Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
  • C12N15/86—Viral vectors
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
  • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P27/00—Drugs for disorders of the senses
  • A61P27/02—Ophthalmic agents
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
  • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
  • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
  • C07K14/4702—Regulators; Modulating activity
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/67—General methods for enhancing the expression
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
  • C12N15/90—Stable introduction of foreign DNA into chromosome
  • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
  • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/14—Hydrolases (3)
  • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
  • C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
• • A—HUMAN NECESSITIES
  • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
  • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
  • A01K2267/00—Animals characterised by purpose
  • A01K2267/03—Animal model, e.g. for test or diseases
  • A01K2267/0306—Animal model for genetic diseases
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
  • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
  • A61K48/0066—Manipulation of the nucleic acid to modify its expression pattern, e.g. enhance its duration of expression, achieved by the presence of particular introns in the delivered nucleic acid
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2319/00—Fusion polypeptide
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/10—Type of nucleic acid
  • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2320/00—Applications; Uses
  • C12N2320/30—Special therapeutic applications
  • C12N2320/33—Alteration of splicing
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
  • C12N2750/00011—Details
  • C12N2750/14011—Parvoviridae
  • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
  • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
  • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
  • C12N2750/00011—Details
  • C12N2750/14011—Parvoviridae
  • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
  • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
  • C12N2750/14145—Special targeting system for viral vectors
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
  • C12N2750/00011—Details
  • C12N2750/14011—Parvoviridae
  • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
  • C12N2750/14171—Demonstrated in vivo effect
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2830/00—Vector systems having a special element relevant for transcription
  • C12N2830/008—Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2830/00—Vector systems having a special element relevant for transcription
  • C12N2830/42—Vector systems having a special element relevant for transcription being an intron or intervening sequence for splicing and/or stability of RNA
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2840/00—Vectors comprising a special translation-regulating system
  • C12N2840/44—Vectors comprising a special translation-regulating system being a specific part of the splice mechanism, e.g. donor, acceptor
  • C12N2840/445—Vectors comprising a special translation-regulating system being a specific part of the splice mechanism, e.g. donor, acceptor for trans-splicing, e.g. polypyrimidine tract, branch point splicing

Definitions

• compositions, methods, and uses involving trans-splicing molecules for correcting mutations in ABCA4 are described herein.
• ABCA4 Recessively inherited mutations in ABCA4 are causal in the development of progressive forms of blindness including Stargardt disease and cone-rod dystrophy.
• ABCA4 functions as a transporter (or “flippase”) of N-retinylidene-phosphatidy!ethanolamine (N-Ret-PE) from the lumen to the cytoplasmic leaflet of disc membranes.
• N-Ret-PE N-retinylidene-phosphatidy!ethanolamine
• 6882-bp coding sequence of ABCA4 is too large to be delivered in its entirety by a single AAV vector.
• a single baseediting approach would not address a significant number of patients. Therefore, there is a need in the field for alternative strategies for correcting mutations in the ABCA4 gene.
• ABCA4-related retinopathies such as Stargardt disease
• Stargardt disease are severe rare genetic retinal diseases affecting both adults and children, caused by biallelic pathogenic mutations in the ABCA4 gene.
• the estimated prevalence of Stargardt disease is 1 in 8-10,000 individuals worldwide and accounts for roughly 7% of retinal dystrophies.
• ABCA4 was characterized as the gene responsible for autosomal recessive Stargardt disease, however, several other retinal phenotypes are also associated with mutations in ABCA4. Indeed, ABCA4-related retinopathies are considered collectively to be the most frequent cause of retinal degeneration due to Mendelian inheritance.
• ABCA4-related retinopathies are typically diagnosed in the first two decades of life and depending on the severity of specific mutations may completely lose their central field of vision by adulthood. [0006]
• nucleic acid elements that confer upon nucleic acid trans-splicing molecules in which they are incorporated properties that address technical challenges associated with, for example, increasing trans-splicing efficiency and the level of trans-spliced protein produced thereby.
• Inclusion of the identified elements in nucleic acid trans-splicing molecules e.g., RNA trans-splicing molecules
• nucleic acid trans-splicing molecules that achieve the long-sought objective of providing options for therapeutic intervention in diseases associated with genetic mutations, whereby correction of those genetic mutations at the RNA level could provide enormous benefit to patients.
• Many patients with diseases associated with genetic mutations have few, if any, options for treatment and therefore, have largely unmet needs.
• a trans-splicing solution also referred to as exon editing, is described herein which comprises delivering a therapeutic nucleic acid trans-splicing construct that encodes an RNA exon editor that is designed to trans-splice into endogenous ABCA4 pre-mRNA that comprises at least one mutation, whereby trans-splicing replaces exons in the endogenous ABCA4 pre-mRNA (at least one exon of which comprises at least one mutation) with exons from the therapeutic RNA exon editor that encode functional (e.g., wildtype) amino acid sequences and thus, corrects the at least one mutation in the endogenous ABCA4 pre-mRNA.
• RNA exon editors may be delivered directly to cells.
• the terms “nucleic acid trans-splicing molecule”, “RNA exon editing molecule”, “RNA exon editor”, “Exon Editor”, and “RNA trans-splicing construct” are used interchangeably herein.
• a nucleic acid trans-splicing molecule comprising: (a) a sequence (CDS) comprising ABCA4 exons; (b) a linker domain comprising SEQ ID NO: 27 or a sequence having at least 90% identity to SEQ ID NO: 27; and (c) a binding domain that anneals to a binding site within endogenous ABCA4 pre-mRNA, wherein the CDS, the linker domain, and the binding domain are operatively linked in a 5’-to-3’ direction.
• CDS sequence comprising ABCA4 exons
• linker domain comprising SEQ ID NO: 27 or a sequence having at least 90% identity to SEQ ID NO: 27
• a binding domain that anneals to a binding site within endogenous ABCA4 pre-mRNA, wherein the CDS, the linker domain, and the binding domain are operatively linked in a 5’-to-3’ direction.
• a nucleic acid trans-splicing molecule comprising: (a) a CDS comprising, consisting essentially of, or consisting of a variant of any one of SEQ ID NOs: 53-55, wherein the variant of any one of SEQ ID NOs: 53-55 comprises at least one nucleotide variation in at least one cryptic splice site listed in Table 3, wherein the at least one nucleotide variation reduces cryptic splice site use at each of the at least one cryptic splice sites comprising at least one nucleotide variation; and (b) optionally, a linker domain; and (c) optionally, a binding domain that anneals to a binding site within endogenous ABCA4 pre-mRNA, wherein the CDS; the linker domain, when present; and the binding domain, when present; are operatively linked in a 5’- to-3’ direction.
• the variant of SEQ ID NO: 55 comprises any one of SEQ ID NOs: 56-59. In some embodiments, the variant of SEQ ID NO: 55 comprises SEQ ID NO: 56. Use of same for treating retinopathies associated with mutations in ABCA4 and in the preparation of medicaments for treating retinopathies associated with mutations in ABCA4, as well as methods for treating retinopathies associated with mutations in ABCA4 are also described herein.
• nucleic acid trans-splicing molecule (or a vector containing or encoding a nucleic acid trans-splicing molecule), wherein the nucleic acid trans-splicing molecule contains, operatively linked in a 5’-to-3’ direction: (a) a 5’ regulatory domain comprising, e.g., a native 5’ ABCA4 untranslated region; (b) a CDS comprising a functional sequence of 5’ ABCA4 exons; (c) a splicing domain configured to mediate trans-splicing; and (d) a binding domain configured to bind a binding site within endogenous ABCA4 pre-mRNA, wherein the nucleic acid trans-splicing molecule is configured to trans-splice the CDS to endogenous ABCA4, thereby replacing an endogenous 5’ ABCA4 exon sequence with the functional sequence of 5’ ABCA4 exons.
• a 5’ regulatory domain comprising, e.g., a native 5’ ABC
• the 5’ regulatory domain further includes a constitutive promoter, such as, e.g., a CMV/CMV promoter (CMV enhancer and promoter), or a variant thereof.
• a constitutive promoter such as, e.g., a CMV/CMV promoter (CMV enhancer and promoter), or a variant thereof.
• the native 5’ ABCA4 untranslated region comprises a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO: 12 or 13 (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) to SEQ ID NO: 12 or 13.
• the 5’ regulatory domain comprises a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO: 14 or 15 (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) to SEQ ID NO: 14 or 15.
• SEQ ID NO: 14 or 15 e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity
• the binding site is within ABCA4 intron 22.
• the binding site comprises any one or more of nucleotides 1 to 510 or 880 to 1,350 of SEQ ID NO: 16 (e.g., any six or more, any eight or more, any 10 or more, any 12 or more, any 18 or more, any 20 or more, any 24 or more, any 50 or more, any 100 or more, or any 150 or more (e.g., 150)) of nucleotides 1 to 510 or 880 to 1 ,350 of SEQ ID NO: 16.
• the binding site comprises any one or more of nucleotides 1160 to 1309 of SEQ ID NO: 16 (e.g., any six or more, any eight or more, any 10 or more, any 12 or more, any 18 or more, any 20 or more, any 24 or more, any 50 or more, any 100 or more, or any 150 or more (e.g., 150)) of nucleotides 1160 to 1309 of SEQ ID NO: 16.
• nucleotides 1160 to 1309 of SEQ ID NO: 16 e.g., any six or more, any eight or more, any 10 or more, any 12 or more, any 18 or more, any 20 or more, any 24 or more, any 50 or more, any 100 or more, or any 150 or more (e.g., 150) of nucleotides 1160 to 1309 of SEQ ID NO: 16.
• a binding domain that binds to a binding site has least 80% sequence identity to a binding site within SEQ ID NO: 16 (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to a binding site within SEQ ID NO: 16.
• the binding domain comprises SEQ ID NO: 17 or 18.
• the splicing domain comprises GTAAGT, GUAAGT, GTAAGG, GUAAGG, GTAAGC, GUAAGC, GTAACT, or GUAACU.
• the nucleic acid trans-splicing molecule further comprises a linker domain.
• the linker domain is longer than 25 nucleotides in length (e.g., between 25 and 50 nucleotides in length, between 35 and 45 nucleotides in length, or about 40 nucleotides in length (e.g., a 40-mer linker)).
• the linker domain is, or comprises, a nucleic acid sequence having at least 80% identity (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) with at least 80% identity (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) with at least 80% identity (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity
• the linker domain is, or comprises, a nucleic acid sequence having at least 80% identity (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) with CCGAATACGACACGTACAAGATCT (SEQ ID NO: 29).
• the linker domain is, or comprises, a nucleic acid sequence having at least 80% identity (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) with at least 80% identity (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) with at least 80% identity (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity
• nucleic acid trans-splicing molecule comprising, operatively linked in a 5’-to-3’ direction: (a) a CDS comprising a functional sequence of 5’ ABCA4 exons; (b) a splicing domain configured to mediate trans-splicing, wherein the splicing domain comprises GTAAGT, GUAAGT, GTAAGG, GUAAGG, GTAAGC, GUAAGC, GTAACT, or GUAACU; and (c) a binding domain configured to bind a binding site within endogenous ABCA4 intron 22, wherein the nucleic acid trans-splicing molecule is configured to trans-splice the CDS to endogenous ABCA4 exon 23, thereby replacing an endogenous 5’ ABCA4 exon sequence with the functional sequence of 5’ ABCA4 exons.
• the nucleic acid trans-splicing molecule comprises a 5’ regulatory domain operatively linked 5’ to the CDS.
• the 5’ regulatory domain comprises a native 5’ ABCA4 untranslated region, e.g., a native 5’ ABCA4 untranslated region having at least 80% sequence identity to SEQ ID NO: 12 or 13 (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) to SEQ ID NO: 12 or 13.
• the 5’ regulatory domain further comprises a constitutive promoter, e.g., a CMV promoter.
• the nucleic acid trans-splicing molecule further comprises a linker domain.
• the linker domain is longer than 25 nucleotides in length (e.g., between 25 and 50 nucleotides in length, between 35 and 45 nucleotides in length, or about 40 nucleotides in length (e.g., a 40-mer linker)).
• the linker domain is, or comprises, a nucleic acid sequence having at least 80% identity (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) with CTGGTGCCCGCGGGCCGCGGAACCGGTTGGGGGCATGTAC (SEQ ID NO: 27).
• the linker domain is, or comprises, a nucleic acid sequence having at least 80% identity (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) with CCGAATACGACACGTACAAGATCT (SEQ ID NO: 29).
• the linker domain is, or comprises, a nucleic acid sequence having at least 80% identity (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) with GCTGCTGCTCAGTCTCCTGGGCTGG (SEQ ID NO: 31).
• the binding site comprises any one or more of nucleotides 1 to 510 or 880 to 1 ,350 of SEQ ID NO: 16 (e.g., any six or more, any eight or more, any 10 or more, any 12 or more, any 18 or more, any 20 or more, any 24 or more, any 50 or more, any 100 or more, or any 150 or more (e.g., 150)) of nucleotides 1 to 510 or 880 to 1 ,350 of SEQ ID NO: 16.
• nucleotides 1 to 510 or 880 to 1 ,350 of SEQ ID NO: 16 e.g., any six or more, any eight or more, any 10 or more, any 12 or more, any 18 or more, any 20 or more, any 24 or more, any 50 or more, any 100 or more, or any 150 or more (e.g., 150)
• the binding site comprises any one or more of nucleotides 1160 to 1309 of SEQ ID NO: 16 (e.g., any six or more, any eight or more, any 10 or more, any 12 or more, any 18 or more, any 20 or more, any 24 or more, any 50 or more, any 100 or more, or any 150 or more (e.g., 150)) of nucleotides 1160 to 1309 of SEQ ID NO: 16.
• nucleotides 1160 to 1309 of SEQ ID NO: 16 e.g., any six or more, any eight or more, any 10 or more, any 12 or more, any 18 or more, any 20 or more, any 24 or more, any 50 or more, any 100 or more, or any 150 or more (e.g., 150) of nucleotides 1160 to 1309 of SEQ ID NO: 16.
• the binding domain that binds to a binding site has least 80% sequence identity to SEQ ID NO: 17 or 18 (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to SEQ ID NO: 17 or 18).
• the binding domain comprises SEQ ID NO: 17 or 18.
• nucleic acid trans-splicing molecule comprising, operatively linked in a 5’-to-3’ direction: (a) a CDS comprising a functional sequence of 5’ ABCA4 exons; (b) a splicing domain configured to mediate trans-splicing; (c) a linker domain between 25 and 50 nucleotides in length; and (d) a binding domain configured to bind a binding site within endogenous ABCA4 intron 22, wherein the nucleic acid trans-splicing molecule is configured to transsplice the CDS to endogenous ABCA4 exon 23, thereby replacing an endogenous 5’ ABCA4 exon sequence with the functional sequence of 5’ ABCA4 exons.
• the linker domain is between 35 and 45 nucleotides in length, or about 40 nucleotides in length (e.g., a 40-mer linker).
• the linker domain is, or comprises, a nucleic acid sequence having at least 80% identity (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) with CTGGTGCCCGCGGGCCGCGGAACCGGTTGGGGGCATGTAC (SEQ ID NO: 27).
• the linker domain is, or comprises, a nucleic acid sequence having at least 80% identity (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) with CCGAATACGACACGTACAAGATCT (SEQ ID NO: 29).
• the linker domain is, or comprises, a nucleic acid sequence having at least 80% identity (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) with GCTGCTGCTCAGTCTCCTGGGCTGG (SEQ ID NO: 31).
• the nucleic acid trans-splicing molecule comprises a 5’ regulatory domain operatively linked 5’ to the CDS.
• the 5’ regulatory domain comprises a native 5’ ABCA4 untranslated region, e.g., a native 5’ ABCA4 untranslated region having at least 80% sequence identity to SEQ ID NO: 12 or 13 (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) to SEQ ID NO: 12 or 13.
• the 5’ regulatory domain further comprises a constitutive promoter, e.g., a CMV/CMV promoter.
• the splicing domain comprises GTAAGT, GUAAGT, GTAAGG, GUAAGG, GTAAGC, GUAAGC, GTAACT, or GUAACU.
• the binding site comprises any one or more of nucleotides 1 to 510 or 880 to 1 ,350 of SEQ ID NO: 16 (e.g., any six or more, any eight or more, any 10 or more, any 12 or more, any 18 or more, any 20 or more, any 24 or more, any 50 or more, any 100 or more, or any 150 or more (e.g., 150)) of nucleotides 1 to 510 or 880 to 1,350 of SEQ ID NO: 16.
• any six or more, any eight or more, any 10 or more, any 12 or more, any 18 or more, any 20 or more, any 24 or more, any 50 or more, any 100 or more, or any 150 or more (e.g., 150) of nucleotides 1 to 510 or 880 to 1,350 of SEQ ID NO: 16.
• the binding site comprises any one or more of nucleotides 1160 to 1309 of SEQ ID NO: 16 (e.g., any six or more, any eight or more, any 10 or more, any 12 or more, any 18 or more, any 20 or more, any 24 or more, any 50 or more, any 100 or more, or any 150 or more (e.g., 150)) of nucleotides 1160 to 1309 of SEQ ID NO: 16.
• nucleotides 1160 to 1309 of SEQ ID NO: 16 e.g., any six or more, any eight or more, any 10 or more, any 12 or more, any 18 or more, any 20 or more, any 24 or more, any 50 or more, any 100 or more, or any 150 or more (e.g., 150) of nucleotides 1160 to 1309 of SEQ ID NO: 16.
• the binding domain that binds to a binding site has least 80% sequence identity to SEQ ID NO: 17 or 18 (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to SEQ ID NO: 17 or 18).
• the binding domain comprises SEQ ID NO: 17 or 18.
• the nucleic acid trans-splicing molecule comprises a 3’ transcription terminator domain.
• the 3’ transcription terminator domain forms a triple helical structure that effectively caps the 3’ end of the trans-splicing molecule.
• the 3’ transcriptional terminator domain comprises a wildtype MALAT 1 sequence.
• the 3’ transcriptional terminator domain comprises a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO: 32 or 33 (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to SEQ ID NO: 32 or 33).
• the CDS comprises ABCA4 exons 1-22 or variants thereof (e.g., codon-optimized variants thereof).
• the nucleic acid trans-splicing molecule comprises a nucleic acid sequence having at least 80% sequence identity to any one of SEQ
• sequence identity e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to any one of SEQ ID NOs: 40-50).
• the endogenous ABCA4 pre- mRNA has at least one mutation associated with an ABCA4-associated retinal dystrophy (e.g., a recessively inherited ABCA4-associated retinal dystrophy, e.g., Stargardt disease or cone-rod dystrophy).
• the mutation is expressed in a photoreceptor cell and/or a retinal pigment epithelial cell.
• nucleic acid trans-splicing molecule comprising, operatively linked in a 5’-to-3’ direction: (a) a CDS comprising a functional sequence of 5’ ABCA4 exons; (b) a splicing domain configured to mediate trans-splicing; and (c) a binding domain having at least 80% sequence identity (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) to any one of SEQ ID NOs: 17-24, wherein the nucleic acid trans-splicing molecule is configured to trans-splice the CDS to endogenous ABCA4 exon 23, thereby replacing an endogenous 5’ ABCA4 exon sequence with the functional sequence of
• RNA molecule or vector thereof, comprising SEQ ID NO: 17.
• nucleic acid e.g., DNA or RNA
• nucleic acid trans-splicing molecule of any of the preceding embodiments or any of the preceding aspects
• a vector encoding the nucleic acid trans-splicing molecule of any of the preceding embodiments or any of the preceding aspects.
• a proviral plasmid comprising the nucleic acid trans-splicing molecule of any of the preceding embodiments or any of the preceding aspects.
• an adeno-associated virus comprising a sequence encoding the nucleic acid trans-splicing molecule of any of the preceding embodiments or any of the preceding aspects.
• the AAV preferentially targets a photoreceptor cell and/or a retinal pigment epithelial cell.
• the AAV is AAV8, AAV5, or AAV2.
• composition comprising the nucleic acid trans- splicing molecule, the vector, the proviral plasmid, or the AAV of any of the preceding embodiments or any of the preceding aspects.
• the composition includes a pharmaceutically acceptable excipient.
• a method of expressing functional ABCA4 in a target cell e.g., in vitro or in vivo.
• the method includes transducing the target cell with the nucleic acid trans-splicing molecule, the vector, the AAV, or the composition of any one of the previous aspects.
• the method replaces 20% or more of the target ABCA4 mRNA in the target cell (e.g., in cultured human cells, e.g., as measured by trans-spliced ABCA4 RNA or corresponding protein resulting from translation of the trans-spliced RNA). In some embodiments, the method replaces 38% or more of the target ABCA4 mRNA in the target cell (e.g., in cultured human cells e.g., as measured by trans-spliced ABCA4 RNA or corresponding protein resulting from translation of the trans-spliced RNA). In some embodiments, the functional ABCA4 (corresponding protein resulting from translation of the trans-spliced RNA) is full-length ABCA4 protein.
• a method of reducing ABCA4 retinopathy- associated lipofuscin and/or A2E accumulation in a subject e.g., a mammal, e.g., a primate, e.g., a human.
• the method includes transducing a target retinal cell in the subject with the nucleic acid trans-splicing molecule, the vector, the AAV, or the composition of any of the preceding embodiments or any of the preceding aspects.
• the subject is a nonhuman primate or a human (e.g., a human who has been diagnosed with an ABCA4-associated retinal dystrophy).
• the nucleic acid trans-splicing molecule, the vector, or the AAV is administered to the subject by ocular administration (e.g., by subretinal administration).
• a method of correcting at least one mutation in a 5’ ABCA4 exon sequence in a target cell of a subject e.g., a mammal, e.g., a primate, e.g., a human.
• the method includes administering to the subject the nucleic acid trans- splicing molecule, the vector, the composition, or the AAV of any of the preceding embodiments or any of the preceding aspects.
• the subject is a non-human primate or a human (e.g., a human who has been diagnosed with an ABCA4-associated retinal dystrophy).
• the nucleic acid trans-splicing molecule, the vector, or the AAV is administered to the subject by ocular administration (e.g., by subretinal administration).
• a method of treating an ABCA4-associated retinal dystrophy in a subject includes administering to the subject the nucleic acid trans-splicing molecule, the vector, the AAV, or the composition of any of the preceding embodiments or any of the preceding aspects in a therapeutically effective amount.
• the ABCA4-associated retinal dystrophy is associated with a mutation in a 5’ ABCA4 exon sequence (e.g., a mutation in any one or more of ABCA4 exons 1-22).
• the ABCA4-associated retinal dystrophy is Stargardt disease or cone-rod dystrophy.
• FIG. 1 is a graph showing trans-splicing efficiency across ABCA4 trans-splicing molecules having various permutations of splice domains (SS), linkers, and binding domains (BD).
• FIG. 2 is a graph showing trans-splicing efficiency across ABCA4 trans-splicing molecules having various splice domain sequences.
• FIGS. 3A and 3B show trans-splicing efficiency of various ABCA4 trans-splicing molecules transduced by AAV in cultured human cells.
• FIG. 3A shows results by RT-qPCR.
• FIGS. 3B and 3C show results by Western blot.
• FIG. 3D is a graph quantifying the results of FIG. 3C.
• FIG. 4 shows a Western blot of AAV8 preparations of trans-splicing molecules, showing VP1 , VP2, and VP3 bands.
• FIGS. 5A-5C show GFP protein expression by GFP trans-splicing molecules in vivo in African Green Monkey (AGM) non-human primates (NHP) following subretinal injection.
• FIG. 5A is a live image showing GFP protein.
• FIG. 5B is a photomicrograph showing anti-GFP immunohistochemistry (IHC) staining of retinal sections (photoreceptors and choroid are labeled) in a negative control at day 28.
• FIG. 5C is a photomicrograph showing anti-GFP IHC staining of retinal sections (photoreceptors and choroid are labeled) in a GFP trans-splicing molecule-treated animal at day 28.
• IHC immunohistochemistry
• FIG. 6 is a set of cSLO an OCT images of baseline, post-subretinal injections at days 14 and 28. Blebs are labeled in the “post injection” panels.
• FIG. 7 is a set of color fundus images (anterior, posterior, superior, and inferior views) of NHP eyes treated with vehicle, exon editor 443, and exon editor 274 at day 28.
• FIG 8A is a schematic diagram showing RT-qPCR testing methodology for trans- splicing molecules.
• a trans-splicing molecule (Exon Editor RNA) with a 5’ tag trans-splices into AGM pre-mRNA, and the edited (e.g., trans-spliced), full-length mRNA is quantitated by its resulting unique sequence.
• FIG. 8B shows quantitative RT-qPCR results for exon editors 443, 274, 497, and 505. As shown, each of Exon Editors 443, 274, 497, and 505 trans-splices with the endogenous AGM pre- mRNA in vivo in AGM retina at a statistically significant frequency as determined by quantitating the number of edited copies/10ng RNA.
• FIG. 9 is a Western blot showing full-length chimeric (human/AGM) ABCA4 protein produced as a result of Exon Editors 443, 274, 497, and 505 trans-splicing into AGM pre-mRNA in AGM retina.
• the protein tag was detected in the membrane extracts of the retina.
• FIGS. 10A and 10B are mass spectrometry results showing detection of unique peptides of human and AGM ABCA4 protein.
• FIG. 10A shows results for a negative control (vehicle- treated) retinal tissue. The top row shows the control sample lacking a spike where the human protein spike should appear; the second row shows the control sample spiked with standard to show where the human protein spike would appear; the third row shows the control sample containing a spike representing AGM protein; and the bottom row shows the sample spiked with standard, which contains the AGM protein spike.
• FIG. 10B shows results for the exon editor-treated retinal tissue, showing detection of both human and AGM peptides.
• the top row shows the control sample, which exhibits a human peptide spike, which reflects the presence of a human/AGM chimeric protein (in contrast to the negative control shown in FIG. 10A); the second row shows the control sample spiked with standard; the third row shows the control sample containing a spike representing AGM protein; and the bottom row shows the sample spiked with standard, which contains the AGM protein spike.
• FIGS. 11 A-11 F are bar graphs showing ocular health in AGM after treatment with AAV8 exon editors or vehicles administered subretinally. Data is shown as mean of vehicle and mean of exon editors 443, 274, 497, and 505 +/- standard deviation.
• FIG. 11A shows retinal thickness at baseline, day 14, and day 28.
• FIG. 11 B shows intraocular pressure by tonometry at baseline, day 7, day 14, day 21 , and day 28.
• FIGS. 11C-11 F show results for metrics of ocular inflammation.
• FIG. 11C shows total clinical scores at baseline, day 7, day 14, day 21 , and day 28;
• FIG. 11 D shows vitreous cell score at baseline, day 7, day 14, day 21 , and day 28;
• FIG. 11 E shows aqueous cell score at baseline, day 7, day 14, day 21 , and day 28;
• FIG. 11 F shows inflammatory keratic particles at baseline, day 7, day 14, day 21 , and day 28.
• FIG. 12A and 12B show results for general health metrics of AGM after treatment with AAV8 exon editors or vehicles administered subretinally.
• FIG. 12A shows body weight measurements at baseline, day 7, day 14, day 21 , and day 28.
• FIG. 12B shows heart rate (beats per minute (bpm)) at baseline and day 28.
• FIG. 13 depicts elements of an exemplary RNA exon editor that is designed to transsplice exons 1-22 of the human ABCA4 gene of the exon editor to exons 23-50 of the endogenous ABCA4 pre-mRNA transcript.
• the exemplary exon editor is designed to treat subjects carrying mutations that span exons 1-22 of ABCA4.
• Numerical tags as follows: 1 : AAV2-based Inverted Terminal Repeat Sequences (ITR) for AAV packaging of the ABCA4 RNA Exon Editor; 2: Cytomegalovirus (CMV) promoter (CMV immediate early enhancer and CMV immediate early promoter) drives ABCA4 RNA Exon Editor expression in photoreceptor cells; 3: Native 5’ Untranslated Region (UTR) from Human ABCA4 mRNA maintains native 5’ regulation; 4: ABCA4 exons 1-21 , which comprise synonymous codon changes, replace corresponding endogenous coding sequence via trans-splicing.
• ITR AAV2-based Inverted Terminal Repeat Sequences
• CMV Cytomegalovirus
• UTR Native 5’ Untranslated Region
• ABCA4 exons 1-21 which comprise synonymous codon changes, replace corresponding endogenous coding sequence via trans-splicing.
• Synonymous codon changes may be used to, e.g., remove cryptic splice acceptor sites to mitigate potential alternative splicing reactions; 5: ABCA4 exon 22 comprising synonymous codon changes that enable sequence-based quantification; 6: Splice donor (also referred to herein as a splicing domain) trans-splices into endogenous ABCA4 intron 22 splice acceptor site leading to replacement of the endogenous ABCA4 pre-mRNA upstream sequence with the ABCA4 RNA Exon Editor Coding Domain Sequence (CDS) including Exon 22; 7: STOP codon (double stop) reduces/prevents translation of amino acids from the ABCA4 Exon Editor downstream of Exon 22 (e.g.
• Linker 3x U1 , ARE, BD domain regions
• 8 Linker provides structural flexibility and accessibility to splice domain site
• 9 Three tandem U1 binding sites (3x U1), which are predicted to associate with U1 snRNP and are demonstrated herein to potentiate ABCA4 RNA Exon Editor-mediated activity
• 10 AU- rich element (ARE) which is demonstrated herein to decrease stability of any non-spliced ABCA4 RNA Exon Editor entering the cytoplasm
• 11 Binding domain (BD) mediates targeting of ABCA4 RNA Exon Editor to endogenous ABCA4 pre-mRNA Intron 22 via sequence complementarity
• 12 MALAT 1 terminator promotes efficient trans-splicing
• 13 AAV2-based ITR for AAV packaging of the Exon Editor cassette.
• SEQ ID NO: 90 corresponds to nucleotides 4284-9073 of SEQ ID NO: 82.
• SEQ ID NO: 90 comprises SEQ ID NO: 78 (spanning from the 5’ UTR to the end of the MALAT1-Masc RNA comprising anti-mut1) and SEQ ID NO: 69 (spanning from the ATG within the 5’ UTR to the end of the MALAT1-Masc RNA comprising anti-mut1).
• SEQ ID NO: 82 encodes SEQ ID NO: 90.
• FIGs. 14A and 14B depict RNA trans-splicing and cis-splicing reactions.
• A Illustrates an RNA trans-splicing reaction schematic wherein the general mechanism of Exon Editing via trans- splicing is presented with respect to an ABCA4 RNA Exon Editor. An exemplary ABCA4 Exon Editor RNA is depicted above the targeted ABCA4 pre-mRNA.
• a binding domain (BD) complementary to intron 22 associates the Exon Editor with the pre-mRNA and enables the spliceosome-mediated trans- splicing reaction to occur between the Exon Editor’s splice donor (SD) site (or splicing domain) and the native intron 22 splice acceptor (SA) site - leading to replacement of the upstream region of the targeted pre-mRNA with the coding sequence (CDS) provided by the Exon Editor.
• the pre-mRNA molecules progressively proceed through the common cis-splicing process that removes any remaining downstream introns, resulting in mature mRNA that can then undergo translation to form a functional (biologically active) ABCA4 protein.
• the red “x” mutations in the endogenous pre-mRNA illustration depict representative individual allelic mutations present in the ABCA4 gene on a single pre-mRNA transcript.
• the SD and SA sites are indicated with red arrows.
• the exon-exon junction formed via trans-splicing is encircled in red.
• B Depicts RNA cis- and trans-splicing mechanisms. Both RNA cis- and trans-splicing rely on the endogenous spliceosome to mediate splicing and begin with covalent bond formation between the Branch Point (BP), which is upstream of a polypyrimidine track (Py), and the first nucleotide of the SD site.
• BP Branch Point
• Py polypyrimidine track
• a lariat is formed, and during trans- splicing a Y-branch is formed.
• the spliceosome mediates the ligation of the upstream exon to the downstream exon while the lariat and Y-branch molecules are rapidly degraded.
• FIG. 15 presents a schematic of RT-qPCR analysis of individual RNA exon editor activity. Following RNA extraction from cells or tissues treated with an RNA exon editor, RNA is reverse-transcribed and subjected to qPCR or ddPCR. In the schematic, RNA exon editor RNA copy number is measured using the purple forward primer (labeled 1) and green reverse primer (labeled 2). Native ABCA4 RNA can be specifically quantified using the blue forward (labeled 3) and reverse (labeled 4) primer pair.
• the blue forward primer (labeled 3) has low complementarity to this position and is replaced with the purple forward primer (labeled 1) in order to quantify the exon-edited ONT RNA product instead.
• the purple forward (labeled 1) and reverse (labeled 5) primer pair is used to quantify the RNA exon editor, ONT, and OFT RNA molecules together.
• FIG. 16 depicts screening and identification of exemplary ABCA4 Exon Editors. Both an NGS library-based approach (top) and a single Exon Editor bioluminescence-based approach (bottom) were applied to identify BD117 as an exemplary position in the ABCA4 gene intron 22 to direct the Exon Editor.
• FIGs. 17A and 17B show that the 40mer linker dramatically outperforms the LinkD linker.
• A Presents a histogram depicting percent replacement of ABCA4 RNA for each construct indicated or an untransfected negative control. An exon editor that comprises the 40mer linker exhibits a dramatic and statistically significant increased percent replacement of ABCA4 RNA compared to an exon editor that contains a progenitor linker (LinkD).
• B Depicts western blots showing that the 40mer linker promotes higher trans-splicing activity relative to the LinkD linker as reflected by dramatically higher levels of protein translated from on-target (ONT) trans-spliced RNA.
• ONT on-target
• the western blot was probed with anti-ABCA4 antibodies specific for the C-terminus of ABCA4 (top panel), anti-V5 epitope tag antibodies specific for the V5 epitope tag which is incorporated into the N-terminus of the trans-spliced protein and NSP (middle panel), and antibodies specific for sodium/potassium ATPase (Na+/K+ ATPase) which is a protein loading control.
• FIG. 18 Cartoon illustrating full length proteins and NSP. C terminal Ab immunoprecipitates only full length ABCA4 protein.
• FIGs. 19A and 19B illustrate the activity of each of the indicated RTM elements, alone and in combination, in the context of an exemplary ABCA4 5’ RTM.
• A Presents a histogram depicting percent replacement of ABCA4 RNA for each construct indicated. The percent replacement ranges from around 20-30% for each construct. Intriguingly, the combination of 40mer + 3x repeat of a U 1 binding site (3XUBS) shows a trend toward increasing percent replacement of ABCA4 RNA relative to 40mer alone.
• (B) Depicts western blots showing that the indicated constructs 40mer, 40mer + 3XUBS, 40mer + AU-rich elements (ARE), and 40mer + 3XUBS + ARE express trans-spliced ABCA4 protein (ONT) and in combination, these RTM elements exhibit a trend toward increased ONT levels relative to 40mer alone.
• the western blots also show that each of the combinations of 40mer + 3XUBS, 40mer + ARE, and 40mer + 3XUBS + ARE exhibits a combinatorial effect on non-spliced protein (NSP) reduction relative to 40mer alone.
• NSP non-spliced protein
• a minimal NSP context (contains stop codons immediately following the slice donor sequence in the exon editor), the combination of two strategies that independently reduced NSP levels -the inclusion of 3x UBS and an AU-rich element - showed concerted effect on NSP level reduction.
• This combination reduced the NSP level by -70% compared to 40mer only, down to the level seen in a non-stop exon editor.
• Exemplary constructs comprise SEQ ID NO: 84 (40mer lane); SEQ ID NO: 85 (40mer + 3XUBS lane); SEQ ID NO: 86 (40mer + ARE); SEQ ID NO: 87 (40mer + 3XUBS + ARE).
• FIGs. 20A and 20B show that the MALAT 1 terminator (triple helix + mascRNA) confers significant improvement in ONT trans-splicing in an exemplary ABCA4 5’ exon editor and the anti-mut1 MALAT 1 terminator exhibits similar activity to that of the MALAT 1 terminator with respect to ONT protein and NSP expression.
• A Presents a histogram depicting relative trans-splicing conferred by the MALAT1 terminator as compared to a progenitor terminator in the context of the exemplary ABCA4 5’ exon editor.
• the MALAT1 terminator confers a 23-fold increase in trans-splicing relative to the progenitor terminator.
• (B) Depicts western blots showing that for three different ABCA4 5’ exon editors, MALAT 1 and anti-mut1 MALAT 1 , exhibit similar activity with respect to expression levels of trans-spliced ABCA4 protein (ONT) and non-spliced protein (NSP).
• the western blot was probed with anti-ABCA4 antibodies specific for the N-terminus of ABCA4 (top panel), anti-ABCA4 antibodies specific for the C-terminal of ABCA4 (middle panel), and antibodies specific for sodium/potassium ATPase (Na7K + ATPase) which is a protein loading control.
• FIGs. 21 A and 21 B show a dose response of an exemplary AAV2-ABCA4 RNA exon editor construct transduced into HEK293T 17+06 cells engineered to overexpress mutant ABCA4 mRNA, wherein the ABCA4 RNA exon editor is depicted in FIG. 13 (spanning from the 5’ UTR to the end of the anti-mut1 MALAT1 terminator) ; SEQ ID NO: 78) and comprises the cassette of the 40mer linker + 3XUBS + ARE (SEQ ID NO: 73).
• the AAV2-ABCA4 exon editor was transduced into HEK293T 17+06 cells in biological duplicate at a series of multiplicity of infection (MOI) as follows: 0, 1 k, 10k (1 e4), 100k (1 e5), 1 M (1 e6) followed by (A) RNA extraction for ddRT-PCR % RNA replacement or (B) membrane protein extraction and Western blotting probed with an ABCA4-specific antibody.
• the western blot probed with anti-ABCA4 antibodies specific for the N-terminus of ABCA4 shows that ONT protein and NSP are detectable at MOI 1 e4 and increase through MOI 1 e6.
• FIG. 22 shows in vivo ABCA4 RNA Exon Editing. Exon Editing in the AGM Retina Measured by RT-qPCR. Neural retina punches of the treated area were analyzed by RT-qPCR.
• A The % RNA replacement is shown as % of the total ABCA4 (native and edited).
• B The Exon Editor copy number per 10ng RNA was normalized to RNF20.
• the exemplary AAV8 RNA exon editor construct (AAV8-REEC) used in this in vivo study comprises an RNA exon editor comprising SEQ ID NO: 77. Results are shown for 1 -month (4 weeks) and 3-months (12 weeks) time points.
• FIG. 23 presents a schematic representation of an AAV vector plasmid (SEQ ID NO: 82) that encodes ABCA4-01 (SEQ ID NO: 90).
• FIG. 24 depicts functional activity of protein translated from exon-edited ABCA4 RNA. These results provide evidence confirming the functional activity of ABCA4 protein rescued via ABCA4 RNA exon editing.
• ATPase activity of ABCA4 protein that was enriched by immunoprecipitation from ABCA4 KO cells following no treatment (negative control) or transfection with a V5 epitope-tagged version of the Exon Editor comprising SEQ ID NO: 78 (V5 tagged REEC), wherein the activity of the V5 epitope-tagged version (SEQ ID NO: 81) is shown.
• SEQ ID NO: 78 V5 tagged REEC
• SEQ ID NO: 81 the activity of the V5 epitope-tagged version
• ABCA4 ATPase activity measurements with no ATR (baseline) or with the addition of 40 fM ATR (+ ATR) are shown. Data are single biological replicates with technical duplicate or triplicate measurements.
• FIG. 25 depicts RNA species captured by OFT-seq.
• GSP targets codon optimized (CO) sequences in Exon 22 (Ex22) of the Exon Editor. Red dotted regions are sequenced by Illumina sequencing platform. The purple region illustrates the ABCA4 CDS provided by the Exon Editor. Three putative OFT junctions (A, B, C) and two putative self-spliced Exon Editor sequences are provided for illustrative purposes.
• FIG. 26 presents results depicting cryptic splice sites identified and frequency of use thereof in HEK 17+06 cells for exemplary ABCA4 constructs comprising the indicated elements.
• a similar panel of cryptic splice sites were identified and characterized in vivo in NHP retina.
• Experimentally determined cryptic splice site frequency for an ABCA4 construct comprising a precursor sequence before introduction of synonymous mutations in identified cryptic splice sites (SEQ ID NO: 46) (top panel) and after introduction of synonymous mutations in identified cryptic splice sites therein (bottom panel), introduction of which generated a splice site resistant sequence (SEQ ID NO: 79) as evidenced by a significant reduction in splicing frequency.
• FIGs. 27A and 27B illustrate activity for each of the indicated RTM elements, alone and in combination, in the context of a 5’ RTM for an exemplary intron (Intron A) of a target pre-mRNA examined in vitro.
• Intron A an exemplary intron of a target pre-mRNA examined in vitro.
• A Presents a histogram depicting percent replacement of the target RNA for each construct indicated. Intriguingly, the combination of 40mer + 3XUBS, the combination of 40mer + ARE, or the combination of 40mer + 3XUBS + ARE shows a trend toward decreasing percent replacement of the target RNA relative to 40mer alone.
• (B) Depicts western blots showing that the indicated constructs 40mer, 40mer + 3XUBS, 40mer + ARE, and 40mer + 3XUBS + ARE express trans-spliced on-target protein (ONT) and that each of the combinations exhibits a combinatorial effect on NSP reduction relative to 40mer alone. More particularly, the combination of 40mer + 3XUBS reduced NSP levels by about 75%; the combination of 40mer + ARE reduced NSP levels by about 40%; and the combination of 40mer + 3XUBS + ARE reduced NSP levels by about 88% relative to 40mer alone.
• ONT trans-spliced on-target protein
• FIGs. 28A and 28B illustrate the activity of each of the indicated RTM elements, alone and in combination, in the context of a 5’ RTM for an exemplary intron (Intron B) of a target pre-mRNA examined in vitro.
• Intron B an exemplary intron
• FIGs. 28A and 28B illustrate the activity of each of the indicated RTM elements, alone and in combination, in the context of a 5’ RTM for an exemplary intron (Intron B) of a target pre-mRNA examined in vitro.
• (A) Presents a histogram depicting percent replacement of the target RNA for each construct indicated. Intriguingly, the combination of 40mer + 3XUBS or the combination of 40mer + ARE shows a trend toward increasing percent replacement of the target RNA relative to 40mer alone.
• (B) Depicts western blots showing that the indicated constructs 40mer, 40mer + 3XUBS, 40mer + ARE, and 40mer + 3XUBS + ARE express trans-spliced target protein (ONT) and that each of the combinations of 40mer + 3XUBS, 40mer + ARE, and 40mer + 3XUBS + ARE exhibits a combinatorial effect on NSP reduction relative to 40mer alone.
• the combinatorial effect on NSP reduction is particularly pronounced for 40mer + 3XUBS + ARE relative to 40mer alone.
• FIG. 29 depicts the activity of each of the indicated RTM elements, alone and in combination, in the context of a 5’ RTM for an exemplary intron (Intron C) of a target pre-mRNA examined in vitro.
• HEK293T cells were transfected with RTMs containing Non-Binding Domain (NBD) + 40mer; BD34 (which binds specifically to Intron C) + 40mer; BD34 + 40mer + 3XUBS; or no RTM (Transfection control). Cells were harvested 48 hours post-transfection and assayed for transsplicing efficiencies by RT-qPCR.
• NBD Non-Binding Domain
• the percent replacement for BD34 + 40mer was about 1% replacement and that increased to about 3% replacement for an RTM comprising BD34 + 40mer + 3XUBS. Accordingly, the 3x UBS element increased percent replacement by about 3-fold in the exemplary RTM targeting Intron C shown.
• FIGs. 30A-30C present results demonstrating robust ABCA4 RNA and Protein Replacement In Vivo in NHP Six (6) Months After Treatment with an exemplary AAV8 RNA exon editor construct.
• VCC Viral genome copy
• y-axis exon editor RNA copies numbers
• B % ABCA4 RNA replacement
• ddPCR Droplet Digital Polymerase Chain Reaction
• percent total protein was quantified using a qualified IA MS assay.
• the exemplary AAV8 RNA exon editor construct used in this in vivo study comprises an RNA exon editor comprising SEQ ID NO: 90. Results for four (4) NHPs are shown and designated in (B) and (C) as 1-4: 1 (vehicle treated); 2-4 (treated with 3.5E11 vg/eye).
• FIG. 31 presents results demonstrating that an exemplary AAV8 RNA exon editor construct edits ABCA4 RNA in human retinas ex vivo.
• the exemplary AAV8 RNA exon editor construct used in this ex vivo study comprises an RNA exon editor comprising SEQ ID NO: 90.
• the graph depicts percent ABCA4 RNA replacement in human retinal explants from 3 independent donors, 21 days after treatment with vehicle or exemplary AAV8 RNA exon editor construct comprising SEQ ID NO: 90.
• compositions and methods described herein involve trans-splicing molecules (e.g., pre-mRNA trans-splicing molecules) for treating diseases or disorders caused by a mutation in the ABCA4 gene.
• trans-splicing molecules e.g., pre-mRNA trans-splicing molecules
• the compositions and methods described herein employ pre-mRNA trans-splicing molecules for gene therapy (e.g., in vivo gene therapy, e.g., delivered by adeno-associated virus) to treat diseases caused by at least one mutation in ABCA4, such as Stargardt disease or cone-rod dystrophy.
• ABCA4 is approximately 6.8 kb in size, contains 50 exons, and encodes a 250 kDa ATP-binding cassette transporter protein that is expressed in photoreceptor cells and RPE cells.
• ABCA4 is a transmembrane protein that is specifically localized at the rims and incisures of outer segment discs of rod and cone photoreceptors. In the retina, ABCA4 transports N-retinylidene- phosphatidylethanolamine from the lumen to the cytoplasmic leaflet of photoreceptor disc membranes, a process that in combination with chemical isomerization facilitates the removal of potentially toxic retinoid compounds.
• ABCA4 function results in an accumulation of bisretinoids such as the di-retinal conjugate A2E in the retinal pigment epithelium (RPE).
• This debris also known as lipofuscin, is thought to disturb RPE metabolism and ultimately contributes to cell death.
• Current genotype-phenotype models correlate the degree of residual ABCA4 activity with the severity of the retinal disease phenotype. Since ABCA4-related retinopathy is typically inherited in an autosomal recessive manner, individuals with 50% ABCA4 levels in photoreceptors are expected to have normal retinal function. Data from Abca4 knock-out mice have shown that a range of 10-25% correction of ABCA4 levels is sufficient to achieve relevant therapeutic effects, including reduction of toxic lipid accumulation in the retina.
• the present inventors have demonstrated complete rescue of ABCA4 protein levels in an in vitro engineered human ABCA4 protein knockout (KO) cell line that carries disease mimicking premature stop codon mutations and achieved therapeutically relevant levels of RNA exon editing in vivo in NHP retinas and in human retinal explants. More specifically, the present inventors have observed that AM-ABCA4 Exon Editor treatment resulting in >20% ABCA4 RNA exon editing efficiency (% RNA replacement) is sufficient to achieve 100% rescue of ABCA4 protein levels in vitro in the ABCA4 protein KO cell line. See, e.g., FIG. 3C.
• the parental ABCA4 knock-in (KI) cell line which contains a strong CAG promoter knocked in upstream of the endogenous ABCA4 locus was used as a reference to compare ABCA4 protein rescue efficiency.
• the in vitro engineered human ABCA4 protein KO cell line was derived from the parental ABCA4 KI cell line by introducing disease mimicking premature stop codon mutations into the ABCA4 gene. Accordingly, the in vitro engineered human ABCA4 protein knockout cell line serves as an in vitro model system for predicting therapeutic efficacy of ABCA4 RNA exon editors (nucleic acid trans-splicing molecules) described herein.
• RNA replacement means that 37% of the total ABCA4 mRNA quantified from the treated cells or tissue is present in an exon-edited form.
• the exemplary AAV8-based ABCA4 exon editing molecule used in this study comprises SEQ ID NO: 77, which shares the same regulatory elements and the double stop codon present in SEQ ID NO: 90.
• ABCA4-01 (SEQ ID NO: 90), which is an exemplary AAV8-packaged RNA exon editor encoded by an AAV vector plasmid comprising SEQ ID NO: 82, can mediate trans-splicing of endogenous pre-RNA to a degree sufficient to at least partially restore ABCA4 biological activity in cells in vitro and in vivo.
• ABCA4-01 (SEQ ID NO: 90) is depicted in FIG. 13 and spans the length of RNA exon editor from 5’ ITR to 3’ ITR.
• SEQ ID NO: 78 [a portion of SEQ ID NO: 90 spanning from the 5’ UTR to the end of the MALAT1 -MascRNA (anti-mut1); See FIG. 13] may be used an RNA exon editor.
• a portion of SEQ ID NO: 78 spanning from Exons 1-22 CDS to the end of the MALAT1- MascRNA comprising anti-mut1 depicted in FIG. 13 (e.g., SEQ ID NO: 69) can be combined with a different 5’ UTR in an ABCA4 RNA exon editor with a reasonable expectation of success in achieving comparable restoration of ABCA4 biological activity.
• FIGs. 30A-30C present results demonstrating robust ABCA4 RNA and protein replacement in vivo in NHP six (6) months after treatment with an exemplary AAV8 RNA exon editor construct (ABCA4-01 ; SEQ ID NO: 90).
• the present inventors treated wildtype cynomolgus macaques with a single subretinal dose of ABCA4-01 (3.5E1 1 vg/eye).
• AAV vector genome DNA copy (VGC) biodistribution, Exon Editor RNA expression, and the percent of edited ABCA4 RNA and protein at a 6-month timepoint were then evaluated.
• Exon Editor RNA expression correlated well with VGC (FIG.
• % RNA replacement conversion of native ABCA4 RNA copies to edited copies
• percent of edited ABCA4 RNA out of the total (edited + native) ABCA4 RNA population present in the neural retina samples As shown in FIG. 30B, the percent RNA replacement ranged from about 40%-60% for this dose of ABCA4-01. This resulted in therapeutic levels of the resultant human-NHP chimeric ABCA4 protein as measured by a qualified IA-MS assay (FIG. 30C).
• human NHP chimeric ABCA4 protein which results from ABCA4 RNA editing in these animals, was found to be present at 20-40% of the total (human-NHP + NHP) ABCA4 protein in the tested samples.
• the present inventors have, moreover, demonstrated up to 66% RNA replacement and up to 45% human/NHP chimeric ABCA4 protein in wild-type cynomolgus macaques treated with a higher dose of ABCA4-01 delivered via single subretinal injection. These results demonstrate that ABCA4-01 achieves therapeutically relevant levels of edited ABCA4 protein expression in NHP, which levels exceed the levels of rescued ABCA4 protein previously shown to confer therapeutic benefit in an Abca4 KO mouse model.
• the present inventors also evaluated ABCA4 exon editing in human photoreceptors by treating human donor retinal explants with ABCA4-01 , an exemplary AAV8 RNA exon editor construct comprising SEQ ID NO: 90.
• the present inventors treated explants from multiple donors with ABCA4-01 (3.9E11 vg/retinal punch), incubated the cells for 21 days, and then extracted RNA. Analysis of the extracted RNA demonstrated approximately 20-30% RNA replacement of the endogenous exons 1-22 with the same corresponding exons encoded by ABCA4-01 (FIG. 31).
• ABCA4 protein rescued in ABCA4 protein KO cells transfected with an overexpression plasmid encoding an N-terminal V5-epitope tagged version of the RNA exon editor of ABCA4-01 (SEQ ID NO: 81) exhibited ATPase activity.
• the activity of ABCA4 protein rescued following trans-splicing mediated by the V5- epitope tagged version of the RNA exon editor of ABCA4-01 (SEQ ID NO: 81) was assessed in the absence or presence of 40 pM all-trans retinal (ATR) following ABCA4 protein immunoprecipitation.
• results presented herein demonstrate the therapeutic potential for ABCA4 RNA exon editors described herein (e.g., RNA exon editors comprising any one of SEQ ID NO: 90, SEQ ID NO: 78, or SEQ ID NO: 69) and compositions comprising same for use in treating ABCA4- related retinopathies and in the preparation of medicaments for treating ABCA4-related retinopathies, as well as in methods for treating subjects having ABCA4-related retinopathies.
• RNA exon editors comprising any one of SEQ ID NO: 90, SEQ ID NO: 78, or SEQ ID NO: 69
• ABCA4-related retinopathies that may be treated using ABCA4 RNA exon editors described herein (e.g., RNA exon editors comprising any one of SEQ ID NO: 90, SEQ ID NO: 78, or SEQ ID NO: 69) and compositions comprising same include Stargardt Disease-1 (STGD1); Fundus flavimaculatus, Retinitis Pigmentosa- 19 (RP19); Cone-Rod Dystrophy-3 (CORD3); and Age-Related Macular Degeneration-2 (ARMD2).
• STGD1 Stargardt Disease-1
• RP19 Fundus flavimaculatus, Retinitis Pigmentosa- 19
• CORD3 Cone-Rod Dystrophy-3
• ARMD2 Age-Related Macular Degeneration-2
• ABCA4-related retinopathies that may be treated using ABCA4 RNA exon editors described herein (e.g., RNA exon editors comprising any one of SEQ ID NO: 90, SEQ ID NO: 78, or SEQ ID NO: 69) and compositions comprising same comprise inherited retinal diseases with two allelic pathogenic mutations spanning Exons 1-22 in the ABCA4 gene that present with a phenotype consistent with cone-rod dystrophy, Stargardt macular dystrophy, or fundus flavimaculatus.
• RNA exon editors comprising any one of SEQ ID NO: 90, SEQ ID NO: 78, or SEQ ID NO: 69
• compositions comprising same comprise inherited retinal diseases with two allelic pathogenic mutations spanning Exons 1-22 in the ABCA4 gene that present with a phenotype consistent with cone-rod dystrophy, Stargardt macular dystrophy, or fundus flavimaculatus.
• ABCA4 RNA exon editors described herein e.g., RNA exon editors encoded by nucleic acid trans-splicing molecules comprising any one of SEQ ID NO: 90, SEQ ID NO: 78, or SEQ ID NO: 69
• 70-85% of patients diagnosed with ABCA4-related retinopathies would benefit from treatment with ABCA4 RNA exon editors described herein (e.g., RNA exon editors comprising any one of SEQ ID NO: 90, SEQ ID NO: 78, or SEQ ID NO: 69).
• subjects/patients are identified as having at least one mutation in exons 1-22 of the ABCA4 gene.
• the subjects/patients are genotyped to identify those having at least one mutation in exons 1-22 of the ABCA4 gene.
• subjects/patients are obtained who have already been genotyped to identify those having at least one mutation in exons 1-22 of the ABCA4 gene. Under any model, subjects/patients are selected based on having at least one mutation in exons 1-22 of the ABCA4 gene, irrespective of the timing of the genotyping on which basis the selection process is made relative to a proposed treatment of such subjects/patients with RNA exon editors described herein.
• Such subjects/patients will benefit from use of ABCA4 RNA exon editors described herein for treating ABCA4-related retinopathies, medicaments comprising ABCA4 RNA exon editors described herein for treating ABCA4-related retinopathies, as well as methods for treating ABCA4-related retinopathies that call for administering ABCA4 RNA exon editors described herein or compositions comprising same.
• Stargardt Disease-1 (STGD1) is caused by homozygous or compound heterozygous mutations in the ABCA4 gene (OMIM #601691) on chromosome 1p22. More than 900 different mutations including missense, splicing, truncating, and frameshift alterations have been reported in the ABCA4 gene and shown to be associated with retinal degeneration. Many of these mutations change single amino acids in the ABCA4 protein and result in the absence of, or decreased, ABCA4 activity in photoreceptor cells. Reduced ABCA4 activity leads to the accumulation of vitamin A derivatives and accumulation of lipofuscin in retinal cells, which is toxic to retinal pigment epithelium and photoreceptors.
• Stargardt macular degeneration is a genetic eye disorder that affects the retina and more specifically, affects an area called the macula that is responsible for sharp central vision, which is important for a variety of visual tasks including reading, driving, and facial recognition.
• subjects with Stargardt macular degeneration have impaired night vision and some affected individuals also have impaired color vision. Late in the disease course the peripheral visual fields may show moderate to extensive restriction as well.
• the signs and symptoms of Stargardt macular degeneration typically present in childhood to early adulthood and patients exhibit progressive bilateral visual loss over time, often reaching 20/200 or worse.
• Fundus flavimaculatus is an allelic subtype of Stargardt disease that has been associated with mutation in the ABCA4 gene and the peripherin-2 (PRPH2) gene. Fundus flavimaculatus, which is a form of fleck fundus disease, derives its name from the occurrence of many white-yellow spots due to deposition of lipofuscin, which are widely distributed over the fundus. FFM is characterized by network atrophy of the retinal pigment epithelium and choroidal vascular atrophy. Central visual loss, loss of color vision, photophobia, paracentral scotoma, and slow dark adaptation are characteristic features of FFM.
• FFM presents later in life than other Stargardt subtypes and tends to run a slower course of progression. If loss of visual acuity begins in the first 2 decades of life, a patient is typically diagnosed with Stargardt, whereas if disease presents later in life and has a more slowly progressive course, a patient is typically diagnosed as having FFM.
• Retinitis Pigmentosa-19 can be caused by homozygous or compound heterozygous mutations in the ABCA4 gene on chromosome 1p22.
• Retinitis pigmentosa is an inherited eye disorder characterized by progressive loss of peripheral vision and impaired night vision. Many genes have been linked to retinitis pigmentosa.
• Retinitis Pigmentosa-19 is characterized by night-blindness, peripheral loss of vision, progressive retinal degeneration, tunnel vision, progressive vision loss, decreased vision at night or in low light, loss of central vision in advanced phases, and retinal pigment epithelium (RPE) mottling.
• the fundus demonstrates widespread outer retinal degeneration, bone-spicule pigment deposition, vessel attenuation, waxy disc pallor, and severe atrophic changes as well as choroidal scarring of the macula.
• Cone-Rod Dystrophy-3 (CORD3) is caused by homozygous or compound heterozygous mutation in the ABCA4 gene on chromosome 1p22.
• ABCA4 is one of the four major causative genes involved in the pathogenesis of cone rod dystrophies and ABCA4 mutations are associated with 30 to 60% of autosomal recessive cone rod dystrophies.
• CORD3 is an autosomal recessive, clinically heterogeneous retinal disorder typically characterized by symptomatic rapidly progressing visual loss combined with photophobia and loss of color discrimination noted initially, followed later by nyctalopia, and progressive visual field loss. Cone degeneration appears early in life with central involvement of the retina, followed by degeneration of rods several years later.
• cone rod dystrophies The diagnosis of cone rod dystrophies is based on clinical history, fundus examination and electroretinogram. Cone-rod dystrophies typically present earlier and progress much more rapidly than the other ABCA4-retinopathies, with extensive macular atrophy occurring several years after onset. Currently, there is no therapy that stops the evolution of the disease or restores vision, and the visual prognosis is poor. Management aims at slowing down the degenerative process, treating the complications, and preparing patients for the challenges associated with the social and psychological impact of blindness.
• Age-Related Macular Degeneration-2 is conferred by variation in the ABCA4 gene on chromosome 1p22.
• ARMD2 is a complex disorder characterized by the accumulation of drusen (a buildup of yellowish deposits) in and under the RPE and the progressive atrophy of the macular RPE. These changes result in loss of photoreceptor function and vision impairment.
• Age-related macular degeneration is a leading cause of vision loss in older people in developed countries. The vision loss usually becomes noticeable in a person's sixties or seventies and tends to worsen over time.
• Age-related macular degeneration mainly affects central vision, which is important for detailed tasks such as reading, driving, and facial recognition.
• the dry form is much more common, accounting for 85 to 90 percent of all cases of age-related macular degeneration. It is characterized by a buildup of drusen beneath the retina, atrophy in the macula, and slowly progressive vision loss. The condition typically affects both eyes.
• the wet form of age-related macular degeneration is associated with sudden-onset severe vision loss that can worsen rapidly. This form of the condition is characterized by the growth of abnormal, fragile blood vessels underneath the macula due to over-expression of VEGF. These vessels leak blood and fluid, which damages the macula, thereby blurring and distorting central vision.
• Wet macular degeneration can be treated using a variety of therapies. Dry AMD has a single available treatment, a C3 inhibitor only for those who have geographic atrophy. No therapies currently exist for earlier forms of ARMD, where only drusen deposition has occurred, without atrophy or fluid leakage.
• trans-splicing means joining a first RNA molecule containing one or more exons (e.g., exogenous exons or exons that are part of a CDS of a trans-splicing molecule) to a second RNA molecule (e.g., a pre-mRNA molecule, e.g., an endogenous pre-mRNA molecule) and replacing a portion of the second RNA molecule with a portion of the first RNA molecule through a spliceosome-mediated mechanism.
• a second RNA molecule e.g., a pre-mRNA molecule, e.g., an endogenous pre-mRNA molecule
• a “nucleic acid trans-splicing molecule” or “trans-splicing molecule” has three main elements: (a) a binding domain that confers specificity by tethering the trans-splicing molecule to its target gene (e.g., pre-mRNA); (b) a splicing domain (e.g., a splicing domain having a 3’ or 5’ splice site); and (c) a CDS configured to be trans-spliced onto the target nucleic acid, which can replace one or more exons in the target nucleic acid (e.g., one or more mutated exons).
• target gene e.g., pre-mRNA
• a splicing domain e.g., a splicing domain having a 3’ or 5’ splice site
• CDS configured to be trans-spliced onto the target nucleic acid, which can replace one or more exons in the target nucleic acid (e.g
• a “pre-mRNA trans- splicing molecule” or “RTM” refers to a nucleic acid trans-splicing molecule that targets pre-mRNA.
• the terms “nucleic acid trans-splicing molecule” and “trans-splicing molecule” refers to both (1) DNA that encodes RNA, wherein the RNA transcript is the effector molecule that physically binds the target pre-mRNA; and (2) the RNA transcript itself.
• the term “-encoding sequence” e.g., trans- splicing molecule-encoding sequence
• the subject encodes the effector (e.g., the encoding sequence is DNA and the effector is RNA).
• a trans- splicing molecule-encoding sequence can include cDNA, e.g., as part of a functional exon (e.g., a functional ABCA4 exon) for replacement of a mutated ABCA4 exon.
• a functional exon e.g., a functional ABCA4 exon
• the term “exon editor” may be used to refer to a trans-splicing molecule or a vector comprising same (e.g., an AAV vector comprising DNA encoding an RNA transcript that is a trans-splicing molecule).
• trans-splicing efficiency refers to a ratio of detected expression level of the desired trans-spliced RNA product (i.e., a chimeric RNA molecule that includes the functional exons of the trans-splicing molecule operably linked to endogenous target pre-mRNA generated by an RNA trans-splicing reaction) to the amount of DNA or RNA introduced for the trans-splicing molecule (or reference molecule).
• expression level of a trans-spliced RNA product is detected from RNA that is isolated from cells or tissues using RNA-seq.
• “relative trans-splicing efficiency” refers to a ratio of a test transsplicing efficiency to a reference trans-splicing efficiency, wherein the test trans-splicing efficiency is the trans-splicing efficiency of a trans-splicing molecule (e.g., a nucleic acid trans-splicing molecule described herein), and the reference trans-splicing efficiency is the trans-splicing efficiency of a reference molecule (e.g., a reference molecule having the same elements as the nucleic acid trans- splicing molecule except that the binding domain is replaced with a scrambled binding domain (e.g., a binding domain comprising, or consisting of, SEQ ID NO: 1 , e.g., a binding domain comprising, or consisting of, SEQ ID NO: 2).
• Relative trans-splicing efficiency of a trans-splicing molecule may be given as a ratio (a.k.a. fold increase) of the test
• operably linked refers to an arrangement of elements, wherein the components so described are configured so as to perform their usual function.
• a nucleic acid is “operably linked” to another nucleic acid sequence when it is placed into a functional relationship with the other nucleic acid sequence.
• Elements need not be contiguous with to be operably linked.
• intervening sequences can be present between operably linked sequences (e.g., a binding domain and a coding sequence can be separated by intervening sequences and the binding domain is still considered to be “operably linked” to the coding sequence).
• CDS refers to a nucleic acid sequence (e.g., an RNA sequence, a DNA sequence, or combination of RNA and DNA) that encodes a portion of a protein (e.g., a target protein in which a mutation is being corrected).
• a CDS may include one or more functional exons (e.g., a sequence of functional exons).
• one or more functional exons of a CDS are not separated by introns (e.g., as in endogenous pre-mRNA) but adjacent to one another (e.g., as cDNA).
• a CDS can include one or more introns (e.g., native introns) or untranslated regions (UTRs, e.g., native UTRs) between or otherwise adjacent to (e.g., upstream or downstream of) exons.
• introns e.g., native introns
• UTRs untranslated regions
• a “native 5’ ABCA4 untranslated region” or “native 5’ ABCA4 UTR” refers to a sequence greater than 20 nucleotides in length that has at least 90% sequence identity with a region of a native ABCA4 gene (e.g., a human ABCA4 gene) that is 5’ to the ATG start codon.
• a native 5’ ABCA4 untranslated region is given by the DNA sequence of SEQ ID NO: 13 or the RNA sequence of SEQ ID NO: 12.
• variants of a native 5’ ABCA4 untranslated region such as, for example, the DNA sequence of SEQ ID NO: 64 or the RNA sequence of SEQ ID NO: 65.
• a “functional sequence of 5’ ABCA4 exons” refers to a nucleic acid sequence comprising one or more of ABCA4 exons 1-22 that encode a functional (biologically active) portion of ABCA4 protein.
• a functional sequence of 5’ ABCA4 exons provides expression of functional ABCA4 protein (e.g., nonmutated ABCA4 protein).
• the functional sequence of 5’ ABCA4 exons includes a sequence of exons abutting the exon to which the trans-splicing molecule is being trans-spliced (e.g., a trans-splicing molecule that binds ABCA4 intron 22 and trans-splices with endogenous ABCA4 exon 23 can include a functional sequence of 5’ ABCA4 exons that includes exons 22, 21 , 20, 19, etc.).
• the term “functional” may also be used to refer to the amount of activity of a protein that is necessary to support normal cellular functions.
• the term “functional” may be used to refer to the amount of ABCA4 protein activity that is necessary to restore ABCA4 activity levels to support normal cellular functions within the context of, for example, photoreceptor and/or retinal epithelial cells. Such levels are sufficient to reduce or prevent the accumulation of toxic levels of bis retinoid compounds in photoreceptor and/or retinal epithelial cells.
• defective (non-functional) ABCA4 protein leads to the accumulation of 11 -cis and all-trans-retinal in photoreceptors and lipofuscin in the retinal pigment epithelium.
• functional refers to restoring an amount of ABCA4 protein sufficient to eliminate one or more symptoms of a condition associated with reduced levels of ABCA4 activity, e.g., an ABCA4-associated retinal dystrophy.
• ABCA4-associated retinal dystrophies include, for example, Stargardt macular dystrophy (Stargardt disease), fundus flavimaculatus, and ABCA4-related cone-rod dystrophy. In some embodiments, such methods or uses lead to an increase in ABCA4 protein activity (functional biologically active ABCA4 protein activity).
• such an increase in ABCA4 protein activity restores ABCA4 activity levels to at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of ABCA4 activity (e.g., 96%, 97%, 98%, 99%, or 100%) relative to that of a cell in which ABCA4 is present at normal, wildtype levels such as those present in cells in which non-mutated ABCA4 is expressed (e.g., photoreceptors and or retinal epithelial cells).
• wildtype levels such as those present in cells in which non-mutated ABCA4 is expressed
• “cryptic splice site corrected”, “cryptic splice site mitigated”, or “cryptic splice site resistant” refers to a nucleic acid trans-splicing molecule or a portion thereof (e.g., a coding domain sequence therein) that has been modified to change individual nucleotides therein to reduce the frequency of splicing that occurs at a cryptic splice site identified in the context of the nucleic acid trans-splicing molecule.
• the modifications do not result in any changes in amino acid sequences encoded thereby.
• the modifications result in changes in amino acid sequences encoded thereby.
• the cryptic splice site resistant nucleic acid sequence within a nucleic acid trans-splicing molecule is a coding domain sequence (CDS).
• the cryptic splice site resistant ABCA4 CDS comprises, consists essentially of, or consists of exons 1-22 of the ABCA4 gene, wherein cryptic splice sites have been identified in the context of the nucleic acid trans-splicing molecule and wherein at least one of the cryptic splice sites has been modified to reduce the frequency of splicing at the at least one site, while not altering amino acids encoded thereby.
• Exemplary cryptic splice sites identified in ABCA4 exons 1-22 and frequencies of splicing at these sites are presented in Table 3.
• the nucleotide position indicated in the column having a header of rtm_pos in Table refers to the position of the last nucleotide indicated in column 3 or column 4 relative to the ATG codon (the translational initiation site), with the A in this codon being designated as position 1.
• Exemplary cryptic splice resistant ABCA4 exons 1-22 sequences comprise, consist essentially of, or consist of any one of SEQ ID NOs: 56-59.
• an exemplary cryptic splice resistant ABCA4 exons 1-22 sequence comprises, consists essentially of, or consists of SEQ ID NO: 56.
• a “splicing domain,” as used herein, refers to a nucleic acid sequence having motifs that are recognized by the spliceosome and mediate trans-splicing.
• a splicing domain includes a splice site (e.g., a single splice site, i.e., one and only one splice site), which can be a 3’ splice site or a 5’ splice site.
• a splicing domain may include other regulatory elements.
• a splicing domain includes splicing enhancers (e.g., exonic splicing enhancers (ESE) and intronic splicing enhancers (ISE)).
• ESE exonic splicing enhancers
• ISE intronic splicing enhancers
• the splicing domain comprises GUAAGT or GTAAGT.
• the splice site consists essentially of GUAAGT or GTAAGT. In some embodiments, the splice site consists of GUAAGT or GTAAGT.
• the “binding domain” of a trans-splicing molecule is a polynucleotide sequence that binds a target gene at a binding site via hybridization (i.e., full or partial complementarity to the binding site).
• binding site refers to an endogenous polynucleotide sequence in the target mRNA (e.g., an mRNA of an endogenous gene, e.g., ABCA4) that is bound by the binding domain of a nucleic acid trans-splicing molecule.
• the binding site extends from the 5’- most nucleotide bound by the binding domain to the 3’-most nucleotide bound by the binding domain.
• the binding site is the same length as the binding domain.
• the binding site is within 1-10 residues longer or shorter than the binding domain (i.e., some of the residues of either the binding site or the binding domain are unhybridized).
• the binding site may be substantially shorter than the binding domain.
• complementarity refers to the percentage of nucleotide bases of a given sequence that pairs through hydrogen bonding with a reference sequence. In the absence of a given percentage of complementarity, the terms “complement” and “complementary” refer to 100% complementarity.
• a given sequence e.g., a binding domain sequence
• a reference sequence e.g., an endogenous pre-mRNA binding site
• a binding domain that is in an antisense orientation to a binding site is complementary to the binding site.
• RNA pairing includes G pairing with U (wobble base pairing); therefore, an RNA binding domain having G-U pairing with its binding site can be 100% complementary with the binding site. Accordingly, a binding domain that is exactly the reverse complement of its binding site (i.e., A's of the binding domain are paired with U’s of the binding site) can be modified to replace any one or more of the A's with G’s without substantially affecting binding.
• a given sequence e.g., a binding domain sequence
• a reference sequence e.g., an endogenous pre-mRNA binding site
• X% of the nucleotide bases of the given sequence pairs through hydrogen bonding with the reference sequence, e.g., hybridizing to form a double stranded sequence (e.g., through Watson-Crick base-pairing, e.g., A pairs with T or U, and C pairs with G).
• a binding domain sequence having a length of 150 bases is at least 90% complementary to a binding site having a length of 150 bases if at least 135 of its 150 residues pair through hydrogen bonding with the binding site through Watson-Crick base pairing, leaving 15 or fewer mismatched nucleotides.
• Binding between a binding domain and an intron, as used herein, refers to hydrogen bonding (e.g., double helix formation, or Watson Crick pairing) between the binding domain and the target intron in a degree sufficient to mediate trans-splicing by bringing the trans-splicing molecule into association with the target (e.g., pre-mRNA).
• the hydrogen bonds between the binding domain and the target intron are between nucleotide bases that are complementary to and in antisense orientation from one another (e.g., hybridized to one another).
• the sequence of a binding domain may be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% complementary to a target sequence of a target sequence (e.g., a pre-mRNA).
• a target sequence e.g., a pre-mRNA
• the sequence of a binding domain may be 100% complementary to a target sequence of a pre-mRNA transcript.
• the sequence of a binding domain may have 4 or fewer mismatches with respect to a target sequence of a pre-mRNA transcript. In some embodiments, the sequence of a binding domain may have 3 or fewer mismatches with respect to a target sequence of a pre-mRNA transcript. In some embodiments, the sequence of a binding domain may have 2 or fewer mismatches with respect to a target sequence of a pre-mRNA transcript. In some embodiments, the sequence of a binding domain may have 1 or fewer mismatches with respect to a target sequence of a pre-mRNA transcript. In some embodiments, the sequence of a binding domain may have no mismatches with respect to a target sequence of a pre-mRNA transcript.
• a binding domain may specifically hybridize to a target sequence of a pre-mRNA transcript.
• the binding domain may have 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% sequence complementarity to a target sequence of the pre-mRNA transcript.
• the hybridization may be under physiological hybridization conditions (in a cell in vitro or in vivo). In some embodiments, the hybridization may be under high stringent hybridization conditions.
• binding domains “specifically hybridize” to or are “specific” for a target sequence of a pre-mRNA.
• Such hybridization typically occurs with a Tm substantially greater than 37° C., more particularly, at least 50° C., and typically between 60° C. to approximately 90° C.
• Such hybridization more particularly corresponds to stringent hybridization conditions.
• the Tm is the temperature at which 50% of a target sequence hybridizes to a complementary oligonucleotide.
• an “artificial intron” refers to a noncoding nucleic acid sequence that links (directly or indirectly) a binding domain to a CDS.
• An artificial intron includes a splicing domain and may further include one or more spacer sequences and/or other regulatory elements.
• mutant may be used to refer to any aberrant nucleic acid sequence that causes a defective protein product (e.g., a non-functional protein product, a non- biolog ically active protein, a protein product having reduced function, a protein product having aberrant function, and/or a protein product that is produced in less than normal or greater than normal quantities). Mutations include base pair mutations (e.g., single nucleotide polymorphisms), missense mutations, frameshift mutations, deletions, insertions, and splice mutations.
• base pair mutations e.g., single nucleotide polymorphisms
• missense mutations e.g., single nucleotide polymorphisms
• frameshift mutations e.g., deletions, insertions, and splice mutations.
• a mutation refers to a nucleic acid sequence that is different in one or more portions of its sequence than a corresponding wildtype nucleic acid sequence or functional variant thereof. In some embodiments, a mutation refers to a nucleic acid sequence that encodes a protein having an amino acid sequence that is different from a corresponding wildtype protein or functional variant thereof.
• a “mutated exon” (e.g., a mutated ABCA4 exon) refers to an exon containing a mutation or an exon sequence that reflects a mutation in a different region, such as a cryptic exon resulting from a mutation in an intron.
• ABC4 ATP Binding Cassette Subfamily A Member 4
• ABCA4 also known as ARMD2, CORD3, ABCR, FFM, Retinal-specific phospholipidtransporting ATPase ABCA4, Stargardt Disease Protein, RIM ABC Transporter, RIM Proteinv, STGD1 , RP19, or STGD
• mammals such as primates (e.g., human, African green monkeys, and cynomolgus monkeys) and rodents (e.g., mice and rats), unless otherwise indicated, as well as functionally equivalent or improved variants (e.g., natural or synthetic variants), mutants, muteins, analogs, subunits, receptor complexes, isotypes, splice variants, and fragments thereof.
• ABCA4 encompasses full-length, unprocessed ABCA4, as well as any form of ABCA4 that results from native processing in the cell.
• An exemplary human ABCA4 sequence is provided as National Center for Biotechnology Information (NCBI) Reference Sequence: NG_009073.1 .
• the ABCA4 is encoded by a therapeutic gene having at least 95% sequence identity to SEQ ID NO: 11 (e.g., at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 11 , a functional portion thereof, and/or a codon-optimized variant thereof.
• a “variant” refers to a polynucleotide that differs in at least one nucleic acid residue from the reference polynucleotide sequence, such as a naturally occurring polynucleotide sequence, or a polypeptide (e.g., an AAV capsid sequence) that differs in at least one amino acid residue from the reference polypeptide sequence, such as a naturally occurring polypeptide sequence or, e.g., any of the rAAV sequences described herein.
• the difference in at least one residue may include, for example, a substitution of a nucleic acid residue to another nucleic acid, a deletion, or an insertion, or a substitution of an amino acid residue to another amino acid.
• a variant may be a homolog, isoform, or transcript variant of a polynucleotide as defined herein, wherein the homolog, isoform or transcript variant is characterized by a degree of identity or homology, respectively, as defined herein.
• a variant of a polynucleotide or polypeptide includes at least one nucleic acid substitution (e.g., 1-100 nucleic acid or amino acid substitutions, 1-50 nucleic acid or amino acid substitutions, 1-20 nucleic acid or amino acid substitutions, 1-10 nucleic acid or amino acid substitutions, e.g., 1 nucleic acid or amino acid substitution, 2 nucleic acid or amino acid substitutions, 3 nucleic acid or amino acid substitutions, 4 nucleic acid or amino acid substitutions, 5 nucleic acid or amino acid substitutions, 6 nucleic acid or amino acid substitutions, 7 nucleic acid or amino acid substitutions, 8 nucleic acid or amino acid substitutions, 9 nucleic acid or amino acid substitutions, or 10 nucleic acid or amino acid substitutions).
• nucleic acid substitution e.g., 1-100 nucleic acid or amino acid substitutions, 1-50 nucleic acid or amino acid substitutions, 1-20 nucleic acid or amino acid substitutions, 1-10 nucleic acid or amino acid
• Nucleic acid substitutions that result in the expressed polypeptide having an exchanged amino acid from the same class are referred to herein as conservative substitutions.
• these are amino acids having aliphatic side chains, positively or negatively charged side chains, aromatic groups in the side chains or amino acids, the side chains of which can form hydrogen bridges, e.g., side chains which have a hydroxyl function.
• an amino acid having a polar side chain may be replaced by another amino acid having a corresponding polar side chain, or, for example, an amino acid characterized by a hydrophobic side chain may be substituted by another amino acid having a corresponding hydrophobic side chain (e.g., serine (threonine) by threonine (serine) or leucine (isoleucine) by isoleucine (leucine)).
• an amino acid having a polar side chain may be replaced by another amino acid having a corresponding polar side chain, or, for example, an amino acid characterized by a hydrophobic side chain may be substituted by another amino acid having a corresponding hydrophobic side chain (e.g., serine (threonine) by threonine (serine) or leucine (isoleucine) by isoleucine (leucine)).
• insertions, deletions, and/or non-conservative substitutions are also encompassed by the term variant, e.g., at those positions that do not cause a substantial modification of the three-dimensional structure of the protein. Modifications to a three-dimensional structure by insertion(s) or deletion(s) can readily be determined by a person of skill in the art, e.g., using CD spectra (circular dichroism spectra).
• sequence homology refers to the degree of identity between sequences of two nucleic acid sequences.
• the homology of sequences is determined by comparing two sequences aligned under standard conditions over the sequence length to be compared.
• the sequences to be compared herein may have an addition or deletion (for example, gap and the like) in the optimum alignment of the two sequences.
• sequence homology is calculated by creating an alignment using, for example, the ClustalW algorithm (Nucleic Acid Res., 1994, 22(22): 4673 4680).
• Commonly available sequence analysis software such as, Vector NTI, GENETYX, BLAST, or analysis tools provided by public databases may also be used.
• AAV or “AAV serotype” as used herein refers to the dozens of naturally occurring and available adeno-associated viruses, as well as artificial AAVs.
• human AAV2 is the first AAV that was developed as a gene transfer vector; it has been widely used for efficient gene transfer experiments in different target tissues and animal models.
• the term variant means any AAV sequence which is derived from a known AAV sequence, including those sharing at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% or greater sequence identity over the amino acid or nucleic acid sequence.
• the AAV capsid includes variants which may include up to about 10% variation from any described or known AAV capsid sequence. That is, the AAV capsid shares about 90% identity to about 99.9% identity, about 95% to about 99% identity or about 97% to about 98% identity to an AAV capsid provided herein and/or known in the art.
• the AAV capsid shares at least 95% identity with an AAV capsid.
• the comparison may be made over any of the variable proteins (e.g., vp1 , vp2, or vp3).
• the ITRs or other AAV components may be readily isolated or engineered using techniques available to those of skill in the art from an AAV.
• AAV may be isolated, engineered, or obtained from academic, commercial, or public sources (e.g., the American Type Culture Collection, Manassas, Va.).
• the AAV sequences may be engineered through synthetic or other suitable means by reference to published sequences such as are available in the literature or in databases such as, e.g., GenBank, PubMed, or the like.
• AAV viruses may be engineered by conventional molecular biology techniques, making it possible to optimize these particles for cell specific delivery of nucleic acid sequences, for minimizing immunogenicity, for tuning stability and particle lifetime, for efficient degradation, for accurate delivery to the nucleus, etc.
• the term “subject,” “individual,” or “patient” includes any mammal in need of these methods of treatment or prophylaxis, including primates, such as humans. Other mammals in need of such treatment or prophylaxis include non-human primates (NHP; e.g., cynomolgus monkeys and African green monkeys), dogs, cats, or other domesticated animals, horses, livestock, laboratory animals (e.g., mice, rats, or rabbits), etc.
• the individual may be male or female.
• the individual has a disease or disorder caused by a mutation in the ABCA4 gene (e.g., an ABCA4-associated retinal dystrophy).
• the individual is at risk for developing a disease or disorder caused by a mutation in the ABCA4 gene.
• the individual has shown clinical signs of a disease or disorder caused by a mutation in the ABCA4 gene, such as an ABCA4-associated retinal dystrophy.
• the individual may be any age during which treatment or prophylactic therapy may be beneficial.
• the individual is 0-5 years of age, 5-10 years of age, 10-20 years of age, 20-30 years of age, 30-50 years of age, 50-70 years of age, or more than 70 years of age.
• the individual is 12 months of age or older, 18 months of age or older, 2 years of age or older, 3 years of age or older, 4 years of age or older, 5 years of age or older, 6 years of age or older, 7 years of age or older, 8 years of age or older, 9 years of age or older, or 10 years of age or older.
• the individual has viable retinal cells (e.g., viable retinal cells sufficient to maintain partial visual function or full visual function).
• disorder associated with a mutation or “mutation associated with a disorder” refer to a correlation between a disorder and a mutation.
• a disorder associated with a mutation is known or suspected to be wholly or partially, or directly or indirectly, caused by the mutation.
• an individual having the mutation may be at risk of developing the disorder, and the risk may additionally depend on other factors, such as other (e.g., independent) mutations (e.g., in the same or a different gene), or environmental factors.
• the term “treatment,” or a grammatical derivation thereof, is defined as reducing the progression of a disease, reducing the severity of a disease symptom, retarding progression of a disease symptom, removing a disease symptom, or delaying onset of a disease.
• the term “treatment” is used to refer to a persistent or durable effect of a therapeutic agent such as an RNA exon editor described herein. Evidence demonstrating the durable therapeutic effects of RNA exon editor described herein are presented in, for example, FIGs. 22 and 31 .
• the effect of a treatment provided herein persists for at least 1 , 2, 3, 4, 5, 6 or more months.
• the nucleic acid trans-splicing molecules are administered only once over the course of a lifetime.
• prevention of a disorder is defined as reducing the risk of onset of a disease, e.g., as a prophylactic therapy for an individual who is at risk for developing a disorder associated with a mutation.
• An individual can be characterized as “at risk” for developing a disorder by identifying a mutation associated with the disorder, according to any suitable method known in the art or described herein.
• an individual who is at risk for developing a disorder has one or more ABCA4 mutations associated with the disorder.
• an individual can be characterized as “at risk” for developing a disorder if the individual has a family history of the disorder.
• ABC4-related retinopathies comprises diseases/conditions associated with mutations in ABCA4, which comprises, for example, Stargardt Disease-1 (STGD1); Fundus flavimaculatus, Retinitis Pigmentosa-19 (RP19); Cone-Rod Dystrophy-3 (CORD3); and Age-Related Macular Degeneration-2 (ARMD2).
• STGD1 Stargardt Disease-1
• RP19 Fundus flavimaculatus, Retinitis Pigmentosa-19
• CORD3 Cone-Rod Dystrophy-3
• ARMD2 Age-Related Macular Degeneration-2
• Treating or preventing a disorder in an individual can be performed by directly administering the trans-splicing molecule or RNA exon editor (e.g., within a vector, e.g., an AAV vector or AAV particle) to the individual.
• RNA exon editor e.g., within a vector, e.g., an AAV vector or AAV particle
• host cells containing the trans-splicing molecule may be administered to the individual.
• administering refers to delivering a trans-splicing molecule or RNA exon editor (e.g., within a vector, e.g., an AAV vector or AAV particle) or a composition thereof, or an ex v/vo-treated cell, to the individual in need thereof, e.g., an individual having a mutation or defect in ABCA4.
• a trans-splicing molecule or RNA exon editor e.g., within a vector, e.g., an AAV vector or AAV particle
• composition thereof e.g., an ex v/vo-treated cell
• the method involves delivering a trans-splicing molecule or RNA exon editor (e.g., within a vector, e.g., an AAV vector or AAV particle) or a composition thereof to the individual by subretinal injection.
• a trans-splicing molecule or RNA exon editor e.g., within a vector, e.g., an AAV vector or AAV particle
• intravitreal injection or injection via the palpebral vein may be performed as administration.
• the composition is administered systemically (e.g., intravenously). Still other methods of administration may be selected by one of skill in the art, in view of this disclosure.
• modulating expression of ABCA4 refers to decreasing the expression of endogenous mutated (non-functional) ABCA4 and/or increasing the expression of transspliced ABCA4.
• Modulating expression of ABCA4 may be used to refer, e.g., to decreasing the expression of endogenous (e.g., mutated) ABCA4 and/or increasing the expression of trans-spliced ABCA4 (e.g., ABCA4 transcript or protein product that has a trans-splicing molecule-mediated corrected mutation site relative to its endogenous mutated transcript or protein product.
• trans-spliced ABCA4 e.g., ABCA4 transcript or protein product that has a trans-splicing molecule-mediated corrected mutation site relative to its endogenous mutated transcript or protein product.
• cogniation optimization refers to modifying a nucleic acid sequence to change individual nucleic acids without any resulting change in the encoded amino acid. Sequences modified in this way are referred to herein as “codon-optimized.” This process may be performed on any of the sequences described in this specification to enhance expression or stability. Codon optimization may be performed in a manner such as that described in, e.g., U.S. Patent Nos. 7,561 ,972, 7,561 ,973, and 7,888,112, each of which is incorporated herein by reference in its entirety. The sequence surrounding the translational start site can be converted to a consensus Kozak sequence according to known methods. See, e.g., Kozak et al, 1987. Nucleic Acids Res. 15 (20): 8125-8148, which is incorporated herein by reference in its entirety.
• a pharmaceutically acceptable composition is approved by a regulatory agency of the Federal or a state government or listed in the U. S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
• carrier refers to a diluent, adjuvant, excipient, or vehicle with which a therapeutic molecule (e.g., a trans-splicing molecule or a trans-splicing molecule including a vector or cell of the present invention) is administered.
• a therapeutic molecule e.g., a trans-splicing molecule or a trans-splicing molecule including a vector or cell of the present invention.
• suitable pharmaceutical carriers are described in “Remington's Pharmaceutical Sciences,” Mack Publishing Co., Easton, PA., 18th edition.
• a and “an” mean “one or more of.”
• a gene is understood to represent one or more such genes.
• the terms “a” and “an,” “one or more of a (or an),” and “at least one of a (or an)” are used interchangeably herein.
• the left-hand end of single-stranded nucleic acid e.g., pre-mRNA transcript, oligonucleotide, etc.
• sequences is the 5' end and the left-hand direction of single or double-stranded nucleic acid sequences is referred to as the 5' direction.
• the righthand end or direction of a nucleic acid sequence is the 3' end or direction.
• upstream a region or sequence that is 5' to a reference point in a nucleic acid
• downstream a region or sequence that is 3' to a reference point in a nucleic acid
• downstream a region or sequence that is 3' to a reference point in a nucleic acid
• Exon Editor design and discovery employs a combined approach that includes Next Generation Sequencing (NGS)-based screening of Exon Editor libraries followed by computational analysis, as well as transfection of individual Exon Editors followed by RT-qPCR analysis to assess RNA replacement efficiency and Western blot analysis to assess protein rescue.
• NGS Next Generation Sequencing
• the former approach utilizes rational design and cumulative knowledge gained from past screens along with the power of multi-parallelized throughput, and the latter approach is used to both test new hypotheses and validate conclusions resulting from the NGS-based method.
• nucleic acid trans-splicing molecules useful for correcting mutations in ABCA4 by replacing at least one mutated ABCA4 exon with a functional ABCA4 exon (e.g., a ABCA4 exon 5’ to the binding site, e.g., exons 1-22 of ABCA4).
• the nucleic acid trans-splicing molecule is a pre-RNA trans-splicing molecule (RTM).
• RTM pre-RNA trans-splicing molecule
• the design of the trans-splicing molecule permits replacement of the defective or mutated portion of the pre-mRNA exon(s) with a nucleic acid sequence, e.g., the exon(s) having a functional (e.g., normal) sequence without the mutation.
• the functional sequence can be a wildtype, naturally occurring sequence or a corrected sequence with some other modification, e.g., codon optimization.
• Trans-splicing molecules comprise a binding domain, a splicing domain, and a CDS.
• the nucleic acid trans-splicing molecule has a 5’ regulatory domain having a native 5’ ABCA4 untranslated region (e.g., a sequence having at least 80% sequence identity with any one of SEQ ID NOS: 12-15).
• the nucleic acid trans-splicing molecule has a splice site of GUAAGT or GTAAGT.
• the nucleic acid trans-splicing molecule has a linker domain that is longer than 25 nucleotides in length.
• the nucleic acid trans-splicing molecule has a linker domain comprising, consisting essentially of, or consisting of SEQ ID NO: 27 or a sequence having at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, or at least 99% identity to SEQ ID NO: 27.
• a trans-splicing molecule described herein includes, operatively linked in a 5’ to 3’ direction: a 5’ untranslated region, a coding domain sequence (e.g., a CDS, e.g., a sequence encoding a functional sequence of ABCA4 exons, e.g., a functional sequence of ABCA4 exons 5’ to the binding site), a splicing domain (e.g., a splice site), a linker domain, a binding domain, a 3’ downstream region, and a terminator domain.
• a coding domain sequence e.g., a CDS, e.g., a sequence encoding a functional sequence of ABCA4 exons, e.g., a functional sequence of ABCA4 exons 5’ to the binding site
• a splicing domain e.g., a splice site
• linker domain e.g., a binding domain, a
• nucleic acid trans-splicing molecules described herein are configured to correct at least one mutation (e.g., two different mutations, wherein each mutation is present on a different allele of the ABCA4 gene in a subject) located in a 5’ region of the ABCA4 gene (e.g., a region 5’ to intron 22) by binding to target intron 22 and mediating trans-splicing of a CDS having a functional sequence of 5’ ABCA4 exons to an endogenous ABCA4 exon 3’ to the target intron.
• at least one mutation e.g., two different mutations, wherein each mutation is present on a different allele of the ABCA4 gene in a subject
• a 5’ region of the ABCA4 gene e.g., a region 5’ to intron 22
• Such trans-splicing thereby repairs the defective ABCA4 gene in the target cell of an individual by replacing the defective exon/s and removing the defective portion of the target pre-mRNA, yielding a functional ABCA4 mRNA capable of transcribing a functional ABCA4 protein in the cell.
• the trans-splicing molecule is up to 5,000 nucleotide bases in length, e.g., up to 4,900 nucleotide bases in length, up to 4,800 nucleotide bases in length, or up to 4,700 nucleotide bases in length (e.g., from 3,000 to 4,000 nucleotide bases in length, from 3,100 to 3,800 nucleotide bases in length, from 3,200 to 3,700 nucleotide bases in length, or from 3,300 to 3,500 nucleotide bases in length, e.g., from 3,000 to 3,100 nucleotide bases in length, from 3,100 to 3,200 nucleotide bases in length, from 3,200 to 3,300 nucleotide bases in length, from 3,300 to 3,400 nucleotide bases in length, from 3,400 to 3,500 nucleotide bases in length, from 3,500 to 3,600 nucleotide bases in length, from 3,600 to 3,700 nucleotide bases in length, from
• trans-splicing molecules configured for packaging within an AAV vector (e.g., as a trans-splicing molecule-encoding sequence) may not span all mutations in a ABCA4 gene that may be associated with a disorder and therefore, may not correct mutations along the length of the entire ABCA4 gene. Accordingly, the trans-splicing molecules described herein can be adapted as part of methods described below to correct multiple mutations spanning the entire length of the ABCA4 gene.
• An ABCA4 gene targeted by a trans-splicing molecule described herein can contain one or multiple mutations that are associated with ABCA4-associated retinal dystrophies (e.g., cause, or are correlated with) a disease, such as Stargardt Disease or cone-rod dystrophy.
• An exemplary human ABCA4 sequence is provided as National Center for Biotechnology Information (NCBI) Reference Sequence: NG_009073.
• NCBI National Center for Biotechnology Information
• NG_009073 National Center for Biotechnology Information
• all corrections later obtained or naturally occurring conservative and non-disease-causing variant sequences that occur in the human or other mammalian population are also included. Additional conservative nucleotide replacements or those causing codon optimizations are also included.
• the sequences as provided by the database accession numbers may also be used to search for homologous sequences in the same or another mammalian organism.
• ABCA4 nucleic acid sequences and resulting proteins expressed may tolerate certain minor modifications at the nucleic acid level to include, for example, modifications to the nucleotide bases which are silent, e.g., preference codons.
• nucleic acid base modifications which change the amino acids, e.g., to improve expression of the resulting peptide/protein (for example, codon optimization) are envisioned.
• modification of allelic variations caused by the natural degeneracy of the genetic code are envisioned.
• modifications of ABCA4 genes are analogs, or modified versions of the encoded amino acid sequences. Typically, such analogs differ from the specifically identified proteins by only one to four codon changes. Conservative replacements are those that take place within a family of amino acids that are related in their side chains and chemical properties.
• the nucleic acid sequence of a functional ABCA4 gene may be derived from any mammal which natively expresses functional ABCA4 or a homolog thereof.
• certain modifications are made to the ABCA4 gene sequence in order to enhance expression in the target cell. Such modifications include codon optimization.
• ABCA4 retinopathies are caused by pathogenic variants in the ABCA4 gene, which are inherited in an autosomal recessive manner.
• pathogenic variants include missense, nonsense, splicing, structural, and deep intronic variants. Missense variants account for most variants associated with ABCA4 retinopathies.
• the individual having an ABCA4 retinopathy the individual has a mutation in ABCA4 on each allele.
• Compositions comprising trans-splicing molecules can correct the mutations on both alleles, regardless of the location of the mutation within the ABCA4 gene.
• a single 5’ trans-splicing molecule (5’ RNA editing molecule) encoding exons 1-22 may be used to replace the mutated ABCA4 exon 2 and the mutated ABCA4 exon 9. See, e.g., FIG. 14A.
• a single trans-splicing molecule having a coding region containing a functional ABCA4 exon/s can replace the one or more exons containing the mutations.
• an individual has ABCA4 mutations that involve mutations at distant exons within the ABCA4 gene.
• two RNA editing molecules may be used in conjunction (e.g., in a composition) to replace each of the mutated exons.
• Such an approach would involve use of a 5’ trans-splicing molecule to replace the mutated ABCA4 exon 2 and a 3’ trans-splicing molecule to replace the mutated ABCA4 exon 49.
• the two trans-splicing molecules can be co-delivered as part of the same AAV vector or delivered in separate AAV vectors (e.g., in the case in which both trans-splicing molecules exceed the packaging limit of AAV).
• the CDS of a 5’ trans-splicing molecule includes all ABCA4 exons (e.g., functional ABCA4 exons) that are 5’ to the target ABCA4 intron (e.g., ABCA4 intron 22).
• the CDS may include functional ABCA4 exons 1-22.
• the CDS may be from 2,000 to 4,500 bp in length.
• both allelic mutations occur in the 5’ portion of the target gene, and a 5’ trans-splicing molecule is selected to correct both mutations.
• the binding domain binds to intron 22, and the CDS includes functional ABCA4 exons 1-22.
• a CDS- (e.g., of a transgene encoding an RTM) includes cDNA of ABCA4 exons (e.g., functional ABCA4 exons) for replacement of mutated ABCA4 exon/s.
• ABCA4 exons e.g., functional ABCA4 exons
• one or more functional ABCA4 exons within the CDS can be a cDNA sequence.
• the entire CDS is a cDNA sequence.
• all or a portion of the CDS, or one or more functional ABCA4 exons thereof can be a naturally occurring sequence (e.g., a sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with an endogenous ABCA4 exon).
• all or a portion of the CDS, or one or more functional ABCA4 exons thereof is a codon-optimized sequence in which a nucleic acid sequence has been modified, e.g., to enhance expression or stability, without resulting in a change in the encoded amino acid.
• Codon optimization may be performed in a manner such as that described in, e.g., U.S. Patent Nos. 7,561 ,972, 7,561 ,973, and 7,888,112, each of which is incorporated herein by reference in its entirety.
• the CDS can be a nucleic acid sequence of up to 4,000 nucleotide bases in length (e.g., from 3,000 to 4,000 nucleotide bases in length, from 3,100 to 3,800 nucleotide bases in length, from 3,200 to 3,700 nucleotide bases in length, or from 3,300 to 3,500 nucleotide bases in length, e.g., from 3,000 to 3,100 nucleotide bases in length, from 3,100 to 3,200 nucleotide bases in length, from 3,200 to 3,300 nucleotide bases in length, from 3,300 to 3,400 nucleotide bases in length, from 3,400 to 3,500 nucleotide bases in length, from 3,500 to 3,600 nucleotide bases in length, from 3,600 to 3,700 nucleotide bases in length, from 3,700 to 3,800 nucleotide bases in length, from 3,800 to 3,900 nucleotide bases in length,
• all or a portion of the CDS, or one or more functional ABCA4 exons thereof, is modified to mutate cryptic splice sites identified therein.
• the present inventors discovered through extensive experimental and computational analyses of results that cryptic splice sites are utilized in the context of some embodiments of the ABCA4 exon editors described herein. In short, the present inventors performed extensive experimentation and analyses, including the generation of an off-target (OFT) library and bioinformatic analyses thereof, and surprisingly discovered numerous locations within the ABCA4 coding sequence (CDS) comprising exons 1-22 wherein cryptic splicing occurs in the context of trans-splicing molecules described herein.
• OFT off-target
• RNA exon editors also referred to herein as RNA trans-splicing molecules or nucleic acid trans-splicing molecules
• RNA exon editors can undergo splicing at cryptic splice sites which can lead to unwanted species of splicing variants having potential downstream effects.
• sequences of a plurality of the cryptic splice sites were modified to impair and/or disable the cryptic splice sites by introduction of synonymous mutations.
• cryptic splice sites that were modified were identified based on the number of times the cryptic splice site was utilized as detected by bioinformatic analyses of the OFT library.
• the cryptic splice sites modified accounted for a plurality of cryptic splice site events. Such an approach takes advantage of the degeneracy of the genetic code, which permits introduction of the desired modifications to mitigate cryptic splice site use without resulting in a change in the encoded amino acid. See, e.g, Table 6 and FIG. 26.
• NGS Next Generation Sequencing
• results and bioinformatic analyses thereof establish a prioritized list of cryptic splice sites in ABCA4 exons 1-22 that may be modified to generate an ABCA4 CDS having improved properties and functionality in the context of a trans-splicing molecule.
• the present inventors established a frequency of use threshold above which analysis and design for cryptic splice site mitigation may advantageously be implemented where possible via introduction of synonymous mutations. See Table 6.
• the threshold based on results presented in Table 3 is equal to or greater than 10 CPMs.
• an RNA exon editor molecule e.g., an ABCA4 exon editor
• an ABCA4 exon editor has a nucleotide change at one or more of the following positions (numbering according to, e.g., SEQ ID NO: 56), wherein the nucleotide positions indicated below refer to the 5’ and 3’ ends of the cryptic splice site nucleotide sequence mitigated relative to the G of the ATG codon (the translational initiation site), or any combination thereof.
• the nucleotide change made is underlined in the sequences listed below. See also Table 3:
• nucleotide change indicated below is a result of changes made in the context of position 3086 (proximal to position 3083) and did not correct a splice site, polypyrimidine tract, and/or branchpoint for the 3083 position]: AGCACATGCTGTTCTATGCC (SEQ ID NO: 107)
• nucleotide change indicated below is a result of changes made in the context of position 3086 (proximal to position 3103) and did not correct a splice site, polypyrimidine tract, and/or branchpoint for the 3103 position]: CAGCTGAAAGGAAAGTCCCA (SEQ ID NO: 113) CAACTGAAAGGAAAGTCCCA (SEQ ID NO: 114)
• Sequence spanning nucleotide positions 3073-3093 [the nucleotide change indicated below is a result of changes made in the context of position 3086 (proximal to position 3093) and did not correct a splice site, polypyrimidine tract, and/or branchpoint for the 3093 position]: GTTCTATGCCCAGCTGAAAG (SEQ ID NO: 115) GTTCTATGCACAACTGAAAG (SEQ ID NO: 116) Sequence spanning nucleotide positions 681-701 (splice site corrected): CCCTGTGCTCCCTCTCCCAG (SEQ ID NO: 117) CCCTGTGCTCCCTCTCCCAA (SEQ ID NO: 118) Sequence spanning nucleotide positions 508-528: CATCGGCCTGTCTGACTCAG (SEQ ID NO: 119) CATCGGCCTGTCTGACTCTG (SEQ ID NO: 120)
• AGCGGAATGAAGAGGCTCAG (SEQ ID NO: 125) AGCGGAATGAAGAGGCTCAG (SEQ ID NO: 125) Sequence spanning nucleotide positions 2234-2254 (splice site corrected): ATGCTGTGCTTTCTGCTCAG (SEQ ID NO: 126) ATGCTGTGCTTTCTGCTCTC (SEQ ID NO: 127)
• the ABCA4 exon editor has one or more of the nucleotide changes at the above positions. See also Table 3.
• the ABCA4 exon editor has a CDS sequence having at least 80, 85, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, or 99.9% sequence identity or having 100% sequence identity to any one of the sequences set forth SEQ ID NOs: 56-59.
• the ABCA4 exon editor has a cryptic splice sitemitigating nucleotide change at one or more of the above positions (numbering according to, e.g., SEQ ID NO: 56) and has a CDS sequence having at least 80, 85, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, or 99.9% sequence identity or having 100% sequence identity to any one of the sequences set forth SEQ ID NOs: 56-58.
• the ABCA4 exon editor has a cryptic splice sitemitigating nucleotide change at one or more of the above positions (numbering according to, e.g., SEQ ID NO: 56) and has a CDS sequence having at least 80, 85, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, or 99.9% sequence identity or having 100% sequence identity to the sequence set forth SEQ ID NO: 56.
• an ABCA4 exon editor has cryptic splice site-mitigating nucleotide changes at least one of 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, or 45 of the positions set forth in Table 3.
• an ABCA4 exon editor has cryptic splice site-mitigating nucleotide changes at at least one of 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the positions set forth in Table 3 that have a frequency of splice site usage of at least 10 counts per million (also referred to herein as CPMs), with the exception of those sites listed in Table 3 that do not include a splice site (e.g., positions 3083, 3103, or 3093).
• the ABCA4 exon editor molecule has a cryptic splice site-mitigating nucleotide change at 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 or all cryptic splice sites having a frequency of usage of at least 10 cpms [with the exception of those sites listed in Table 3 that do not include a splice site (e.g., positions 3083, 3103, or 3093)], as measured by an assay described in Example 7 below.
• an ABCA4 exon editor has cryptic splice site-mitigating nucleotide changes at at least one of 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the positions set forth in Table 3 that have a frequency of splice site usage of at least 5 counts per million (also referred to herein as CPMs), with the exception of those sites listed in Table 3 that do not include a splice site (e.g., positions 3083, 3103, or 3093).
• the ABCA4 exon editor molecule has a cryptic splice site-mitigating nucleotide change at 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 or all cryptic splice sites having a frequency of usage of at least 5 cpms [with the exception of those sites listed in Table 3 that do not include a splice site (e.g., positions 3083, 3103, or 3093)], as measured by an assay described in Example 7 below.
• an ABCA4 exon editor has cryptic splice site-mitigating nucleotide changes at at least one of 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the positions set forth in Table 3 that have a frequency of splice site usage of at least 3 counts per million (also referred to herein as CPMs), with the exception of those sites listed in Table 3 that do not include a splice site (e.g., positions 3083, 3103, or 3093).
• the ABCA4 exon editor molecule has a cryptic splice site-mitigating nucleotide change at 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 or all cryptic splice sites having a frequency of usage of at least 3 cpms [with the exception of those sites listed in Table 3 that do not include a splice site (e.g., positions 3083, 3103, or 3093)], as measured by an assay described in Example 7 below.
• an ABCA4 exon editor has cryptic splice site-mitigating nucleotide changes at at least one of 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the positions set forth in Table 3 that have a frequency of splice site usage of at least 2 counts per million (also referred to herein as CPMs), with the exception of those sites listed in Table 3 that do not include a splice site (e.g., positions 3083, 3103, or 3093).
• the ABCA4 exon editor molecule has a cryptic splice site-mitigating nucleotide change at 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 or all cryptic splice sites having a frequency of usage of at least 2 cpms [with the exception of those sites listed in Table 3 that do not include a splice site (e.g., positions 3083, 3103, or 3093)], as measured by an assay described in Example 7 below.
• an ABCA4 exon editor has cryptic splice site-mitigating nucleotide changes at at least one of 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the positions set forth in Table 3 that have a frequency of splice site usage of at least 1 count per million (also referred to herein as CPMs), with the exception of those sites listed in Table 3 that do not include a splice site (e.g., positions 3083, 3103, or 3093).
• the ABCA4 exon editor molecule has a cryptic splice site-mitigating nucleotide change at 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 or all cryptic splice sites having a frequency of usage of at least 1 cpms [with the exception of those sites listed in Table 3 that do not include a splice site (e.g., positions 3083, 3103, or 3093)], as measured by an assay described in Example 7 below.
• a cryptic splice site identified in the context of an RNA exon editor typically comprises a splice site, a polypyrimidine tract, and a branchpoint.
• one or more nucleotide changes may be introduced into at least one of a splice site, a polypyrimidine tract, or a branchpoint, or any combination thereof of a cryptic splice site identified in the context of an RNA exon editor.
• the nucleotide change is determined so as to minimize the potential impact on a protein encoded thereby.
• a person of skill in the art would appreciate that if a nucleotide change made to reduce the frequency of cryptic splice site usage also altered the amino acid encoded by a trans-spliced RNA, conservative amino acid changes would be preferred over non-conservative amino acid changes.
• a skilled person could readily analyze the protein sequence and structure with an eye toward functional domains and significant sequences therein to evaluate whether such changes could reasonably be expected to alter function of a protein encoded by a trans-spliced protein.
• a skilled person could also test a protein comprising such an amino acid change to determine if biological activity is altered using assays known in the art.
• more than one nucleotide is changed within a cryptic splice site identified. Under some circumstances, a determination of how many nucleotides should be changed is made empirically based on in silico predictions and/or experimental results.
• one or more (also referred to herein as at least one) synonymous mutations may be introduced into at least one of a splice site, a polypyrimidine tract, or a branchpoint, or any combination thereof of a cryptic splice site identified in the context of an RNA exon editor. Synonymous mutations do not alter the amino acid sequence of a protein encoded by a trans-spliced RNA. In some embodiments, more than one synonymous mutation may be introduced into at least one of a splice site, a polypyrimidine tract, or a branchpoint, or any combination thereof of a cryptic splice site identified in the context of an RNA exon editor.
• any such branch point sequences identified were then analyzed and considered for introduction of a nucleotide mutation/s to reduce cryptic splice site usage at the experimentally identified cryptic splice site.
• the sequences were also scanned for the presence of polypyrimidine tracts (multiple Ys immediately upstream of the terminal AG). Typically, such polypyrimidine tracts comprise at least 5 pyrimidines within 10 base pairs upstream of the splice site. Once identified, such polypyrimidine tracts were then analyzed and considered for introduction of a nucleotide mutation/s to reduce cryptic splice site usage at the experimentally identified cryptic splice site.
• the cryptic splice site, or off-target splice site, that is changed to mitigate off-target splicing is a site that has been identified empirically as a site of off-target splicing. Such sites can be identified, for example, using techniques described in Examples 6 and 7 below. In some embodiments, all cryptic splice sites that have a frequency of usage above a predetermined threshold are changed by cryptic splice site-mitigating nucleotide changes.
• the cryptic splice site, or off-target splice site, that is changed to mitigate off-target splicing is a site that has been predicted to be a site of off-target splicing. Such predictions can be made based on sequence analysis to identify a canonical splice site, polypyrimidine tract, and/or branchpoint of a putative cryptic splice site therein. Cryptic splice sites outnumber authentic splice sites in the human genome by an order of magnitude and may have the same splicing recognition sequences as authentic splice sites but are normally repressed by thus far poorly understood molecular mechanisms.
• Cryptic 5' splice sites frequently have a consensus NNN/GUNNNN or NNN/GCNNNN where N is any nucleotide and 7” is the exon-intron boundary.
• Cryptic 3' splice sites frequently have a consensus NAG/N.
• Cryptic splice site activation is positively influenced by surrounding nucleotides that may serve to make cryptic splice sites appear more like those of a typical consensus of authentic splice sites, namely MAG/GURAGU and YAG/G, respectively, where M is C or A, R is G or A, and Y is C or U.
• a cryptic splice site-mitigating nucleotide change causes a nucleotide sequence that matches a canonical splice site consensus sequence to no longer match the canonical sequence.
• a cryptic splice site-mitigating nucleotide change eliminates a potential splice site nucleotide.
• a cryptic splice site-mitigating nucleotide change eliminates a potential polypyrimidine tract nucleotide.
• a cryptic splice site-mitigating nucleotide change eliminates a potential branch point nucleotide.
• a cryptic splice site-mitigating nucleotide change is a synonymous nucleotide change. In some embodiments, a cryptic splice site-mitigating nucleotide change causes a change in an amino acid encoded by the exon editor. In some embodiments, the amino acid change is a conservative amino acid substitution.
• an RNA molecule comprising, in a 5’ to 3’ direction: (a) a cDNA coding domain sequence; (b) a splice donor sequence; and (c) a binding domain sequence configured to bind to an intron of an endogenous RNA molecule; wherein the coding domain sequence comprises a nucleotide mutation relative to the endogenous RNA molecule sequence, wherein the nucleotide mutation disrupts a cryptic splice site within the coding domain sequence.
• the nucleotide mutation is a synonymous nucleotide mutation.
• the cryptic splice site is identified experimentally. In some embodiments, the cryptic splice site is predicted based on in silico analysis.
• RNA molecule in a cell comprising providing to the cell an exogenous RNA molecule comprising, in a 5’ to 3’ direction: (a) a cDNA coding domain sequence comprising a nucleotide mutation that differs from that of an endogenous target RNA molecule in the cell; (b) a splice donor sequence configured to splice to a splice acceptor sequence of the endogenous target RNA molecule; and (c) a binding domain sequence configured to bind to an intron of the endogenous target RNA molecule; wherein the nucleotide mutation disrupts a cryptic splice site within the coding domain sequence of the exogenous RNA molecule.
• the nucleotide mutation is a synonymous nucleotide mutation.
• the cryptic splice site is identified experimentally. In some embodiments, the cryptic splice site is predicted based on in silico analysis.
• RNA exon editor also encompassed herein is a method of increasing trans-splicing efficiency of an RNA exon editor comprising introducing a mutation into a coding domain sequence of the RNA exon editor, wherein the mutation disrupts a cryptic splice site in the coding domain sequence of the RNA exon editor.
• the nucleotide mutation is a synonymous nucleotide mutation. See, e.g., Table 6.
• the cryptic splice site is identified experimentally.
• the cryptic splice site is predicted based on in silico analysis.
• ABCA4 trans-splicing molecules described herein feature a binding domain (BD) configured to bind/anneal a target ABCA4 intron and/or exon.
• the target ABCA4 intron is ABCA4 intron 22.
• the binding domain is a nucleic acid sequence that is at least 80% complementary to (e.g., at least 85% complementary to, at least 90% complementary to, at least 91% complementary to, at least 92% complementary to, at least 93% complementary to, at least 94% complementary to, at least 95% complementary to, at least 96% complementary to, at least 97% complementary to, at least 98% complementary to, at least 99% complementary to, or 100% complementary to) a sequence of the target ABCA4 intron pre-mRNA (e.g., a target ABCA4 intron), which may suppress endogenous target cis-splicing while enhancing trans-splicing between the trans- splicing molecule and the target ABCA4 pre-mRNA (e.g., by creating a chimeric molecule having a portion of endogenous ABCA4 mRNA and a coding domain sequence having one or more functional ABCA4 exons that encode wildtype ABCA4 amino acid sequences).
• a target ABCA4 intron pre-mRNA e.
• the binding domain-encoding sequence encodes a nucleic acid sequence that is at least 80% complementary to (e.g., at least 85% complementary to, at least 86% complementary to, at least 87% complementary to, at least 88% complementary to, at least 89% complementary to, at least 90% complementary to, at least 91% complementary to, at least 92% complementary to, at least 93% complementary to, at least 94% complementary to, at least 95% complementary to, at least 96% complementary to, at least 97% complementary to, at least 98% complementary to, at least 99% complementary to, or 100% complementary to) a sequence of the target ABCA4 intron pre-mRNA.
• the present invention provides trans-splicing molecules (or vectors thereof) that bind ABCA4 at intron 22, e.g., wherein the nucleic acid trans-splicing molecule is configured to trans-splice a CDS to endogenous ABCA4 exon 23.
• trans-splicing molecules described herein include those in which the binding domain binds a binding site having any one or more (e.g., six or more, eight or more, ten or more, or twelve or more) of nucleotides 1 to 510 or 880 to 1 ,350 of SEQ ID NO: 16.
• the binding domain includes any six or more consecutive nucleotides within nucleotides 1 to 510 or 880 to 1,350 of ABCA4 intron 22 (e.g., any eight or more consecutive nucleic acids within nucleotides 1 to 510 or 880 to 1,350 of ABCA4 intron 22, any ten or more consecutive nucleic acids within nucleotides 1 to 510 or 880 to 1,350 of ABCA4 intron 22, any 12 or more consecutive nucleic acids within nucleotides 1 to 510 or 880 to 1,350 of ABCA4 intron 22, any 20 or more consecutive nucleic acids within nucleotides 1 to 510 or 880 to 1,350 of ABCA4 intron 22, any 30 or more consecutive nucleic acids within nucleotides 1 to 510 or 880 to 1,350 of ABCA4 intron 22, any 40 or more consecutive nucleic acids within nucleotides 1 to 510 or 880 to 1,350 of ABCA4 intron 22, any 50 or more consecutive nucleic acids within nucleotides within nucle
• the binding site includes any six or more consecutive nucleotides within nucleotides 880 to 1,350 of ABCA4 intron 22 (e.g., any eight or more consecutive nucleic acids within nucleotides 880 to 1 ,350 of ABCA4 intron 22, any ten or more consecutive nucleic acids within nucleotides 880 to 1,350 of ABCA4 intron 22, any 12 or more consecutive nucleic acids within nucleotides 880 to 1,350 of ABCA4 intron 22, any 20 or more consecutive nucleic acids within nucleotides 880 to 1,350 of ABCA4 intron 22, any 30 or more consecutive nucleic acids within nucleotides 880 to 1,350 of ABCA4 intron 22, any 40 or more consecutive nucleic acids within nucleotides 880 to 1,350 of ABCA4 intron 22, any 50 or more consecutive nucleic acids within nucleotides 880 to 1,350 of ABCA4 intron 22, any 100 or more consecutive nucleic acids within nucleotides 880
• a binding domain has at least two non-overlapping sequences with at least 80% complementarity to the binding site.
• the binding domain includes a nucleic acid sequence having at least 80% identity (e.g., at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity; e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity) to UUGUUGGUAAAGGGUGUACAGCAAUUUCCUGGCUAUAUAGUUGCAAAAAUCAGGAGUUAACUAA AAAAAAAAAAACCCAAGGGAACUAAUUCAGCAGCAAAUUCCAGCAUAUUGGGACAAUAAUAACCAAC AUUUCAUAGCUUCCUACAUAC (SEQ ID NO
• the binding domain is a DNA sequence having at least 80% identity (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity; e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity) to SEQ ID NO: 18 TTGTTGGTAAAGGGTGTACAGCAATTTCCTGGCTATATAGTTGCAAAAATCAGGAGTTAACTAAAAAAAAAAAAAAAAAAACCCAAGGGAACTAATTCAGCAGCAAATTCCAGCATATTGGGACAATAATAACCAACATTTC ATAGCTTCCTACATAC (SEQ ID NO: 18).
• the binding domain includes a nucleic acid sequence having at least 80% identity (at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity; e.g., 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity) to SEQ ID NO: 19.
• the binding domain is a DNA sequence having at least 80% identity (e.g., at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity; e.g., 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity) to SEQ ID NO: 20.
• the binding domain includes a nucleic acid sequence having at least 80% identity (at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity; e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity) to SEQ ID NO: 21.
• the binding domain is a DNA sequence having at least 80% identity (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity; e.g., 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity) to SEQ ID NO: 22.
• the binding domain includes a nucleic acid sequence having at least 80% identity (e.g., at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity; e.g., 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity) to SEQ ID NO: 23.
• the binding domain is a DNA sequence having at least 80% identity (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity; e.g., 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity) to SEQ ID NO: 24.
• a binding domain can be operably linked 3’ to a splicing domain (e.g., directly connected to a splicing domain or have intervening sequences connecting the 3’ end of the splicing domain and the 5’ end of the binding domain).
• the first stage of ABCA4 Exon Editor design began with the screening and selection of a highly efficient BD sequence, which is complementary to the targeted pre-mRNA intron.
• intron 22 of the ABCA4 gene was selected for a BD screen.
• the present inventors applied both an NGS-based BD library approach and a bioluminescence-based approach to scan along the intron 22 sequence with exon editor variants that differed in their BD sequence. Results from both methods aligned and successfully identified regions within the intron that were amenable to RNA exon editing, leading to the selection of BD117 in some embodiments. See FIG. 16.
• the splicing domain can include a splice site, a branch point, and/or a polypyrimidine tract (PPT) tract to mediate trans-splicing.
• a splicing domain has a single splice site, which denotes that the splice site is designed for preferential trans-splicing, but not cissplicing, due to the lack of a corresponding splice site.
• the 5’ splice site consensus sequence is the nucleic acid sequence AG/GURAGU (where I indicates the splice site).
• the endogenous splice sites that correspond to the exon and intron proximal to the splice site can be employed to maintain any splicing regulatory signals.
• a suitable 5’ splice site with spacer is: 5’- GTA AGA GAG CTC GTT GCG ATA TTA T-3’ (SEQ ID NO: 25).
• a suitable 5’ splice site is AGGT.
• the splice site e.g., 5’ splice site
• the splice site is, or comprises, GTAAGT or GUAAGT.
• the splice site (e.g., 5’ splice site) is, or comprises, GTAAGG, GUAAGG, GTAAGC, GUAAGC, GTAACT, GUAACU, CAAAGT, or CAAAGU.
• a splicing domain can be operably linked 5’ to a terminator domain (e.g., directly connected to a terminator domain or have intervening sequences connecting the 3’ end of the splicing domain and the 5’ end of the terminator domain, e.g., a linker domain and/or a 3’ downstream sequence).
• a terminator domain e.g., directly connected to a terminator domain or have intervening sequences connecting the 3’ end of the splicing domain and the 5’ end of the terminator domain, e.g., a linker domain and/or a 3’ downstream sequence.
• the nucleic acid trans-splicing molecule includes a 5’ untranslated region.
• the 5’ untranslated region comprises, consists essentially of, or consists of a native 5’ ABCA4 untranslated region.
• the 5’ untranslated region comprises a sequence having at least 80% sequence identity (e.g., at least 85% sequence identity, at least 86% sequence identity, at least 87% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) to any one of SEQ ID NOs: 12-13.
• sequence identity e.g., at least 85% sequence identity, at least 86% sequence identity, at least 87% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at
• a 5’ untranslated region can be operably linked 5’ to a CDS (e.g., directly connected to a CDS or have intervening sequences connecting the 3’ end of the 5’ untranslated region and the 5’ end of the CDS).
• the nucleic acid trans-splicing molecule is operatively linked to a 5’ regulatory domain operatively linked 5’ to the CDS (e.g., directly linked to the CDS, or linked through an intermediate domain, e.g., an untranslated region).
• a 5’ regulatory domain can include a promoter (e.g., a constitutive promoter, e.g., CMV promoter or an EF1-alpha promoter).
• the 5’ regulatory domain includes a promoter (e.g., a constitutive promoter, e.g., CMV promoter) operatively linked to a native 5’ ABCA4 untranslated region.
• the 5’ regulatory domain operatively linked to a native 5’ ABCA4 untranslated region comprises a sequence having at least 80% sequence identity (e.g., at least 85% sequence identity, at least 86% sequence identity, at least 87% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) to any one of SEQ ID Nos: 14-15.
• sequence identity e.g., at least 85% sequence identity, at least 86% sequence identity, at least 87% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity,
• a 5’ regulatory domain can be operably linked 5’ to a CDS (e.g., directly connected to a CDS or have intervening sequences connecting the 3’ end of the 5’ regulatory domain and the 5’ end of the CDS).
• Linker Domains [0193] As discussed herein, increasing trans-splicing efficiency remains an important goal for implementation of nucleic acid trans-splicing molecules as therapeutic agents.
• nucleic acid trans-splicing molecules may include a linker domain at one or more positions with the molecule.
• the linker domain is operatively linked 3’ to the splicing domain or splice site (e.g., directly connected to the splicing domain or splice site).
• the linker domain may be any suitable size.
• the linker domain is longer than 25 nucleotides in length (e.g., between 25 and 50 nucleotides in length, between 35 and 45 nucleotides in length, or about 40 nucleotides in length (e.g., a 40-mer linker)).
• the linker domain comprises, consists essentially of, or consists of a nucleic acid sequence having at least 80% identity (e.g., at least 85% sequence identity, at least 86% sequence identity, at least 87% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) with CUGGUGCCCGCGGGCCGCGGAACCGGUUGGGGGCAUGUAC (SEQ ID NO: 26) or CTGGTGCCCGCGGGCCGCGGAACCGGTTGGGGGCATGTAC (SEQ ID NO: 27).
• at least 80% identity e.g., at least 85% sequence identity, at least 86% sequence identity, at least 87% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90%
• the 40mer linker comprising SEQ ID NO: 26 (RNA) or SEQ ID NO: 27 (DNA), was selected from a library screen wherein thousands of different elements were assessed for function in the context of trans-splicing molecules.
• the superiority of the 40mer linker is, for example, evident in FIG. 1 , which compares three different linkers in the context of different combinations of elements.
• the presence of the 40mer linker indicated as the Linker corresponding to the lightest grayscale tone; the third linker indicated from left to right in the context of each ss
• a linker sequence is frequently included in trans-splicing molecules, wherein it is positioned between the splice donor and the binding domain to offer flexibility and accessibility to each element.
• functional contributions of different elements were assessed in different combinations for activity conferred thereby in the context of trans-splicing molecules.
• the 40mer linker emerged from this screen as a lead candidate element that conferred improved trans-splicing activity in the context of trans-splicing molecules, as exemplified by a statistically significant increase in on-target (ONT) % replacement of ABCA4 RNA (FIG. 17A) and a significant increase in trans-spliced ABCA4 protein (ONT) levels and a significant decrease in non-spliced protein (NSP) levels relative to LinkD (FIG. 17B).
• ONT on-target
• NTP non-spliced protein
• the linker domain comprises, consists essentially of, or consists of a nucleic acid sequence having at least 80% identity (e.g., at least 85% sequence identity, at least 86% sequence identity, at least 87% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) with CCGAAUACGACACGUACAAGAUCU (SEQ ID NO: 28) or CCGAATACGACACGTACAAGATCT (SEQ ID NO: 29).
• the linker domain comprises, consists essentially of, or consists of a nucleic acid sequence having at least 80% identity (e.g., at least 85% sequence identity, at least 86% sequence identity, at least 87% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) with GCUGCUGCUCAGUCUCCUGGGCUGG (SEQ ID NO: 30) or GCTGCTGCTCAGTCTCCTGGGCTGG (SEQ ID NO: 31).
• the present inventors used a multi-faceted experimental approach to engineer nucleic acid trans-splicing molecules having properties advantageous for their use in therapeutic intervention. Accordingly, the present inventors sought to identify additional elements that could enhance RNA exon editor activity by, for example, increasing on target (ONT) trans-splicing, increasing ONT ABCA4 trans-spliced protein levels, or decreasing non-spliced protein (NSP) levels, or any combination thereof. Accordingly, a variety of elements were tested to determine if the presence of a tested element potentiated the activity of an RNA exon editor relative to that observed for the RNA exon editor without the tested element.
• ONT on target
• NSP non-spliced protein
• U1 binding site (UBS)
• UBS U1 binding site
• 3xUBS (also referred to as 3xU1) comprises SEQ ID NO: 62.
• 3xUBS (also referred to as 3xU1) comprises at least one sequence comprising GGTAAGT or GGTAAGTAGAGTG (SEQ ID NO: 61) or GGTGAGTAGAGTG (SEQ ID NO: 83).
• 3xUBS is positioned 3’ of the linker domain.
• 3xUBS is positioned 3’ of the linker domain and 5’ to the binding domain.
• 3xUBS comprises at least one sequence comprising GGTAAGT, wherein each of the at least one sequences comprising GGTAAGT further comprises flanking sequences.
• 3xUBS comprises at least one of GGTAAGTAGAGTG (SEQ ID NO: 61) or GGTGAGTAGAGTG (SEQ ID NO: 83). In some embodiments, 3xUBS comprises at least one of CGT GGTAAGT AGAGTG (SEQ ID NO: 74; UBS1); ATG GGTAAGT AGAGTG (SEQ ID NO: 75; UBS2); or TGG GGTAAGT AGAGTG (SEQ ID NO: 76; UBS3), or any combination thereof.
• an RNA exon editor comprising at least one UBS comprises at least one sequence comprising GGTAAGT or GGTAAGTAGAGTG (SEQ ID NO: 61).
• the 3xUBS is positioned 3’ of the linker domain in the RNA exon editor.
• the 3xUBS is positioned 3’ of the linker domain and 5’ to the binding domain in the RNA exon editor.
• an RNA exon editor comprising at least one UBS comprises at least one of CGT GGTAAGT AGAGTG (UBS1 ; SEQ ID NO: 74); ATG GGTAAGT AGAGTG (UBS2; SEQ ID NO: 75); or TGG GGTAAGT AGAGTG (UBS3; SEQ ID NO: 76); or any combination thereof.
• an RNA exon editor comprising at least one UBS comprises at least one CGT GGTAAGT AGAGTG (UBS1 ; SEQ ID NO: 74).
• an RNA exon editor comprising at least one UBS comprises CGT GGTAAGT AGAGTG (SEQ ID NO: 74; UBS1), ATG GGTAAGT AGAGTG (SEQ ID NO: 75; UBS2), and TGG GGTAAGT AGAGTG (SEQ ID NO: 76; UBS3).
• At least one UBS present in the context of a trans-splicing molecule is referred to herein as a potentiator.
• An exemplary potentiator described herein comprises at least one of CGT GGTAAGT AGAGTG (UBS1 ; SEQ ID NO: 74), ATG GGTAAGT AGAGTG (UBS2; SEQ ID NO: 75), or TGG GGTAAGT AGAGTG (UBS3; SEQ ID NO: 76), or any combination thereof.
• an exemplary potentiator described herein comprises at least one UBS comprising at least one CGT GGTAAGT AGAGTG (UBS1 ; SEQ ID NO: 74).
• an exemplary potentiator described herein comprises a UBS comprising CGT GGTAAGT AGAGTG (UBS1 ; SEQ ID NO: 74), ATG GGTAAGT AGAGTG (UBS2; SEQ ID NO: 75), and TGG GGTAAGT AGAGTG (UBS3; SEQ ID NO: 76).
• a potentiator at least one of a UBS, e.g., UBS1 , UBS2, or UBS3, or any combination thereof
• the potentiator also conferred a statistically significant decrease in NSP, which observation further underscored the surprising functional properties of this element in the context of an RNA exon editor.
• RNA exon editors comprising different binding domains that bind/target different introns in different target pre-mRNAs other than ABCA4 pre-mRNA.
• Results from exemplary RNA exon editors demonstrate that a potentiator comprising 3xUBS confers surprising beneficial properties in the context of RNA exon editors targeting Intron A and Intron B in non-ABCA4 pre-mRNAs. More particularly, RNA exon editors targeting non-ABCA4 pre-mRNA that comprise a combination of 40mer + 3xUBS (SEQ ID NO: 62) exhibited significantly reduced levels of NSP relative to RNA exon editors comprising only 40mer (SEQ ID NO: 27).
• FIG. 19A Intron 22 targeting ABCA4 pre-mRNA
• FIG. 28A Intron B
• FIG. 29 Intron C
• FIG. 19A Intron 22 targeting ABCA4 pre-mRNA
• FIG. 28A Intron B
• FIG. 29 Intron C
• FIG. 19A Intron 22 targeting ABCA4 pre-mRNA
• FIG. 28A Intron B
• FIG. 29 Intron C
• FIG. 19A Intron 22 targeting ABCA4 pre-mRNA
• FIG. 28A Intron B
• FIG. 29 Intron C
• the presence of the 3xUBS sequence (SEQ ID NO: 62) conferred a 3-fold increase in the level of % replacement.
• potentiators such as those described herein (e.g., SEQ ID NO: 62) function in a binding domain- and target-independent manner and therefore, may be used in the context of RNA exon editors in general with an expectation that the presence of a potentiator will confer advantageous properties, including reduced NSP levels and potentially increased trans-splicing activity as reflected in % RNA replacement.
• RNA exon editor activity by increasing on target (ONT) trans-splicing, increasing ONT ABCA4 trans-spliced protein levels, or decreasing non-spliced protein (NSP) levels, or any combination thereof also led the present inventors to the discovery that AU-rich elements (ARE) exhibit surprising functional properties in the context of RNA exon editors described herein.
• the surprising properties of AREs were discovered via extensive trial and error procedures whereby scores of different elements and different combinations thereof were assessed in the context of individual trans-splicing molecules.
• ARE conferred a decrease in NSP levels to RNA exon editors comprising an ARE as an additional element (40mer + ARE) relative to those lacking an ARE (e.g., comprising the 40mer alone).
• the presence of an ARE also conferred an increase in ONT trans-spliced ABCA4 protein to RNA exon editors comprising an ARE as an additional element (40mer + ARE) relative to those lacking an ARE (e.g., comprising the 40mer alone). See, for example, FIG. 13 (ARE) and FIG. 19B (40mer + ARE). Since AREs conferred a decrease in NSP levels and an increase in ONT trans-spliced ABCA4 protein levels, they are referred to herein as “translational potentiators”.
• an exemplary ARE is a granulocyte-macrophage colony stimulating factor (GM-CSF) ARE comprising a sequence comprising ATTTATATATTTATATTTTTAAAATATTTATTTATTTATTTATTTA (SEQ ID NO: 63) or a sequence having at least 90% identity to SEQ ID NO: 63.
• GM-CSF granulocyte-macrophage colony stimulating factor
• the translational potentiator has at least 91% identity to SEQ ID NO: 63, has at least 92% identity to SEQ ID NO: 63, has at least 93% identity to SEQ ID NO: 63, has at least 94% identity to SEQ ID NO: 63, has at least 95% identity to SEQ ID NO: 63, has at least 96% identity to SEQ ID NO: 63, has at least 97% identity to SEQ ID NO: 63, has at least 98% identity to SEQ ID NO: 63, or has at least 99% identity to SEQ ID NO: 63.
• SEQ ID NO: 63 or the sequence having at least 90% identity to SEQ ID NO: 63 is operably linked 3’ to the potentiator (e.g., SEQ ID NO: 62).
• the core sequence is typically AUUUA (RNA; ATTTA in the DNA vector encoding same) and repeats of this core AUUUA element are often required for function.
• An ARE element is typically about equal to or greater than 50 bases. Accordingly, in some embodiments the ARE comprises repeats of the core AUUUA element about equal to or greater than 50 bases.
• ARE included as an additional element in an RNA exon editor; See FIG. 13
• ARE-mediated effects on protein levels encoded thereby promote the therapeutic potential of the RNA exon editor by preferentially increasing therapeutic protein levels (ONT trans-spliced ABCA4 protein levels) and decreasing NSP levels.
• cassette of an exemplary potentiator in combination with an exemplary translational potentiator confers an even more significant decrease in NSP levels relative to that of RNA exon editors comprising 40mer only, 40mer + 3XUBS, or 40mer + ARE.
• This combination of elements (40mer + 3XUBS + ARE; SEQ ID NO: 73), therefore, exhibits particularly advantageous properties in the context of trans-splicing molecules such as those described herein.
• translational potentiators described herein have also been demonstrated in the context of RNA exon editors comprising different binding domains that bind/target different introns in different target pre-mRNAs other than ABCA4 pre-mRNA.
• Results from exemplary RNA exon editors demonstrate that a translational potentiator comprising ARE (SEQ ID NO: 63) confers surprising beneficial properties in the context of RNA exon editors targeting Introns A and B in non-ABCA4 pre-mRNAs.
• RNA exon editors targeting non-ABCA4 pre- mRNA that comprise a combination of 40mer + ARE exhibited significantly reduced levels of NSP relative to RNA exon editors comprising only 40mer (SEQ ID NO: 27). See, e.g., FIGs. 27B and 28B. While reducing NSP, the combination of 40mer + ARE (SEQ ID NO: 63) maintained similar levels of ONT trans-spliced protein relative to that of 40mer alone.
• each of the RNA exon editors in which ARE was shown to reduce NSP [Intron 22 targeting ABCA4 pre- mRNA (FIG. 19B); Intron A (FIG. 27B); and Intron B (FIG.
• translational potentiators such as those described herein (e.g., SEQ ID NO: 63) function in a binding domain- and target-independent manner and therefore, may be used in the context of RNA exon editors in general with an expectation that the presence of a translational potentiator will confer advantageous properties, including reduced NSP levels.
• the trans-splicing molecule includes a 3’ transcription terminator domain.
• such 3’ transcription terminator domains form a triple helical structure that effectively caps the 3’ end of the trans-splicing molecule.
• the 3’ transcription terminator domain is from the human long non-coding RNA MALAT1 (e.g., wildtype MALAT1).
• the 3’ transcription terminator domain includes a tRNA-like domain. 3’ transcription terminator domains useful as part of the present ABCA4 trans-splicing molecules are described in International Patent Publication No. WO 2020/214973, which is herein incorporated by reference in its entirety.
• the region of an RTM operably linked to the 3’ end of the binding domain includes a terminator domain that comprises, consists essentially of, or consists of a wildtype MALATI+mascRNA domain, such as SEQ ID NO: 32 or SEQ ID NO: 33.
• the region of an RNA exon editor operably linked to the 3’ end of the binding domain includes a terminator domain that comprises, consists essentially of, or consists of a mutated MALAT1 +masc RNA (anti-Mut1 masc RNA) domain, such as SEQ ID NO: 66 (DNA) or SEQ ID NO: 67 (RNA).
• the trans-splicing molecule includes a 3’ downstream (DS) region downstream of (i.e., operatively linked 3’ to) the binding domain and/or upstream of (i.e., operatively linked 5’ to) the terminator domain.
• the 3’ DS region is part of the terminator domain.
• the 3’ DS region may directly connect the binding domain to the terminator region.
• the 3’ DS region is 6-10 nucleotides in length (e.g., 8 nucleotides in length).
• the 3’ DS region comprises any one of 3’ DS- MALAT1 flanking 8-mer RNA, AGGGUCAU; 3’ DS- MALAT1 flanking 8-mer DNA, AGGGTCAT; 3’ DS- random 8-mer RNA, CGAGCCUC; 3’ DS- random 8-mer DNA, CGAGCCTC; 3’ DS- MALAT1 flanking first 6 of 8-mer RNA, AGGGU; and 3’ DS- MALAT1 flanking first 6 of 8-mer DNA, AGGGT.
• the 3’ DS region consists of any one of 3’ DS- MALAT 1 flanking 8-mer RNA, AGGGUCAU; 3’ DS- MALAT 1 flanking 8-mer DNA, AGGGTCAT; 3’ DS- random 8-mer RNA, CGAGCCUC; 3’ DS- random 8-mer DNA, CGAGCCTC; 3’ DS- MALAT1 flanking first 6 of 8-mer RNA, AGGGU; and 3’ DS- MALAT1 flanking first 6 of 8-mer DNA, AGGGT.
• binding of a trans-splicing molecule to the target pre-mRNA is mediated by percent complementarity (i.e., based on base-pairing characteristics of nucleic acids), triple helix formation, or protein-nucleic acid interaction (as described in documents cited herein).
• the nucleic acid trans-splicing molecule includes DNA, RNA, or DNA/RNA hybrid molecules, wherein the DNA or RNA is either single or double stranded.
• RNAs or DNAs which can hybridize to one of the aforementioned RNAs or DNAs, preferably under stringent conditions, for example, at 60°C in 2.5x SSC buffer and several washes at 37°C at a lower buffer concentration, for example, 0.5x SSC buffer.
• These nucleic acids can encode proteins exhibiting lipid phosphate phosphatase activity and/or association with plasma membranes.
• trans-splicing molecules When trans-splicing molecules are synthesized in vitro, such trans-splicing molecules can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, hybridization to the target mRNA, transport into the cell, stability in the cells to enzymatic cleavage, etc.
• nucleic acid molecules may be synthesized in such a way as to be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc.
• nucleic acid molecules can be introduced as a means of increasing intracellular stability and half-life (see also above for oligonucleotides). Possible modifications are known to the art. Modifications, which may be made to the structure of synthetic trans-splicing molecules include backbone modifications.
• an ABCA4 RNA exon editor cassette (ABCA4 REEC) comprises a regulatory component that drives expression of the RNA exon editor, a 5’ UTR and CDS that replaces the corresponding native sequence and any mutations that may exist within the target native sequence, a splice donor (SD) that interacts with the native splice acceptor (SA), a linker that may enable flexibility and accessibility for this interaction to occur, regulatory elements that enhance trans- splicing (TS), a BD that targets the correct position in the pre-mRNA, and a terminator sequence that promotes TS and stability.
• SD splice donor
• SA native splice acceptor
• TS trans- splicing
• BD trans- splicing
• BD terminator sequence that promotes TS and stability.
• ITR sequence 5’ and 3’ ITR sequences flank the exemplary RNA Exon Editor sequence and are essential for Adeno-associated virus (AAV) packaging of the transgene.
• An exemplary ABCA4 REEC contains “flop orientation” 130 nucleotide ITR sequences derived from AAV2, which are commonly used in gene therapies.
• CMV/CMV promoter This regulatory sequence drives the expression of the exemplary Exon Editor transcript. It comprises the Cytomegalovirus (CMV) immediate-early enhancer and CMV immediate-early enhancer, which has been shown to drive high expression in non-human primate (NHP) photoreceptors and is shown herein to drive high expression in NHP retina and human retina. See, e.g., FIGs. 8, 9, 31 , and 32.
• CMV/CMV promoter This regulatory sequence drives the expression of the exemplary Exon Editor transcript. It comprises the Cytomegalovirus (CMV) immediate-early enhancer and CMV immediate-early enhancer, which has been shown to drive high expression in non-human primate (NHP) photoreceptors and is shown herein to drive high expression in NHP retina and human retina. See, e.g., FIGs. 8, 9, 31 , and 32.
• UTR The 5’ end of the exemplary Exon Editor RNA molecule begins with the native ABCA4 5’ UTR sequence, which maintains the native RNA sequence in the final ONT mRNA molecule resulting from TS.
• the UTR sequence has been modified with five point mutations that remove suspected or data-driven cryptic splice acceptor sites to mitigate the potential occurrence of cis-splicing or TS between Exon Editor transcripts.
• Terminal Exon 22 The encoded CDS in the exemplary ABCA4 REEC includes Exon 22, referred to as the Terminal Exon, as it immediately precedes the splice donor (SD) site in the Exon Editor sequence and is later, via TS, ligated to the native Exon 23 forming a correct Exon 22-23 junction. To facilitate the identification and quantification of the ONT molecule formed by TS, Exon 22 has been modified with 29 synonymous point mutations.
• mutations provide opportunities to differentiate trans-spliced transcripts from endogenous transcripts by facilitating selective primer/probe design for RT-qPCR analysis (quantification), as well as next-generation sequencing (NGS) - based analysis (identification and quantification) without eliciting amino acid changes to the protein sequence.
• quantitative quantitative polymerase chain reaction
• NGS next-generation sequencing
• Splice donor site (splicing domain; SD):
• the exemplary ABCA4 REEC comprises a consensus U1 splice donor site (SD) located immediately downstream of Terminal Exon 22. This SD interacts with the endogenous Intron 22 splice acceptor (SA) site during the TS reaction mediated by the spliceosome, in place of the natural cis-splicing reaction that would otherwise occur between the endogenous Intron 22 splice donor site and SA site.
• SD consensus U1 splice donor site located immediately downstream of Terminal Exon 22. This SD interacts with the endogenous Intron 22 splice acceptor (SA) site during the TS reaction mediated by the spliceosome, in place of the natural cis-splicing reaction that would otherwise occur between the endogenous Intron 22 splice donor site and SA site.
• SA endogenous Intron 22 splice acceptor
• the result of this TS event is a precisely formed Exon 22-23 junction in which the upstream region originates from the Exon Editor and the downstream region comprises the remainder of the native ABCA4 pre-mRNA, which proceeds through its natural cis-splicing events toward the formation of the mature mRNA molecule.
• STOP codon The exemplary ABCA4 REEC includes a double STOP codon immediately following the SD site. In fact, the last nucleotide of the GTAAGT SD site serves as the first nucleotide in the TAGTGA double STOP codon.
• One purpose of this intentional STOP codon is to eliminate the addition of foreign amino acids at the C-terminus under circumstances in which the prespliced Exon Editor transcript exits the nucleus, enters the cytoplasm and undergoes translation that results in a truncated, non-spliced protein (NSP). Any such foreign amino acids at the C-terminus of the NSP could pose a potential immunogenicity risk that is avoided via the inclusion of the STOP codon.
• the STOP codon can also contribute to AU rich element (ARE) mediated decay, which the present inventors hypothesized would serve to degrade pre-spliced Exon Editor RNA that escapes into the cytoplasm, as discussed hereinbelow.
• ARE AU rich element
• 40mer Linker A linker sequence positioned between the SD site and downstream elements may provide flexibility to the RNA structure and accessibility to the SD, which can be advantageous for effective TS.
• the 40mer Linker emerged as a highly effective sequence from comprehensive screens of thousands of linker candidates. See, for example, FIG. 1 .
• the predicted secondary structure of the relevant region of an Exon Editor containing the 40mer Linker suggests that the presence of the 40mer Linker results in an open and accessible SD.
• An exemplary ABCA4 REEC comprises a potentiator comprising three tandem U1 sites downstream of the 40mer Linker.
• U1 sites are bound by U1 snRNP during the process of spliceosome mediated splicing.
• Inclusion of three tandem U1 sites in this Exon Editor downstream of the primary SD site led to an increase in RNA TS, as well as a decrease in observed NSP levels.
• AU rich element An exemplary ABCA4 REEC comprises an AU rich element (ARE) derived from the mRNA of the granulocyte-macrophage colony-stimulating factor (GM-CSF) gene. The presence of this ARE along with the upstream STOP codon was designed to mimic a 3’ UTR-like sequence. The present inventors hypothesized that in cases in which pre-spliced Exon Editor RNA enters the cytoplasm, ARE RNA binding proteins might recognize the ARE sequence and lead to rapid degradation of the molecule, thereby reducing levels of the NSP.
• GM-CSF granulocyte-macrophage colony-stimulating factor
• Binding domain The exemplary ABCA4 REEC ’s encoded BD directly associates the Exon Editor RNA with the native ABCA4 pre-mRNA. Its 150 nucleotide (nt) sequence is complementary to a region of the same length within the pre-mRNA’s intron 22 (chr1 :94041452- 94041601). The BD’s intronic position was selected through an iterative process of scanning intron 22 with an array of Exon Editors which diverge with respect to their BD sequences at distinct intronic positions.
• MALAT1 triple-helix terminator The exemplary ABCA4 REEC also includes a terminator sequence derived from the MALAT1 long non-coding RNA (IncRNA). This portion of the MALAT1 IncRNA contains a triple helix structure that may confer stability and nuclear retention to the Exon Editor RNA. The MALAT1 terminator leads to TS efficiency that is far beyond that which is achieved when applying alternative terminators, such as self-cleaving ribozymes. See, e.g., FIG. 20A. The triple helix is followed by an Rnase P cleavage site and a short sequence comprising the MALAT1 -associated small cytoplasmic RNA (mascRNA), discussed below. The Rnase P cleavage downstream of the triple helix defines the 3’ end of the Exon Editor transcript.
• IncRNA MALAT1 long non-coding RNA
• MascRNA The mascRNA sequence in the exemplary ABCA4 REEC is flanked by an upstream Rnase P cleavage site and a downstream Rnase Z cleavage site, and once processed, is thought to exit the nucleus while the Exon Editor transcript remains and engages in TS. While the mascRNA is no longer present within the Exon Editor transcript following Rnase P cleavage, including its sequence downstream of the MALAT1 triple helix as it naturally occurs may contribute to achieving a highly efficient TS outcome.
• mascRNA is suspected to promote global protein translation and cell proliferation via its interaction with and upregulation of the multi-tRNA synthetase complex component glutaminyl-tRNA synthetase (QARS).
• QARS glutaminyl-tRNA synthetase
• the mascRNA sequence encoded in the exemplary ABCA4 REEC has been mutated to include a point mutation within its anticodon stem loop, termed anti-Mut1 , which abolishes its interaction with QARS and the potentially ensuing increase in global protein synthesis rate.
• anti-Mut1 a point mutation within its anticodon stem loop
• a second point mutation helps maintain the mascRNA’s natural cloverleaf structure by base-pairing with the anti-Mut1 mutation.
• an exemplary ABCA4 REEC encodes an exemplary ABCA4 5’ Exon Editor RNA molecule that functions in a 5’ trans-splicing reaction mediated by the endogenous spliceosome.
• an RNA sequence (Binding domain; BD) within the Exon Editor that is complementary to Intron 22 of the native ABCA4 pre-mRNA localizes the Exon Editor RNA to the pre-mRNA.
• TS trans-splicing
• SD splice donor site
• SA pre-mRNA’s intron 22 splice acceptor site
• This reaction results in the replacement of the native endogenous pre-mRNA’s sequence from exon 1 to exon 22 with the corresponding coding sequence (CDS) provided by the Exon-Editor RNA, thereby correcting any mutations that might exist within that region of the native endogenous pre-mRNA.
• CDS coding sequence
• the resulting on-target (ONT) molecule undergoes translation to form a biologically active ABCA4 protein. See, e.g., FIG. 14A.
• RNA exon editors described herein are thought to operate via spliceosome-mediated trans-splicing, which proceeds via a mechanism similar to that of cis-splicing.
• the exon editor RNA diffuses within the nucleus with U1 snRNP deposited on its unpaired SD.
• the endogenous (native) pre-mRNA target is transcribed from its genomic locus, and the removal of its introns via cis- splicing between their flanking SD and splice acceptor (SA) sites occurs within seconds of the emergence of each intron’s SA.
• the trans-splicing process is initiated by the base-pairing of an exon editor’s binding domain (BD) to its complementary sequence located within intron 22 of the endogenous ABCA4 pre-mRNA, which must occur before the removal of the intron through cis- splicing.
• the spliceosome may either proceed with (1) lariat formation toward cis-splicing using the endogenous SD and SA sites or (2) “Y branch” formation toward trans-splicing using the exon editor’s SD paired with the endogenous SA.
• the first nucleotide of the exon editor’s SD (Guanine), forms a covalent bond with the intron’s branchpoint, which is typically 15-50 bp upstream of the SA.
• ABCA4 exon editors can include or exclude one or more of the components set forth in Table 1 above. Individual functional components can be advantageously included in an ABCA4 exon editor without including all of the components set forth in Table 1 . For example, while elements 3, 7, 8, 9, 10, and 12 provide advantages to an ABCA4 exon editor, an effective ABCA4 exon editor can be made without one or more of these elements.
• trans-splicing molecules described herein are tested in cultured cell lines.
• cultured cell lines may be acquired or engineered to express the targeted ABCA4 pre-mRNA at a sufficient level. Since ABCA4 expression is extremely low in a common, robust and readily transfectable/transducible transformed cell line, a HEK293T-based cell line, termed B6, was engineered that expresses both high ABCA4 RNA and protein levels. This was achieved via the knock-in (KI) of a constitutive CAGGS promoter between the endogenous ABCA4 promoter and exon 1 via CRISPR-mediated homology-directed repair (HDR).
• KI knock-in
• HDR CRISPR-mediated homology-directed repair
• RNA exon editor To characterize an ABCA4 RNA exon editor’s ability to effectively correct a targeted native pre-mRNA, the resulting trans-spliced on-target (ONT) RNA’s ability to undergo translation and yield a full-length ABCA4 protein was assessed.
• a knock-out (KO) cell line was engineered based on the B6 cell line. 17+06 cells continued to produce high levels of ABCA4 RNA, but in contrast to the B6 cell line, 17+06 cells do not produce ABCA4 protein.
• Engineering 17+06 cells was achieved by introducing mutations into the ABCA4 gene coding sequence using CRISPR and guide RNAs (gRNA) targeting exons 3 and 4.
• B6 cells were subjected to two sequential transfection rounds to achieve high mutational efficiency and disrupt the ABCA4 gene sequence - first by applying a gRNA targeting exon 3 and then by applying a mixture of gRNA targeting exon 3 and gRNA targeting exon 4. Mutations were confirmed by Sanger sequencing applied to PCR amplicons produced from 17+06 genomic DNA, as well as cDNA, with the latter serving as confirmation that the mutations occurred within alleles that had undergone successful CAG insertion during the process of generating the parental cell line, B6. RT-qPCR confirmed the persistence of ABCA4 RNA expression in the 17+06 cell line, and Western blot analysis indicated that ABCA4 protein translation was abolished. See FIG. 3C.
• RNA exon editors comprise several functional sequence elements, such as a binding domain (BD) for pre-mRNA targeting and a linker that enables access to the splice donor (SD) site.
• BD binding domain
• SD splice donor
• Such testing may be accomplished via (A) cloning and transfecting individual RNA exon editor variants and analyzing efficiency via RT-qPCR/ddPCR and Western blot or (B) cloning and pooling RNA exon editors in a high-throughput (HT) library-based approach that relies on next generation sequencing (NGS) and computational analysis to assess efficiency.
• HT high-throughput
• NGS next generation sequencing
• This approach can be applied to test a small-scale number of variable elements within an RNA exon editor sequence prior to initiating a library-based multiplexed screen, to validate the performance of RNA exon editors identified in a multiplexed screen, and/or to improve performance of lead candidates. Evaluation of TS efficiency occurs at the RNA and protein levels.
• TS activity is evaluated via isolation of total RNA from cells followed by reverse transcription and real-time quantitative PCR (RT-qPCR) measuring RNA copy numbers of, e.g., the following targets: RNF20 (housekeeping gene for normalization); Native (ABCA4) mRNA; Exon Editor RNA; On-target, exon-edited RNA (ONT), which is the product of positive TS; ONT+Exon Editor+OFT (off-target) - a single assay that captures all three of these targets. OFT represents incorrect RNA molecules to which the RNA exon editor may trans-splice.
• RNF20 housekeeping gene for normalization
• Native ABCA4
• ONT+Exon Editor+OFT off-target
• TS activity is measured via Western blot analysis applied to protein extracted from cell or tissue samples via a protocol that enriches membrane proteins in the case of ABCA4.
• Na+/K+ ATPase which is a membrane protein, is used as a loading control.
• the level of ONT protein is measured via ABCA4-specific antibodies (Ab).
• Ab ABCA4-specific antibodies
• an Ab specific for the tag e.g., a V5 specific Ab
• RNA exon editors can be screened in a high-throughput library format that relies on synthesis of DNA oligo libraries that may focus on a particular feature of an Exon Editor, such as a BD or linker.
• the ABCA4 protein is a member of the superfamily of ATP-binding cassette (ABC) transporters and is preferentially localized along the rim region of photoreceptor outer segment disc membranes.
• ABC transporters utilize the energy of ATP hydrolysis to unidirectionally translocate a diverse set of substrates, ranging from ions to lipids and peptides, across cellular membranes.
• the ABCA4 protein becomes active once light entering the eye is converted into an electrical signal (phototransduction). Potentially toxic vitamin A derivatives are formed during phototransduction, and the ABCA4 protein helps remove at least two of these substances (all trans retinal and 11-cis-retinal) from photoreceptor outer segments.
• This photoreceptor clearance mechanism helps protect both photoreceptors and retinal pigment epithelial cells from the buildup and secondary damage that can be induced by these molecules.
• recessively inherited loss-of-fu notion ABCA4 mutations result in the accumulation of these vitamin A derivatives causing a buildup of lipofuscin, including A2E (a bis retinoid pyridinium salt N-retinylidene-N-retinylethanolamine fluorophore found in lipofuscin), resulting in cellular toxicity in the retina, and culminating in a progressive loss of vision.
• A2E a bis retinoid pyridinium salt N-retinylidene-N-retinylethanolamine fluorophore found in lipofuscin
• ATPase activity is critical for ABCA4 protein function. Accordingly, assessing the ATPase activity of ABCA4 protein that was translated from a an ABCA4 mRNA generated via exon editing serves as an overall indicator of ABCA4 biological activity. Previous reports have shown that incubation of 40 pM all trans retinal (ATR) with purified wild-type (WT) ABCA4 protein results in a 1.8- to 2.5-fold increase in ATPase activity. With this information in mind, experiments were designed to assess the biological activity of exon- edited ABCA4 protein.
• ATPase activity of the ABCA4 protein rescued in ABCA4 KO cells transfected with an overexpression plasmid encoding an N-terminal V5-epitope tagged version of the RNA exon editor of ABCA4-01 (SEQ ID NO: 81) was assessed in the absence or presence of 40 pM all-trans retinal (ATR) following ABCA4 protein immunoprecipitation utilizing established methods.
• ATR all-trans retinal
• Initial data demonstrates a basal level of ATPase activity that increases in response to the addition of 40 pM all-trans retinal. See FIG. 24.
• Minimal background ATPase activity was detected in an untransfected sample that lacks ABCA4.
• Example 4 presents evidence demonstrating that AAV8-based V5 epitope-tagged ABCA4 Exon Editors result in therapeutically relevant exon editing activity in African Green Monkey (AGM) 1-month after a single subretinal administration of 1 E11 vg/injection.
• AGM African Green Monkey
• SEQ ID NO: 42 an Early Lead vector comprising (SEQ ID NO: 42) tested in this study was used as the basis for further optimization and ultimate selection of elements present in ABCA4-01 (SEQ ID NO: 90), which comprises an RNA exon editor comprising SEQ ID NO: 78. See, for example, FIGs. 4-12; Tables 1 and 2.
• Example 8 presents evidence demonstrating that the selected regulatory elements in ABCA4-01 (SEQ ID NO: 90) confer persistent expression and exon editing activity out to a 3-month time-point in AGM.
• the AAV8 construct tested in this study comprises an RNA Exon Editor comprising SEQ ID NO: 77 (of which the first 104 nucleotides comprise the native ABCA4 5’ UTR followed by the ATG start codon for translation initiation) that closely resembles Early Lead vector comprising (SEQ ID NO: 42), but differs from it in that it lacks the V5 epitope tag, contains a double stop-codon following the splice domain, and produces higher levels of a truncated ABCA4 non-spliced protein (NSP) in vitro when compared to ABCA4-01 (SEQ ID NO: 90).
• SEQ ID NO: 77 of which the first 104 nucleotides comprise the native ABCA4 5’ UTR followed by the ATG start codon for translation initiation
• SEQ ID NO: 42
• the AAV8 construct tested in this study comprises an Exon Editor (SEQ ID NO: 77) that closely resembles Early Lead vector comprising (SEQ ID NO: 42), which was well tolerated at 1- and 3-months in all animals following a single subretinal dose of 4.3E10 vg/eye, further supporting a clinical approach using the related construct ABCA4-01 (SEQ ID NO: 90). See FIG. 22.
• the ABCA4-01 RNA Exon Editor comprising SEQ ID NO: 90 differs from the RNA exon editor comprising SEQ ID NO: 77 used in this study in that SEQ ID NO: 77 does not include a potentiator (e.g., SEQ ID NO: 62) or a translational potentiator (e.g., SEQ ID NO: 63).
• SEQ ID NO: 77 and SEQ ID NO: 78 share the same regulatory elements and double STOP codon.
• Example 10 presents evidence demonstrating that ABCA4-01 (SEQ ID NO: 90) confers persistent expression and exon editing activity out to a 6-month time-point in NHP. More particularly, FIGs. 30A-30C present results demonstrating robust ABCA4 RNA and protein replacement in vivo in NHP six (6) months after treatment with an exemplary AAV8 RNA exon editor construct (ABCA4-01 ; SEQ ID NO: 90). Briefly, wild-type cynomolgus macaques were treated with a single subretinal dose of ABCA4-01 (results for an exemplary dose of 3.5E11 vg/eye are presented). The percent RNA replacement ranged from about 40%-60% for this dose of ABCA4-01.
• Example 12 presents evidence that ABCA4-01 , an exemplary AAV8 RNA exon editor construct comprising SEQ ID NO: 90, functions in the context of human photoreceptors.
• ABCA4-01 an exemplary AAV8 RNA exon editor construct comprising SEQ ID NO: 90
• donor-derived retinal explants from multiple human donors were treated with ABCA4-01 (3.9E11 vg) to evaluate ABCA4-01 activity in human photoreceptors.
• ABCA4-01 treatment resulted in approximately 20-30% RNA replacement of the endogenous exons 1-22 with the same corresponding exons encoded by ABCA4-01 (FIG. 31).
• the same lot of ABCA4-01 was also used in the investigative NHP study referred to in Example 10, further evidencing the translatability of ABCA4-01 results from NHP to human subjects.
• Trans-splicing molecules can be delivered to target cells of an individual using various techniques, e.g., using recombinant adeno-associated virus (AAV) vectors or other vector modalities, such as non-viral vectors.
• AAV adeno-associated virus
• vectors comprising/encoding trans- splicing molecules e.g., viral or non-viral vectors comprising/encoding trans-splicing molecules, e.g., DNA vectors comprising/encoding trans-splicing molecules.
• Any suitable nucleic acid vector may be used in conjunction with the present compositions and methods to design and assemble the components of the trans-splicing molecule and a recombinant AAV.
• the vector is a recombinant AAV carrying the trans-splicing molecule driven by a promoter that expresses a trans- splicing molecule in selected cells of an individual.
• Methods for assembly of the recombinant vectors are known in the art. See, e.g., Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989; Kay, M. A. et al., Nat. Medic, 2001 , 7(l):33-40; and Walther W. and Stein LI., Drugs 2000, 60(2):249-71 .
• the trans-splicing molecule is delivered to the selected cells, e.g., photoreceptor cells, in need of treatment by means of an AAV vector.
• a variety of naturally occurring serotypes of AAV are available. Many natural variants in the AAV capsid exist, allowing identification and use of an AAV with properties specifically suited for ocular or cochlear cells.
• Artificial AAV vectors may be engineered by conventional molecular biology techniques, making it possible to optimize these particles for cell specific delivery of the trans-splicing molecule nucleic acid sequences, for minimizing immunogenicity, fortuning stability and particle lifetime, for efficient degradation, for accurate delivery to the nucleus, etc.
• such artificial capsids may be generated by any suitable technique, using a selected AAV sequence (e.g., a fragment of a vp1 capsid protein) in combination with heterologous sequences which may be obtained from a different selected AAV, non-contiguous portions of the same AAV, from a non-AAV viral source, or from a non-viral source.
• An artificial AAV may be, without limitation, a pseudotyped AAV, a chimeric AAV capsid, a recombinant AAV capsid, or a “humanized” AAV capsid.
• Pseudotyped vectors wherein the capsid of one AAV is replaced with a heterologous capsid protein, are useful for delivering trans-splicing molecules described herein.
• the expression of trans-splicing molecules described herein can be achieved in the selected cells through delivery by recombinantly engineered AAVs or artificial AAVs that contain sequences comprising/encoding the desired trans-splicing molecule.
• AAVs is a common mode of exogenous delivery of DNA as it is relatively non-toxic, provides efficient gene transfer, and can be easily optimized for specific purposes.
• human serotype 2 has been widely used for efficient gene transfer experiments in different target tissues and animal models.
• the AAV is AAV1 or a variant thereof (e.g., SEQ ID NO: 6 or 64 of US20030138772 or SEQ ID NO: 11 or 27 of US20150159173), AAV2 or a variant thereof (e.g., SEQ ID NO: 7 or 70 of US20030138772, SEQ ID NO: 7 or 23 of US20150159173, or SEQ ID NO: 7 of US20150159173), AAV2G9 or a variant thereof, AAV3 or a variant thereof (e.g., SEQ ID NO: 8 or 71 of US20030138772), AAV3a or a variant thereof, AAV3b or a variant thereof (e.g., SEQ ID NO: 1 and 10 of U.S.
• AAV1 or a variant thereof e.g., SEQ ID NO: 6 or 64 of US20030138772 or SEQ ID NO: 11 or 27 of US20150159173
• AAV2 or a variant thereof e.g., SEQ
• AAV3-3 or a variant thereof e.g., SEQ ID NO: 200 and 217 of W02005033321
• AAV4 or a variant thereof e.g., SEQ ID NO: 63 of US20030138772
• AAV4-4 or a variant thereof e.g., SEQ ID NO: 201 or 218 of W02005033321
• AAV5 or a variant thereof e.g., SEQ ID NO: 114 of US20030138772
• AAV6 or a variant thereof e.g., SEQ ID NO: 65 of US20030138772
• AAV6.1 or a variant thereof e.g., SEQ ID NO: 29 of US20150159173
• AAV7 or a variant thereof e.g., SEQ ID NO: 1-3 of US20030138772
• AAV8 or a variant thereof e.g., AAV8 or
• AAV10 or a variant thereof e.g., SEQ ID NO: 117 of US20030138772
• AAV11 or a variant thereof e.g., SEQ ID NO: 118 of US20030138772
• AAV12 or a variant thereof e.g., SEQ ID NO: 119 of US20030138772
• AAV16.3 or a variant thereof AAV24.1 or a variant thereof, AAV27.3 or a variant thereof
• Nonlimiting examples of variants include SEQ ID NOs: 9, 27-45, 47-62, 66-69, 73-81 , 84-94, 96, 97, 99, and 101-113 of US20030138772, the contents of which are herein incorporated by reference in its entirety, and SEQ ID NOs: 1 , 2, 4-82, 89, 90, 93-95, 98, 100, 101 , 109-113, 118-120, 124, 126, 131 , 139, 142, 151 , 154, 158, 161 , 162, 165-183, 202, 204-212, 215, 219, and 224-236 of W02005033321 , the contents of which are herein incorporated by reference in its entirety.
• the AAV serotype is any of those described in U.S. 2021/0189430, the contents of which is herein incorporated by reference in its entirety.
• the amino acid sequence of the AAV may include one or more amino acid substitutions in an AAV capsid protein at one or more positions that interacts with a heparan sulfate proteoglycan or at one or more positions corresponding to amino acids 484, 487, 527, 532, 585, or 588, numbering based on VP1 numbering of AAV2.
• the AAV ITRs, and other selected AAV components described herein may be readily selected from among any AAV serotype, including, without limitation, AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 or other known and unknown AAV serotypes.
• the ITRs are from AAV2.
• These ITRs or other AAV components may be readily isolated using techniques available to those of skill in the art from an AAV serotype. Such AAV may be isolated or obtained from academic, commercial, or public sources (e.g., the American Type Culture Collection, Manassas, VA).
• the AAV sequences may be obtained through synthetic or other suitable means by reference to published sequences such as are available in the literature or in databases such as, e.g., GenBank, PubMed, or the like.
• Desirable AAV fragments for assembly into vectors include the cap proteins, including the vp1 , vp2, vp3, and hypervariable regions, the rep proteins, including rep 78, rep 68, rep 52, and rep 40, and the sequences encoding these proteins. These fragments may be readily utilized in a variety of vector systems and host cells. Such fragments may be used alone, in combination with other AAV serotype sequences or fragments, or in combination with elements from other AAV or non- AAV viral sequences.
• artificial AAV serotypes include, without limitation, AAV with a non-naturally occurring capsid protein.
• Such an artificial capsid may be generated by any suitable technique, using a selected AAV sequence (e.g., a fragment of a vp1 capsid protein) in combination with heterologous sequences which may be obtained from a different selected AAV serotype, noncontiguous portions of the same AAV serotype, from a non-AAV viral source, or from a non-viral source.
• An artificial AAV serotype may be, without limitation, a pseudotyped AAV, a chimeric AAV capsid, a recombinant AAV capsid, or a “humanized” AAV capsid.
• the AAV is AAV2/5 (i.e., an AAV having AAV2 ITRs and an AAV5 capsid).
• the AAV is AAV2/8 (i.e., an AAV having AAV2 ITRs and an AAV8 capsid).
• the AAV includes an AAV8 capsid.
• Such AAV8 capsid includes the amino acid sequence found under NCBI Reference Sequence: YP_077180.1.
• the AAV8 capsid includes a capsid encoded by nt 2121 to 4337 of GenBank accession: AF513852.1.
• the vectors useful in compositions and methods described herein contain, at a minimum, sequences encoding a selected AAV serotype capsid, e.g., an AAV2 capsid, or a fragment thereof.
• useful vectors contain, at a minimum, sequences encoding a selected AAV serotype rep protein, e.g., AAV2 rep protein, or a fragment thereof.
• such vectors may contain both AAV cap and rep proteins.
• the AAV rep and AAV cap sequences can both be of one serotype origin, e.g., an AAV2 origin.
• vectors may be used in which the rep sequences are from an AAV serotype which differs from that which is providing the cap sequences.
• the rep and cap sequences are expressed from separate sources (e.g., separate vectors, or a host cell and a vector).
• these rep sequences are fused in frame to cap sequences of a different AAV serotype to form a chimeric AAV vector, such as those described in U.S. Patent No. 7,282,199, which is incorporated by reference herein.
• a suitable recombinant AAV is generated by culturing a host cell which contains a nucleic acid sequence encoding an AAV serotype capsid protein, or fragment thereof, as defined herein; a functional rep gene; a minigene composed of, e.g., AAV ITRs and a trans-splicing molecule nucleic acid sequence; and sufficient helper functions to permit packaging of the minigene into the AAV capsid protein.
• the components required to be cultured in the host cell to package an AAV minigene in an AAV capsid may be provided to the host cell in trans.
• any one or more of the required components may be provided by a stable host cell which has been engineered to contain one or more of the required components using methods known to those of skill in the art.
• the AAV includes a promoter (or a functional fragment of a promoter).
• the selection of the promoter to be employed in the rAAV may be made from among a wide number of constitutive or inducible promoters that can express the selected transgene in the desired target cell. See, e.g., the list of promoters identified in International Patent Publication No. WO 2014/012482, incorporated by reference herein.
• the promoter is cellspecific.
• the term “cell-specific” means that the particular promoter selected for the recombinant vector can direct expression of the selected transgene in a particular cell type.
• the promoter is specific for expression of the transgene in photoreceptor cells.
• the promoter is specific for expression in the rods and/or cones. In another embodiment, the promoter is specific for expression of the transgene in retinal pigment epithelium (RPE) cells. In another embodiment, the promoter is specific for expression of the transgene in ganglion cells. In another embodiment, the promoter is specific for expression of the transgene in Mueller cells. In another embodiment, the promoter is specific for expression of the transgene in bipolar cells. In another embodiment, the promoter is specific for expression of the transgene in horizontal cells. In another embodiment, the promoter is specific for expression of the transgene in amacrine cells. In another embodiment, the transgene is expressed in any of the above noted cells.
• RPE retinal pigment epithelium
• the promoter is the native promoter for the target gene to be expressed.
• Useful promoters include, without limitation, a rod opsin promoter, a red-green opsin promoter, a blue opsin promoter, a cGMP-phosphodiesterase promoter, a mouse opsin promoter, a rhodopsin promoter, an alpha-subunit of cone transducing, a beta phosphodiesterase (PDE) promoter, a retinitis pigmentosa promoter, a NXNL2/NXNL 1 promoter, the RPE65 promoter, the retinal degeneration slow/peripherin 2 (Rds/perph2) promoter, and the VMD2 promoter.
• PDE beta phosphodiesterase
• the selected genetic element may be delivered by any suitable method, including those described herein.
• the methods used to construct any embodiment described herein are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY. Similarly, methods of generating rAAV virions are well known and the selection of a suitable method is not a limitation on methods and constructs described herein. See, e.g., K. Fisher et al., J. Virol., 1993 70: 520-532 and U.S. Patent 5,478,745, each of which is incorporated by reference herein.
• the trans-splicing molecule is included in a proviral plasmid, such as those disclosed in International Patent Publication No. WO 2012/158757, incorporated herein by reference.
• a proviral plasmid contains a modular recombinant AAV genome comprising in operative association: a wildtype 5’ AAV2 ITR sequence flanked by unique restriction sites that permit ready removal or replacement of said ITR; a promoter comprising a 49-nucleic acid cytomegalovirus sequence upstream of a cytomegalovirus (CMV)-chicken beta actin sequence, or a photoreceptorspecific promoter/enhancer, the promoter flanked by unique restriction sites that permit ready removal or replacement of the entire promoter sequence, and the upstream sequence flanked by unique restriction sites that permit ready removal or replacement of only the upstream CMV or enhancer sequence, from the promoter sequence.
• CMV cytomegalovirus
• the trans-splicing molecule described herein can be inserted into the site of a multi-cloning poly linker, wherein the trans-splicing molecule is operably linked to, and under the regulatory control of, the promoter.
• a bovine growth hormone polyadenylation sequence flanked by unique restriction sites that permit ready removal or replacement of said poly A sequence; and a wildtype 3’ AAV2 ITR sequence flanked by unique restriction sites that permit ready removal or replacement of the 3’ ITR; are also part of such a plasmid.
• the plasmid backbone comprises the elements necessary for replication in bacterial cells, e.g., a kanamycin resistance gene, and is itself flanked by transcriptional terminator/insulator sequences.
• a proviral plasmid comprises: (a) a modular recombinant AAV genome comprising in operative association: (i) a wildtype 5’ AAV2 ITR sequence flanked by unique restriction sites that permit ready removal or replacement of said ITR; (ii) a promoter comprising (A) a 49-nucleic acid CMV sequence upstream of a CMV-chicken beta actin sequence; (B) a photoreceptor-specific promoter/enhancer; or (C) a neuronal cell-specific promoter/enhancer.
• the promoter is flanked by unique restriction sites that permit ready removal or replacement of the entire promoter sequence, and the upstream sequence flanked by unique restriction sites that permit ready removal or replacement of only the upstream CMV or enhancer sequence, from the promoter sequence.
• a multi-cloning polylinker sequence that permits insertion of a trans-splicing molecule sequence including any of those described herein, wherein the trans-splicing molecule is operably linked to, and under the regulatory control of, the promoter; a bovine growth hormone polyadenylation sequence flanked by unique restriction sites that permit ready removal or replacement of said poly A sequence; and a wildtype 3’ AAV2 ITR sequence flanked by unique restriction sites that permit ready removal or replacement of the 3’ ITR.
• the proviral plasmid also contains a plasmid backbone comprising the elements necessary for replication in bacterial cells, and further comprising a kanamycin resistance gene, said plasmid backbone flanked by transcriptional terminator/insulator sequences.
• the proviral plasmid described herein may also contain in the plasmid backbone a non-coding lambda phage 5.1 kb stuffer sequence to increase backbone length and prevent reverse packaging of non-functional AAV genomes.
• the promoter of the proviral plasmid is modified to reduce the size of the promoter to permit larger trans-splicing molecule sequences to be inserted in the rAAV.
• the CMV/CBA hybrid promoter which normally includes a non-coding exon and intron totaling about 1 ,000 base pairs, is replaced with a 130-base pair chimeric intron, as described in International Patent Publication No. WO 2017/087900, which is incorporated herein by reference in its entirety.
• proviral plasmids are then employed in currently conventional packaging methodologies to generate a recombinant virus expressing the trans-splicing molecule transgene carried by the proviral plasmids.
• Suitable production cell lines are readily selected by one of skill in the art.
• a suitable host cell can be selected from any biological organism, including prokaryotic (e.g., bacterial) cells, and eukaryotic cells, including, insect cells, yeast cells and mammalian cells. Briefly, the proviral plasmid is transfected into a selected packaging cell, where it may exist transiently.
• the minigene or gene expression cassette with its flanking ITRs is stably integrated into the genome of the host cell, either chromosomally or as an episome. Suitable transfection techniques are known and may readily be utilized to deliver the recombinant AAV genome to the host cell.
• the proviral plasmids are cultured in the host cells which express the cap and/or rep proteins.
• the minigene consisting of the trans-splicing molecule with flanking AAV ITRs is rescued and packaged into the capsid protein or envelope protein to form an infectious viral particle.
• a recombinant AAV infectious particle is produced by culturing a packaging cell carrying the proviral plasmid in the presence of sufficient viral sequences to permit packaging of the gene expression cassette viral genome into an infectious AAV envelope or capsid.
• trans-splicing molecules can be delivered using a non-AAV vector, e.g., a non-viral vector.
• a non-viral vector Any suitable non-viral vector technology known in the art or described herein may be used.
• Such non-viral vectors amenable for delivery of trans-splicing molecules include liposomes (e.g., cationic liposomes, unilamellar liposomes, or multilamellar liposomes), nanoparticles (e.g., polymeric nanoparticles, lipid nanoparticles (LNPs), PEGylated nanoparticles (e.g., PEGylated LNPs), peptide nanoparticles, metal nanoparticles, and the like), dendrimers (e.g., cationic dendrimers, e.g., polypropylenimine dendrimers), exosomes (e.g., immunologically inert and/or targeted exosomes, e.
• trans-splicing molecules described herein may be delivered using cell penetrating peptides (CPPs), which can translocate the plasma membrane of a target cell and facilitate the delivery of a trans-splicing molecule to the interior of the target cell.
• CPPs cell penetrating peptides
• compositions including a nucleic acid trans- splicing molecule, a proviral plasmid, or a rAAV comprising any of the ABCA4 nucleic acid trans- splicing molecules described herein.
• the pharmaceutical composition includes any of the 5’ trans-splicing molecules described herein.
• the pharmaceutical composition includes a 5’ trans-splicing molecule and a 3’ trans-splicing molecule, e.g., wherein the 5’ trans-splicing molecule and the 3’ trans-splicing molecule together contain a functional sequence of ABCA4 exons and bind the same target ABCA4 intron (e.g., intron 22).
• Such pharmaceutical compositions may be prepared so as to be pure of contamination and suitable for /n vivo administration.
• the pharmaceutical compositions described herein may be assessed for contamination by conventional methods and then formulated into a pharmaceutical composition intended for a suitable route of administration.
• Still other compositions containing the trans-splicing molecule, e.g., naked DNA may be formulated similarly with a suitable carrier.
• Such formulation involves the use of a pharmaceutically and/or physiologically acceptable vehicle or carrier, particularly directed for administration to the target cell (e.g., an ocular cell).
• carriers suitable for administration to the target cells include buffered saline, an isotonic sodium chloride solution, or other buffers, e.g., HEPES, to maintain pH at appropriate physiological levels, and, optionally, other medicinal agents, pharmaceutical agents, stabilizing agents, buffers, carriers, adjuvants, diluents, etc.
• the carrier is a liquid for injection.
• physiologically acceptable carriers include sterile, pyrogen-free water and sterile, pyrogen-free, phosphate buffered saline. A variety of such known carriers are provided in U.S. Patent No. 7,629,322, incorporated herein by reference.
• the carrier is an isotonic sodium chloride solution.
• the carrier is balanced salt solution.
• the carrier includes tween. If the virus is to be stored long-term, it may be frozen in the presence of glycerol or TWEEN 20.
• compositions containing trans-splicing molecules described herein include a surfactant.
• useful surfactants such as Pluronic F68 (Poloxamer 188, also known as LUTROL® F68) may be included as they prevent AAV from sticking to inert surfaces and thus ensure delivery of the desired dose.
• one illustrative composition designed for the treatment of ocular diseases described herein comprises a recombinant adeno-associated vector carrying a nucleic acid sequence encoding a 5’ trans-splicing molecule or 3’ trans-splicing molecule as described herein, under the control of regulatory sequences which express the trans-splicing molecule in an ocular cell of a mammalian individual, and a pharmaceutically acceptable carrier.
• the carrier is isotonic sodium chloride solution and includes a surfactant Pluronic F68.
• the trans-splicing molecule is any of those described herein.
• the composition comprises a rAAV virus comprising any of the ABCA4 trans-splicing molecules described herein for ABCA4 gene correction, the nucleic acid sequence under the control of a promoter which directs expression of the trans- splicing molecule in photoreceptor cells, wherein the composition is formulated with a carrier and additional components suitable for subretinal injection.
• the composition or components for production or assembly of this composition including carriers, rAAV particles, surfactants, and/or the components for generating the rAAV, as well as suitable laboratory hardware to prepare the composition, may be incorporated into a kit.
• kits may further include instructions for administering the composition to an individual, e.g., as a treatment for an ocular disease, such as Stargardt Disease or Usher Syndrome.
• kits containing a pharmaceutical composition comprising a 5’ trans-splicing molecule e.g., wherein the trans-splicing molecule is packaged in any AAV vector described herein.
• the kit includes instructions for mixing the pharmaceutical composition prior to administration.
• ABCA4-related retinopathy presents with similar, but not identical clinical features. The vast majority have accumulation of lipofuscin and bilateral visual loss. ABCA4-related Stargardt disease typically shows a characteristic macular atrophy often with a beaten-bronze appearance on fundoscopy. Fundus flavimaculatus is similar but can reveal less macular atrophy and a greater presence of yellow-white flecks in the macula, extending to the mid-peripheral region. Subjects with ABCA4-related cone-rod dystrophy present with visual symptoms such as visual loss, impaired color vision, and a central scotoma.
• ABCA4-related Stargardt disease can be divided into childhood-onset, early adult-onset and late adult-onset. Each of these groups may have their own variations in phenotype that correlate with specific ABCA4 variants.
• Childhood-Onset Children with biallelic severe ABCA4 variants present with more aggressive central visual loss attributed to macular dysfunction alone or in combination with cone-rod dystrophy, typically between the ages of five and eleven years.
• Late Adult-Onset The definition of a “late” onset disease has varied from those > 35 to those > 50 years of age. Thus, patients can present from the fourth decade onwards. Patients are often identified incidentally through retinal screening due to relatively well-preserved best corrected visual acuity (BCVA) thought to be explained by atrophy sparing the fovea.
• BCVA best corrected visual acuity
• nucleic acid trans-splicing molecules e.g., nucleic acid trans-splicing molecules and nucleic acid trans-splicing molecule-encoding vectors
• compositions described above are useful for expressing functional ABCA4, and/or modulating expression of ABCA4, in a target cell (e.g., an ocular cell, a retinal cell, a photoreceptor and/or an RPE cell) of an individual in, e.g., methods for treating diseases or disorders associated with mutations in the ABCA4 gene, such as ABCA4- associated retinal dystrophies, such as Stargardt Disease and cone-rod dystrophy, including delaying or ameliorating symptoms associated with the disease described herein.
• a target cell e.g., an ocular cell, a retinal cell, a photoreceptor and/or an RPE cell
• nucleic acid trans- splicing molecules e.g., nucleic acid trans-splicing molecules and nucleic acid trans-splicing molecule-encoding vectors
• compositions described above are furthermore useful for expressing functional ABCA4, and/or modulating expression of ABCA4, in a target cell (e.g., an ocular cell, a retinal cell, a photoreceptor and/or an RPE cell) of an individual as applied, e.g., to their use for treating diseases or disorders associated with mutations in the ABCA4 gene, such as ABCA4- associated retinal dystrophies, such as Stargardt Disease and cone-rod dystrophy, including delaying or ameliorating symptoms associated with the disease described herein or to their use in the preparation of a medicament for the treatment of diseases or disorders associated with mutations in the ABCA4 gene, such as ABCA4-associated retinal dystrophies, such as Stargardt Disease and cone-rod dystrophy, including delaying or ameliorating symptoms associated with the disease described herein.
• Such methods and uses involve contacting a target ABCA4 gene (e.g., ABCA4 pre- mRNA) with a trans-splicing molecule as described herein [e.g., a 5’ trans-splicing molecule, or a mixture of both 3’ and 5’ trans-splicing molecules as described herein, a composition (e.g., a pharmaceutical composition) comprising same or a medicament comprising same], under conditions in which a CDS of the trans-splicing molecule is spliced to the target ABCA4 pre-mRNA to replace a part of the targeted pre-mRNA carrying one or more defects or mutations, with a functional (i.e., healthy), or normal or wildtype or corrected mRNA of the targeted gene, in order to correct expression of ABCA4 in the target cell.
• a functional i.e., healthy
• normal or wildtype or corrected mRNA of the targeted gene in order to correct expression of ABCA4 in the target cell.
• kits for expressing functional ABCA4 in a target cell by contacting (e.g., transducing) the target cell with any of the nucleic acid trans-splicing molecules, vectors (e.g., AAV vectors), or compositions described herein.
• the contacting involves direct administration of the composition (e.g., pharmaceutical composition) to the affected individual.
• the contacting may occur ex vivo with the cultured cell and the treated ocular cell reimplanted in the individual.
• the method involves administering an rAAV carrying any of the 5’ ABCA4 trans-splicing molecules described herein.
• the method involves administering a mixture of rAAV carrying a 3‘ trans-splicing molecule and rAAV carrying a 5 ‘ trans-splicing molecule.
• These methods comprise administering to an individual in need thereof an effective concentration of a composition of any of those described herein.
• the methods include selecting one or more trans-splicing molecules for treating an individual having a disorder associated with mutation/s in ABCA4.
• use of one or more trans-splicing molecules for treating an individual having a disorder associated with mutation/s in ABCA4 or use of same in the preparation of a medicament for the treatment of an individual having a disorder associated with mutation/s in ABCA4 is encompassed herein.
• Such methods and uses include selecting one or more trans-splicing molecules for treating an individual having a disorder associated with a mutation in ABCA4 or for use of such selected one or more trans-splicing molecules in treating an individual having a disorder associated with a mutation in ABCA4 or for use of such selected one or more trans-splicing molecules in the preparation of a medicament for the treatment of an individual having a disorder associated with mutation/s in ABCA4.
• selection can be based on the genotype of the individual.
• a disorder associated with ABCA4 may be an autosomal recessive disorder.
• the individual is homozygous or compound heterozygous for mutation/s in ABCA4. Methods of screening for and identifying particular mutations in ABCA4 are known in the art.
• Methods of the invention include selecting a single trans-splicing molecule based on the location of a single mutation in ABCA4 (e.g., a mutation of one allele of the individual). In some instances in the context of autosomal recessive mutations, correction of just one of two mutations can be sufficient to restore functional protein activity, for example, wherein the second allele has a mutation on the opposite portion of the ABCA4 gene, out of range of a single AAV-delivered trans- splicing molecule configured to correct the first mutation. Thus, in some embodiments, methods of the invention include administering a single trans-splicing molecule to correct a single mutation on the 5’ portion of the target gene, e.g., without regard to the location of the mutation in the other allele.
• the invention provides methods involving selecting a single trans-splicing molecule to correct two or more mutations on the 5’ portion of the ABCA4 gene, such that a single trans-splicing molecule capable of being packaged in an AAV vector is capable of spanning both or all of the mutations, thereby correcting both or all of the mutations.
• provided herein are methods for correcting multiple mutations within a ABCA4 gene using two trans-splicing molecules — a 5’ trans-splicing molecule and a 3’ trans- splicing molecule.
• the entire ABCA4 gene is replaced upon binding and trans- splicing of both trans-splicing molecules, for example, where the 5’ trans-splicing molecule and the 3’ trans-splicing molecule bind the same target ABCA4 intron and replace the exons upstream and downstream, respectively, of the target intron(s).
• compositions provided herein are administered to an individual as a method of treating a disease or disorder.
• the individual has a genetic disease, such as an ABCA4-related retinopathy as described herein.
• the individual is at risk of having a disease, such as an ABCA4-related retinopathy as described herein.
• the individual is at increased risk of having a disease or disorder caused by insufficient amount of a protein (e.g., ABCA protein) or insufficient activity of a protein (e.g., ABCA protein).
• an individual is “at an increased risk” of having a disease or disorder caused by insufficient amount of a protein or insufficient activity of a protein
• the method involves preventative or prophylactic treatment.
• an individual may be at an increased risk of having such a disease or disorder because of family history of the disease.
• individuals at an increased risk of having such a disease or disorder benefit from prophylactic treatment (e.g., by preventing or delaying the onset or progression of the disease or disorder).
• An effective concentration of a recombinant adeno-associated virus carrying a transsplicing molecule as described herein ranges between about 10 8 and 10 13 vector genomes per milliliter (vg/mL).
• the rAAV infectious units are measured as described in McLaughlin et al., J. Virol. 1988, 62: 1963.
• the concentration ranges between 10 9 and 10 13 vg/mL.
• the effective concentration is about 1.5 x 10 11 vg/mL.
• the effective concentration is about 5 x 10 11 vg/mL.
• the effective concentration is about 1 .5 x 10 10 vg/mL.
• the effective concentration is about 2.8 x 10 11 vg/mL. In yet another embodiment, the effective concentration is about 1 .5 x 10 12 vg/mL. In another embodiment, the effective concentration is about 1 .5 x 10 13 vg/mL.
• the concentration ranges between 4.0 X 10 10 and 1 X 10 12 vg/eye. In some embodiments, the effective concentration is about 1 .0 x 10 11 vg/eye. In some embodiments, the effective concentration is about 4.3 x 10 10 vg/eye.
• an effective dosage of a recombinant adeno-associated virus carrying a trans-splicing molecule as described herein ranges between about 10 8 and 10 13 vector genomes (vg) per dose (i.e., per injection). In one embodiment, the dosage ranges between 10 9 and 10 13 vg. In another embodiment, the effective dosage is about 1 .5 x 10 11 vg. In another embodiment, the effective dosage is about 5 x 10 11 vg.
• the effective dosage is about 1 .5 x 10 10 vg. In another embodiment, the effective dosage is about 2.8 x 10 11 vg. In yet another embodiment, the effective dosage is about 1 .5 x 10 12 vg. In another embodiment, the effective concentration is about 1 .5 x 10 13 vg. Still other dosages in these ranges or in other units may be selected by the attending physician, taking into account the physical state of the individual being treated, including the age of the individual; the composition being administered, and the particular disorder; the targeted cell and the degree to which the disorder, if progressive, has developed.
• the composition may be delivered in a volume of from about 50 pL to about 1 mL, including all numbers within the range, depending on the size of the area to be treated, the viral titer used, the route of administration, and the desired effect of the method.
• the volume is about 50 pL.
• the volume is about 70 pL.
• the volume is about 100 pL.
• the volume is about 125 pL.
• the volume is about 150 pL.
• the volume is about 175 pL.
• the volume is about 200 pL.
• the volume is about 250 pL.
• the volume is about 300 pL.
• the volume is about 350 pL.ln another embodiment, the volume is about 400 pL. In another embodiment, the volume is about 450 pL. In another embodiment, the volume is about 500 pL. In another embodiment, the volume is about 600 pL. In another embodiment, the volume is about 750 pL. In another embodiment, the volume is about 850 pL. In another embodiment, the volume is about 1 ,000 pL.
• a composition comprising an RNA exon editor described herein (e.g., an RNA exon editor comprising SEQ ID NO: 90, SEQ ID NO: 78, or SEQ ID NO: 69) may be supplied as a suspension suitable for injection.
• an RNA exon editor described herein may be administered by subretinal injection following pars plana vitrectomy through a small gauge cannula in a fixed volume of 300 pL.
• the volume and concentration of the rAAV composition are selected so that only certain anatomical regions having target cells are impacted. In another embodiment, the volume and/or concentration of the rAAV composition is a greater amount, in order to reach larger portions of the eye. Similarly, dosages are adjusted for administration to other organs.
• treatments and uses described herein replace 10% or more of the target ABCA4 mRNA in the target cell (e.g., 11% or more of the target ABCA4 mRNA in the target cell(s), 12% or more of the target ABCA4 mRNA in the target cell(s), 13% or more of the target ABCA4 mRNA in the target cell(s), 14% or more of the target ABCA4 mRNA in the target cell(s), 15% or more of the target ABCA4 mRNA in the target cell(s), 16% or more of the target ABCA4 mRNA in the target cell(s), 17% or more of the target ABCA4 mRNA in the target cell(s), 18% or more of the target ABCA4 mRNA in the target cell(s), or 19% or more of the target ABCA4 mRNA in the target cell(s).
• the target ABCA4 mRNA in the target cell e.g., 11% or more of the target ABCA4 mRNA in the target cell(s), 12% or more of
• treatments and uses described herein replace 20% or more of the target ABCA4 mRNA in the target cell [e.g., 21% or more of the target ABCA4 mRNA in the target cell(s), 22% or more of the target ABCA4 mRNA in the target cell(s), 23% or more of the target ABCA4 mRNA in the target cell(s), 24% or more of the target ABCA4 mRNA in the target cell(s), 25% or more of the target ABCA4 mRNA in the target cell(s), 26% or more of the target ABCA4 mRNA in the target cell(s), 27% or more of the target ABCA4 mRNA in the target cell(s), 28% or more of the target ABCA4 mRNA in the target cell(s), 29% or more of the target ABCA4 mRNA in the target cell(s), 30% or more of the target ABCA4 mRNA in the target cell(s), 31% or more of the target ABCA4 mRNA in the target cell(s), 32% or
• treatments and uses described herein replace 5% or 10% or more of the target ABCA4 protein in the target cell [e.g., 11% or more of the target ABCA4 protein in the target cell(s), 12% or more of the target ABCA4 protein in the target cell(s), 13% or more of the target ABCA4 protein in the target cell(s), 14% or more of the target ABCA4 protein in the target cell(s), 15% or more of the target ABCA4 protein in the target cell(s), 16% or more of the target ABCA4 protein in the target cell(s), 17% or more of the target ABCA4 protein in the target cell(s), 18% or more of the target ABCA4 protein in the target cell(s), or 19% or more of the target ABCA4 protein in the target cell(s)].
• the target ABCA4 protein in the target cell e.g., 11% or more of the target ABCA4 protein in the target cell(s), 12% or more of the target ABCA4 protein in the target cell(s), 13% or more of the target
• treatments and uses described herein replace 20% or more of the target ABCA4 protein in the target cell [e.g., 21% or more of the target ABCA4 protein in the target cell(s), 22% or more of the target ABCA4 protein in the target cell(s), 23% or more of the target ABCA4 protein in the target cell(s), 24% or more of the target ABCA4 protein in the target cell(s), 25% or more of the target ABCA4 protein in the target cell(s), 26% or more of the target ABCA4 protein in the target cell(s), 27% or more of the target ABCA4 protein in the target cell(s), 28% or more of the target ABCA4 protein in the target cell(s), 29% or more of the target ABCA4 protein in the target cell(s), 30% or more of the target ABCA4 protein in the target cell(s), 31% or more of the target ABCA4 protein in the target cell(s), 32% or more of the target ABCA4 protein in the target cell(s), 33% or more of the target ABCA
• the increase may be clinically significant.
• the increase may be relative to the level of functional ABCA4 protein in the subject without treatment or relative to the amount of functional ABCA4 protein in a population of similar subjects.
• the increase may be at least 10% more functional ABCA4 protein relative to the subject prior to treatment or to a population of similar subjects.
• the increase may be at least 20% more functional ABCA4 protein relative to the subject prior to treatment or to a population of similar subjects.
• the increase may be at least 40% more functional ABCA4 protein relative to the subject prior to treatment or to a population of similar subjects.
• the increase may be at least 50% more functional ABCA4 protein relative to the subject prior to treatment or to a population of similar subjects.
• the increase may be at least 80% more functional ABCA4 protein relative to the subject prior to treatment or to a population of similar subjects.
• the increase may be at least 100% more functional ABCA4 protein relative to the subject prior to treatment or to a population of similar subjects.
• the increase may be at least 200% more functional ABCA4 protein relative to the subject prior to treatment or to a population of similar subjects.
• the increase may be at least 500% more functional ABCA4 protein relative to the subject prior to treatment or to a population of similar subjects.
• methods and uses described herein reduce ABCA4-associated lipofuscin in a subject (e.g., a subject having an ABCA4-associated retinal dystrophy). In other instances, methods and uses described herein reduce A2E accumulation in a subject (e.g., a subject having an ABCA4-associated retinal dystrophy).
• the treatment or use may be used to prevent the occurrence of further damage or to rescue tissue having mild, moderate, or advanced disease.
• rescue means to prevent progression of the disease, prevent spread of damage to uninjured cells, and/or to improve damage in injured cells.
• the composition is administered before disease onset. In another embodiment, the composition is administered prior to the development of symptoms. In another embodiment, the composition is administered after development of symptoms. In yet another embodiment, the composition is administered when less than 90% of the target cells are functioning or remaining, e.g., as compared to a reference tissue. In yet another embodiment, the composition is administered when more than 10% of the target cells are functioning or remaining, e.g., as compared to a reference tissue. In yet another embodiment, the composition is administered when more than 20% of the target cells are functioning or remaining. In yet another embodiment, the composition is administered when more than 30% of the target cells are functioning or remaining. In yet another embodiment, the composition is administered when more than 40% of the target cells are functioning or remaining.
• the composition is administered when more than 50% of the target cells are functioning or remaining. In yet another embodiment, the composition is administered when more than 60% of the target cells are functioning or remaining. In yet another embodiment, the composition is administered when more than 70% of the target cells are functioning or remaining. In yet another embodiment, the composition is administered when more than 80% of the target cells are functioning or remaining. In yet another embodiment, the composition is administered when more than 90% of the target cells are functioning or remaining. In yet another embodiment, the composition is administered when more than 95% of the target cells are functioning or remaining.
• any of the above-described methods or uses is performed in combination with another, or secondary, therapy.
• the therapy may be any now known, or as yet unknown, therapy which helps prevent, arrest or ameliorate these mutations or defects or any of the effects associated therewith.
• the secondary therapy can be administered before, concurrent with, or after administration of a pharmaceutical composition described above.
• a secondary therapy involves non-specific approaches for maintaining the health of the retinal cells, such as administration of neurotrophic factors, anti-oxidants, and/or anti-apoptotic agents.
• the non-specific approaches are achieved through injection of proteins, recombinant DNA, recombinant viral vectors, stem cells, fetal tissue, or genetically modified cells. The latter could include genetically modified cells that are encapsulated.
• the method includes performing functional and imaging studies to determine the efficacy of the treatment. These studies include ERG and in vivo retinal imaging, as described in U.S. Patent No. 8,147,823; in International Patent Publication Nos. WO 2014/011210 or WO 2014/124282, incorporated herein by reference.
• visual field studies e.g., kinetic perimetry or full field static perimetry
• microperimetry slit lamp examination, intraocular pressure measurement, dilated fundus ophthalmoscopy, mobility testing, visual acuity, and/or color vision testing may be performed.
• Efficacy may be measured at time points following administration of the nucleic acid trans-splicing molecules and RNA exon editors encoded thereby as described herein or compositions comprising same (e.g., pharmaceutical compositions) to determine if symptoms of ABCA4-related retinopathies are, e.g., reduced in treated subjects versus untreated subjects.
• efficacy may be measured by, for example, an improvement in visual acuity and/or color vision or a decrease in lipofuscin, including A2E accumulation.
• the volume and viral titer of each injection is determined individually and may be the same or different from other injections performed in the same, or contralateral, eye. In another embodiment, a single, larger volume injection is made in order to treat the entire eye.
• the dosages, administrations, and regimens may be determined by the attending physician given the teachings of this disclosure.
• ABCA4 trans-splicing molecules were tested in cultured human cells using a high- throughput, NGS-based assay in which various permutations were tested in each trans-splicing molecule. Results are shown in FIG. 1 .
• Each ABCA4 trans-splicing molecule in this example included a 5’ regulatory domain including a CMV promoter and a native 5’ UTR and a functional ABCA4 CDS. Domains that were varied across trans-splicing molecules were the linker domain, the binding domain (BD), the 3’ DS, and the terminator.
• trans-splicing molecules were transfected into cells as plasmid and detected by unique molecule identifier (UMI) according to known RNA-seq methods.
• UMI unique molecule identifier
• Trans-splicing efficiency readouts show that certain domains showed improved trans-splicing across many or all permutations. For instance, here, a 40-mer linker of SEQ ID NO: 27 unexpectedly exhibited the highest trans-splicing efficiency, relative to shorter linkers of SEQ ID NO: 29 and 31. Also, a binding domain having SEQ ID NO: 18 exhibited the highest trans-splicing efficiency among all binding domains tested. It is also noteworthy that certain combinations of linker domains, BDs, and splice sites (SSs) conferred surprising levels of relative trans-splicing efficiency.
• Splice site evaluation Splice site evaluation
• RNA sequences encoded thereby are referred to herein as GUAAGU, GUAAGG, GUAAGC, and GUAACU, respectively.
• FIG. 2 shows trans-splicing activity (exon editing activity) in arbitrary units. These results show that a splice site comprising GTAAGT conferred the highest trans-splicing activity out of the five splice sites tested. Accordingly, an exemplary splicing domain described herein comprises GUAAGT, which is encoded by GTAAGT.
• AAV-56 is an AAV vector that encodes an ABCA4 trans-splicing molecule having SEQ ID NO: 40.
• AAV-274 is an AAV vector that encodes an ABCA4 trans-splicing molecule having
• AAV-443 is an AAV vector that encodes an ABCA4 trans-splicing molecule having
• AAV-497 is an AAV vector that encodes an ABCA4 trans-splicing molecule having
• AAV-505 is an AAV vector that encodes an ABCA4 trans-splicing molecule having
• Membrane protein extraction was performed using conventional methods. Briefly, permeabilization buffer and protease/phosphatase inhibitor were added to cells, vortexed, incubated at 4C for 10 minutes. Permeabilized cells were centrifuged, and the pellet was resuspended in solubilization buffer with protease/phosphatase inhibitor. Samples were incubated at 4°C for 30 minutes before centrifugation. Supernatants containing membrane protein were transferred and stored at -80°C.
• AAV-274, AAV-443, AAV-497, and AAV-505 each exhibited improved trans-splicing efficiency relative to AAV-56 (37.3%, 38.7%, 28.5%, and 28.5%, respectively, relative to 23.8%).
• AAV- 274 and AAV-443 each exhibited significantly higher on-target copy number, compared to AAV-56.
• FIG. 3C shows a Western blot showing protein expression in replicates of each of AAV-443-2 and AAV-652. Results are given as fold change in FIG. 3D. Remarkably, full restoration of ABCA4 protein levels was observed in ABCA4 knockout cells (FIG. 3D).
• ABCA4 Recessively inherited mutations in ABCA4 are causal in the development of progressive forms of blindness including Stargardt disease 1 and cone-rod dystrophy 3.
• the 6882-bp coding sequence of ABCA4 is too large to be delivered in its entirety by a single AAV vector.
• a large-scale exon editing solution was designed to deliver a therapeutic RNA construct capable of trans-splicing into endogenous ABCA4 pre-mRNA, thereby introducing functional exons that correct a myriad of mutations localized in the functional exons delivered via trans-splicing.
• RNA trans-splicing with a single AAV-based construct can address approximately 60% of all patient mutations.
• This example reports the editing efficiency and tolerability of AAV-ABCA4 exon editors in vivo in healthy African Green Monkey (AGM) non-human primates (NHP) following subretinal injection.
• AGM African Green Monkey
• NHS non-human primates
• Exon editors 443 SEQ ID NO: 47
• 274 SEQ ID NO: 48
• 497 SEQ ID NO: 49
• 505 SEQ ID NO: 50
• AAV8 vector preparations were characterized using qPCR of shared regulatory elements to titer, Stunner for measurement of full and empty capsids, and measurement of endotoxin levels. Results are shown in Table 2, below.
• VP1 , VP2 and VP3 proteins for each preparation were detected and visualized on an SDS gel run at 5x10 vg/well (FIG. 4).
• FIGS. 5A-5C GFP-encoding AAV vectors containing a 5’ regulatory domain of SEQ ID NO: 15 (i.e., containing a CMV promoter and a native 5’ ABCA4 untranslated region) were administered subretinally in African Green Monkey (AGM) non-human primates (NHP).
• AGM African Green Monkey
• NHP non-human primates
• FIGS. 5A-5C GFP protein expression is shown in FIGS. 5A-5C.
• FIG. 5A is a live image showing GFP protein.
• FIG. 5B is a photomicrograph showing anti-GFP immunohistochemistry (IHC) staining of retinal sections (photoreceptors and choroid are labeled) in a negative control at day 28.
• IHC anti-GFP immunohistochemistry
• 5C is a photomicrograph showing anti-GFP IHC staining of retinal sections (photoreceptors and choroid are labeled) in a GFP exon editor-treated animal at day 28. These results show that the 5’ regulatory domain confers robust protein expression in photoreceptors in vivo.
• ABCA4 exon editors were formulated as AAV8 and were administered subretinally in AGM NHP as two blebs per eye. Each injection was 100 pl containing 1x10 11 vg. cSLO and OCT images of baseline, post subretinal injections, day 14 and day 28, are shown in FIG. 6. Superior and inferior blebs were observed post-injection. A slight ‘shadow’ of the bleb area was observed through day 28.
• tagged full-length trans-spliced ABCA4 protein was quantified in membrane extracts from retina by western blot of the tag.
• An exemplary western blot showing full-length ABCA4 expression for exon editors 443, 274, 497, and 505 is shown in FIG. 9.
• Ophthalmic health was monitored throughout the study. In general, ophthalmic health was maintained after treatment with AAV8 subretinally delivered exon editors, as measured by retinal thickness (FIG. 11A), intraocular pressure (FIG. 11 B), total clinical score (FIG. 11 C), vitreous cell score (FIG. 11 D), aqueous cell score (FIG. 11 E), and inflammatory keratic particles (FIG. 11 F). Retinal thickness remained normal throughout the study (FIG. 11 A). Tonometry showed intraocular pressure was reduced on day 7 in vehicle-treated eyes and stabilized at later timepoints (FIG. 11 B). Intraocular pressure remained in a healthy range in exon editor-treated eyes.
• Ocular inflammation was assessed by slit lamp biomicroscopy and fundoscopy (FIGS. 11C-11F). Individual eyes treated with exon editors showed some signs of mild-to-moderate inflammation, but not consistently for a certain editor or AAV preparation, suggesting that these observations were due to the procedure in an individual eye.
• HEK293T-based cell line termed B6, was engineered that expresses both high ABCA4 RNA and protein levels. This was achieved via the knock-in (KI) of a constitutive CAGGS promoter between the endogenous ABCA4 promoter and exon 1 via CRISPR- mediated homology-directed repair (HDR).
• KI knock-in
• HDR CRISPR- mediated homology-directed repair
• a protein knock-out (KO) cell line was engineered based on the B6 cell line. 17+06 cells continued to produce high levels of ABCA4 RNA, but in contrast to the B6 cell line, 17+06 cells do not produce ABCA4 protein.
• Engineering 17+06 cells was achieved by introducing mutations into the ABCA4 gene coding sequence using CRISPR and guide RNAs (gRNA) targeting exons 3 and 4. RT-qPCR confirmed the persistence of ABCA4 RNA expression in the 17+06 cell line, and Western blot analysis indicated that ABCA4 protein translation was abolished. See FIG. 3C.
• ABCA4 KO (17+06) cells were transfected with several ABCA4 RNA Exon Editor constructs to assess trans-splicing efficiency and resultant expression of ONT trans-spliced ABCA4 protein.
• the constructs were identical but for the elements indicated as distinguishing each as reflected in the labels for the 4 lanes in FIGs. 19A and 19B.
• An exemplary ABCA4 RNA Exon Editor Construct comprising an exemplary ABCA4 RNA Exon Editor depicted in FIG.
• FIGs. 19A and 19B illustrate the activity of each of the indicated RNA exon editor (RTM) elements, alone and in combination, in the context of an exemplary ABCA4 5’ construct.
• FIG. 19A shows a histogram depicting percent replacement of ABCA4 RNA for each construct indicated. The percent replacement ranges from around 20-30% for each construct.
• the combination of 40mer + 3x repeat of a U1 binding site (3XUBS) shows a trend toward increasing percent replacement of ABCA4 RNA relative to 40mer alone (SEQ ID NO: 27).
• 19B presents western blots showing that the indicated constructs comprising the 40mer (SEQ ID NO: 27), 40mer + 3XUBS (SEQ ID NO: 72), 40mer + AU-rich elements (sequences 3444- 3529 of SEQ ID NO: 86), and 40mer + 3XUBS + ARE (SEQ ID NO: 73) express trans-spliced ABCA4 protein (ONT) and in combination, these RTM elements exhibit a trend toward increased ONT levels relative to 40mer alone.
• the indicated constructs comprising the 40mer (SEQ ID NO: 27), 40mer + 3XUBS (SEQ ID NO: 72), 40mer + AU-rich elements (sequences 3444- 3529 of SEQ ID NO: 86), and 40mer + 3XUBS + ARE (SEQ ID NO: 73) express trans-spliced ABCA4 protein (ONT) and in combination, these RTM elements exhibit a trend toward increased ONT levels relative to 40mer alone.
• ONT trans-
• cassette of the 40mer + 3XUBS + ARE confers an even more significant decrease in NSP levels relative to that of RNA exon editors comprising 40mer only, 40mer + 3XUBS, or 40mer + ARE.
• This combination of elements (40mer + 3XUBS +ARE; SEQ ID NO: 73), therefore, exhibits particularly advantageous properties in the context of trans-splicing molecules such as those described herein.
• NSP was reduced in a combinatorial manner by the inclusion of 3X UBS and an ARE in the Intron A-targeting RNA Exon Editor for which results are depicted.
• the Intron A-targeting RNA Exon Editor targets an intron in a pre-mRNA that is different from ABCA4.
• HEK293 cells were transfected with Intron A-targeting RNA Exon Editors that varied at their linker region to include the indicated RNA exon editor elements (40mer, 40mer + 3XUBS, 40mer + ARE, and 40mer + 3XUBS + ARE). Cells were harvested 48 hours post-transfection, assayed for transsplicing efficiencies by RT-qPCR (FIG.
• NSP was reduced in a combinatorial manner by the inclusion of 3X UBS and an ARE in the Intron B-targeting RNA Exon Editor for which results are depicted.
• the Intron B-targeting RNA Exon Editor targets an intron in a pre-mRNA that is different from ABCA4 and from the pre-mRNA targeted by the Intron-A targeting RNA Exon Editor.
• HEK293 cells were transfected with Intron B-targeting RNA Exon Editors that varied at their linker region to include the indicated RNA exon editor elements (40mer, 40mer + 3XUBS, 40mer + ARE, and 40mer + 3XUBS + ARE).
• ABCA4 RNA Exon Editor Construct (ABCA4-01) comprising an exemplary ABCA4 RNA Exon Editor depicted in FIG. 13 (SEQ ID NO: 90, which comprises SEQ ID NO: 78) into a surrogate AAV2 capsid and evaluated a dose response in the ABCA4 KO cell line.
• ABCA4 KO cells were transduced with increasing MOIs 1 X 10 3 to 1 X 10® (1 e3-1 e6) of AAV2-ABCA4 RNA Exon Editor Construct comprising an exemplary ABCA4 RNA Exon Editor depicted in FIG.
• OFT RNA sequencing is a global OFF-target discovery method developed by the present inventors. This method utilizes RNA extracted from cells, NHP neural retina samples, or human retinal explants that have either been transfected with plasmids or transduced with AAV encoding ABCA4 Exon Editors or relevant controls.
• the Exon Editor specific codon optimized CDS upstream of the 3’ of Exon22 is used as a targeted primer (gene specific primer: GSP) region. Since this method only targets upstream sequences of the Exon Editor, it can be used to capture unbiased global OFF-target non-ABCA4 RNA sequences.
• This method therefore, allows capture of non-spliced Exon Editor, self-spliced Exon Editor, and intended ONT edited ABCA4 RNA and OFT (Figure 25). These sequences are then sequenced with an Illumina short read NGS platform. Output NGS reads are processed with proprietary computational bioinformatics analysis tools developed in house. This analysis provides overall sequencing quality and target junction sequences as well as quantitative information for each variant sequence.
• RNA samples were first treated with DNase to eliminate residual genomic DNA, plasmid DNA/AAV DNA, and possible contaminant DNA. Then enrichment of RNA was performed with either ribosomal RNA (rRNA) depletion or PolyA enrichment. Enriched RNA samples were then fragmented. After Illumina adapter ligation and cDNA preparation, GSP-targeting ABCA4 codon optimized sequence and adapter targeting primer were used for PCR. This step amplifies target sequences bearing ABCA4 codon optimized sequences - including Exon Editor, ONT, OFT and self-spliced Exon Editor.
• rRNA ribosomal RNA
• the present inventors discovered through extensive experimental and computational analyses of results in vitro and in vivo (NHP) that cryptic splice sites are utilized in the context of the ABCA4 exon editors described herein.
• the present inventors performed extensive experimentation and analyses, including the generation of an off-target (OFT) library and bioinformatic analyses thereof, and surprisingly discovered numerous locations within the ABCA4 coding sequence (CDS) comprising exons 1-22 wherein cryptic splicing occurs in the context of trans-splicing molecules described herein.
• OFT off-target
• the sequences of a plurality of the cryptic splice sites were modified to impair and/or disable the cryptic splice sites by introduction of synonymous mutations therein.
• Such an approach takes advantage of the degeneracy of the genetic code, which permits introduction of the desired modifications to mitigate cryptic splice site use without resulting in a change in the encoded amino acid.
• NGS Next Generation Sequencing
• the present inventors identified cryptic splice sites and quantitated the frequency of cryptic splice use at each of the different locations within the ABCA4 CDS comprising exons 1-22, thereby establishing a protocol for data driven, prioritized mitigation of cryptic splice use therein. See Table 3 and FIG. 26. As shown in Table 3, the cryptic splice sites identified are arranged in order of frequency of use as determined by the average counts per million reads mapped (CPM) incorporated before introduction of synonymous mutations.
• CPM average counts per million reads mapped
• results and bioinformatic analyses thereof establish a prioritized list of cryptic splice sites in ABCA4 exons 1-22 that may be modified to generate an ABCA4 CDS having improved properties (e.g., cryptic splice site resistant ABCA4 CDS) and functionality in the context of a trans-splicing molecule.
• FIG. 26 illustrates the function conferred by introduction of synonymous mutations at identified cryptic splice sites in an exemplary ABCA4 exon editor by showing the frequency of cryptic splice site cleavage before introduction of synonymous mutations at identified cryptic splice sites (top panel) and after introduction of synonymous mutations at identified cryptic splice sites (bottom panel; splice site resistant sequence).
• FIG. 26 shows that a significant reduction in splicing frequency is observed following cryptic splice site mitigation.
• Table 3 Lists cryptic splice sites identified in ABCA4 coding domain sequences (CDS) and frequency of splicing at each splice site identified before and after splice site mitigation.
• SEQ ID NO: 46 represents an exemplary sequence before introduction of synonymous mutations
• SEQ ID NO: 79 represents an exemplary sequence after introduction of synonymous mutations.
• the nucleotide position indicated in the rtm_pos column refers to the position of the last nucleotide indicated in column 2 or column 3 relative to the G of the ATG codon (the translational initiation site).
• the abbreviation “not” is used to indicate that a nucleotide change was not made in the indicated sequence (SEQ ID NO: 79); the abbreviation for branchpoint is “bp”.
• “Canonical amino acids” refer to those 20 amino acids found naturally in the human body shown in Table 6 below.
• Table 6 Depicts the canonical amino acids with each of their three letter abbreviations, one letter abbreviations, structures, and corresponding codons:
• the primary objective of this study is to confirm persistent Exon Editor expression and efficacy at the 1- and 3-month timepoints following subretinal administration of an exemplary AAV8- ABCA4 RNA Exon Editor construct at a dose of 4.3 X 10 10 (4.3E10) vg/eye oculus uterque (OU; both eyes) in African Green monkey (AGM).
• the exemplary AAV8-ABCA4 RNA Exon Editor construct comprises SEQ ID NO: 77.
• the Exon Editor encoded by the exemplary AAV8-ABCA4 RNA Exon Editor construct comprises the same regulatory elements (enhancer, promoter and 5’ UTR) as described in FIG.
• the AAV8-ABCA4 RNA Exon Editor construct titer was measured using a ddPCR assay with a forward primer and probe targeting the terminal exon 22 within the Exon Editor’s ABCA4 CDS and a reverse primer spanning the 40mer linker and double STOP codon sequence in the Exon Editor construct. This same ddPCR assay has been used to calculate the titer of other exemplary ABCA4 RNA Exon Editor constructs.
• RT-qPCR was used to measure expression of edited ABCA4 RNA, native NHP ABCA4 RNA, and the exemplary AAV8-ABCA4 RNA Exon Editor construct, all normalized to the housekeeping gene RNF20.
• the percentage of ABCA4 RNA replacement at 4 weeks (1 month) ranged from 14.4% to 31.5%, and at 12 weeks (3 months) ranged from 26.3% to 37.8%.
• the range of Exon Editor copy number per 10 ng RNA at 4 weeks was 1.3E6 to 0.6E6 and at 12 weeks 2.1 E6 to 3.0E6.
• the primary objective of this study was to confirm in vivo safety and efficacy of the exemplary AAV8-ABCA4 RNA Exon Editor (ABCA4-01 ; SEQ ID NO: 90), which comprises SEQ ID NO: 78) at 1- and 6-month timepoints.
• Two dose levels were being evaluated in this study; 3.5E11 and 1 E12 vg/eye, given as a single subretinal injection per eye (OU) in male cynomolgus macaques.
• VCC vector genome DNA copy
• VGC was evaluated in optic chiasm, optic tract, optic nerve.
• the following non-ocular tissues were collected: brain, dorsal root ganglion (lumbar), heart, kidney, liver, gallbladder, lateral geniculate nucleus, lung, lymph nodes (mandibular and mesenteric), spleen, and testis.
• the initial plan was to analyze all non-ocular tissues from only the 1 E12 vg/eye dose group at the 1-month timepoint to assess the need for downstream and future analysis requirements.
• RT-qPCR (or ddPCR) was used to measure edited ABCA4 RNA, native NHP ABCA4 RNA, and ABCA4-01 Exon Editor RNA expression, all normalized to the housekeeper RNF20. Beyond neural retinal samples, only tissues positive for ABCA4-01 VGC were evaluated for ABCA4-01 Exon Editor RNA expression.
• Intraocular pressure remained stable throughout the study in all groups. Imaging of the eyes with cSLO/OCT showed fundus changes consistent with subretinal injection and did not show changes attributed to ABCA4-01 administration (study ongoing, day 8 data evaluated).
• Anti-AAV8 NAbs were evaluated prior to ABCA4-01 administration in all animals. These titers ranged from below 1:10 to >1:100. The pre-existing NAb titer data was used to distribute animals across the three groups. At 4- or 5-weeks, vehicle dosed animals had NAb titers within the range >1:10 to >1:100 while those dosed with ABCA4-01 at either dose ranged from >1:100 to 1 > 1 :1000 consistent with an expected adaptive immune response against a minor amount of AAV8 capsid that can leak from the subretinal bleb into systemic circulation. [0354] Cage side monitoring of animal health and measuring of body weights showed no signs of adverse events.
• Example 10 Definitive GLP Toxicology Study: Evaluation of Exemplary ABCA4 trans-splicing molecule in vivo
• Endpoints included ocular and systemic safety assessments both in-life and samples collected at necropsy.
• In-life assessments of general and ocular health were performed as follows: Detailed observations (weekly), body weights (pretest, day -1 and weekly thereafter), food consumption (weekly), ophthalmology (pretest, weeks 1 and 5 and prior to terminal necropsy; indirect ophthalmoscopy and slit lamp biomicroscopy), intraocular pressure measurements (pretest, weeks 1 and 5 and prior to terminal necropsy), confocal laser ophthalmoscopy (pretest, week 5 and prior to terminal necropsy), optical coherence tomography (pretest, week 5 and prior to terminal necropsy), clinical pathology (hematology, coagulation, clinical chemistry: twice pre-test, day 1 pre-dose, days 2, 8, 15, 22, 29, 35, 43, 50, 57 and monthly thereafter until necropsy).
• VGC was evaluated only in tissues that are positive for ABCA4-01 VGC in the 1 E12 vg/eye dose group at 1-month from the Investigative Toxicology Study described above. Likewise, ABCA4-01 RNA expression was measured in tissues positive for ABCA4-01 VGC.
• FIGs. 30A-30C present results demonstrating robust ABCA4 RNA and protein replacement in vivo in NHP six (6) months after treatment with an exemplary AAV8 RNA exon editor construct (ABCA4-01 ; SEQ ID NO: 90).
• Viral genome copy (VGC) x-axis
• exon editor RNA copies numbers y-axis
• FIG. 30A % ABCA4 RNA replacement is shown in FIG. 30B
• DNA and RNA levels were evaluated using Droplet Digital Polymerase Chain Reaction (ddPCR) based assays. Percent total protein (edited ABCA4 relative to the sum of edited and NHP native protein) was quantified using a qualified immu no-affinity mass spectrometry (IA-MS) assay.
• the exemplary AAV8 RNA exon editor construct used in this in vivo study comprises an RNA exon editor comprising SEQ ID NO: 90. Results for four (4) NHPs are shown and designated in (B) and (C) as 1-4: 1 (vehicle treated); 2-4 (treated with 3.5E11 vg/eye).
• the present inventors treated wild-type cynomolgus macaques with a single subretinal dose of ABCA4-01 (3.5E11 vg/eye).
• AAV vector genome DNA copy (VGC) biodistribution, Exon Editor RNA expression, and the percent of edited ABCA4 RNA and protein at a 6-month timepoint were then evaluated.
• Exon Editor RNA expression correlated well with VGC (FIG. 30A) and resulted in robust % RNA replacement (conversion of native ABCA4 RNA copies to edited copies), calculated as the percent of edited ABCA4 RNA out of the total (edited + native) ABCA4 RNA population present in the neural retina samples (FIG. 30B). As shown in FIG.
• the percent RNA replacement ranged from about 40%-60% for this dose of ABCA4-01.
• human NHP chimeric ABCA4 protein which results from ABCA4 RNA editing in these animals, was found to be present at 20-40% of the total (human-NHP + NHP) ABCA4 protein in the tested samples.
• the present inventors have, moreover, demonstrated up to 66% RNA replacement and up to 45% human NHP chimeric ABCA4 protein in wild-type cynomolgus macaques treated with a higher dose of ABCA4-01 delivered via single subretinal injection. These results demonstrate that ABCA4-01 achieves therapeutically relevant levels of edited ABCA4 protein expression in NHP, which exceed the levels of rescued ABCA4 protein previously shown to confer therapeutic benefit in an Abca4 KO mouse model.
• Example 11 AAV vector plasmid comprising RNA exon editor SEQ ID NO: 78
• the plasmid (SEQ ID NO: 82) encoding ABCA4-01 is a 13,232 base pair (bp) AAV vector plasmid comprising the RNA exon editor (SEQ ID NO: 78) flanked by AAV2 ITRs (SEQ ID NO: 90).
• the plasmid backbone contains a Kanamycin resistance (KanR) gene, a bacterial origin of replication and two non-coding regions derived from the Opsin 1 intron 1. These latter sequences are described as ‘stuffer’ sequences and are designed to increase the size of the plasmid beyond the packaging limit for AAV and therefore reduce the level of possible encapsidated plasmid DNA backbone components.
• KanR Kanamycin resistance
• FIG. 23 A schematic representation of AAV vector plasmid is presented in FIG. 23 and additional details regarding same are presented in Table 5.
• the present inventors treated human donor retinal explants with ABCA4-01 , an exemplary AAV8 RNA exon editor construct comprising SEQ ID NO: 90.
• the present inventors have found that incubating explants from multiple donors with ABCA4-01 (3.9E11 vg) for 21 days results in approximately 20-30% RNA replacement of the endogenous exons 1-22 with the same corresponding exons encoded by ABCA4-01 (FIG. 31).
• the donor explants in this experiment came from individuals without any previously diagnosed retinal disease.
• the same lot of ABCA4-01 was also used in the investigative NHP study mentioned above (FIG. 30), further strengthening the present inventors’ confidence in the translatability of ABCA4-01 results from NHP to human subjects.
• a nucleic acid trans-splicing molecule comprising:
• a linker domain comprising, consisting essentially of, or consisting of SEQ ID NO: 27 or a sequence having at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, or at least 99% identity to SEQ ID NO: 27;
• c optionally, a coding domain sequence (CDS) comprising ABCA4 exons;
• CDS coding domain sequence
• a splicing domain optionally, a potentiator comprising at least one of GGTAAGT or SEQ ID NO: 61 or a sequence having at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, or at least 99% identity to GGTAAGT or SEQ ID NO: 61 ; and
• a translational potentiator comprising a sequence consisting of SEQ ID NO: 63 or a sequence having at least 90% identity, at least 91 % identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, or at least 99% identity to SEQ ID NO: 63, wherein the CDS; the splicing domain, when present; the linker domain; the potentiator, when present; the translational potentiator, when present; and the binding domain are operatively linked in a 5’-to-3’ direction.
• nucleic acid trans-splicing molecule of embodiment 1 wherein the binding domain anneals to an intron in the endogenous ABCA4 pre-mRNA.
• nucleic acid trans-splicing molecule of any one of embodiments 1-3, wherein the binding domain comprises, consists essentially of, or consists of SEQ ID NO: 18 or SEQ ID NO: 20.
• nucleic acid trans-splicing molecule of any of embodiments 1-4, wherein the binding domain consists essentially of or consists of SEQ ID NO: 18 or SEQ ID NO: 20.
• nucleic acid trans-splicing molecule of any one of embodiments 1-5, wherein the binding domain consists essentially of or consists of SEQ ID NO: 20.
• a CDS comprising, consisting essentially of, or consisting of any one of SEQ ID NOs: 53- 59;
• a linker domain comprising, consisting essentially of, or consisting of SEQ ID NO: 27 or a sequence having at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, or at least 99% identity to SEQ ID NO: 27;
• binding domain comprising, consisting essentially of, or consisting of SEQ ID NO: 18 or SEQ ID NO: 20;
• a splicing domain comprising, consisting essentially of, or consisting of any one of SEQ ID NOs: 4, 6, 8, or 10;
• the potentiator comprises SEQ ID NO: 62 or a sequence having at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, or at least 99% identity to SEQ ID NO: 62.
• nucleic acid trans-spl icing molecule of any one of embodiments 9-11 wherein the splicing domain comprises, consists essentially of, or consists of SEQ ID NO: 4 (GTAAGT).
• nucleic acid trans-spl icing molecule of any one of embodiments 9-12, wherein the 5’ untranslated region comprises, consists essentially of, or consists of SEQ ID NO: 13 or SEQ ID NO: 64.
• the 3’ transcriptional terminator domain comprises, consists essentially of, or consists of SEQ ID NO: 33 or SEQ ID NO: 66.
• nucleic acid trans-spl icing molecule of any one of embodiments 1-16 comprising, operatively linked in a 5’-to-3’ direction:
• CDS comprising, consisting essentially of, or consisting of any one of SEQ ID NOs: 53- 59;
• linker domain comprising, consisting essentially of, or consisting of SEQ ID NO: 27;
• binding domain comprising, consisting essentially of, or consisting of SEQ ID NO: 20;
• the 5’ untranslated region comprises, consists essentially of, or consists of SEQ ID NO: 13 or SEQ ID NO: 64;
• the splicing domain comprises, consists essentially of, or consists of SEQ ID NO: 4 (GTAAGT);
• the at least one stop codon comprises two stop codons, wherein the sequence of the first of the two stop codons overlaps in part with the splicing domain sequence and wherein the sequence of the splicing domain in combination with the two stop codons comprises, consists essentially of, of consists of SEQ ID NO: 68;
• the at least one potentiator comprises, consists essentially of, or consists of three sequences arranged in tandem, wherein each of the three sequences comprises GGTAAGT or SEQ ID NO: 61 , or any combination thereof;
• the translational potentiator comprises, consists essentially of, or consists of SEQ ID NO: 63;
• the 3’ transcriptional terminator domain comprises, consists essentially of, or consists of SEQ ID NO: 66.
• a nucleic acid trans-splicing molecule comprising:
• linker domain comprising, consisting essentially of, or consisting of SEQ ID NO: 27 or a sequence having at least 90% identity to SEQ ID NO: 27;
• a potentiator comprising, consisting essentially of, or consisting of at least one of GGTAAGT or 61 , or any combination thereof;
• a translational potentiator comprising, consisting essentially of, or consisting of SEQ ID NO: 63, wherein the linker domain; the potentiator, when present, and the translational potentiator, when present, are operatively linked in a 5’-to-3’ direction.
• a 5’ nucleic acid trans-splicing molecule comprising:
• a potentiator comprising, consisting essentially of, or consisting of at least one of GGTAAGT or SEQ ID NO: 61 or a sequence having at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, or at least 99% identity to GGTAAGT or SEQ ID NO: 61 ;
• linker domain comprising, consisting essentially of, or consisting of SEQ ID NO: 27 or a sequence having at least 90% identity to SEQ ID NO: 27;
• a translational potentiator comprising, consisting essentially of, or consisting of SEQ ID NO: 63, wherein the linker domain, when present; the potentiator; and the translational potentiator, when present, are operatively linked in a 5’-to-3’ direction.
• a 5’ nucleic acid trans-splicing molecule comprising:
• a potentiator comprising, consisting essentially of, or consisting of SEQ ID NO: 62 or a sequence having at least 90% identity to SEQ ID NO: 62;
• linker domain comprising, consisting essentially of, or consisting of SEQ ID NO: 27 or a sequence having at least 90% identity to SEQ ID NO 27;
• a translational potentiator comprising, consisting essentially of, or consisting of SEQ ID NO: 63, wherein the linker domain, when present; the potentiator; and the translational potentiator, when present, are operatively linked in a 5’-to-3’ direction.
• nucleic acid trans-splicing molecule of embodiment 28 or embodiment 29, further comprising a binding domain that anneals to a binding site within endogenous ABCA4 pre-mRNA, wherein the linker domain, when present; the potentiator; the translational potentiator, when present; and the binding domain, are operatively linked in a 5’-to-3’ direction.
• a nucleic acid trans-splicing molecule comprising:
• a translational potentiator comprising, consisting essentially of, or consisting of SEQ ID NO: 63 or a sequence having at least 90% identity to SEQ ID NO: 63;
• a potentiator comprising, consisting essentially of, or consisting of at least one of GGTAAGT or 61 , or any combination thereof;
• linker domain comprising, consisting essentially of, or consisting of SEQ ID NO: 27 or a sequence having at least 90% identity to SEQ ID NO: 27, wherein the linker domain, when present; the potentiator, when present; and the translational potentiator, are operatively linked in a 5’-to-3’ direction.
• a nucleic acid trans-splicing molecule of embodiment 32, wherein the potentiator, when present, comprises, consists essentially of, or consists of SEQ ID NO: 62.
• nucleic acid trans-splicing molecule of embodiment 32 or embodiment 33 further comprising a binding domain that anneals to a binding site within endogenous ABCA4 pre-mRNA, wherein the linker domain, when present; the potentiator, when present; the translational potentiator; and the binding domain, are operatively linked in a 5’-to-3’ direction.
• nucleic acid trans-splicing molecule of any one of embodiments 32-34 further comprising a CDS comprising ABCA4 exons, wherein the CDS; the linker domain, when present; the potentiator, when present; the translational potentiator; and the binding domain, when present, are operatively linked in a 5’- to-3’ direction.
• a nucleic acid trans-splicing molecule comprising: a cassette comprising a linker domain and a potentiator, wherein the cassette comprises, consists essentially of, or consists of SEQ ID NO: 72.
• a nucleic acid trans-splicing molecule comprising: a cassette comprising a linker domain, a potentiator, and a translational potentiator, wherein the cassette comprises, consists essentially of, or consists of SEQ ID NO: 73. 38.
• a nucleic acid trans-splicing molecule comprising:
• a 3’ transcription terminator domain comprising, consisting essentially of, or consisting of SEQ ID NO: 66 or a sequence having at least 95% identity to SEQ ID NO: 66.
• nucleic acid trans-splicing molecule of embodiment 38, wherein the 3’ transcriptional terminator domain comprises a nucleic acid sequence having at least 96% identity with SEQ ID NO: 66; at least 97% identity with SEQ ID NO: 66; at least 98% identity with SEQ ID NO: 66; at least 99% identity with SEQ ID NO: 66; or 100% identical to SEQ ID NO: 66.
• nucleic acid trans-splicing molecule of embodiment 38 or embodiment 39 wherein the 3’ transcriptional terminator domain comprises, consists essentially of, or consists of SEQ ID NO: 66.
• a nucleic acid trans-splicing molecule comprising:
• CDS coding domain sequence
• a nucleic acid trans-splicing molecule comprising:
• a CDS comprising, consisting essentially of, or consisting of a variant of any one of SEQ ID NOs: 53-55, wherein the variant of any one of SEQ ID NOs: 53-55 comprises at least one nucleotide variation in at least one cryptic splice site listed in Table 3, wherein the at least one nucleotide variation reduces cryptic splice site use at each of the at least one cryptic splice sites comprising at least one nucleotide variation;
• (c) optionally, a binding domain that anneals to a binding site within endogenous ABCA4 pre- mRNA, wherein the CDS; the linker domain, when present; and the binding domain, when present; are operatively linked in a 5’-to-3’ direction.
• SEQ ID NOs: 56-59 comprises any one of SEQ ID NOs: 56-59. 4.
• nucleic acid trans-splicing molecule of any one of the preceding embodiments, wherein the linker domain, when present, comprises, consists essentially of, or consists of SEQ ID NO: 27.
• nucleic acid trans-splicing molecule of any one of the preceding embodiments, wherein the binding domain, when present, anneals to an intron in the endogenous ABCA4 pre-mRNA.
• nucleic acid trans-splicing molecule of any one of the preceding embodiments, wherein the binding domain, when present, comprises SEQ ID NO: 18 or SEQ ID NO: 20.
• nucleic acid trans-splicing molecule of any one of the preceding embodiments, wherein the binding domain consists essentially of or consists of SEQ ID NO: 18 or SEQ ID NO: 20.
• nucleic acid trans-splicing molecule of any one of the preceding embodiments, wherein the binding domain, when present, consists essentially of or consists of SEQ ID NO: 20.
• nucleic acid trans-splicing molecule of any one of embodiments 1 or 5-11 , wherein the CDS comprises ABCA4 exons 1-22 or variants thereof.
• nucleic acid trans-splicing molecule of embodiment 12, wherein the CDS comprises, consists essentially of, or consists of any one of SEQ ID NOs: 53-59.
• a nucleic acid trans-splicing molecule comprising:
• a linker domain comprising, consisting essentially of, or consisting of SEQ ID NO: 27 or a sequence having at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, or at least 99% identity to SEQ ID NO: 27;
• a binding domain comprising, consisting essentially of, or consisting of SEQ NO: 18 or ID SEQ ID NO: 20;
• nucleic acid trans-spl icing molecule of embodiment 14, wherein the CDS, when present, comprises, consists essentially of, or consists of any one of SEQ ID NOs: 53-59.
• a nucleic acid trans-splicing molecule comprising:
• a CDS comprising, consisting essentially of, or consisting of any one of SEQ ID NOs: 53- 59;
• a linker domain comprising, consisting essentially of, or consisting of SEQ ID NO: 27 or a sequence having at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, or at least 99% identity to SEQ ID NO: 27;
• binding domain comprising, consisting essentially of, or consisting of SEQ NO: 18 or SEQ ID NO: 20, wherein the CDS; the linker domain; and the binding domain, when present, are operatively linked in a 5’-to-3’ direction.
• nucleic acid trans-splicing molecule of any one of the preceding embodiments further comprising a potentiator comprising at least one sequence comprising GGTAAGT or SEQ ID NO: 61.
• nucleic acid trans-splicing molecule of any one of the preceding embodiments further comprising a translational potentiator, wherein the translational potentiator comprises SEQ ID NO: 63 or a sequence having at least 90% identity to SEQ ID NO: 63, wherein SEQ ID NO: 63 or the sequence having at least 90% identity to SEQ ID NO: 63 is operably linked 3’ to the potentiator.
• nucleic acid trans-spl icing molecule of embodiment 21 wherein the translational potentiator has at least 91% identity to SEQ ID NO: 63, has at least 92% identity to SEQ ID NO: 63, has at least 93% identity to SEQ ID NO: 63, has at least 94% identity to SEQ ID NO: 63, has at least 95% identity to SEQ ID NO: 63, has at least 96% identity to SEQ ID NO: 63, has at least 97% identity to SEQ ID NO: 63, has at least 98% identity to SEQ ID NO: 63, or has at least 99% identity to SEQ ID NO: 63.
• nucleic acid trans-spl icing molecule of any one of the preceding embodiments further comprising a splicing domain comprising any one of GTAAGT, GTAAGG, GTAAGC, or GTAACT.
• nucleic acid trans-spl icing molecule of any one of the preceding embodiments further comprising a splicing domain comprising, consisting essentially of, or consisting of GTAAGT.
• nucleic acid trans-spl icing molecule of any one of the preceding embodiments further comprising a 5’ untranslated region.
• nucleic acid trans-spl icing molecule of embodiment 26, wherein the 5’ untranslated region comprises, consists essentially of, or consists of SEQ ID NO: 13 or SEQ ID NO: 64.
• nucleic acid trans-spl icing molecule of any one of the preceding embodiments further comprising a 3’ transcription terminator domain.
• nucleic acid trans-splicing molecule of embodiment 28 or embodiment 29, wherein the 3’ transcriptional terminator domain comprises a wildtype MALAT 1 sequence (SEQ ID NO: 33) or a nucleic acid sequence having at least 80% identity with SEQ ID NO: 33.
• nucleic acid trans-splicing molecule of embodiment 30, wherein the 3’ transcriptional terminator domain comprises a nucleic acid sequence having at least 80% identity with SEQ ID NO: 33; at least 85% identity with SEQ ID NO: 33; at least 90% identity with SEQ ID NO: 33; at least 91% identity with SEQ ID NO: 33; at least 92% identity with SEQ ID NO: 33; at least 93% identity with SEQ ID NO: 33; at least 94% identity with SEQ ID NO: 33; at least 95% identity with SEQ ID NO: 33; at least 96% identity with SEQ ID NO: 33; at least 97% identity with SEQ ID NO: 33; at least 98% identity with SEQ ID NO: 33; at least 99% identity with SEQ ID NO: 33; or 100% identical to SEQ ID NO: 33.
• nucleic acid trans-spl icing molecule of embodiment 28 or embodiment 29 wherein the 3’ transcriptional terminator domain comprises, consists essentially of, or consists of SEQ ID NO: 33 or SEQ ID NO: 66.
• nucleic acid trans-spl icing molecule of any one of the preceding embodiments further comprising at least one stop codon operatively linked 3’ to the splicing domain.
• nucleic acid trans-spl icing molecule of embodiment 33 comprising, operatively linked in a 5’-to-3’ direction:
• binding domain consisting essentially of or consisting of SEQ ID NO: 18 or SEQ ID NO: 20;
• the 5’ untranslated region comprises, consists essentially of, or consists of SEQ ID NO: 13 or SEQ ID NO: 64;
• the splicing domain comprises, consists essentially of, or consists of GTAAGT;
• the at least one stop codon is present and comprises, consists essentially of, or consists of two stop codons, wherein the sequence of the first of the two stop codons overlaps in part with the splicing domain sequence;
• the at least one potentiator comprises, consists essentially of, or consists of three sequences arranged in tandem, wherein each of the three sequences comprises GGTAAGT or SEQ ID NO: 61 ;
• the translational potentiator comprises, consists essentially of, or consists of SEQ ID NO: 63;
• the 3’ transcriptional terminator domain comprises, consists essentially of, or consists of SEQ ID NO: 66.
• a nucleic acid trans-splicing molecule comprising:
• CDS comprising, consisting essentially of, or consisting of any one of SEQ ID NOs: 53- 59;
• linker domain comprising, consisting essentially of, or consisting of SEQ ID NO: 27;
• binding domain comprising, consisting essentially of, or consisting of SEQ ID NO: 18 or SEQ ID NO: 20;
• a 3’ transcriptional terminator domain wherein the 5’ untranslated region; the CDS; the splicing domain; the at least one stop codon, when present; the linker domain; the at least one potentiator; the translational potentiator; the binding domain; and the 3’ transcriptional terminator domain are operatively linked in a 5’-to- 3’ direction.
• the 5’ untranslated region comprises, consists essentially of, or consists of SEQ ID NO: 13 or SEQ ID NO: 64;
• the splicing domain comprises, consists essentially of, or consists of GTAAGT;
• the at least one stop codon is present and comprises, consists essentially of, or consists of two stop codons wherein the sequence of the first of the two stop codons overlaps in part with the splicing domain sequence;
• the at least one potentiator comprises, consists essentially of, or consists of three sequences arranged in tandem, wherein each of the three sequences comprises GGTAAGT or SEQ ID NO: 61 ;
• the translational potentiator comprises, consists essentially of, or consists of SEQ ID NO: 63;
• the 3’ transcriptional terminator domain comprises, consists essentially of, or consists of SEQ ID NO: 66.
• a nucleic acid trans-splicing molecule comprising, operatively linked in a 5’-to-3’ direction: (a) a 5’ untranslated region comprising, consisting essentially of, or consisting of SEQ ID NO: 13 or SEQ ID NO: 64;
• CDS comprising, consisting essentially of, or consisting of any one of SEQ ID NOs: 53- 59;
• a splicing domain comprising, consisting essentially of, or consisting of GTAAGT;
• linker domain comprising, consisting essentially of, or consisting of SEQ ID NO: 27;
• a potentiator comprising, consisting essentially of, or consisting of SEQ ID NO: 62;
• a translational potentiator comprising, consisting essentially of, or consisting of SEQ ID NO: 63;
• binding domain comprising, consisting essentially of, or consisting of SEQ ID NO: 18 or SEQ ID NO: 20;
• a 3’ transcriptional terminator domain comprising, consisting essentially of, or consisting of SEQ ID NO: 66.
• nucleic acid trans-spl icing molecule of embodiment 37 or embodiment 38, wherein the nucleic acid trans-splicing molecule comprises, consists essentially of, or consists of SEQ ID NO: 69, SEQ ID NO: 78, or SEQ ID NO: 90.
• nucleic acid trans-splicing molecule of any one of embodiments 1-20, wherein the nucleic acid trans-splicing molecule comprises, consists essentially of, or consists of SEQ ID NO: 70 or SEQ ID NO: 71.
• nucleic acid trans-splicing molecule of any one of embodiments 1-12, wherein the nucleic acid trans-splicing molecule comprises a nucleic acid sequence having at least 80% identity with any one of SEQ ID NOs: 40-44, 46, or 48-50.
• nucleic acid trans-splicing molecule of any one of embodiments 1-41 wherein the endogenous ABCA4 pre-mRNA comprises at least one mutation associated with an ABCA4- associated retinal dystrophy.
• nucleic acid trans-spl icing molecule of embodiment 43 or 44 wherein the ABCA4- associated retinal dystrophy is associated with allelic pathogenic mutations spanning exons 1-22 of the ABCA4 gene and a phenotype consistent with cone-rod dystrophy (e.g., Cone-Rod Dystrophy-3), Stargardt macular dystrophy (e.g., Stargardt Disease-1), fundus flavimaculatus, Retinitis Pigmentosa- 19, or Age-Related Macular Degeneration-2.
• cone-rod dystrophy e.g., Cone-Rod Dystrophy-3
• Stargardt macular dystrophy e.g., Stargardt Disease-1
• fundus flavimaculatus e.g., Retinitis Pigmentosa- 19, or Age-Related Macular Degeneration-2.
• a vector comprising the nucleic acid trans-splicing molecule of any one of embodiments 1-46.
• the vector of any one of embodiments 48-49, wherein the 5’ regulatory domain comprises a constitutive promoter or a tissue specific promoter.
• a proviral plasmid comprising the nucleic acid trans-splicing molecule of any one of embodiments 1-46.
• An adeno-associated virus comprising the nucleic acid trans-splicing molecule of any one of embodiments 1-46, wherein the AAV optionally comprises a 5’ regulatory domain operatively linked 5’ to the nucleic acid trans-splicing molecule.
• composition comprising the nucleic acid trans-splicing molecule of any one of embodiments 1-46, the vector of any one of embodiments 47-51 , the proviral plasmid of embodiment 52, or the AAV of any one of embodiments 53-59.
• composition of embodiment 60 comprising a pharmaceutically acceptable excipient.
• a method of expressing biologically active ABCA4 in a target cell to restore functional levels of ABCA4 protein in the target cell comprising transducing the target cell with the nucleic acid trans-splicing molecule of any one of embodiments 1 -46, the vector of any one of embodiments 47-51 , the proviral plasmid of embodiment 52, the AAV of any one of embodiments 53-59, or the composition of embodiment 60 or 61 .
• a method of reducing ABCA4-associated lipofuscin and/or A2E accumulation in a subject comprising transfecting or transducing a target retinal cell in the subject with the nucleic acid trans-splicing molecule of any one of embodiments 1-46, the vector of any one of embodiments 47-51 , the proviral plasmid of embodiment 52, the AAV of any one of embodiments 53-59, or the composition of embodiment 60 or 61 .
• a method of correcting at least one mutation in an ABCA4 exon sequence in a target cell of a subject comprising administering to the subject the nucleic acid trans-splicing molecule of any one of embodiments 1-46, the vector of any one of embodiments 47-51 , the proviral plasmid of embodiment 52, the AAV of any one of embodiments 53-59, or the composition of embodiment 60 or 61 .
• a method of treating an ABCA4-associated retinal dystrophy in a subject in need thereof comprising administering to the subject the nucleic acid trans-splicing molecule of any one of embodiments 1-46, the vector of any one of embodiments 47-51 , the proviral plasmid of embodiment 52, the AAV of any one of embodiments 53-59, or the composition of embodiment 60 or 61 in a therapeutically effective amount.
• nucleic acid trans-splicing molecule of any one of embodiments 1 -46, the vector of any one of embodiments 47-51 , the proviral plasmid of embodiment 52, the AAV of any one of embodiments 53-59, or the composition of embodiment 60 or 61 for use in the preparation of a medicament for the treatment of an ABCA4-associated retinal dystrophy in a subject in need thereof.
• ABCA4-associated retinal dystrophy is associated with allelic pathogenic mutations spanning Exons 1-22 of the ABCA4 gene and a phenotype consistent with cone-rod dystrophy, Stargardt macular dystrophy, or fundus flavimaculatus.
• a nucleic acid trans-splicing molecule comprising:
• linker domain comprising, consisting essentially of, or consisting of SEQ ID NO: 27 or a sequence having at least 90% identity to SEQ ID NO: 27;
• a potentiator comprising, consisting essentially of, or consisting of SEQ ID NO: 62;
• a translational potentiator comprising, consisting essentially of, or consisting of SEQ ID NO: 63, wherein the linker domain; the potentiator, when present, and the translational potentiator, when present, are operatively linked in a 5’-to-3’ direction.
• nucleic acid trans-splicing molecule of embodiment 76 further comprising a binding domain that anneals to a binding site within endogenous ABCA4 pre-mRNA, wherein the linker domain; the potentiator, when present; the translational potentiator, when present; and the binding domain, are operatively linked in a 5’-to-3’ direction.
• nucleic acid trans-splicing molecule of embodiment 76 or embodiment 77 further comprising a CDS comprising ABCA4 exons, wherein the CDS; the linker domain; the potentiator, when present; the translational potentiator, when present; and the binding domain, when present, are operatively linked in a 5’-to-3’ direction.
• a 5’ nucleic acid trans-splicing molecule comprising:
• a potentiator comprising, consisting essentially of, or consisting of at least one of GGTAAGT or SEQ ID NO: 61 or a sequence having at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, or at least 99% identity to GGTAAGT or SEQ ID NO: 61 ;
• linker domain comprising, consisting essentially of, or consisting of SEQ ID NO: 27 or a sequence having at least 90% identity to SEQ ID NO: 27;
• a translational potentiator comprising, consisting essentially of, or consisting of SEQ ID NO: 63, wherein the linker domain, when present; the potentiator; and the translational potentiator, when present, are operatively linked in a 5’-to-3’ direction.
• a 5’ nucleic acid trans-splicing molecule comprising: (a) a potentiator comprising, consisting essentially of, or consisting of SEQ ID NO: 62 or a sequence having at least 90% identity to SEQ ID NO: 62; and
• linker domain comprising, consisting essentially of, or consisting of SEQ ID NO: 27 or a sequence having at least 90% identity to SEQ ID NO 27;
• a translational potentiator comprising, consisting essentially of, or consisting of SEQ ID NO: 63, wherein the linker domain, when present; the potentiator; and the translational potentiator, when present, are operatively linked in a 5’-to-3’ direction.
• nucleic acid trans-splicing molecule of embodiment 79 or embodiment 80 further comprising a binding domain that anneals to a binding site within endogenous ABCA4 pre-mRNA, wherein the linker domain, when present; the potentiator; the translational potentiator, when present; and the binding domain, are operatively linked in a 5’-to-3’ direction.
• nucleic acid trans-splicing molecule of any one of embodiments 79-81 , further comprising a CDS comprising ABCA4 exons, wherein the CDS; the linker domain, when present; the potentiator; the translational potentiator, when present; and the binding domain, when present, are operatively linked in a 5’-to-3’ direction.
• a nucleic acid trans-splicing molecule comprising:
• a translational potentiator comprising, consisting essentially of, or consisting of SEQ ID NO: 63 or a sequence having at least 90% identity to SEQ ID NO: 63;
• a potentiator comprising, consisting essentially of, or consisting of SEQ ID NO: 62;
• linker domain comprising, consisting essentially of, or consisting of SEQ ID NO: 27 or a sequence having at least 90% identity to SEQ ID NO: 27, wherein the linker domain, when present; the potentiator, when present; and the translational potentiator, are operatively linked in a 5’-to-3’ direction.
• nucleic acid trans-splicing molecule of embodiment 83 further comprising a binding domain that anneals to a binding site within endogenous ABCA4 pre-mRNA, wherein the linker domain, when present; the potentiator, when present; the translational potentiator; and the binding domain, are operatively linked in a 5’-to-3’ direction.
• nucleic acid trans-splicing molecule of embodiment 83 or embodiment 84 further comprising a CDS comprising ABCA4 exons, wherein the CDS; the linker domain, when present; the potentiator, when present; the translational potentiator; and the binding domain, when present, are operatively linked in a 5’- to-3’ direction.
• a nucleic acid trans-splicing molecule comprising: a cassette comprising a linker domain and a potentiator, wherein the cassette comprises, consists essentially of, or consists of SEQ ID NO: 72.
• a nucleic acid trans-splicing molecule comprising: a cassette comprising a linker domain, a potentiator, and a translational potentiator, wherein the cassette comprises, consists essentially of, or consists of SEQ ID NO: 73.
• a nucleic acid trans-splicing molecule comprising:
• a 3’ transcription terminator domain comprising, consisting essentially of, or consisting of SEQ ID NO: 66 or a sequence having at least 95% identity to SEQ ID NO: 66.
• nucleic acid trans-splicing molecule of embodiment 88, wherein the 3’ transcriptional terminator domain comprises a nucleic acid sequence having at least 96% identity with SEQ ID NO: 66; at least 97% identity with SEQ ID NO: 66; at least 98% identity with SEQ ID NO: 66; at least 99% identity with SEQ ID NO: 66; or 100% identical to SEQ ID NO: 66.
• nucleic acid trans-splicing molecule of embodiment 88 or embodiment 89 wherein the 3’ transcriptional terminator domain comprises, consists essentially of, or consists of SEQ ID NO: 66.
• nucleic acid trans-splicing molecule of claim 89 or claim 90 further comprising a CDS comprising ABCA4 exons, wherein the CDS; the cassette; and the binding domain, when present, are operatively linked in a 5’-to-3’ direction.
• a nucleic acid trans-splicing molecule comprising:
• a 3’ transcription terminator domain comprising, consisting essentially of, or consisting of SEQ ID NO: 66 or a sequence having at least 95% identity to SEQ ID NO: 66.
• nucleic acid trans-splicing molecule of claim 92 wherein the 3’ transcriptional terminator domain comprises a nucleic acid sequence having at least 96% identity with SEQ ID NO: 66; at least 97% identity with SEQ ID NO: 66; at least 98% identity with SEQ ID NO: 66; at least 99% identity with SEQ ID NO: 66; or 100% identical to SEQ ID NO: 66.
• a nucleic acid trans-splicing molecule comprising:
• a coding domain sequence comprising ABCA4 exons having at least one nucleotide variation relative to a wild-type ABCA4 sequence at a cryptic splice site
• nucleic acid trans-splicing molecule of embodiment 1 wherein the cryptic splice site is a cryptic splice site listed in Table 3.
• nucleic acid trans-splicing molecule of embodiment 1 or 2 wherein the at least one nucleotide variation is a synonymous mutation that reduces or eliminates splicing at the cryptic splice site.
• nucleic acid trans-splicing molecule of any one of embodiments 1 to 3, wherein the CDS comprises one or more of SEQ ID NOs: 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114,
• nucleic acid trans-splicing molecule of any one of embodiments 1 to 4, wherein the CDS comprises exons 1-22 of ABCA4 having the at least one nucleotide variation.
• nucleic acid trans-splicing molecule of any one of embodiments 1 to 8, wherein the binding domain anneals to a sequence within intron 22 of the endogenous ABCA4 pre-mRNA.
• nucleic acid trans-splicing molecule of any one of embodiments 1 to 9, wherein the binding domain comprises SEQ ID NO: 18 or 20.
• nucleic acid trans-splicing molecule of embodiment 11, wherein the potentiator comprises three sequences arranged in tandem, wherein each of the three sequences comprises GGTAAGT or SEQ ID NO: 61.
• nucleic acid trans-splicing molecule of any one of embodiments 1 to 17 comprising, operatively linked in a 5’-to-3’ direction: (a) a 5’ untranslated region comprising SEQ ID NO: 13 or SEQ ID NO: 64;
• nucleic acid trans-spl icing molecule of any one of embodiments 1 to 18 comprising SEQ ID NO: 69, SEQ ID NO: 78, or SEQ ID NO: 90.
• a vector or adeno-associated virus comprising the nucleic acid trans-splicing molecule of any one of embodiments 1 to 19.
• a pharmaceutical composition comprising the vector or the AAV of any one of embodiments 21 to 24 and a pharmaceutically acceptable excipient.
• a method of treating an ABCA4-associated retinal dystrophy in a subject in need thereof comprising administering to the subject the composition of embodiment 25 in a therapeutically effective amount.
• a method of expressing biologically active ABCA4 in a target cell comprising transfecting or transducing the target cell with a nucleic acid trans-splicing molecule comprising: (a) a coding domain sequence (CDS) comprising ABCA4 exons having at least one nucleotide variation relative to a wild-type ABCA4 sequence at a cryptic splice site; and
• CDS coding domain sequence
• the CDS comprises one or more of SEQ ID NOs: 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 1 12, 114, 116, 118, 120, 122, 124, 127, 129, 131 , 673, 674, 679, 682, 685, 693, 695, 698, 701 ,708,721 , 722, 737, 758, 763, 764, 765, 775, 785, 789, 791 , 798, 799, 792, 818, 820, 822, 825, 831 , 837, 854, 859, 873, 881 , 886, 888, 891 , 903, 904, 910, 918, 924, 932, 938, 940, 945, 946, 950, 951 , 952, 968, 976, 992, 993, 995, 997, 998, 999, 1003,
• a method of treating an ABCA4-associated retinal dystrophy in a subject in need thereof comprising administering to the subject a nucleic acid trans-splicing molecule comprising:
• a coding domain sequence comprising ABCA4 exons having at least one nucleotide variation relative to a wild-type ABCA4 sequence at a cryptic splice site

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Genetics & Genomics (AREA)
• Chemical & Material Sciences (AREA)
• Engineering & Computer Science (AREA)
• Organic Chemistry (AREA)
• Zoology (AREA)
• Molecular Biology (AREA)
• Biotechnology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Biomedical Technology (AREA)
• Wood Science & Technology (AREA)
• General Health & Medical Sciences (AREA)
• General Engineering & Computer Science (AREA)
• Biochemistry (AREA)
• Biophysics (AREA)
• Medicinal Chemistry (AREA)
• Microbiology (AREA)
• Physics & Mathematics (AREA)
• Plant Pathology (AREA)
• Cell Biology (AREA)
• Gastroenterology & Hepatology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Toxicology (AREA)
• Public Health (AREA)
• Animal Behavior & Ethology (AREA)
• Veterinary Medicine (AREA)
• Pharmacology & Pharmacy (AREA)
• Epidemiology (AREA)
• Virology (AREA)
• Immunology (AREA)
• Mycology (AREA)
• Ophthalmology & Optometry (AREA)
• Chemical Kinetics & Catalysis (AREA)
• General Chemical & Material Sciences (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
• Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)

Priority Applications (9)

Applications Claiming Priority (4)

Publications (2)

Family

ID=88731152

Family Applications (1)

Country Status (11)

Cited By (2)

Families Citing this family (2)

Family Cites Families (50)

• 2023
  • 2023-05-12 IL IL316944A patent/IL316944A/en unknown
  • 2023-05-12 KR KR1020247041372A patent/KR20250011939A/ko active Pending
  • 2023-05-12 EP EP23804548.8A patent/EP4522758A4/en active Pending
  • 2023-05-12 GB GB2418240.4A patent/GB2634434A/en active Pending
  • 2023-05-12 AU AU2023269865A patent/AU2023269865A1/en active Pending
  • 2023-05-12 CA CA3252043A patent/CA3252043A1/en active Pending
  • 2023-05-12 US US18/316,959 patent/US20240042057A1/en active Pending
  • 2023-05-12 JP JP2024566858A patent/JP2025521102A/ja active Pending
  • 2023-05-12 CN CN202380049353.8A patent/CN119731328A/zh active Pending
  • 2023-05-12 WO PCT/US2023/066969 patent/WO2023220742A2/en not_active Ceased
  • 2023-11-22 US US18/518,212 patent/US12410440B2/en active Active
• 2024
  • 2024-11-12 MX MX2024014029A patent/MX2024014029A/es unknown
• 2025
  • 2025-07-25 US US19/280,445 patent/US20260049332A1/en active Pending

Also Published As

Similar Documents

Legal Events