapeutic agents of the present invention.
- step (b) if the expression of human STAT1 is inhibited in the presence of the test compound compared to the absence of the test compound, the compound is selected as a candidate compound. It is believed that the selected compounds exhibit efficacy in treating systemic lupus erythematosus by inhibiting the expression of human STAT1.
- antibody is used in its broadest sense and includes a variety of antibodies, including monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments, so long as they exhibit the desired antigen-binding activity. Contains structure. Antibodies may be murine, rabbit, human, humanized, chimeric, or derived from other species. Antibodies can be of any type (eg, IgG, IgE, IgM, IgD, and IgA), class (eg, IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2), or subclass of immunoglobulin molecules.
- the antibody of the present invention is preferably a rabbit monoclonal antibody.
- Rabbit antibodies are generally known to have high affinity and high specificity, and rabbits are also known to produce antibodies against many antigens that are poorly immunogenic in mice or other animals. Because there is.
- Rabbit monoclonal antibodies can be obtained by screening antibody-producing cells using, for example, the ISAAC (ImmunoSpot Array Assay on a Chip) method (Nat. Med., 15, 1088-1092, 2009, PLoS One, 7, 1-9, 2012). Then, the antibody gene can be cloned from the selected antibody-producing cells and introduced into host cells to produce a recombinant rabbit monoclonal antibody (see Example 4).
- ISAAC ImmunoSpot Array Assay on a Chip
- the antibody of the present invention is preferably a rabbit monoclonal antibody produced by antibody-producing cell clone #1 and clone #2 selected in Example 4.
- the rabbit monoclonal antibodies produced by antibody-producing cell clone #1 and clone #2 have high specificity for both human STAT1, which is phosphorylated at threonine at position 749, and mouse STAT1, which is phosphorylated at threonine at position 748, and have cross-reactivity. It is a reactive antibody and has been confirmed to have low binding affinity to non-phosphorylated human STAT1 and non-phosphorylated mouse STAT1.
- the present invention provides genetically modified human cells in which a gene encoding mutant human STAT1 in which threonine at position 749 is replaced with alanine is knocked in, and mutant mouse STAT1 in which threonine at position 748 is replaced with alanine.
- the genetically modified cells of the present invention can be produced using, for example, known genome editing techniques.
- genetically modified mouse cells in which a gene encoding a mutant mouse STAT1 in which threonine at position 748 is replaced with alanine are knocked in are referred to in "1.
- Mouse in [Experimental Materials and Experimental Methods] in the Examples below. It can be produced by introducing the template oligo DNA described in 1. and the crRNA/tracrRNA/Cas9 complex into mouse cells.
- the threonine at position 749 is Genetically modified human cells can be produced in which a gene encoding mutant human STAT1 in which alanine is substituted is knocked in.
- Mouse in “Experimental Materials and Experimental Methods” in the Examples below are of the mutant type in which threonine at position 748 is replaced with alanine according to the present invention.
- These are genetically modified mouse cells in which the gene encoding mouse STAT1 has been knocked in.
- the genetically modified cells of the present invention are useful as a tool for evaluating whether a test compound can specifically suppress only the phosphorylation at position 749 of human STAT1, and can be suitably used in the screening method of the present invention. (See the fourth embodiment of the method for screening sepsis therapeutic agents of the present invention above).
- Mouse Stat1T748A mutant mice with a C57BL/6 background were generated using the CRISPR/Cas9 method. Briefly, a template oligo DNA (5'-ccaaagtccgtgtactgaacctacctacattctgtctcttgcag ATGAGC GCT GTATGA t gaattc tctggcgacatttttttcccatctgtgattccttcctgctactgttccttt -3': Sequence number 9) designed. Several silent mutations were introduced to prevent frequent cleavages.
- the crRNA/tracrRNA/Cas9 complex and template oligo were introduced into C57BL/6 fertilized eggs by electroporation. After recombination, the sequence ACA encoding threonine (T) in wild-type Stat1 was replaced by GCT encoding alanine (A).
- Stat1KO Karl et al., J. Exp. Med., 206, 2027-2035, 2009
- Stat1T748A mutant mice was backcrossed with Stat1T748A mutant mice for three generations. Wt/Stat1T748A and Stat1KO/Stat1T748A were crossed to obtain an isogenic littermate. Breeding followed Mendelian inheritance patterns. Mice were housed and bred in a pathogen-free environment. Unless otherwise indicated in the text, age- and sex-matched littermates were used in experiments. All animal experiments were conducted in accordance with the guidelines of the Osaka University Animal Care Committee.
- Genomic DNA was extracted from the tail using Tail lysis buffer with proteinase K (Nacalai Tesque). DNA was washed with Protein Precipitation Solution (Promega) and precipitated with isopropanol. The DNA was then washed with 70% ethanol and eluted with Tris-EDTA (TE) buffer. The following PCR primers were used for genotyping of Wt/Stat1T748A. The size of the PCR product is 970 bp.
- Stat1KO/Stat1T748A genotyping two types of PCR reactions were performed using a common forward primer and different reverse primers corresponding to the Stat1 exon or a neomycin cassette replacing the Stat1 exon (Stat1KO). The primers used are shown below.
- the size of the PCR product of StatT748A is 360 bp
- the size of the PCR product of Stat1KO is 440 bp.
- the PCR product was purified using QIAquick PCR Purification Kit (QIAGEN). 5'-AGGAGGCCAGACAGTAATAACC-3' (SEQ ID NO: 15) was used as a DNA sequence primer.
- LPS Lipopolysaccharide
- H&E histopathological specimens and hematoxylin and eosin staining were commissioned to the Institute of Nutrition and Pathology Co., Ltd. (Kyoto, Japan). Images were taken using a BZ-X710 microscope (Keyence). The severity of colitis was evaluated in a blinded manner according to a previous report (Sato et al., Sci. Rep., 5, 2015).
- Pristane-induced lupus model 0.5 ml of pristane (Sigma) was intraperitoneally administered to 7- to 8-week-old female littermate mice, followed by observation for 6 months. Mice survival rate, anti-dsDNA serum titer, and proteinuria were analyzed. Anti-dsDNA antibody titer in serum was measured using LBIS Mouse anti-dsDNA ELISA Kit (Fujifilm Wako Pure Chemical Industries, Ltd.).
- Albuminuria was measured as ⁇ g of albumin per mg of midstream urine creatinine using the Mouse Urinary Albumin Quantitative ELISA Kit (Ethos Bioscience) and the Urinary Creatinine Quantitation Kit Creatinine Companion (Ethos Bioscience) according to the manufacturer's protocol.
- kidneys harvested from pristane-treated or non-pristane-treated mice were fixed in 4% PBS-buffered paraformaldehyde for 1 hour. Afterwards, the buffer was changed to 10%, 20% PBS buffered saccharide.
- H&E histopathological specimens and hematoxylin and eosin staining were commissioned to the Institute of Nutrition and Pathology Co., Ltd. (Kyoto, Japan). Images were taken using a BZ-X710 microscope (Keyence).
- Mouse Flag-Stat1T748A mutant construct was generated using KOD-Plus-Mutagenesis Kit (TOYOBO) according to the manufacturer's protocol. The primers used are shown below.
- Mouse Stat1 F 5'-ATGTCACAGTGGTTCGAGCTTC-3' (SEQ ID NO: 16)
- Mouse Stat1 R 5'-TTATACTGTGCTCATCACTGTC-3' (SEQ ID NO: 17)
- Mouse Ikk ⁇ F 5'-ATGAGCTGTCACCGTCCCTC-3' (SEQ ID NO: 18)
- Mouse Ikk ⁇ R 5'-TCAGTCACAGGCCTGCTCCAG-3' (SEQ ID NO: 19)
- the antibodies used for Western blotting and immunoprecipitation are shown below. These antibodies were purchased from Cell Signaling and Technology (CST).
- Example 1 Evaluation of threonine 748 phosphorylated Stat1 in LPS-induced septic shock] 1-1 Survival rate after LPS challenge (1) Evaluation of survival rate in wild type mice (Wt/Wt), heterozygous mice (Wt/Stat1T748A) and mutant mice (Stat1T748A/Stat1T748A) By mating Wt/Stat1T748A mice LPS (12.5 mg/kg) was administered intraperitoneally to the littermates Wt/Wt (hereinafter referred to as “Wt”), Wt/Stat1T748A (hereinafter referred to as “heterozygote”) and Stat1T748A/Stat1T748A (hereinafter referred to as “Stat1T748A”), and the survival rate was evaluated.
- Wt/Wt wild type mice
- heterozygous mice Wt/Stat1T748A
- mutant mice Stat1T748A/St
- Example 2 Evaluation of threonine 748 phosphorylated Stat1 in dextran sodium sulfate (DSS)-induced colitis]
- Wt and Stat1T748A littermates obtained by crossing Wt/Stat1T748A mice were given 1.5% (w/v) DSS solution in drinking water for 7 days. This caused acute colitis.
- Body weight was measured every day from before administration (Day 0). Seven days after the start of DSS administration (Day 7), the mice were euthanized, the large intestine was removed, and the length of the colon was measured. In addition, pathological specimens of the colon were prepared and the severity of colitis was evaluated.
- Example 3 Evaluation of threonine 748 phosphorylated Stat1 in pristane-induced lupus
- SLE human systemic lupus erythematosus
- FIG. 6 The results are shown in Figure 6.
- A is the survival rate 6 months after pristane administration
- B is the anti-dsDNA serum titer 6 months after pristane administration
- C is a microscopic image of a hematoxylin and eosin specimen of a kidney section.
- the survival rate of Stat1T748A was approximately 50%, equivalent to Wt.
- Anti-dsDNA serum titers, proteinuria, and histopathological images of glomerulonephritis were also comparable between the two.
- FIG. 7 (A) is the survival rate 6 months after pristane administration, (B) is the anti-dsDNA serum titer 6 months after pristane administration, and (C) is a microscopic image of a hematoxylin and eosin specimen of a kidney section.
- Stat1KO mice were resistant to pristane-induced mortality and had lower anti-dsDNA serum titers compared to Stat1T748A mice.
- histologic imaging of proteinuria and glomerulonephritis showed mild pathology.
- Example 4 Rabbit monoclonal antibody against mouse STAT1 phosphorylated on threonine at position 748 (hereinafter referred to as "pThr748 mStat1”) and rabbit monoclonal antibody against human STAT1 phosphorylated on threonine at position 749 (hereinafter referred to as "pThr749 hStat1”) Preparation of antibodies]
- pThr748 mStat1 peptide a peptide (RIVGPEFDSMMS(pT)V, SEQ ID NO: 20) in which threonine at position 748 of the C-terminal region of mouse Stat1 (positions 736 to 749 of SEQ ID NO: 7) was phosphorylated was used.
- KLH keyhole limpet hemocyanin
- C cysteine
- 500 ⁇ g of the obtained KLH conjugate of pThr748 mStat1 peptide was mixed with complete Freund's adjuvant (Millipore), and 12- to 13-week-old New Zealand white rabbits were subcutaneously inoculated for immunization. Two, four, and six weeks after primary immunization, 500 ⁇ g of KLH conjugate of pThr748 mStat1 peptide was mixed with incomplete Freund's adjuvant (Millipore) and boosted.
- pThr748 mStat1-specific antibody-producing cells and pThr749 hStat1-specific antibody-producing cells were screened using the ISAAC (ImmunoSpot Array Assay on a Chip) method.
- ISAAC ImmunoSpot Array Assay on a Chip
- the surface of the chip was coated with 10 ⁇ g/ml rabbit IgG-specific antibody (manufactured by MP Biomedicals).
- single antigen-specific antibody-secreting cells were harvested from individual wells using a micromanipulator (TransferMan NK2, Eppendorf) fitted with a capillary (Primetech) and combined with cell lysate and rabbit ⁇ and ⁇ . It was discharged into a microtube containing a specific primer for a certain region.
- Antibody cDNAs related to VH and VL fragments from the collected cells were amplified using the single cell 5'-RACE method (Japanese Patent Application Laid-Open No. 2014-073100, Ozawa et al., PLoS One, 7, e52383, 2012, etc.) ,reference).
- Ig ⁇ -RT 5'-GCGAGTAGAGGCCTGAGGAC-3', SEQ ID NO: 21
- Ig ⁇ -RT 5'-GATGCCAGTTGTTTGGGTGGT-3', SEQ ID NO: 22
- primers 1U of RNase inhibitor (New England Biolabs)
- 0.5mM of each dNTP 5mM DTT
- 0.2% Triton-X100 0.2% Triton-X100
- 1x 1st strand cDNA buffer Invitrogen
- 3'-tailing of cDNA was performed with 20U of terminal deoxynucleotide transferase (Roche) in 4mM MgCl2 , 0.5mM dGTP, 50mM PK buffer ( 25mM K2HPO4 and 25mM KH2PO4 , pH 7). .0) and 1U RNase inhibitor for 1 hour at 37°C.
- 20U of terminal deoxynucleotide transferase (Roche) in 4mM MgCl2 , 0.5mM dGTP, 50mM PK buffer ( 25mM K2HPO4 and 25mM KH2PO4 , pH 7). .0) and 1U RNase inhibitor for 1 hour at 37°C.
- the first PCR was performed using the dC adapter primer (5'-AGCAGTAGCAGCAGTTCGATAACTTCGAATTCTGCAGTCGACGGTACCGCGGGCCCGGGATCCCCCCCCCDN-3', SEQ ID NO: 23) and the constant regions of the ⁇ and ⁇ chains (Ig ⁇ -1st: 5'-CGAGTTCCAAGTCACGGTCA-3', SEQ ID NO: 24) and the Ig ⁇ -1st :5'-CTCCCAGGTGACGGTGACAT-3', SEQ ID NO: 25).
- Amplification of each product was performed using primeSTAR DNA polymerase (TaKaRa) according to the manufacturer's instructions: 30 cycles of denaturation at 94°C for 15 seconds, annealing at 55°C for 5 seconds, and 72 Extension for 1 min 30 s at °C.
- the resulting PCR products were then diluted 4 times with water and 2 ⁇ l of each was used for nested PCR.
- Nested PCR was performed using adapter primer (5'-AGCAGTAGCAGCAGTTCGATAA-3') (SEQ ID NO: 26) and ⁇ chain (Ig ⁇ -nest: 5'-GCCTTTGACCAAGCAGCCCAA-3', SEQ ID NO: 27) or ⁇ chain constant region (Ig ⁇ -nest: 5 '-CGGGAAAGTATTTATTCGCCACA-3') (SEQ ID NO: 28) with respective nested primers specific for CGGGAAAGTATTTATTCGCCACA-3') using primeSTAR DNA polymerase.
- the obtained PCR products were inserted into expression vectors containing cDNA for the entire constant region of rabbit ⁇ chain or ⁇ chain, respectively.
- both the ⁇ chain and ⁇ chain expression vectors encoding the entire antibody molecule were co-introduced into Expi293 cells, and the supernatant of the cultured cells was collected 3 days later.
- FIG. (A) shows the numerical values measured for color development in wells immobilized with mouse phosphorylated peptide (pThr748 mStat1 peptide) (upper row) and wells immobilized with non-phosphorylated peptide (lower row).
- the numerical values measured for color development in wells immobilized with human phosphorylated peptide (pThr749 hStat1 peptide) (upper row) and wells immobilized with non-phosphorylated peptide (lower row) are shown. Based on these results, eight clones (in bold) with high specificity and cross-reactivity for both mouse and human phosphorylated peptides were selected.
- FIG. (A) shows the numerical values obtained by measuring the color development in a dilution series (left) of a mouse phosphorylated peptide (pThr748 mStat1 peptide) and a dilution series (right) of a non-phosphorylated peptide
- (B) shows the numerical values obtained by measuring the color development in a dilution series (right) of a mouse phosphorylated peptide (pThr748 mStat1 peptide).
- Both ⁇ chain and ⁇ chain expression vectors encoding the entire selected antibody molecule were cotransfected into HEK293T cells using Lipofectamine LTX (Thermo Fisher).
- HEK293T ATCC
- DMEM Nacalai Tesque
- FCS 10% FCS
- the supernatant containing the monoclonal antibodies was collected, and the monoclonal antibodies were purified using a TCS antibody purification kit (Abcam) according to the manufacturer's protocol.
- the purified monoclonal antibody eluate was subjected to electrophoresis under non-reducing conditions and reducing conditions, and bands were confirmed by Coomassie blue staining. The results are shown in FIG.
- the expression vectors shown below were transiently introduced or co-introduced into HEK293T cells, and after 24 hours of culture, whole cell lysates were prepared and separated by SDS-PAGE, followed by Western blotting analysis.
- the prepared monoclonal antibodies were used to detect pThr748 mStat1 and pThr749 hStat1.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- Genetics & Genomics (AREA)
- Physics & Mathematics (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Computational Biology (AREA)
- Dermatology (AREA)
- Toxicology (AREA)
- Communicable Diseases (AREA)
- Epidemiology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biotechnology (AREA)
- Cell Biology (AREA)
- Oncology (AREA)
- Microbiology (AREA)
- Zoology (AREA)
- Food Science & Technology (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US18/874,275 US20250368724A1 (en) | 2022-06-16 | 2023-06-15 | Novel therapeutic agent for inflammatory diseases and screening method thereof |
| JP2024528945A JPWO2023243689A1 (https=) | 2022-06-16 | 2023-06-15 | |
| EP23823979.2A EP4541373A1 (en) | 2022-06-16 | 2023-06-15 | Novel inflammatory disease treatment agent and screening method for same |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2022097638 | 2022-06-16 | ||
| JP2022-097638 | 2022-06-16 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2023243689A1 true WO2023243689A1 (ja) | 2023-12-21 |
Family
ID=89191414
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/JP2023/022262 Ceased WO2023243689A1 (ja) | 2022-06-16 | 2023-06-15 | 新規な炎症性疾患治療剤およびそのスクリーニング方法 |
Country Status (4)
| Country | Link |
|---|---|
| US (1) | US20250368724A1 (https=) |
| EP (1) | EP4541373A1 (https=) |
| JP (1) | JPWO2023243689A1 (https=) |
| WO (1) | WO2023243689A1 (https=) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3773919A (en) | 1969-10-23 | 1973-11-20 | Du Pont | Polylactide-drug mixtures |
| EP0058481A1 (en) | 1981-02-16 | 1982-08-25 | Zeneca Limited | Continuous release pharmaceutical compositions |
| EP0133988A2 (de) | 1983-08-02 | 1985-03-13 | Hoechst Aktiengesellschaft | Regulatorische Peptide enthaltende pharmazeutische Präparate mit protrahierter Freisetzung und Verfahren zu deren Herstellung |
| WO2003002609A2 (en) | 2001-06-28 | 2003-01-09 | Domantis Limited | Dual-specific ligand and its use |
| WO2004058821A2 (en) | 2002-12-27 | 2004-07-15 | Domantis Limited | Dual specific single domain antibodies specific for a ligand and for the receptor of the ligand |
| JP2014073100A (ja) | 2012-10-04 | 2014-04-24 | Toyama Univ | 抗原特異的ウサギ抗体産生細胞の迅速な特定方法およびその利用 |
-
2023
- 2023-06-15 WO PCT/JP2023/022262 patent/WO2023243689A1/ja not_active Ceased
- 2023-06-15 EP EP23823979.2A patent/EP4541373A1/en active Pending
- 2023-06-15 US US18/874,275 patent/US20250368724A1/en active Pending
- 2023-06-15 JP JP2024528945A patent/JPWO2023243689A1/ja active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3773919A (en) | 1969-10-23 | 1973-11-20 | Du Pont | Polylactide-drug mixtures |
| EP0058481A1 (en) | 1981-02-16 | 1982-08-25 | Zeneca Limited | Continuous release pharmaceutical compositions |
| EP0133988A2 (de) | 1983-08-02 | 1985-03-13 | Hoechst Aktiengesellschaft | Regulatorische Peptide enthaltende pharmazeutische Präparate mit protrahierter Freisetzung und Verfahren zu deren Herstellung |
| WO2003002609A2 (en) | 2001-06-28 | 2003-01-09 | Domantis Limited | Dual-specific ligand and its use |
| WO2004058821A2 (en) | 2002-12-27 | 2004-07-15 | Domantis Limited | Dual specific single domain antibodies specific for a ligand and for the receptor of the ligand |
| JP2014073100A (ja) | 2012-10-04 | 2014-04-24 | Toyama Univ | 抗原特異的ウサギ抗体産生細胞の迅速な特定方法およびその利用 |
Non-Patent Citations (25)
| Title |
|---|
| "ImmunoSpot Array Assay on a Chip (ISAAC) method", NAT. MED., vol. 15, 2009, pages 1088 - 1092 |
| "NCBI", Database accession no. NM_001205314.1 |
| "Remington's Pharmaceutical Science", 1980 |
| BROOKS, H. ET AL., ADVANCED DRUG DELIVERY REVIEWS, vol. 57, 2005, pages 559 - 577 |
| COVIC, L. ET AL., NAT MED., vol. 8, 2002, pages 1161 |
| ENDRES, P. J. ET AL., MOLECULAR IMAGING, vol. 4, 2006, pages 485 |
| FEBS LETTERS, vol. 228, 1988, pages 228 - 230 |
| GENES AND DEVELOPMENT, vol. 16, 2002, pages 948 - 958 |
| GOUBAEVA, F. ET AL., J. BIOL. CHEM., vol. 278, pages 19634 |
| HOZAIFA METWALLY, TOSHIO TANAKA, SONGLING LI, GYANU PARAJULI, SUJIN KANG, HAMZA HANIEH, SHIGERU HASHIMOTO, JAYA P CHALISE, YOHANNE: "Noncanonical STAT1 phosphorylation expands its transcriptional activity into promoting LPS-induced IL-6 and IL-12p40 production", SCIENCE SIGNALING, AMERICAN ASSOCIATION FOR THE ADVANCEMENT OF SCIENCE, US, vol. 13, no. 624, 24 March 2020 (2020-03-24), US , pages eaay0574 - 16, XP009551582, ISSN: 1945-0877, DOI: 10.1126/scisignal.aay0574 * |
| JIN ET AL., NAT. MED., vol. 15, 2009, pages 1088 - 1092 |
| KIMURA ET AL., J. EXP. MED., vol. 206, 2009, pages 2027 - 2035 |
| LANGER ET AL., J. BIOMED. MATER. RES., vol. 15, 1981, pages 167 - 277 |
| LANGER, CHEM. TECH., vol. 12, 1982, pages 98 - 105 |
| LEE SEUNG JUN; GHARBI AMAL; YOU JUENG SOO; HAN HEE DONG; KANG TAE HEUNG; HONG SEONG HWI; PARK WON SUN; JUNG IN DUK; PARK YEONG-MIN: "Drug repositioning of TANK-binding kinase 1 inhibitor CYT387 as an alternative for the treatment of Gram-negative bacterial sepsis", INTERNATIONAL IMMUNOPHARMACOLOGY, ELSEVIER, AMSTERDAM, NL, vol. 73, 1 August 2019 (2019-08-01), NL , pages 482 - 490, XP085729471, ISSN: 1567-5769, DOI: 10.1016/j.intimp.2019.05.051 * |
| METWALLY, H ET AL., SCIENCE SIGNALING, vol. 13, no. 624, 24 March 2020 (2020-03-24) |
| NAKASE, I. ET AL., ADVANCED DRUG DELIVERY REVIEWS, vol. 60, 2008, pages 598 - 607 |
| NG ET AL., PROC NATL ACAD SCI USA, vol. 108, 2011, pages 21170 - 21175 |
| OZAWA ET AL., PLOS ONE, vol. 7, 2012, pages 1 - 9 |
| SATO ET AL., SCI. REP., vol. 5, 2015 |
| SIDMAN ET AL., BIOPOLYMERS, vol. 22, 1983, pages 547 - 556 |
| TAEKYUN KIM: "Pheophorbide a suppresses toll-like receptor signaling via IKKβ/NFκB/TBK1/IRF3 to improve survival in septic mice", ABSTRACTS OF PAPERS. 256TH NATIONAL MEETING (2018), 1 August 2018 (2018-08-01), XP093118485, Retrieved from the Internet <URL:https://www.morressier.com/o/event/5fc6413703137aa525805a17/article/5fc642112d78d1fec4658121> [retrieved on 20240111] * |
| TANAKA, JUNYA: "Discussion - from a study using JAK/STAT system - sedative hypnotic bromovalerylurea as the signaling pathway which can become the target of the septicemic treatment", SHOCK, vol. 29, no. 2, 1 January 2014 (2014-01-01), pages 40 - 46, XP009551717, ISSN: 0919-8156 * |
| VON BÜLOW VERENA, DUBBEN SVENJA, ENGELHARDT GABRIELA, HEBEL SILKE, PLÜMÄKERS BIRGIT, HEINE HOLGER, RINK LOTHAR, HAASE HAJO: "Zinc-Dependent Suppression of TNF-α Production Is Mediated by Protein Kinase A-Induced Inhibition of Raf-1, IκB Kinase β, and NF-κB", THE JOURNAL OF IMMUNOLOGY, WILLIAMS & WILKINS CO., US, vol. 179, no. 6, 15 September 2007 (2007-09-15), US , pages 4180 - 4186, XP093118488, ISSN: 0022-1767, DOI: 10.4049/jimmunol.179.6.4180 * |
| WEN ET AL., CELL, vol. 82, 1995, pages 241 - 250 |
Also Published As
| Publication number | Publication date |
|---|---|
| EP4541373A1 (en) | 2025-04-23 |
| US20250368724A1 (en) | 2025-12-04 |
| JPWO2023243689A1 (https=) | 2023-12-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR101317264B1 (ko) | 톨 유사 수용체 3 길항제, 방법 및 용도 | |
| US10696971B2 (en) | MrgprX2/MrgprB2 expressing cell based assay to detect pseudo-allergic drug reactions and to identify blockers to prevent the adverse reactions | |
| TWI834025B (zh) | 用於治療和/或預防冠狀病毒誘導的急性呼吸窘迫症候群的抑制masp-2的方法 | |
| US20050037955A1 (en) | Therapeutic protein and treatments | |
| US11279931B2 (en) | Therapeutic agent for a lung disease and/or method for screening for the same | |
| KR20190129859A (ko) | 항-d 인자 항체 및 그의 용도 | |
| US20240294910A1 (en) | Novel therapeutic agent for septicemia, and a method for screening for same | |
| JP2003523207A (ja) | Liv−1関連タンパク質、それをコードするポリヌクレオチド、及び癌の治療へのその利用 | |
| JP2008538553A (ja) | Il−21/il−21rアンタゴニストによって線維症を治療および予防する方法 | |
| CN114073770B (zh) | MCM8-cGAS-STING-I型干扰素信号通路作为疾病靶点的用途 | |
| US20150139999A1 (en) | Interferon antagonists, antibodies thereto, and associated methods of use | |
| KR20100023869A (ko) | 페리오스틴의 Exon-17 부위에 의해 코드되는 펩티드에 대한 항체를 함유하는 암 치료제 | |
| Avalle et al. | Liver-specific siRNA-mediated Stat3 or C3 knockdown improves the outcome of experimental autoimmune myocarditis | |
| WO2023143425A1 (zh) | 改善认知障碍的方法 | |
| US20060153840A1 (en) | Methods for preventing or treating a condition or a disease associated with angiogenesis | |
| WO2023243689A1 (ja) | 新規な炎症性疾患治療剤およびそのスクリーニング方法 | |
| DE60038740T2 (de) | Stimulierung oder hemmung von angiogenese und herzvaskularisierung | |
| JP2004507251A (ja) | 癌の治療効果を増強するための方法 | |
| JP6854515B2 (ja) | 解糖系代謝制御物質のスクリーニング方法及び解糖系代謝制御剤 | |
| US12534535B2 (en) | Monoclonal antibody or antibody fragment against canine CD20 | |
| AU2009270826B2 (en) | Compositions comprising MG29 nucleic acids, polypeptides and associated methods of use | |
| US20030232367A1 (en) | Differentially expressed genes involved in angiogenesis, the proteins encoded thereby, and methods of using the same | |
| ES2242597T3 (es) | Composiciones y procedimientos para el diagnostico y tratamiento de un tumor. | |
| EP4260872A1 (en) | Agent for preventing or treating frontotemporal lobar degeneration | |
| WO2006025421A1 (ja) | 精子膜タンパク質obfの利用 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 23823979 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2024528945 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 18874275 Country of ref document: US |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2023823979 Country of ref document: EP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2023823979 Country of ref document: EP Effective date: 20250116 |
|
| WWP | Wipo information: published in national office |
Ref document number: 2023823979 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 18874275 Country of ref document: US |