WO2006026611A2 - Reverse transcriptase mediated rna gene expression - Google Patents

Abstract

The present invention provides methods and compositions for expressing a polypeptide or nucleic acid of interest in cells expressing reverse transcriptase (RT). The compositions of the invention include reverse transcriptase RNA (RTD-RNA) molecules that are designed to be reverse transcribed into a DNA molecule capable of encoding a polypeptide or nucleic acid of interest. Polypeptides of interest include cytotoxic, therapeutic, enzymatic, or reporter polypeptides. Nucleic acid molecules of interest include those capable of regulating, altering or reprogramming gene expression, for example, those capable of functioning as antisense, aptamer, decoy, inhibitor, ribozyme, or RNAi molecules.

Description

TO ALL WHOM IT MAY CONCERN:

Be it known that I, LLOYD G. MITCHELL, a citizen of the United States, residing in Bethesda, County of Montgomery, State of Maryland, whose post office address is 4519 Gretna Street, Bethesda, MD 20814, have invented an improvement in

REVERSE TRANSCRIPTASE MEDIATED RNA GENE EXPRESSION

of which the following is a

SPECIFICATION

1. INTRODUCTION

[0001] The present invention provides methods and compositions for expressing a polypeptide or nucleic acid of interest in cells expressing reverse transcriptase (RT). The compositions of the invention include reverse transcriptase dependant RNA (RTD-RNA) molecules that are designed to be reverse transcribed into a DNA molecule capable of encoding a polypeptide or nucleic acid interest. Polypeptides of interest include cytotoxic, therapeutic, enzymatic, or reporter polypeptides. Nucleic acid molecules of interest include those capable of regulating, revising, or altering gene expression. For example, such nucleic acid molecules may include those capable of functioning as antisense, aptamer, decoy, inhibitor, trans-splicing, ribozyme, or RNAi molecules.

[0002] The present invention further provides recombinant (eukaryotic) expression vectors (that do not possess reverse transcriptase activity) designed to express or deliver RTD-RNAs within a cell. Such vectors include non-viral as well as viral vectors, for example, recombinant viral vectors, such as retroviral, lentiviral, or adeno-associated (AAV) vectors, that are engineered to encode the RTD-RNAs of the invention, but do not encode or contain active RT.

[0003] The methods of the invention comprise transferring a RTD-RNA, or a recombinant expression vector capable of encoding a RTD-RNA, into a cell expressing reverse transcriptase, resulting in formation of DNA capable of encoding the polypeptide or nucleic acid of interest. RTD-RNAs may be delivered to cells that may or may not express RT at the time of RTD-RNA delivery. The RTD-RNA would not be expressed until the cell were to acquire RT activity. The invention provides methods and compositions for detection of viral infection. In a specific embodiment of the invention the methods and compositions can be used for targeting (conferring) selective gene expression to cells expressing reverse transcriptase, i.e., virally infected cells, but not normal cells. Such methods may be used to target the expression of nucleic acids, cytotoxins, therapeutic proteins and/or marker molecules to virally infected cells, thereby providing methods for treating and/or diagnosing viral infections.

[0004] The methods and compositions of the invention may be also be utilized to monitor the expression or presence of reverse transcriptase within a cell. In instances where the expression of reverse transcriptase is associated with an infectious disease, the present invention provides diagnostic methods and compositions and could be used to titer viral concentration or activity. Additionally, the present invention may be used in screening assays to identify compounds capable of directly or indirectly modulating reverse transcriptase activity. Such assays may be used to identify compounds useful in inhibiting viral replication in infected cells.

2. BACKGROUND OF THE INVENTION

[0005] Many viruses such as HIV require the activity of one or more unique enzymes to complete their life cycles. (Reverse Transcription and Integration, in Principles of Virology, second edition. SJ. Flint, L. W. Enquist, V.R. Racaniello, and A.M. Skalka (eds.). Amer. Soc. for Microbiology Press, 216-251, 2004). The genomes of retroviruses and a few others, such as the hepadnaviruses ( for example, hepatitis B), undergo a highly unique process whereby their genome passes backwards from RNA to DNA. The HIV virus transmits its genome as a single-stranded RNA that must undergo reverse transcription to be converted into a double stranded DNA after infection. HIV virions bring with them many unique elements necessary to carry out reverse transcription and integration. Each HIV virus contains 50 to 100 molecules of RT. The process of reverse transcription occurs mainly in the cytoplasm. Retroviral RTs are complex molecular machines with four distinct catalytic activities. These include RNA-directed and DNA-directed DNA polymerization, DNA helicase, and RNase H activities. After reverse transcription, the HIV double stranded DNA genome with flanking LTRs is transported into the nucleus where another unique viral enzyme, integrase splices the viral DNA into the host genome. The integrated proviral DNA is transcribed by host cellular RNA polymerase II, producing two types of RNA: pre-mRNAs that are processed and translated to produce the structural and functional HIV proteins, and genomic RNAs that are not spliced or translated. Both forms are necessary to produce new virus.

[0006] HIV RT is not synthesized de novo, but is generated from a 165 kD gag/pol- encoded precursor polyprotein by the action of the pol-encoded protease. (For a review, see Reverse Transcriptase). (S.F. LeGrice, in Reverse Transcriptase. A.M. Skalka and S.P. Goff (eds.). Cold Spring Harbor Laboratory Press, 163-191, 1993). Gag/pol is produced at lower levels than gag because full length gag/pol requires ribosome frame shifting between the two open reading frames. Maturation of RT from the gag/pol precursor raises the question of the stage at which activity is imparted to the enzyme. Maximal RT activity is produced after the 165 kD gag/pol polyprotein is cleaved by HIV protease and perhaps other factors to generate the 66 and 51 kD polypeptides. The most active form of HIV RT is a heterodimer consisting of p66 and p51 subunits. However, there are reports that RT activity is present in p66 homodimers (M.C. Starnes, W.G. Gao, R.Y.C. Ting and Y.C. Cheng. Enzyme activity gel analysis of HIV reverse transcriptase. J. Biol. Sci. 11, 5132-5134, 1988) and in the pi 65 gag/pol fusion protein (C. Peng, N.T. Chang, and T.W. Chang. Identification and characterization of HIV type 1 gag/pol fusion protein in transfected mammalian cells. J. Virol. 65. 2751-2756, 1991; L.F. Scovassi, D. Zella, G. Achilli, E. Cattaneo, C. Casoli and U. Bertazzoni. Enzymatically active forms of reverse transcriptase of the human immunodeficiency virus. AIDS Res. Hum. Retroviruses 5, 393-8, 1988). Studies employing HIV mutants with defective protease activity have indicated that the HIV gag/pol fusion precursor expresses significant RT activity. (C. Peng, B.K. Ho, T.W. Chang and N.T. Chang. Role of HIV type-1 protease in core protein maturation and viral infectivity. J. Virol. 63, 2550-2556, 1989). Lack of polymerase activity in the immature precursors of related retroviruses was originally proposed as a mechanism to prevent premature reverse transcription prior to virus budding. (O. Witte and D. Baltimore. Relationship of retroviral polyprotein cleavage to virion maturation studied with temperature sensitive murine leukemia virus mutants. J. Virol. 26, 750-761, 1978). This does not appear to be the case with HIV. Further evidence of RT activity is offered by reports of intracellular reverse transcription prior to viral release. (F. Lori, F. Di Marzo Veronese, A.L. De Vico, P. Lusso, M.S. Reitz and R.C. Gallo. Viral DNA carried by HIV type-1 virions. J. Virol. 66, 5067-5074, 1992).

[0007] Thirteen currently FDA approved anti-HIV therapeutics that target HIV RT are designed to inhibit the activity of the RT enzyme. Unfortunately, HIV generates mutations at a rapid rate and resistance to both classes of RT inhibitors (nucleoside and non-nucleoside) and various combinations of these drugs often develops in patients. Besides the development of viral resistance, there are additional difficulties with patient adherence to dosing regimens and toxicity that stems from having to take therapy on a continuous basis. The goal of anti-HIV RT inhibitors is to block the activity of HIV RT in all infected cells all the time, however, this is difficult to achieve. The strategy targeting RT and problems associated with treating HBV infection share many similarities with HIV (Quan et al., 2004, Clin Liver Dis. 8:371-85; De Clercq J, 2004 Clin Virol 30:115-33).

[0008] The present invention utilizes the RT activity conferred by HIV (or other RT dependent viruses) in infected cells to specifically enable the expression of a forward, antisense or backwards gene (Fig 1) that is designed to encode a useful gene product, such as cytotoxic polypeptide. The strategy employed by this proposal is opposite to the strategic approach of current therapeutics which seek to block some viral activity, not exploit it.

3. SUMMARY OF THE INVENTION

[0009] The present invention relates to compositions and methods for reverse transcriptase mediated expression of a polypeptide or nucleic acid of interest within a cell. Specifically, the invention provides methods and compositions for expression of cytotoxic, therapeutic or reporter polypeptides and any other genetic element or combination that may modulate gene expression. The RTD-RNA may be engineered to encode any form of nucleic acid molecules, such as antisense, aptamer, decoy, inhibitor, trans-splicing, ribozyme, or RNAi molecules, capable of targeting cytotoxicity, inhibiting and/or altering viral expression, replication or other viral activities, and/or host/viral interactions.

[0010] The compositions of the invention include reverse transcriptase dependent RNA (referred to as "RTD-RNA") which are reverse transcribed resulting in the generation of a novel DNA (hereinafter referred to as "DNA") molecule capable of encoding a polypeptide or nucleic acid of interest.

[0011] The methods of the invention encompass transferring the RTD-RNAs of the invention, or a recombinant vector capable of encoding a RTD-RNA, into a target cell. If the cell contains or expresses reverse transcriptase, the RTD-RNA is reverse transcribed to form a novel DNA molecule capable of encoding a polypeptide or nucleic acid of interest. The RTD-RNA of the invention are genetically engineered so that the novel DNA resulting from reverse transcription of the RTD-RNA may itself perform a function such as encoding an RNA that encodes a polypeptide or toxin which kills the target cells. The generation of DNA from the RTD-RNA will occur only in cells expressing reverse transcriptase, thereby providing a means for targeting expression of the RTD-RNA encoded gene sequence(s) to a selected cell type. The target cells may include, but are not limited to, those infected with viral agents that express reverse transcriptase. The product or activity of an expressed reverse transcribed RTD-RNA is not limited to those having an affect only on cells those expressing said product or activity, but may also function at additional sites within the host. For example, the expressed RTD-RNA may encode a molecule secreted by the cell. Such molecules include, for example, antibodies or signaling molecules such as growth factors or cytokines. The methods and compositions of the invention can be used to target cell death to virally infected cells. Such methods and compositions can be used for the treatment of various diseases including, but not limited to, infectious diseases resulting from viral infection. [0012] The present invention further provides methods and compositions for imaging of gene expression within cells expressing RT activity. The compositions of the invention comprise RTD-RNA molecules engineered to express a reporter molecule or a molecule useful in the production of a dectable signal and the use of such molecules to detect the expression or presence of reverse transcriptase or study viral or host processes within a cell expressing RT activity. Such reporter molecules include but are not limited to fluorescent and bioluminescent molecules, enzymes, ion channels, receptors and peptide tags. Thus, the methods and compositions of the invention can be used in imaging techniques to detect virally infected cells.

[0013] In addition, the present invention provides for or may be utilized in screening assays designed to identify compounds capable of modulating reverse transcriptase activity or expression. Such compounds may be useful in the treatment of infectious diseases such as virus infections wherein replication of the virus is dependent on expression of reverse transcriptase.

4. BRIEF DESCRIPTION OF THE DRAWINGS

Figure IA. Structure of RTD-RNA.

Figure 2A-B. Model for expression of RTD-RNA.

Figure 3. Increased lentiviral gene expression in cells expressing RT

Figure 4. Expression of RTD-RNA when delivered by RT deficient lentivirus to cells expressing RT

5. DETAILED DESCRIPTION OF THE INVENTION

[0014] The present invention provides methods and compositions for selective expression of a polypeptide or nucleic acid molecule of interest in a target cell wherein said target cell expresses a reverse transcriptase. Specifically, the present invention relates to compositions comprising RTD-RNAs and a suitable carrier or incipient and the use of such compositions for expression of a chosen molecule within a target cell.

[0015] The RTD-RNAs of the invention comprise (i) recognition signals for reverse transcriptase mediated RNA and/or DNA synthesis and processing; (ii) a nucleotide sequence, in forward or reverse orientation, capable of encoding a polypeptide or nucleic acid of interest; and (iii) a nucleotide sequence, in forward or reverse orientation, capable of directing or modulating the expression of the polypeptide or nucleic acid of interest.

[0016] The methods of the invention encompass transferring the RTD-RNA of the invention, or a nucleic acid molecule capable of encoding a RTD-RNA, into a target cell under conditions in which the RTD-RNA is reverse transcribed to form a novel DNA in cells expressing RT activity. The target cell is chosen due to its expression, or potential expression, of reverse transcriptase, or a unique form of reverse transcriptase, thus providing a mechanism for limiting expression of novel DNA to a selected cell type, i.e., one expressing reverse transcriptase or one which may express RT at a later time, for example if the cell were to become infected by HIV. The resulting DNA may provide a desired function, or may produce a gene product in the selected cell type. The selected cells may include, but are not limited to those infected with viral or other infectious agents that express reverse transcriptase. The gene products encoded by the DNA, include but not limited to genes having clinical, i.e., therapeutic, or imaging applications, for example, therapeutic genes, marker genes, genes encoding toxins, antibodies, cytokines, enzymes and genes encoding antisense, trans-splicing, ribozyme, aptamers, decoys, inhibitory, miRNA, riboswitches, or RNAi molecules.

5.1. STRUCTURE OF THE MOLECULES

[0017] The present invention provides compositions for use in expression of novel nucleic acid molecules through reverse transcription of a RTD-RNA. The RTD-RNAs of the invention comprise (i) recognition signals for reverse transcriptase mediated RNA and/or DNA synthesis and processing; (ii) one or more nucleotide sequences, in forward or reverse orientation, capable of encoding a polypeptide or nucleic acid of interest; and (iii) one or more nucleotide sequences, in forward or reverse orientation, capable of directing the expression of the polypeptide or nucleic acid of interest.

[0018] Recognition signals that may be included in the RTD-RNA molecules of the invention include, but are not limited to, retroviral R sequences, U5 and U3 sequences, PB (primer binding) sequences and a polypyrimidine tract. The R sequence is typically a short, 15-250 nucleotide sequence repeated at both ends of genomic RNA, whose boundaries are defined by the positions of RNA transcription initiation and polyadenylation. The R sequence is also present twice in viral DNA residing between U3 and U5 in each long terminal repeat (LTR). Additionally, in a majority of the retroviruses, R contains the polyadenylation signal sequence (AAUAAA). A U5 sequence comprises approximately 70-250 nucleotides positioned between the R sequence and the primer binding site (PBS). U5 is present once in genomic RNA and twice in viral DNA as part of the LTR. The U3 sequence comprises a sequence of several hundred nucleotides positioned between PPT and R in close proximity to the 3' end of viral RNA. The U3 sequence is present once in viral genome RNA and twice in viral DNA as part of the LTR. The U3 sequence contains promoter-enhancer sequences that control viral RNA transcription from the 5' LTR. The polypyrimidine tract is a homopolymer of multiple adenylic acid residues located following the R sequence at the 3' end of the viral RNA. The signal for polyadenylation (AAUAAA) is generally present upstream of the site of polyadenylation. The PB sequence is a region found adjacent to the U5 sequence and complementary to the 3' terminus of a specific host tRNA species. The PB sequence functions as the binding site for a tRNA which acts as the primer for reverse transcriptase to initiate synthesis of the minus strand of viral DNA.

[0019] These recognition sequences can be modified to modulate function, reduce sequence length, or to enhance safety by making the RTD-RNA self-inactivating, replication incompetent (Iwakuma T, Cui Y, Chang LJ. Self-inactivating lentiviral vectors with U3 and U5 modifications. Virology. 1999;261(1): 120-32; Zufferey R, Dull T, Mandel RJ, Bukovsky A, Quiroz D, Naldini L, Trono D. Self-inactivating lentivirus vector for safe and efficient in vivo gene delivery. J Virol. 1998;72(12):9873-80; Kraunus J, Schaumann DH, Meyer J, Modlich U, Fehse B, Brandenburg G, von Laer D, Klump H, Schambach A, Bohne J, Baum C. Self-inactivating retroviral vectors with improved RNA processing. Gene Ther. 2004;ll(21):1568-78; and Anson D. S. The use of retroviral vectors for gene therapy-what are the risks? A review of retroviral pathogenesis and its relevance to retroviral vector-mediated gene delivery. Genet Vaccines Ther. 2004; 2: 9.) Muthuswami et al., 2002, Switching the in vitro tRNA usage of HIV-I by simultaneous adaptation of the PBS and PAS. RNA 8:357-69.

[0020] It is understood that recognition sequences that may be used in the practice of the invention include any sequences that are able to mediate reverse transcriptase mediated RNA and/or DNA synthesis and processing. Recognition sequences are well known to those of skill in the art, and include those sequences derived from spumavirus, MLV- and ALV- retroviruses, D- and B- type retroviruses, lentivirus, BLV-HTLV and hepatitis B,viruses, to name a few. The specific sequences to be used in the RTD-RNA will depend on the type of retrovirus or reverse transcriptase expressed within the virally infected cell type. For example, when targeting lentivirus infected cells, i.e., HIV, feline immunodeficiency virus (FIV), equine infectious anemia virus (EIAV) , or simian immunodeficiency virus (SIV) lentivirus recognition signals would preferably be used to ensure recognition by the lentivirus expressed reverse transcriptase. However, it should be noted that in some instances heterologous reverse transcriptase and recognition signals may be utilized if such combinations function to reverse transcribe the RTD-RNA of interest.

[0021] Additionally, the RTD-RNA is engineered to contain any nucleotide sequence or combination of nucleotide sequences, in forward or reverse orientation, encoding a translatable peptide or protein product. In this application, the term "forward orientation" means that the sequence(s) encoded by the RTD-RNA are in the sense orientation could possibly act as a functional nucleotide sequence, or as an mRNA that could be subject to direct translation to encode a peptide without first undergoing reverse transcription into DNA, followed by transcription into RNA and translation. The following reference describes viral RNAs that can be translated directly, without first undergoing the process of reverse transcription (Galla M, Will E, Kraunus J, Chen L, Baum C. Retroviral pseudotransduction for targeted cell manipulation. MoI Cell. 2004 Oct 22;16(2):309-15.) Reverse orientation means that the gene sequences encoded by the RTD-RNA are in the anti- sense direction, they will not generate the RTD-RNA encoded peptide or protein if translated directly.

[0022] In a preferred embodiment the nucleotide sequences may encode toxins or other proteins which provide some function which enhances the susceptibility of the cells to subsequent treatments, such as radiation, drug or chemotherapy. In a highly preferred embodiment of the invention a RTD-RNA molecule is designed to encode the Diphtheria toxin subunit A (Greenfield, L., et al., 1983, Proc. Nat'l. Acad. Sci. USA 80:6853-6857). Diphtheria toxin subunit A contains enzymatic toxin activity and will function, if delivered into or expressed within human cells, resulting in cell death. Furthermore, various other known peptide toxins may be used in the present invention, including but not limited to ricin, Pseudomonus toxin, Shiga toxin and exotoxin A. Nucleotide sequences encoding such toxins are known to those of skill in the art. Additionally, the RTD-RNA molecule may encode one or more enzymes (such as HSV- thymidine kinase) that can be used to activate a pro-drug molecule such as gancyclovir.

[0023] In yet another embodiment of the invention, the RTD-RNA can be engineered to contain one or any combination of nucleotide sequences, in forward or reverse orientation, encoding for a nucleotide sequence that inhibits, alters or reprograms the translation of selected RNA molecules expressed within the target cell. For example, the nucleotide sequences may function as antisense, ribozyme, trans-splicing, aptamer, decoy, inhibitory, miRNA, riboswitches, or RNAi molecule thereby inhibiting, altering or reprograming transcription, pre-mRNA processing, splicing, nuclear transport, stability or translation of the RNA to which it binds. In a preferred embodiment of the invention, the RNA to be inhibited, altered, or reprogramed is a virally encoded RNA. hi addition, any other nucleotide sequence may be encoded by the RTD-RNA (or reverse transcribed DNA) which may be useful to co- express within the cell.

[0024] In an embodiment of the invention, a translatable nucleotide sequence encoding a protein capable of producing a reporter molecule may also be included in the RTD-RNA of the invention. Such reporter genes include but are not limited to bioluminescent and fluorescent molecules, fluorescent resonance energy transfer (FRET) partner molecules, interacting molecules (such as those used in 2 hybrid studies), receptors, ion channel components, enzymes, and protein/peptide tags (Yu et al., 2000 Nature Medicine 6:933-937; MacLarent et al., 2000 Biol Psychiatry 48:337-348; Zaret et al., 2001 J. Nuclear Cardiology March/April 256-266; Ray et al, 2001 Seminars in Nuclear Medicine 31 :312-320; Lok, 2001 Nature 412:372-374; Allport et al., 2001 Experimental Hematology 29:1237-1246; Berger and Gambhir, 2000 Breast Cancer Research 3:28-35; Cherry and Gambhir, 2001, ILAR Journal 42:219-232). Bioluminescent molecules include but are not limited to firefly, Renilla or bacterial luciferase. Fluorescent molecules include, for example, green fluorescent protein or red fluorescent protein.

[0025] In yet another embodiment of the invention, the reporter molecule may be an enzyme such as β-galactosidase (Louie et al., 2000 Nature Biotechnology 15:321-325), cytosine deaminase, herpes simplex virus type I thymidine kinase, creatine kinase (Yaghoubi et al., 2001 Human Imaging of Gene Expression 42:1225-1234; Yaghoubi et al., 2001 Gene Therapy 8:1072-1080; Iyer et al., 2001 J. Nuclear Medicine 42:96-105), or arginine kinase, to name a few. The enzyme may be selected because of its ability to trap a specific radio labeled tracer by action of the enzyme on a chosen tracer.

[0026] Alternatively, the nucleotide sequences can encode for an intracellular, membrane component, and/or extracellular marker protein, such as a receptor or membrane channel, which is capable of interacting with, transporting, accumulating, or binding to a labeled tracer that has a binding affinity for the expressed marker protein. Such proteins include, for example, the dopamine 2 receptor, sodium/iodine symporter (Vassaux and Groot-Wassmk , J Biomed Biotechnol. 2003; 2003 (2): 92—101), somatostatin receptor, oxotechnetate-binding fusion proteins, gastrin-releasing peptide receptor, cathepsin D, the transferrin receptor or the CFTR chloride ion channel.

[0027] Nucleotide sequences encoding peptide tags, also referred to as epitope tags, may also be included in the structure of the RTD-RNAs of the invention. In a preferred embodiment of the invention, the epitope is one that is recognized by a specific antibody or binds to a specific ligand, each of which may be labeled, thereby providing a method for imaging of cells expressing reverse transcriptase. Epitopes that may be used include, but are not limited to, AUl, AU5, BTag, c-myc, FLAG, Glu-Glu, HA, His6, HSV, HTTPHH, IRS, KT3, Protein C, S-Tag, T7, V5, or VSV-G.

[0028] The RTD-RNAs of the invention will also contain sequences, in forward or reverse orientation, capable of regulating the expression of the protein or nucleic acid molecules of interest. Such expression can be regulated by any polyadenylation signal, promoter and or enhancer known in the art to act in mammalian, preferably human cells. Such promoters can be inducible or constitutive. Such promoters include but are not limited to: the SV40 early promoter region (Benoist, C. and Chambon, P. 1981, Nature 290:304- 310), the promoter contained in the 3' long terminal repeat of Rous sarcoma virus (Yamamoto et al., 1980, Cell 22:1 %1 -191), the herpes thymidine kinase promoter (Wagner et al., 1981, Proc. Natl. Acad. Sci. USA 78:1441-1445), the regulatory sequences of the metallothionein gene (Brinster et al., 1982, Nature 296:39-42), the viral CMV promoter, the human chorionic gonadotropin-/3 promoter (Hollenberg et al., 1994, MoI. Cell. Endocrinology 106:111-119), etc. Other expression elements, such as the LTRs of retroviruses or ITRs of adeno-associated virus may also be utilized. Any other sequence elements known to those of skill in the art which modulate or define transcription units may also be incorporated.

5.2. SYNTHESIS OF THE MOLECULES

[0029] The RTD-RNAs of the invention are typically nucleic acid molecules or derivatives or modified versions thereof. The RTD-RNAs of the invention are preferably RNA molecules composed of ribonucleosides with phosphodiester linkages or modified linkages. The term nucleic acid also specifically includes nucleic acids composed of bases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine and uracil).

[0030] The RTD-RNAs of the invention can be prepared by any method known in the art for the synthesis of nucleic acid molecules. For example, the nucleic acids maybe chemically synthesized using commercially available reagents and synthesizers by methods that are well known in the art (see, e.g., Gait, 1985, Oligonucleotide Synthesis: A Practical Approach, IRL Press, Oxford, England).

[0031] Alternatively, RTD-RNAs can be generated by in vitro transcription of DNA sequences encoding the RTD-RNAs of interest. Such DNA sequences can be incorporated into a wide variety of vectors downstream from suitable RNA polymerase promoters such as the T7, SP6, or T3 polymerase promoters. Consensus RNA polymerase promoter sequences include the following:

T7: TAATACGACTCACTATAGGGAGA SP6: ATTTAGGTGACACTATAGAAGNG T3: AATTAACCCTCACTAAAGGGAGA.

The base in bold is the first base incorporated into RNA during transcription. The underline indicates the minimum sequence required for efficient transcription.

[0032] RNAs may be produced in high yield via in vitro transcription using plasmids such as SPS65 and Bluescript (Promega Corporation, Madison, WI). In addition, RNA amplification methods such as Q-/3 amplification can be utilized to produce the RTD-RNA of interest. [0033] The RTD-RNAs of the invention, whether synthesized chemically, in vitro, or in vivo, can be synthesized in the presence of modified or substituted nucleotides to increase stability or uptake. In addition, following synthesis of the RTD-RNAs, the RTD-RNAs may be modified with peptides, chemical agents, antibodies, or nucleic acid molecules, for example, to enhance the physical properties of the RTD-RNA molecules, for example, to enhance binding, to enhance cellular uptake, to improve pharmacology or pharmacokinetics or to improve other pharmaceutically desirable characteristics.

[0034] Following synthesis, the RTD-RNAs may be purified by any suitable means, as are well known in the art. For example, the RTD-RNAs can be purified by gel filtration, affinity or antibody interactions, reverse phase chromatography or gel electrophoresis. Of course, the skilled artisan will recognize that the method of purification will depend in part on the size, charge and shape of the nucleic acid to be purified.

[0035] In addition, the RTD-RNAs can be generated by in vivo transcription within a cell. DNA encoding the RTD-RNAs of interest may be engineered into a variety of host vector systems that also provide for replication and production of the DNA in large scale or contain the necessary elements for directing high level transcription of the RTD-RNAs. For example, a vector can be introduced in vivo such that it is taken up by a cell and directs the transcription of the RTD-RNAs molecule. Such vectors may remain episomal or become integrated into the host genome, as long as it can be transcribed to produce sufficient quantities of the desired RTD-RNA. Such vectors can be constructed by recombinant DNA technology methods standard in the art.

[0036] In instances where a nucleic acid molecule encoding a RTD-RNA is utilized, cloning techniques known in the art may be used for cloning of the nucleic acid molecule into an expression vector. Methods commonly known in the art of recombinant DNA technology which can be used are described in Ausubel et al. (eds.), 1993, Current Protocols in Molecular Biology, John Wiley & Sons, NY; and Kriegler, 1990, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY.

[0037] Vectors encoding the RTD-RNAs of interest can be plasmid, viral, or others known in the art used for replication and expression in mammalian cells. Expression of the sequence encoding the RTD-RNAs can be regulated by any promoter known in the art to act in mammalian, preferably human cells. Such promoters can be inducible or constitutive. Such promoters include but are not limited to: the SV40 early promoter region (Benoist, C. and Chambon, P. 1981, Nature 290:304-310), the promoter contained in the 3' long terminal repeat of Rous sarcoma virus (Yamamoto et al., 1980, Cell 22:787-797), the herpes thymidine kinase promoter (Wagner et al., 1981, Proc. Natl. Acad. Sci. USA 78:1441-1445), the regulatory sequences of the metallothionein gene (Brinster et al., 1982, Nature 296:39- 42), tetracycline inducible or repressible, ecdysone, mifepristone, or rapamycin promoters, the viral CMV promoter, the human chorionic gonadotropin promoter (Hollenberg et al., 1994, MoI. Cell. Endocrinology 106:111-119), etc. Any type of plasmid, cosmid, YAC or viral vector can be used to prepare the recombinant DNA construct which can be introduced directly into the tissue site.

[0038] A selectable mammalian expression vector system can also be utilized. A number of selection systems can be used, including but not limited to selection for expression of the herpes simplex virus thymidine kinase, hypoxanthine-guanine phosphoribosyltransterase and adenine phosphoribosyl tranferase protein in tk-, hgprt- or aprt- deficient cells, respectively. Also, anti-metabolic resistance can be used as the basis of selection for dihydrofolate transferase (dhfr), which confers resistance to methotrexate; xanthine-guanine phosphoribosyl transferase (gpt), which confers resistance to mycophenolic acid; neomycin (neo), which confers resistance to aminoglycoside G-418; and hygromycin B phosphotransferase (hygro) which confers resistance to hygromycin.

[0039] In a preferred embodiment of the invention, recombinant viral vectors may be genetically engineered to express a RTD-RNA of interest within a selected target cell. The recombinant viruses of the invention are designed to encode RTD-RNAs comprising (i) recognition signals for reverse transcriptase mediated RNA and DNA synthesis and processing; (ii) a nucleotide sequence, in reverse orientation, capable of encoding a polypeptide or nucleic acid of interest; and (iii) a nucleotide sequence, in reverse orientation, capable of directing the expression of the polypeptide or nucleic acid of interest. The RTD- RNA molecules are designed to be reverse transcribed to form a DNA molecule capable of encoding a polypeptide, or nucleic acid molecule capable of inhibiting viral replication and/or mediating cell destruction, hi preferred embodiments of the invention the recombinant viral vectors are retroviral, lentiviral, or adeno-associated virus (AAV) vectors. It may be useful to remove or alter the Ψ viral packaging signal so that the RTD-RNA is not packaged and exported out of cells actively producing new virons.

[0040] Li yet another embodiment of the invention, methods and compositions are provided for conferring selective cell death on cells expressing RT as a consequence of being infected with a pathogenic agent. In such instances, the RTD-RNA is delivered by a replication incompetent viral vector wherein the RTD-RNA is designed to be reverse transcribed by RT produced by the pathogenic infective agent. The gene, protein, or function provided by the reverse transcribed RTD-RNA provides one or more essential activities necessary for complementation of the conditionally replicative viral vector. The methods and compositions of the invention may be utilized for selective destruction of infected cells. [0041] In a particular embodiment of the invention, the RTD-RNA is delivered by a recombinant conditionally replicative adenovirus which is defective for replication but capable of expressing a RTD-RNA. Within the meaning of the present invention, the expression "conditionally replicative adenovirus" refers to a defective adenovirus which is incapable of autonomous replication in a host cell until the viral defect is complemented in trans, as described in US patent application number 20040038403 and references contained therein. The present invention is based on the ability of the RTD-RNA(s) of the invention to provide complementing activity upon successful delivery, reverse transcription and expression of the RTD-RNA.

[0042] The present invention encompasses recombinant adenovirus wherein at least one adenovirus gene is deleted. In a preferred embodiment of the invention the adenovirus early region El, E2 or E4 gene is deleted and replaced with nucleic acid sequences encoding the RTD-RNA(s) of interest. Recombinant adenoviruses of the invention also include those viruses having multiple deletions and insertion of one or more RTD-RNA encoding sequence. Since such an adenovirus is conditionally replicative, the virus is initially propagated in cells that complement the deleted region(s) of the adenovirus, i.e., "complementing cell line". Within the meaning of the present invention "complementing cell line" refers to a cell line that provides the gene products necessary for replication of the defective adenovirus. Such cells include those infected with a helper virus.

[0043] In a specific embodiment of the invention, the early region 1 (El) is deleted and replaced with a nucleic acid sequences encoding a RTD-RNA of interest and the virus is propagated in an El -trans-complementing cell line such as 293 (Graham et al., 1977, J. Gen. Virol. 36:59-72) or in cell lines expressing the pre-mRNA target. In another embodiment, the conditionally replicating adenovirus may be propagated in vitro in cell lines naturally expressing or engineered to express the specific target pre-RNA(s).

[0044] Standard methods for making such deleted adenovirus vectors, such as El deleted vectors, may involve in vitro ligation methods or homologous recombination methods. (See, Adenoviral Vectors for Gene Therpy, Curiel and Douglas, eds. 2002, Academic Press). The following section describes methods for generating El deleted adenoviruses wherein the El region is replaced with a nucleic acid molecule encoding an RTD-RNA of interest, however, such methods can also be used to generate adenoviruses with deletions and insertion of RTD- RNA encoding nucleic acids in other regions of the virus. The complementing cell lines to be used when producing such viruses will depend on the type of deletion, for example, El, E2 or E4, and can be determined by one of ordinary skill in the art. 5.3. USES AND ADMINISTRATION OF MOLECULES

[0045] The compositions and methods of the present invention will have a variety of different applications including targeted cell death, interference with viral life cycle or viral/host processes, and real time imaging. For example, the compositions can be used to selectively express a protein with toxic properties in a cell expressing RT. In addition, RTD- RNAs can be used to express, upon formation of a DNA, transcripts capable of binding to viral niRNA and inhibiting, altering (complementing) or reprograming viral gene expression.

[0046] Various delivery systems are known and can be used to transfer the compositions of the invention into cells in vitro or in vivo, including conjugating RTD-RNAs with cationic lipids (Lu, D., et al, 1994, Cancer Gene Ther., 1:245-252) or polycations, DEAE-dextran (Malone, R. W., et al., 1989, Proc. Natl Acad. Sci. USA, 86:6077-6081), poly(L-lysine) (Fisher, KJ. and Wilson, J.M., 1997, Biochem. J., 321:49-58) or dendrimers (Strobel, L, et al., 2000, Gene Ther., 7:2028-2035).

[0047] In another embodiment of the invention, RTD-RNAs may be covalently linked to lipophilic groups or other reagents capable of improving uptake by cells. For example, the RTD-RNAs may be covalently linked to: (i) cholesterol (Letsinger, R. L., et al., 1989, Proc. Natl. Acad. Sci. USA, 86:6553-6556); (ii) polyamines (Lemaitre, M., et al., 1987, Proc. Natl. Acad. Sci, USA, 84:648-652); other soluble polymers (e.g. polyethylene glycol) to improve the efficiently with which the RTD-RNAs are delivered to a cell. In addition, combinations of the above identified modifications may be utilized to increase the stability and delivery of RTD-RNAs into the target cell.

[0048] Direct in vivo RTD-RNA transfer may be achieved with formulations of synthetic RTD-RNAs trapped in liposomes (Ledley et al., 1987); or in proteoliposomes that contain viral envelope receptor proteins (Nicolau et al., 1983) The present invention relates to the synthesis of novel cationic, amphiphilic lipids and their application as RTD-RNAs transfer vehicles in vitro and in vivo. A variety of different lipids (diglycerides, steroids) can be synthesized and modified with variable cationic molecules (amino acids, biogenic amines). Compounds of this kind are, due to their capability of producing complexes with polynucleotides (DNA, RNA, antisense oligonucleotides, ribozymes, etc.) suitable as vectors for RTD-RNAs (transfection) (See, U.S. Patent No. 6,268,516; Feigner P.L., et al., 1987, Lipofection: a highly efficient, lipid-mediated DNA transfection procedure, Proc. Natl. Acad. Sci. USA, 84:7413-7417). Delivery can also be mediated or facilitated by electroporation or mechanical means, such as ballistic particles (gene gun).

[0049] In order to achieve a highly efficient gene transfer both in vitro and in vivo the cationic lipids employed for the generation of liposomes should be non-toxic, fully biodegradable and should not cause an immune reaction. In addition, the liposomes should form complexes with the RTD-RNAs with high efficacy, protect the RTD-RNAs against degradation, and provide high transfection efficiencies. In a preferred embodiment of the invention, liposomes can be engineered in a receptor specific manner. Methods for synthesis of cationic lipids are well known to those of skill in the art.

[0050] Receptor-mediated gene transfer may also be used to introduce RTD-RNAs into target cells, both in vitro and in vivo. Such transfer involves linking the RTD-RNA to a polycationic protein (usually poly-L-lysine) containing a covalently attached ligand, which is selected to target a specific receptor on the surface of the cell of interest. The nucleic acid is taken up by the cell and expressed. Cell-specific delivery of a RTD-RNA using a conjugate of a polynucleic acid binding agent (such as polylysine, polyarginine, polyoraithine, histone, avidin, or protamine) and a tissue receptor-specific protein ligand may also be achieved using the method of Wu et al. (U.S. Patent No. 5,166,320).

[0051] In yet another embodiment of the invention the "naked" RTD-RNAs may be directly injected into the host (Dubenski et al., Proc. Natl. Acad. Sci. USA, 81 :7529-33 (1984)). The RTD-RNAs may be precipitated using calcium phosphate and injected together with a suitable carrier.

[0052] In a preferred embodiment of the invention, recombinant viral vectors are utilized to transfer the RTD-RNAs of the invention into the selected cell type. The recombinant viruses of the invention will be administered in amounts which are effective to produce the desired effect in the targeted cell, e.g., virus mediated cell lysis or inhibition of viral replication. Effective dosages of the viruses can be determined through procedures well known to those in the art which address such parameters as biological half-life, bioavailability and toxicity.

[0053] The present invention also provides for pharmaceutical compositions comprising an effective amount of a RTD-RNA, or a recombinant expression vector capable of expressing a RTD-RNA, and a pharmaceutically acceptable carrier. In a specific embodiment, the term "pharmaceutically acceptable" means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the synthetic is administered. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical sciences" by E. W. Martin.

[0054] The present invention also provides for pharmaceutical compositions comprising an effective amount of a RTD-RNA or a nucleic acid encoding a RTD-RNA, and a pharmaceutically acceptable carrier. In a specific embodiment, the term "pharmaceutically acceptable" means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical sciences" by E. W. Martin. In a specific embodiment, it may be desirable to administer the pharmaceutical compositions of the invention locally to the area in need of treatment. This may be achieved by, for example, and not by way of limitation, local infusion during surgery, topical application, e.g., in conjunction with a wound dressing after surgery, by injection, by means of a catheter, by means of a suppository, or by means of an implant, said implant being of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers. Other control release drug delivery systems, such as nanoparticles, matrices such as controlled-release polymers, hydrogels.

[0055] The RTD-RNAs will be administered in amounts which are effective to produce the desired effect in the targeted cell. Effective dosages of the RTD-RNAs can be determined through procedures well known to those in the art which address such parameters as biological half-life, bioavailability and toxicity. The amount of the composition of the invention which will be effective will depend on the nature of the disease or disorder being treated, and can be determined by standard clinical techniques. In addition, in vitro assays may optionally be employed to help identify optimal dosage ranges. If viral delivery vectors are employed, various assays have been described and are known to be useful to determine effective dosages for viral infection or transduction.

[0056] The present invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention optionally associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.

[0057] In a specific embodiment, it may be desirable to administer the pharmaceutical compositions of the invention locally to the area in need of treatment, e.g., within the bone marrow or skin, the site of the tumor or infection. This may be achieved by, for example, and not by way of limitation, inhalation, local infusion during surgery, topical application, e.g., in conjunction with a wound dressing after surgery, by injection, by means of a catheter, by means of a suppository, or by means of an implant, said implant being of a porous, non- porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers. Other control release drug delivery systems, such as nanoparticles, matrices such as controlled-release polymers, hydrogels.

[0058] The present invention also provides diagnostic methods and compositions for imaging of gene expression in cells expressing a functional reverse transcriptase, i.e., virally infected cells. Thus, the compositions and methods of the invention may be used to detect the presence of virally infected cells.

[0059] The diagnostic methods of the invention comprise contacting a test subject, or a sample derived from a test subject, with a RTD-RNA or a nucleic acid molecule encoding a RTD-RNA . If reverse transcriptase is expressed in the sample, or in the test subject, a reverse transcription reaction will occur resulting in the production of a DNA molecule capable of encoding a reporter molecule. Detection of the reporter molecule indicates the presence of virally infected cells. Alternatively, expression of the reporter molecules may be useful to quantify the amount or activity of RT within cells.

5.4. SCREENING ASSAYS

[0060] In another embodiment of the invention, RTD-RNAs may be designed to encode one or more reporter molecules or selectable markers that can be used to screen for compounds capable of directly or indirectly modulating reverse transcriptase activity.

[0061] The methods and compositions of the invention can be used to rapidly evaluate, compare and identify compounds on the basis of their ability to inhibit reverse transcriptase mediated gene expression. The compounds identified using the screening methods of the invention can be used to inhibit reverse transcriptase mediated viral replication. In addition, the compounds may also interfere with other viral processes, including binding, fusion, entry, nuclear translocation, integration, transcription, splicing, translation, ribosomal frameshifiting (required to make gag/pol), and protease activity.

[0062] In accordance with the invention, a cell-based assay system can be used to screen for compounds that modulate the activity of RT directly or indirectly by interfering with other viral processes and thereby, modulate viral gene expression. To this end, cells comprising an RTD-RNA molecule and reverse transcriptase or any portion of a virus that expresses RT can be used to screen for compounds.

[0063] Specifically, the present invention provides for methods for identifying a compound that inhibits RT activity comprising (i) contacting a cell expressing a RTD-RNA molecule and reverse transcriptase (whether provided by a virus or by other means) with a test compound and measuring the level of RTD-RNA expression; (ii) in a separate experiment, contacting a cell comprising a RTD-RNA molecule and reverse transcriptase (whether provided by a virus or by other means) with a vehicle control (e.g., placebos) and measuring the level of RTD-RNA expression, where the conditions are essentially the same as in part (i) and then (iii) comparing the level of RTD-RNA expression measured in part (i) with the level of RTD-RNA expression in part (ii), wherein a decrease level of RTD-RNA expression in the presence of the test compound indicates that the test compound is a RT inhibitor, by directly acting upon RT or indirectly by affecting some other viral process that causes a reduction in the level of RT produced.

[0064] Levels of RTD-RNA can be detected using a variety of different methods well known to those of skill in the art for detection of nucleic acid molecules, i.e., PCR amplification, and hybridization methods.

[0065] In a specific embodiment of the invention, levels of RT can be measured using constructs wherein the RTD-RNAs is designed to encode any of a variety of different reporter genes. Such reporter genes may include but are not limited to chloramphenicol acetyltransferase (CAT), firefly, Renilla, or bacterial luciferase, green, yellow, blue or red fluorescent protein, β-glucuronidase (GUS), growth hormone, or placental alkaline phosphatase (SEAP). Such constructs are introduced into cells capable of expressing RT thereby providing a recombinant cell useful for screening assays designed to identify modulators of RT activity.

[0066] In yet another embodiment of the invention, the RTD-RNA may be engineered to encode for a toxic protein or other selectable marker or enzyme, such as a thymidine kinase, which can convert a non-toxic prodrug (gancyclovir) into a toxic compound thereby providing a positive selection for compounds capable of inhibiting RT activity.

[0067] Following exposure of the cells to the test compound, the level of reporter gene expression may be quantified to determine the test compound's ability to regulate RT activity. Alkaline phosphatase assays are particularly useful in the practice of the invention as the enzyme is secreted from the cell. Therefore, tissue culture supernatant may be assayed for secreted alkaline phosphatase. In addition, alkaline phosphatase activity may be measured by calorimetric, bioluminescent or chemilumenscent assays such as those described in Bronstein, I. et al. (1994, Biotechniques 17: 172-177). Such assays provide a simple, sensitive easily automatable detection system for pharmaceutical screening.

[0068] Test compounds which inhibit the activity or quantity of RT, identified by any of the above methods, may be subjected to further testing to confirm their ability to inhibit viral replication. For example, a study may be performed where HIV or lenti viral replication is assayed. [0069] The assays described above can identify compounds which modulate RT activity. For example, compounds that affect RT activity include but are not limited to compounds that bind to the RT and inhibit RT activity. Compounds that affect RT gene activity (by affecting RT gene expression, including molecules, e.g., proteins or small organic molecules, that affect transcription or interfere with splicing events so that expression of the full length or the truncated form of the RT can be modulated) can also be identified using the screens of the invention. However, it should be noted that the assays described can also identify compounds that modulate RT activity indirectly (e.g., compounds which affect upstream or downstream events, such as inhibitors or enhancers of RT activity). In addition, the compounds to be screened and identified may also interfere with other viral processes including: binding, fusion, entry, nuclear translocation, integration, transcription, splicing, translation, ribosomal frameshifiting (required to make gag/pol), and protease activity. The identification and use of such compounds are within the scope of the invention.

[0070] The compounds which may be screened in accordance with the invention include, but are not limited to, small organic or inorganic compounds, peptides, antibodies and fragments thereof, and other organic compounds (e.g., peptidomimetics) that may inhibit RT activity. Compounds may include, but are not limited to, peptides such as, for example, soluble peptides, including but not limited to members of random peptide libraries (see, e.g., Lam, K.S. et al., 1991, Nature 354:82-84; Houghten, R. et al., 1991, Nature 354:84-86); and combinatorial chemistry-derived molecular library made of D- and/or L- configuration amino acids, phosphopeptides (including, but not limited to, members of random or partially degenerate, directed phosphopeptide libraries; (see, ej*., Songyang, Z. et al., 1993, Cell 72:767-778), antibodies (including, but not limited to, polyclonal, monoclonal, humanized, anti-idiotypic, chimeric or single chain antibodies, and FAb, F(ab')₂ and FAb expression library fragments, and epitope binding fragments thereof), and small organic or inorganic molecules.

[0071] Other compounds which may be screened in accordance with the invention include but are not limited to small organic molecules that affect the expression of the RT gene or compounds that affect the activity of the RT or the activity of some other intracellular factor involved in the RT activity. Combinations of different compounds and various concentrations may be tested using the assay (the invention). Cells or viruses from patients may be used (directly or after expansion and/or purification) to evaluate the susceptibility of drug resistant viral strains to various drug combinations and concentrations. Such tests, often referred to as "phenotypic assays" may be useful to determine which treatment regimens would potentially be advantageous for individual patients. [0072] 6. EXAMPLE: CONDITIONAL EXPRESSION OF RTD-RNA

[0073] The examples presented below 1) demonstrate that the ability of a cell to provide extra RT in trans- can increase transgene expression in an RT positive virus (lentivirus), and 2) describe methods for conditional expression of RTD-RNA marker gene constructs in engineered human cells that express HIV reverse transcriptase (RT).

[0074] Design of initial RTD-RNAs constructs: The RTD-RNAs constructs incorporate a backwards marker gene that encodes green fluorescent protein (GFP). GFP is relatively easy to visualize and quantify. This simplifies the detection and quantification of RT dependent GFP expression and permits rapid comparison of various RTD-RNA constructs in cells that do or do not express RT.

[0075] RTD-RNA constructs are generated by altering a modified genomic viral packaging plasmid, creating a backwards, reverse orientated promoter and marker gene. The orientation of the promoter, cloning sites and polyadenylation (polyA) signal is reversed in a lentiviral transfer vector such as pRRL.SIN-18, (T. Dull, R. Zufferey, M. Kelly, R. J. Mandel, M. Nguyen, D. Trono, and L. Naldini. A Third-Generation Lentivirus Vector with a Conditional Packaging System. J. Virol. 72, 8463-8471, 1998) or one of the pLenty vectors, such as pLenti4/V5-DEST (available from Invitrogen) which are based on pRRL.SIN-18 . These plasmids are used in combination with a third generation lentiviral conditional packaging system to generate virus which does not package numerous pathogenic or accessory viral genes and also has self inactivating LTRs. These are important safety features and will facilitate the experiments. Such vectors may utilize an heterologous envelop to pseudotyped the virus, such as VSVG. The use of pseudotyped vectors to deliver the RTD-RNA may facilitate test cell co-infection with HIV. hi Figure 1, the RTD-RNA is depicted in the sense or forward direction, as (+) strand RNA. GFP is inserted in the anti- sense direction (to the viral genomic RNA) between the reverse promoter and polyA site of the altered transfer vector to create a prototype RTD-RNA. In addition, the pol gene of the gag-pol plasmid (in the pMDLg/RRE plasmid as described by Dull et al, or pLPl in the hivitrogen system) is mutated to eliminate RT activity. Mutations that reduce or eliminate RT activity include altering the YMDD motif at amino acid 183-186 to YMAA (Lowe DM, Parmar V, Kemp SD, Larder BA. Mutational analysis of two conserved sequence motifs in HIV-I reverse transcriptase. FEBS Lett. 282(2): 231-4, 1991)

[0076] To increase the efficiency of initial experiments, a T7 RNA promoter can be inserted upstream of the 5' LTR to generate a RTD-RNA T7 expression plasmid, which can be transcribed using an T7 RNA polymerase system. The RTD-RNA generated can be transfected into various human cell lines that either express HIV RT, or do not. Expression of GFP is examined at 2 to 4 days post transfection by either fluorescent microscopy, fluorescent plate reader, or by FACS analysis.

[0077] An alternative method for the detection of GFP positive cells may also be utilized if reverse transcription of the RTD-RNA is initially a rare event. pLenty vectors (Invitrogen) also contain selection markers such as zeocin or blasticidin. Such vectors may be used to enrich for populations of cells containing reverse transcribed RTD-RNA before analyzing for GFP expression. PCR using primers specific for the RTD-RNA sequences can also be performed on DNA from enriched or unselected cells to determine if reverse transcription has occurred. Quantitative PCR may also be performed to compare the efficiency of various RTD-RNA constructs.

[0078] BTV RT expressing cells: HTV RT expressing cells may be generated using a number of different methods. For example, HeLa, 293, Jurkat or other suitable or permissive (CD4 positive) cell lines may be transfected with various HIV RT expressing plasmids. The cells may be transiently transfected using plasmids encoding full length gag/pol along with a rev expression plasmid (such as pLPl and pLP2, Invitrogen), RT (such as pPolo, NIH AIDS Research and Reference Reagent Program), or the individual p66 and p51 RT subunits . Stable RT expressing cells may also be obtained from the NTH AIDS Research and Reference Reagent Program. Cells may be tested to quantify the level of functional RT they express by a number of different methods, such as described using cell lysates. (Ansari-Lari, M. A, and R.A. Gibbs. Expression of Human Immunodeficiency Virus Type 1 Reverse Transcriptase in trans during Virion Release and after Infection. J. Virol. 70, 3870-3875, 1996). Initial experiments to detect RTD-RNA mediated GFP expression are performed in the cell clones expressing the highest levels of RT activity. Should RTD-RNA GFP expression be undetectable in cells that express only HFV RT, other HIV genes can be sequentially added by transfecting plasmids expressing additional HIV genes. To prevent packaging and subsequent infection of cells by a RTD-RNA in a virus that contains RT, the ψ packaging sequence may be deleted from the T7-RTD-RNA plasmid. Additionally, T7 transcribed RTD-RNA can be transfected into cells infected with wild-type HFV. Such HIV infected cells are most representative of the conditions in which RTD-RNA would be expected to function, but require more stringent laboratory precautions.

[0079] Analysis of various RTD-RNAs to optimize reverse transcription and expression: Initial RTD-RNAs may not produce detectable reverse transcription in RT positive cells. Even if reverse transcription is detected, it is possible that the RTD-RNA constructs may not be optimal for reverse transcription and expression. Therefore, the efficiency and specificity of various modified RTD-RNAs can be tested to identify more optimal RTD-RNAs. Modifications to optimize the RTD-RNA include alterations of the T7 RTD-RNA plasmid, transfection, production and isolation of T7 RTD-RNA DNA, T7 translation, transfection into RT positive and RT negative test cells, overexpression of RT, and detection of either GFP or reversed transcribed DNA by PCR. Variant RTD-RNAs to be tested may include modification of different lentiviral packaging transfer constructs, including up to a wild-type HIV genome with the RT gene knocked out; removal of non-essential genes such as selectable antibiotic resistance genes (i.e., Zeocin, ampicillin, or both) to reduce the length of the RTD-RNA which may improve the efficiency of RT processing; and changing the order or location of the tRNA primer binding site (PBS). Moving the PBS towards the 3' end of the RTD-RNA may improve reverse transcription of the first DNA strand; alteration of the PBS or adjacent sequences may also enhance the binding of primer or RT; modification to the polypyrimidine tract or RT pause sites may also improve efficiency. Additionally, it may be useful to pre-incubate the T7 RTD-RNA with viral proteins, such as nucleocapsid (NC) to improve the efficiency of RT in trans.

[0080] The most efficient and specific RTD-RNA constructs are subcloned into lentiviral transfer plasmids to produce RT minus lentivirus versions of RTD-RNA designs. In order to produce virus that does not contain RT, mutations are generated in the gag/pol plasmid that are similar to those produced by Gibbs. (T. Dull, R. Zufferey, M. Kelly, R. J. Mandel, M. Nguyen, D. Trono, and L. Naldini. A Third-Generation Lentivirus Vector with a Conditional Packaging System. J. Virol. 72, 8463-8471, 1998). Reverse transcription of RTD-RNA delivered by an RT deficient virus into in RT positive and RT negative cells is analyzed for GFP expression and PCR as described above.

[0081] hi addition to the system described above, production and delivery of RTD-RNAs can be moved to a lentiviral packaging system. Reverse transcription may be facilitated by delivery of the RTD-RNA coated by NC, along with other the viral components. For these experiments, two related VSVG pseudotyped lentiviral GFP expression vectors were produced. For experiment A; a virus was made with an RNA genome that contained a forward orientated CMV promoter driven GFP gene. For experiment B_i the viral genome was cut by restriction enzymes and ligated to flip the orientation of the CMV-GFP cassette into a reverse orientation and adding a poly adenylation signal to create a reverse orientation RTD-RNA virus (see Fig.l). The RT positive lentivirus used in example 1 was produced using a wild-type gag-pol. The RT deficient lentivirus used in example 2 was produced using a mutated gag-pol plasmid, where the YMDD residues of pol at position 183-186 were changed to YMAA. Cells that express RT were generated by cloning the coding regions for the p66 and p51 HIV RT subunits into expression plasmids and transfecting them into 293 cells using lipofectamine. [0082] Experiment Aj_. Control experiments to test the infectivity of the forward, RT positive GFP lentivirus in untreated 293 cells or the same cells transfected with RT expression plasmids revealed an ~50% increase in GFP positive cells, measured by FACS. To determine the cause of this apparent increase in viral infectivity (titer), several control experiments were performed. Using a single, RT positive forward GFP viral preparation at an estimated multiplicity of infection of 20%, FACS analysis was performed on 293 cells (48 hrs post infection (or more precisely "transduction"), 96 hrs post transfection with lipofectamine alone) which demonstrated a slightly increased number of GFP positive cells compared to infected only 293 cells (data not shown). This increase was equivalent to the increased number of GFP positive cells that were first transfected with RT negative control plasmid, then infected (Fig.3, lower line labeled 1, y-axis = number of cells, x-axis = level of green fluorescence). The rectangular box in the upper left corner of figure 3 shows the total population of cells and the gated analyzed population labeled R2. Remarkably, in cells co- transfected with equivalent amounts of either gag-pol and rev plasmids (Fig 3, line 2) or p66 and p51 RT expression plasmids (Fig. 3, line 3) then infected with the equivalent amounts of virus, there was a further increase in the number of GFP positive cells. The experiment has been repeated several times with similar results. The data indicates that (i) RT activity can be provided by a cell in trans to a lentivirus; and (ii) a "normal" lentivirus may be deficient in RT, indicating that viral gene expression would be expected to be significantly higher if more RT were available to the virus.

Experiment Bi A second line of experiments was performed using the RT deficient RTD- RNA lentivirus made with the YMAA RT mutant gag-pol. This virus was used to infect 293 cells transfected 48 hrs. previously with the p66 and p51 RT plasmids, or untransfected 293 cells. No GFP positive cells were detected by FACS in the untransfected (normal control), RTD-RNA viral infected 293 cells (data not shown). However, there was a small number (30-44) of GFP positive cells in the cells that were transfected with RT plasmids (to generate RT expression and activity) and then infected 48 hrs later with the same amount of RTD- RNA virus (figure 4). No GFP positive cells were detected by FACS analysis of buffer samples run immediately before or after these cell samples. Future experiments will use higher viral titers, which should generate higher numbers of GFP positive cells. Nevertheless, this experiment demonstrates that cells can provide RT in trans to an RT deficient RTD-RNA lentivirus and expression of the RTD-RNA is restricted to cells that can provide RT activity. [0083] 7. EXAMPLE: CONDITIONAL EXPRESSION OF RATIONALLY

DESIGNED RTD-RNA GENE CONSTRUCTS

[0084] The most efficient and specific of the lentiviral delivered RTD-RNA constructs are evaluated for RT trans-complementation in the context of authentic HIV infection. An alternative cell line, such as CEM-A or Jurkat (NIH AIDS Research and Reference Reagent Program) may be utilized. The RTD-RNA lentiviral vectors utilized may be VSVG pseudotyped, thereby permitting transduction of cells that do not express CD-4 or co- infection along with HIV.

[0085] CD-4 positive cells are infected with both a wild-type HIV to provide RT in trans and RTD-RNA delivered by an RT negative (deficient) lentivirus. Appropriate negative controls using mock, HIV and RTD-RNA infection alone are also performed. Reverse transcription is quantified by real time PCR. Expression of GFP produced by the lead RTD- RNAs is quantified by FACS or fluorescent microplate analysis. Reverse transcription of RTD-RNA is tested in CD-4 positive cells using HIV and RT(negative) RTD-RNA lentivirus at several different combinations MOIs (multiplicity of infections). One or two optimal MOI combinations may be identified. Three replicate co-infections at the chosen combination MOIs are performed using wild-type HIV and each lead RTD-RNA lentivirus.

[0086] In another set of experiments, the marker gene is replaced with an anti-sense therapeutic gene, such as a toxin gene (diphtheria or pseudomonas subunit A, for example) and a suitable clinical delivery method or vector is obtained. These viral delivered constructs are tested for specificity and efficiency of cytotoxicity or action in HIV infected and uninfected cells. The therapeutic gene(s) may either interfere with one or more crucial viral functions, stimulate an immune response, or specifically kill the HIV infected host cells.

[0087] The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and accompanying Figures. Such modifications are intended to fall within the scope of the appended claims. Various references are cited herein, the disclosure of which are incorporated by reference in their entireties.

Claims

I CLAIM:

1. A nucleic acid molecule comprising:

(i) one or more recognition signals for reverse transcriptase mediated

RNA and DNA synthesis and processing; (ii) one or more nucleotide sequence(s), in forward or reverse orientation, capable of encoding a polypeptide or nucleic acid of interest; and (iii) one or more nucleotide sequences capable of directing the expression of the polypeptide or nucleic acid of interest.

2. A cell comprising a nucleic acid molecule comprising:

(i) one or more recognition signals for reverse transcriptase mediated

RNA and DNA synthesis and processing; (ii) a nucleotide sequence, in forward or reverse orientation, capable of encoding a polypeptide or nucleic acid of interest; and (iii) a nucleotide sequence capable of directing the expression of the polypeptide or nucleic acid of interest.

3. A method for expressing a nucleic acid of interest in a target cell comprising contacting said target cell with a nucleic acid molecule comprising:

(i) one or more recognition signals for reverse transcriptase mediated

RNA and DNA synthesis and processing; (ii) a nucleotide sequence, in forward or reverse orientation, capable of encoding a polypeptide or nucleic acid of interest; and (iii) a nucleotide sequence capable of directing the expression of the polypeptide or nucleic acid of interest;

wherein the nucleic acid molecule of interest is only expressed in the presence of reverse transcriptase activity.

4. A method for selective destruction of a cell infected with a virus expressing reverse transcriptase comprising contacting said cell with a nucleic acid molecule comprising:

(i) one or more recognition signals for reverse transcriptase mediated RNA and DNA synthesis and processing; (ii) a nucleotide sequence, in forward or reverse orientation, capable of encoding a polypeptide or nucleic acid capable of inducing cell destruction; and

(iii) a nucleotide sequence capable of directing the expression of the polypeptide or nucleic acid of interest;

wherein the expression of the polypeptide or nucleic acid of interest results in destruction of the viral infected cell.

5. A method for detecting the presence of reverse transcriptase activity in a cell comprising: (0 contacting said cell with a nucleic acid molecule comprising:

(a) one or more recognition signals for reverse transcriptase mediated RNA and DNA synthesis and processing;

(b) a nucleotide sequence, in forward or reverse orientation, capable of encoding a reporter molecule; and

(c) a nucleotide sequence capable of directing the expression of the polypeptide or nucleic acid of interest

(ii) detecting the expression of the reporter molecule, wherein detection of expression of the reporter molecule indicates the presence of reverse transcriptase activity.

6. A method for detecting the level of reverse transcriptase activity in a cell comprising:

(i) contacting said cell with a nucleic acid molecule comprising:

(a) one or more recognition signals for reverse transcriptase mediated RNA and DNA synthesis and processing;

(b) a nucleotide sequence, in forward or reverse orientation, capable of encoding a reporter molecule; and

(c) a nucleotide sequence capable of directing the expression of the polypeptide or nucleic acid of interest

(ii) measuring the level of expression of the reporter molecule, wherein the level of expression of the reporter molecule compares with the level of reverse transcriptase activity in a cell.

7. A method for diagnosing a retroviral infection in a subject comprising: (i) obtaining a sample from a subject;

(ii) contacting said sample with a nucleic acid molecule comprising:

(a) one or more recognition signals for reverse transcriptase mediated RNA and DNA synthesis and processing;

(b) a nucleotide sequence, in forward or reverse orientation, capable of encoding a reporter molecule; and

(c) a nucleotide sequence capable of directing the expression of the polypeptide or nucleic acid of interest

(iii) detecting the expression of the reporter molecule, wherein detection of expression of the reporter molecule indicates infection with a retrovirus.

8. A conditionally replication defective virus comprising:

(i) one or more recognition signals for reverse transcriptase mediated RNA and DNA synthesis and processing;

(ii) a nucleotide sequence, in forward or reverse orientation, capable of encoding a polypeptide that provides a function necessary for replication of the defective virus; and

(iii) a nucleotide sequence capable of directing the expression of the polypeptide or nucleic acid of interest.

9. A method for identifying a compound that inhibits RT activity comprising:

(i) contacting a cell expressing a RTD-RNA molecule and reverse transcriptase (whether provided by a virus or by other means) with one or more test compound(s) and measuring the level of RTD-RNA expression;

(ii) in a separate experiment, contacting a cell comprising a RTD- RNA molecule and reverse transcriptase (whether provided by a virus or by other means) with a vehicle control (e.g., placebos) and measuring the level of RTD-RNA expression, where the conditions are essentially the same as in part (i); and (iii) comparing the level of RTD-RNA expression measured in part

(i) with the level of RTD-RNA expression in part (ii), wherein a decrease level of RTD-RNA expression in the presence of the test compound(s) indicates that the test compound is a RT inhibitor, by directly acting upon RT or indirectly by affecting some other viral process that causes a reduction in the level of RT produced.

10. A method for identifying one or more compounds capable of inhibiting retroviral replication in a subject infected with a retrovirus comprising :

(i) contacting a sample of infected cells derived from the infected subject with one or a combination of test compounds and a nucleic acid molecule comprising:

(a) one or more recognition signals for reverse transcriptase mediated RNA and DNA synthesis and processing;

(b) a nucleotide sequence, in forward or reverse orientation, capable of encoding a reporter or other molecule of interest; and

(c) a nucleotide sequence capable of directing the expression of the polypeptide or nucleic acid of interest

(ii) measuring the expression of the reporter or selectable molecule in the presence of a test compound wherein a decrease in the expression o f the reporter or selectable molecule indicates the identification of a compound capable of inhibiting retroviral replication.