WO2023172075A1 - Setmar 억제제를 포함하는 암 예방 또는 치료용 조성물 - Google Patents

Setmar 억제제를 포함하는 암 예방 또는 치료용 조성물 Download PDF

Info

Publication number
WO2023172075A1
WO2023172075A1 PCT/KR2023/003198 KR2023003198W WO2023172075A1 WO 2023172075 A1 WO2023172075 A1 WO 2023172075A1 KR 2023003198 W KR2023003198 W KR 2023003198W WO 2023172075 A1 WO2023172075 A1 WO 2023172075A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
cells
setmar
normal
inhibitor
Prior art date
Application number
PCT/KR2023/003198
Other languages
English (en)
French (fr)
Inventor
조광현
공정렬
김주희
Original Assignee
한국과학기술원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국과학기술원 filed Critical 한국과학기술원
Publication of WO2023172075A1 publication Critical patent/WO2023172075A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0693—Tumour cells; Cancer cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5011—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/308—Foods, ingredients or supplements having a functional effect on health having an effect on cancer prevention
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds

Definitions

  • the present invention relates to a composition for preventing or treating cancer containing a SETMAR inhibitor, and is characterized by reversing cancer cells into normal cells.
  • Cancer is one of the incurable diseases that civilization must solve, and a huge amount of capital is being invested in development to cure it around the world. In Korea, it is the number one cause of death due to disease, killing more than 100,000 people every year. After being diagnosed, more than 60,000 people have died. Among them, liver cancer is designated as the main cause of cancer death according to the "Global cancer statistics 2020" report published by the International Agency for Research on Cancer (IARC) in 2020.
  • IARC International Agency for Research on Cancer
  • Carcinogens that cause such cancer include smoking, ultraviolet rays, chemicals, food, and other environmental factors.
  • the causes are diverse, making it difficult to develop a treatment, and the effectiveness of the treatment also varies depending on the area where it occurs.
  • Substances currently used as treatments have significant toxicity and do not selectively remove cancer cells, so there is an urgent need to develop less toxic and effective anticancer agents to not only treat cancer after it has developed, but also prevent the development of cancer.
  • the primary treatment principle for cancer is surgical resection, but since there is a high recurrence rate even after surgical resection, auxiliary treatment such as radiation therapy or chemotherapy is necessary to prolong survival, alleviate symptoms, and maintain and improve quality of life.
  • auxiliary treatment such as radiation therapy or chemotherapy is necessary to prolong survival, alleviate symptoms, and maintain and improve quality of life.
  • anticancer chemotherapy drugs there are no absolute principles regarding the type and route of administration of anticancer chemotherapy drugs, and the effectiveness is also not satisfactory.
  • response rates and survival rates to chemotherapy To date, research is being actively conducted on drugs that target the tumor's genetic predisposition, especially growth signaling transduction and the microenvironment of tumor cells, to develop treatments for patients with solid tumors. However, satisfactory treatments have not been developed. The situation is not working.
  • the present inventors made diligent research efforts to develop a method to treat cancer safely and effectively without side effects.
  • the present inventors based on data produced by various technologies that identify epigenetic changes, identified the key elements necessary to return cancer cells to normal cells (or normal-like cells) at the pre-cancer level. While discovering factors, it was discovered that when the SETMAR gene, known as an epigenetic regulator, is suppressed, not only can cancer cells be reversible into normal cells, but an excellent cancer treatment (remission) effect is achieved accordingly, and the present invention was developed. Completed.
  • an object of the present invention is to provide a pharmaceutical composition for preventing or treating cancer.
  • Another object of the present invention is to provide an anti-cancer adjuvant.
  • Another object of the present invention is to provide a food composition for preventing or improving cancer.
  • Another object of the present invention is to provide a composition for converting cancer cells into normal cells or normal-like cells.
  • Another object of the present invention is to provide a method for inducing conversion of cancer cells into normal cells or normal-like cells.
  • Another object of the present invention is to provide a screening method for agents for treating cancer.
  • Another object of the present invention is to provide a screening method for an agent capable of converting cancer cells into normal cells or normal-like cells.
  • Another object of the present invention is to provide a cancer treatment method.
  • the present invention provides a pharmaceutical composition for preventing or treating cancer, including a SETMAR (SET Domain And Mariner Transposase Fusion Gene) inhibitor.
  • SETMAR SET Domain And Mariner Transposase Fusion Gene
  • SETMAR of the present invention is a target gene discovered based on genome, epigenome, and transcriptome databases (TCGA, ENCODE, GTEX, HPA, FANTOM) of various cancers and normal tissues, and is derived from more than 8,000 samples from 11 types of cancer. Therefore, it is a target gene that can be used for various cancer types. More specifically, SETMAR analyzes data that constitutes a gene regulatory network, and identifies epigenetic regulators based on histone modification, which can be an effective distinction standard between normal cells and cancer cells derived from various tissues. As a result of analyzing these cells at the pan-cancer level, they were identified as key regulators that lead to reversibility into normal cells. Therefore, the present invention can be used in various cancer types, including liver cancer, colon cancer, lung cancer, and kidney cancer cells.
  • the SETMAR inhibitor of the present invention can use any agent or means known in the art as long as it can reduce the SETMAR expression level or activity in cancer cells, which is the purpose of the present invention.
  • the SETMAR inhibitor is selected from the group consisting of antisense oligonucleotides, small interference RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), and ribozyme that bind complementary to the mRNA of the SETMAR gene. It may be one or more types selected, or one or more types selected from the group consisting of compounds, peptides, peptide mimetics, substrate analogs, aptamers and antibodies that specifically bind to the SETMAR protein, but is not limited thereto.
  • siRNA small interference RNA
  • shRNA short hairpin RNA
  • miRNA microRNA
  • ribozyme that bind complementary to the mRNA of the SETMAR gene. It may be one or more types selected, or one or more types selected from the group consisting of compounds, peptides, peptide mimetics, substrate analogs, aptamers and antibodies that specifically bind to the SETMAR protein, but is not limited thereto.
  • antisense nucleic acid refers to DNA or RNA or derivatives thereof containing a nucleic acid sequence complementary to the sequence of a specific mRNA, and has the effect of inhibiting the translation of mRNA into protein by binding to the complementary sequence in the mRNA. Do it.
  • the antisense sequence refers to a DNA or RNA sequence that is complementary to the mRNA of the gene and is capable of binding to the mRNA, and is involved in translation, translocation into the cytoplasm, maturation, or any other overall biological function of the mRNA. It may inhibit essential activities.
  • the antisense nucleic acid may be modified at one or more base, sugar, or backbone positions to improve efficacy.
  • the nucleic acid backbone can be modified with phosphorothioate, phosphotriester, methyl phosphonate, short-chain alkyl, cycloalkyl, short-chain heteroatomic, heterocyclic intersaccharide linkages, etc.
  • antisense nucleic acids may contain one or more substituted sugar moieties.
  • Antisense nucleic acids may contain modified bases.
  • Modified bases include hypoxanthine, 6-methyladenine, 5-methylpyrimidine (especially 5-methylcytosine), 5-hydroxymethylcytosine (HMC), glycosyl HMC, gentobiosyl HMC, 2-aminoadenine, 2 -Thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6(6-aminohexyl)adenine, 2,6-diaminopurine, etc.
  • the antisense nucleic acid may be chemically combined with one or more moieties or conjugates that improve the activity and cell adsorption of the antisense nucleic acid.
  • the antisense oligonucleotide can be synthesized in a test tube using a conventional method and administered in vivo, or the antisense oligonucleotide can be synthesized in vivo.
  • siRNA refers to a nucleic acid molecule capable of mediating RNA interference or gene silencing. Because siRNA can suppress the expression of target genes, it serves as an efficient gene knockdown method or gene therapy method.
  • the siRNA molecule of the present invention may have a double-stranded structure in which the sense strand (sequence corresponding to the mRNA sequence of the target gene SETMAR gene) and the antisense strand (sequence complementary to the mRNA sequence) are located on opposite sides of each other, , the siRNA molecule of the present invention may have a single-stranded structure with self-complementary sense and antisense strands.
  • siRNA is not limited to complete pairing of double-stranded RNA portions of RNA, but pairs can be formed by mismatch (corresponding bases are not complementary), bulge (corresponding base is missing in one chain), etc. Parts that are not completed may be included.
  • the siRNA end structure can be either a blunt end or a cohesive end as long as it can inhibit the expression of the target gene through the RNAi effect
  • the cohesive end structure includes a 3'-end protrusion structure and a 5'-end structure. Any protruding structure is possible.
  • shRNA of the present invention is called small hairpin RNA or short hairpin RNA, and is used to silence genes through RNA interference. It is usually introduced into target cells using a vector. This shRNA hairpin structure can be cleaved by other substances within the cell to become siRNA.
  • shRNA short hairpin RNA represented by SEQ ID NO: 1 was used as the SETMAR inhibitor, but it is not limited thereto as long as the purpose of the present invention can be achieved.
  • the present invention may include a functional equivalent of the shRNA base sequence represented by SEQ ID NO: 1.
  • the "functional equivalent” refers to a base sequence that is at least 70% or more, preferably 80% or more, more preferably 80% or more, as a result of deletion, substitution or insertion of bases, and the base sequence of SEQ ID NO: 1. refers to a polynucleotide that has a sequence homology of at least 90%, more preferably at least 95%, and exhibits substantially the same physiological activity as the polynucleotide represented by the base sequence of SEQ ID NO: 1.
  • the “% sequence homology” for a polynucleotide is determined by comparing a comparison region with two optimally aligned sequences, where a portion of the polynucleotide sequence in the comparison region is a reference sequence (additions or deletions) for the optimal alignment of the two sequences. may contain additions or deletions (i.e. gaps) compared to those that do not contain .
  • the present invention is characterized by inducing conversion, that is, reversibility, of cancer cells into normal cells or normal-like cells when SETMAR is inhibited.
  • conversion that is, reversibility
  • the reversibility into normal cells or normal-like cells induces a change in normal cell shape, restoration of normal cell function, or epigenetic change to normal cells.
  • reversibility and “conversion” used herein to refer to the change of cancer cells into normal cells or normal-like cells refer to SETMAR, an epigenetic regulator target gene in the cancerization process discovered in the present invention. When suppressed in cancer cells, it means differentiation from cancer cells into normal cells or normal-like cells, and these are used interchangeably in this specification.
  • the “normal-like cell” refers to a cell having the transcriptome of a cancer cell-derived normal cell, and refers to a normal cell, preferably a cell with the same or similar activity as a normal cell.
  • reversibility into normal cells or normal-like cells may be a change in normal cell shape, restoration of normal cell function, or induction of epigenetic changes to normal cells, and is a preferred aspect of the present invention.
  • SETMAR when SETMAR is inhibited, one or more types selected from the group consisting of proliferation ability, growth ability, metastatic ability, invasion ability, and migration ability of cancer cells are inhibited.
  • the methylation of histones in cancer cells is increased or inhibited, and more specifically, the SETMAR inhibition increases the trimethylation of histone H3 at lysine 4 (H3K4me3). It was confirmed that it inhibits trimethylation (H3K27me3) of histone H3 at lysine 27.
  • SETMAR inhibition of the present invention can reprogram or convert cancer cells into normal cells or normal-like cells.
  • the SETMAR inhibitor of the present invention when treated with cancer cells, inhibits the cancer cell characteristics of target cells, such as proliferation, growth, metastasis, invasion, or migration ability, while also inhibiting target cells.
  • target cells such as proliferation, growth, metastasis, invasion, or migration ability
  • cancer cells are converted back to normal or normal-like cells and are similar to normal cells. It can be made to perform the same function. Therefore, unlike existing anticancer drugs that only induce cell death, side effects caused by cell death can be resolved.
  • the cancer of the present invention may include any cancer as long as the composition of the present invention achieves the intended effect, for example, liver cancer, colon cancer, lung cancer ( lung cancer, adrenal cancer, stomach cancer, breast cancer, blood cancer, bone cancer, pancreatic cancer, skin cancer, head or Head or neck cancer, cutaneous or intraocular melanoma, uterine sarcoma, ovarian cancer, rectal cancer, anal cancer, fallopian tube cancer ( fallopian tube carcinoma), endometrial carcinoma, cervical cancer, small intestine cancer, endocrine cancer, thyroid cancer, parathyroid cancer, soft tissue tumor It may be one or more types selected from the group consisting of soft tissue tumor, urethral cancer, prostate cancer, bronchogenic cancer, and bone marrow tumor, and is an embodiment of the present invention In , liver cancer was targeted, but it is not limited to this.
  • the term "comprising an active ingredient” means containing the SETMAR inhibitor, which is an active ingredient of the present invention, in an amount sufficient to achieve a predetermined efficacy or activity.
  • the SETMAR inhibitor can be administered in a pharmaceutically effective amount, and the effective dose level can be determined depending on the type and age of the individual, gender, sensitivity to the drug, treatment period, drugs used simultaneously, and other medical factors.
  • the pharmaceutical composition may be in the form of a capsule, tablet, granule, injection, ointment, powder, or beverage, and the pharmaceutical composition may be intended for human subjects.
  • the pharmaceutical composition is not limited to these, but can be formulated and used in the form of oral dosage forms such as powders, granules, capsules, tablets, and aqueous suspensions, external preparations, suppositories, and sterile injection solutions according to conventional methods. .
  • the pharmaceutical composition according to the present invention may include a pharmaceutically acceptable carrier.
  • Pharmaceutically acceptable carriers include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, colorants, flavorings, etc. for oral administration.
  • buffers, preservatives, and analgesics can be used.
  • Topics, solubilizers, isotonic agents, stabilizers, etc. can be mixed and used, and for topical administration, bases, excipients, lubricants, preservatives, etc. can be used.
  • the dosage form of the pharmaceutical composition according to the present invention can be prepared in various ways by mixing it with a pharmaceutically acceptable carrier as described above.
  • the oral administration it can be manufactured in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and in the case of injections, it can be manufactured in the form of unit dosage ampoules or multiple dosage forms. there is.
  • it can be formulated as a solution, suspension, tablet, capsule, sustained-release preparation, etc.
  • examples of carriers, excipients and diluents suitable for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, or mineral oil may be used.
  • fillers, anti-coagulants, lubricants, wetting agents, fragrances, emulsifiers, preservatives, etc. may be additionally included.
  • the route of administration of the pharmaceutical composition according to the present invention is not limited to these, but is oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, and topical. , sublingual or rectal.
  • parenteral includes subcutaneous, intradermal, intravenous, intramuscular, intra-articular, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques.
  • the pharmaceutical composition according to the invention can also be administered in the form of suppositories for rectal administration.
  • the pharmaceutical composition according to the present invention is influenced by various factors, including the activity of the specific active ingredient used, age, body weight, general health, gender, diet, administration time, administration route, excretion rate, drug formulation, and the severity of the specific disease to be prevented or treated.
  • the dosage of the pharmaceutical composition may vary depending on the patient's condition, body weight, degree of disease, drug form, administration route and period, but may be appropriately selected by a person skilled in the art.
  • the amount that can achieve the maximum effect with the minimum amount without side effects can be administered, more preferably 1 to 10,000 ⁇ g/kg of body weight/day, and even more preferably 10 to 1000 mg.
  • the effective dose is /kg body weight/day and can be administered repeatedly several times a day. The above dosage does not limit the scope of the present invention in any way.
  • the pharmaceutical composition of the present invention can be used alone or in combination with surgery, radiation therapy, hormone therapy, chemotherapy, and methods using biological response regulators for the prevention or treatment of target indications.
  • the present invention provides an anti-cancer adjuvant comprising a SETMAR (SET Domain And Mariner Transposase Fusion Gene) inhibitor.
  • SETMAR SET Domain And Mariner Transposase Fusion Gene
  • an anticancer adjuvant refers to an agent that can improve, enhance, or increase the anticancer effect of an anticancer agent by administering it in combination with an anticancer agent when administering an anticancer agent.
  • the anti-cancer adjuvant can be used as an anti-cancer agent or an anti-cancer adjuvant depending on the treatment concentration, and can also improve sensitivity to anti-cancer drugs.
  • the adjuvant of the present invention may be administered simultaneously (simutaneous), separately (separately), or sequentially (sequentially) with the anticancer drug.
  • the order of administration of the anti-cancer adjuvant according to the present invention that is, which of the anti-cancer agent and anti-cancer adjuvant is to be administered at what point and simultaneously, individually or sequentially, can be determined by a doctor or expert. This order of administration may vary depending on many factors.
  • the anti-cancer adjuvant may be administered in combination with a known compound that has the effect of preventing, improving, or treating cancer. In this regard, it can be administered simultaneously or sequentially with known compounds.
  • the known compounds include Oxaliplatin, 5-FU (5-fluorouracil), Doxorubicin, Irinotecan, Carboplatin, Paclitaxel, Gemcitabine, and Botezomib ( It may be one or more anticancer drugs selected from the group consisting of Bortezomib, but is not limited thereto.
  • the present invention provides a food composition for preventing or improving cancer, including a SETMAR (SET Domain And Mariner Transposase Fusion Gene) inhibitor.
  • SETMAR SET Domain And Mariner Transposase Fusion Gene
  • Food compositions according to the present invention include all types of functional foods, nutritional supplements, health foods, health supplements, and food additives.
  • the food composition of the above type may be formulated in any form selected from the group consisting of powder, tablet, capsule, pill, and liquid according to a conventional method known in the art, but is not limited thereto. It can be manufactured in various forms using methods known in the art.
  • the SETMAR inhibitor of the present invention itself can be granulated, encapsulated, and powdered for consumption, or manufactured in the form of tea, juice, and drink.
  • the SETMAR inhibitor of the present invention can be prepared in the form of a composition by mixing it with a known substance or active ingredient known to have cancer prevention, improvement, or treatment activity.
  • functional foods include beverages (including alcoholic beverages), fruits and their processed foods (e.g. canned fruit, bottled foods, jam, marmalades, etc.), fish, meat and their processed foods (e.g. ham, sausage corn beef, etc.) , bread and noodles (e.g. udon, buckwheat noodles, ramen, spaghetti, macaroni, etc.), fruit juice, various drinks, cookies, taffy, dairy products (e.g. butter, cheese, etc.), edible vegetable oil, margarine, vegetable protein, retort. It can be manufactured by adding the SETMAR inhibitor of the present invention to food, frozen food, various seasonings (e.g. soybean paste, soy sauce, sauce, etc.).
  • various seasonings e.g. soybean paste, soy sauce, sauce, etc.
  • the food composition of the present invention may contain common food additives, and its suitability as a "food additive" is determined in accordance with the general provisions of the food additive code and general test methods approved by the Ministry of Food and Drug Safety, unless otherwise specified. It is determined based on the specifications and standards for the relevant item.
  • Items listed in the "Food Additives Code” include, for example, chemical compounds such as ketones, glycine, potassium citrate, nicotinic acid, and cinnamic acid; natural additives such as subchromic pigment, licorice extract, crystalline cellulose, high-liquid pigment, and guar gum; Examples include mixed preparations such as sodium L-glutamate preparations, noodle additive alkaline preparations, preservative preparations, and tar coloring preparations.
  • the SETMAR inhibitor may preferably be included in an amount of 0.00001 to 50% by weight relative to the food composition. If the content is less than 0.00001% by weight, the effect is insignificant, and if it exceeds 50% by weight, the increase in effect compared to the amount used is minimal, making it uneconomical.
  • the SETMAR inhibitor of the present invention in the form of a food additive, it can be manufactured and used in the form of tablets, capsules, powders, granules, liquids, pills, etc.
  • the composition of the present invention When the composition of the present invention is manufactured into a beverage, it may contain various flavoring agents or natural carbohydrates as additional ingredients, like conventional beverages.
  • the above-mentioned natural carbohydrates may include monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, natural sweeteners such as dextrin and cyclodextrin, and synthetic sweeteners such as saccharin and aspartame.
  • the proportion of natural carbohydrates is generally about 0.01 to 10 g, preferably about 0.01 to 0.1 g, per 100 ml of the composition of the present invention.
  • the composition of the present invention contains various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, It may include carbonating agents used in carbonated drinks. Additionally, the composition of the present invention may include pulp for the production of natural fruit juice, fruit juice beverages, and vegetable beverages. These ingredients can be used independently or in combination. The ratio of these additives is not very important, but is generally selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention.
  • health supplement or “health functional food” means food manufactured and processed using raw materials or ingredients with functionality useful to the human body in accordance with the Health Functional Food Act.
  • “Functional” means ingestion for the purpose of controlling nutrients for the structure and function of the human body or obtaining useful effects for health purposes such as physiological effects.
  • the present invention provides a composition for converting cancer cells into normal cells or normal-like cells, comprising a SETMAR (SET Domain And Mariner Transposase Fusion Gene) inhibitor, and the SETMAR inhibitor in vitro .
  • a method for inducing conversion of cancer cells into normal cells or normal-like cells comprising the step of treating cancer cells.
  • the present invention provides a method for screening an agent for treating cancer, comprising the following steps:
  • a candidate substance to be analyzed can first be contacted with cancer cells containing the gene or protein.
  • the candidate substance refers to an unknown substance used in screening to test whether it affects the expression level of the gene, the amount of protein, or the activity of the protein.
  • the candidate substances may include, but are not limited to, chemicals, antisense oligonucleotides, antisense-RNA, siRNA, shRNA, miRNA, antibodies specific for the protein, or natural product extracts.
  • it may include siRNA, shRNA, miRNA, or antibody specific for SETMAR.
  • the expression level of the gene, the amount of the protein, or the activity of the protein can be measured in the cells treated with the candidate substance. If the measurement results show that the expression level of the gene, the amount of the protein, or the activity of the protein is decreased, the A candidate substance can be determined to be usable as an agent that can treat or prevent cancer.
  • the method of measuring the expression level of the gene or the amount of protein may be performed including a known process of isolating mRNA or protein from a biological sample using a known technique.
  • the "biological sample” refers to a sample collected from a living body in which the expression level of the gene or the level of protein is different from that of the normal control group depending on the degree of occurrence or progression of cancer.
  • the sample includes, for example, tissues, cells, It may include, but is not limited to, blood, serum, plasma, saliva, and urine.
  • the expression level of the gene is preferably measured by measuring the level of mRNA, and methods for measuring the level of mRNA include reverse transcription polymerase chain reaction (RTPCR), real-time reverse transcription polymerase chain reaction, RNase protection assay, Northern blot, and DNA chips, etc., but are not limited thereto.
  • RTPCR reverse transcription polymerase chain reaction
  • RNase protection assay RNase protection assay
  • Northern blot and DNA chips, etc.
  • the protein level can be measured using an antibody.
  • the marker protein in the biological sample and the antibody specific for it form a complex, that is, an antigen-antibody complex
  • the amount of the antigen-antibody complex formed is determined by the detection label ( It can be measured quantitatively through the size of the signal of the detection label.
  • detection labels may be selected from the group consisting of, but are not limited to, enzymes, fluorescent substances, ligands, luminescent substances, microparticles, redox molecules, and radioisotopes.
  • Analytical methods for measuring protein levels include Western blot, ELISA, radioimmunoassay, radioimmunodiffusion, Ouchteroni immunodiffusion, rocket immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay, complement fixation assay, FACS, and protein. Chips, etc., but are not limited thereto.
  • the present invention provides a method for screening an agent capable of converting cancer cells into normal cells or normal-like cells, comprising the following steps:
  • the present invention provides a method of treating cancer, comprising administering a SETMAR (SET Domain And Mariner Transposase Fusion Gene) inhibitor to a subject.
  • SETMAR SET Domain And Mariner Transposase Fusion Gene
  • subject used in the present invention refers to an individual having a cancer disease, preferably a mammal such as a horse, sheep, pig, goat, or dog, including humans, having a cancer disease. means human.
  • the present invention it has been found that when SETMAR is inhibited in cancer cells, reversal of the cancerization process, which is the differentiation of cancer cells into normal cells, is successfully achieved. Unlike conventional anticancer drugs that simply induce death of cancer cells, the present invention has anticancer properties. It can be usefully used as a treatment method to convert cancer cells into normal cells, excluding the side effect of normal cell death that may occur during treatment.
  • Figures 1A to 1H show the results of confirming that there is a statistically significant correlation between important epigenetic regulatory genes in the cancerization process through data analysis in various tissues.
  • Figure 1a schematically shows the results of deriving H3K4me3 Peaks (Broad H3K4me3) of 4 kb or more indicating differences between cancer cells and normal cells based on a known database.
  • Figure 1b shows the results of PCA (Principal Component Analysis) analysis of normal tissue-derived H3K4me3 data and cancer cell line-derived H3K4me3 data based on Total H3K4me3 Peaks and Broad H3K4me3 Peaks.
  • Figure 1c shows the results of GO (Gene Ontology) analysis using major genes constituting the axis of PCA.
  • Figure 1d shows the results of comparing genes associated with Broad H3K4me3 Peaks using the previously known characteristic gene databases for each organ (GTEx, FANTOM5, HPA).
  • Figure 1e shows the results of analyzing the entire human genome for 10 kb each to determine the presence of H3K4me3 and/or H3K27me3, and based on this, comparing the changes in Broad H3K4me3 Peaks and Total H3K4me3 Peaks in normal and cancer tissues.
  • Figure 1f shows a method to select the location and associated genes of Total and Broad H3K4me3 and determine how much the transcript and epigenome have increased.
  • Figure 1g integrates the normal tissue transcriptome database GTEX and the cancer cell line transcriptome database, and compares the expression levels of the previously selected Broad H3K4me3-related genes in the two databases. At this time, Broad H3K4me3-related genes are significantly different between cancer and normal.
  • Figure 1h summarizes the changes in the transcriptome and epigenome of normal tissues and cancer cells in the TCGA database, and compares the expression level of transcripts of Broad H3K4me3-related genes previously selected in the database and the amount of change in the epigenome. At this time, Broad H3K4me3-related genes are significantly different in both transcriptome and epigenome between cancer and normal.
  • Figure 2 shows that epigenetic regulators that can directly bind to and regulate Broad H3K4me3, which is known to be important in normal tissues, were analyzed at the pan-cancer level to discover epigenetic regulator targets that are important in the cancerization process. Shows the results.
  • Figures 3a and 3b show the results confirming the inhibition of proliferation of SETMAR-inhibited cancer cells and the phenotypic change to normal cells. KD; knock-down
  • Figures 4a and 4b show the results of confirming the expression levels of normal related genes and their proteins in SETMAR-inhibited cancer cells.
  • Figure 5 shows the results confirming the recovery of normal cellular metabolic function in SETMAR-inhibited cancer cells.
  • Figure 6 shows the results confirming the decrease in metastatic ability in SETMAR-inhibited cancer cells.
  • Figures 7a and 7b show the results confirming various epigenetic changes in cancer cells caused by inhibition of SETMAR.
  • Figure 8 shows the results confirming the effect of SETMAR inhibition on the single cell transcriptome and epigenome in cancer cells.
  • Figure 9 shows the results of comparing cancer cell growth in a xenograft model in which a liver cancer cell line containing SETMAR as a comparative control group and a liver cancer cell line in which SETMAR is inhibited of the present invention were transplanted into nude mice.
  • liver cancer cell lines (SNU-475, SNU-761) used in the present invention were all obtained from Seoul National University Cell Bank, and 10% FBS and DMEM from Welgene were used. Cells were cultured at 37°C in humid conditions in a 5% CO2 environment, and all conditions followed the protocol of the Seoul National University cell line bank that established the cell line.
  • SETMAR In order to suppress SETMAR in cell lines, the expression of SETMAR was suppressed by delivering shRNA (TCCGACTCCAATTACATTATA, SEQ ID NO: 1) into the cells using Lenti virus. And their reduction was confirmed through RT-qPCR using primers SETMAR-F (GGATGGCGGAGTTTAAGGAGA, SEQ ID NO: 2) and SETMAR-R (GCTGGGTTCCTTCTCATTTCC, SEQ ID NO: 3).
  • ChIP-seq followed the ChIP-IT high sensitive protocol from Activie motif, and all analyzes followed the Bowtie-MACS2 pipeline.
  • data was produced using the single cell multiome Kit from 10x Genomics, and then aligned to hg38 using the Cellranger-arc program, and Seurat, Signac, and FigR were used for further analysis.
  • animal testing was conducted using a method approved by the Animal Ethics Committee of the Korea Advanced Institute of Science and Technology. Xenograft mice were created by transplanting cancer cells under the skin of mice, and the therapeutic effect of SETMAR was confirmed through this model.
  • the present inventors based on genome, epigenome, and transcriptome databases (TCGA, ENCODE, GTEX, HPA, FANTOM) of various cancer and normal tissues, to discover important epigenetic regulator targets in the cancer transformation process. Data analysis was conducted to construct a gene regulatory network.
  • Broad H3K4me3 Peaks were obtained by integrated analysis of various data from more than 8,000 people ( Figure 1a), and when it was confirmed whether normal cells and cancer cells were distinguished using Total histone modification loci and Broad H3K4me3 histone modification markers of 4 kb or more, Total It was confirmed that normal cells and cancer cells could not be distinguished using histone modification loci (Total H3K4me3 Peaks), whereas in the case of Broad H3K4me3 Peaks), normal cells and cancer cells could be effectively distinguished (Figure 1b). Based on the above results, principal component analysis was performed to identify genes corresponding to the main PC (Principal Component) axis.
  • Principal component analysis was performed to identify genes corresponding to the main PC (Principal Component) axis.
  • PC1 was confirmed to be mainly related to the differentiation of normal cells
  • PC2 was mainly related to the characteristics of cancer cells (Figure 1c).
  • identifying genes associated with the Broad H3K4me3 loci using GTEx, FANTOM5, and HPA data it was found that they matched the characteristics of each organ ( Figure 1d).
  • the Broad H3K4me3 loci in normal tissues was found to be significantly reduced in length in cancer cells, while simultaneously acquiring the characteristics of H3K27me3 (Figure 1e).
  • liver cancer as a representative target.
  • Example 2 Effect of inhibition of SETMAR, an epigenetic regulator of the present invention, on cancer cells
  • the epigenetic regulator selected in Example 1 on cancer cells, the present inventors created two liver cancer cell lines (SNU475, SNU761) with reduced SETMAR using shRNA to Proliferation level and morphology were observed.
  • the major hepatocyte function-related genes are as follows:
  • AAT Alpha 1 anti-trypsin
  • ALB Albumin
  • ALDOB Aldolase
  • Fructose-Bisphosphate B CYP1A2: Cytochrome P450 1A2
  • G6P Glucose 6-phosphate
  • GS Glutamine synthetase
  • MRP2 Multidrug Resistance-Associated Protein 2
  • PCK1 Phosphoenolpyruvate Carboxykinase 1
  • PEPCK Phosphoenolpyruvate Carboxykinase
  • ASGR2 Asialoglycoprotein Receptor 2
  • CEBPA CCAAT Enhancer Binding Protein Alpha, ONECUT1 (HNF6A): One Cut Homeobox 1.
  • TF Transferrins
  • LIPC Hepatic lipase
  • C3 Complement subunit 3
  • ASGR1 glycoprotein that forms the asialoglycoprotein receptor
  • FOXA3 Forkhead Box A3
  • the present inventors measured the level of recovery of normal hepatocyte metabolic function in the SETMAR-inhibited liver cancer cell line to verify whether liver cancer cells were actually reversible to normal cells (or normal-like cells).
  • the present inventors observed the effect of inhibition (reduction) of SETMAR on the metastatic ability of cancer cells.
  • Example 3 Various epigenetic changes in cancer cells caused by inhibition of SETMAR, an epigenetic regulator of the present invention
  • the present inventors observed the effect of inhibition of SETMAR, a selected epigenetic regulator of the present invention, on epigenetic changes in cancer cells.
  • Example 4 Effect of inhibition of SETMAR, an epigenetic regulator of the present invention, on single cell transcriptome and epigenome in cancer cells
  • the present inventors analyzed data to confirm the effect of inhibition of SETMAR, a selected epigenetic regulator of the present invention, on the single cell transcriptome and epigenome of cancer cells.
  • cancer cells are reversible to normal cells over time, that is, albumin increases in the same way as normal liver cells, and at the same time, albumin, which is important for normal liver cells, increases. It was confirmed that transcription factors HNF4A, FOXA1, and HNF1A increased.
  • Example 5 By inhibiting the epigenetic regulator SETMAR of the present invention in vivo Confirmation of cancer cell inhibition effect in
  • the present inventors sought to confirm the growth level of cancer cells due to SETMAR inhibition in vivo .
  • HCC SNU761
  • WT_SETMAR normal SETMAR and SETMA-knockdown HCC
  • SETMAR_KD normal SETMAR and SETMA-knockdown HCC
  • cancer cell line loses its unique characteristics as a cancer cell by SETMAR inhibition, not only does it not cause cancer, but it is also reversible to a normal cell, meaning that there are no cancer cells, that is, only normal cells or normal-like cells. This proves that complete remission of cancer, which is the ultimate goal, has been achieved.
  • SETMAR inhibition of the present invention can effectively act in anticancer treatment.
  • the present invention demonstrated that inhibition of SETMAR not only inhibits cancer characteristics, but also changes cancer cells to express characteristics of normal cells, resulting in the phenotype and function of normal cells. Therefore, it is expected that safe and effective anticancer treatment effects can be achieved by reversing cancer cells into normal cells through the control of these epigenetic regulators.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Oncology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Urology & Nephrology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Hematology (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • Biophysics (AREA)
  • Hospice & Palliative Care (AREA)
  • Nutrition Science (AREA)
  • Mycology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Polymers & Plastics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Toxicology (AREA)
  • Tropical Medicine & Parasitology (AREA)

Abstract

본 발명은 SETMAR 억제제를 포함하는 암 예방 또는 치료용 조성물에 관한 것으로, 암세포에서 SETMAR을 억제하는 경우, 암세포의 정상 세포로의 분화인, 암화 과정의 가역화가 성공적으로 달성됨을 규명한 바, 본 발명은 단순히 암세포의 사멸을 유도하는 종래 항암제와 달리, 항암 치료시 발생할 수 있는 정상 세포가 사멸되는 부작용을 배제하고, 암세포를 정상 세포로 전환시키는 치료 방법으로서 유용하게 활용할 수 있다.

Description

SETMAR 억제제를 포함하는 암 예방 또는 치료용 조성물
본 발명은 SETMAR 억제제를 포함하는 암 예방 또는 치료용 조성물에 관한 것으로, 암 세포를 정상 세포로 가역화시키는 것을 특징으로 한다.
암은 인류가 해결해야 할 난치병 중의 하나로, 전 세계적으로 이를 치유하기 위한 개발에 막대한 자본이 투자되고 있는 실정이며, 우리나라의 경우, 질병 사망 원인 중 제 1위의 질병으로서 연간 약 10만 명 이상이 진단되고, 약 6만 명 이상이 사망하고 있다. 그 중 간암은 2020년 국제암연구센터(IARC)에서 발행된 "Global cancer statistics 2020" 보고서에 따르면 암 사망의 주요 원인으로 지목되어 있다.
이러한 암의 유발 인자인 발암물질로는 흡연, 자외선, 화학 물질, 음식물, 기타 환경인자들이 있으나, 그 유발 원인이 다양하여 치료제의 개발이 어려울 뿐만 아니라 발생하는 부위에 따라 치료제의 효과 또한 각기 다르다. 현재 치료제로 사용되는 물질들은 상당한 독성을 지니고 있으며, 암세포만을 선택적으로 제거하지 못하므로, 암의 발생 후 이의 치료 뿐 아니라, 암의 발생을 예방하기 위한 독성이 적고 효과적인 항암제의 개발이 절실히 필요하다.
암에 대한 일차적 치료 원칙은 수술 절제이나, 수술 절제 후에도 높은 재발율을 보이기 때문에 생존 기간을 연장시키며 증상을 완화시키고 삶의 질의 유지와 향상을 위해서 방사선 치료 혹은 항암화학적요법 등의 보조 치료가 필요하다. 그러나, 항암화학요법의 약물의 종류와 투여 경로에 대해 절대적인 원칙은 없는 상태이며, 그 효과 역시 만족할 정도는 아니다. 또한, 같은 암 환자들 중에도 항암화학적요법에 대한 반응률과 생존율의 차이가 크게 나타나기도 한다. 현재까지 고형암 환자의 치료제 개발을 위해 종양의 유전적 성향, 특히, 성장 신호의 전달 (growth signaling transduction)과 종양 세포의 미세 환경을 목표로 하는 약제의 연구가 활발히 진행되고 있으나, 만족할 만한 치료제가 개발되지 못하고 있는 실정이다.
특히, 정상 세포가 암세포가 되는 암화 과정에 있어서, 돌연변이의 축적과 함께 후성유전학 조절자의 활성이 필요하다고 알려져 있다. 따라서, 암에 대한 우수한 치료 활성을 달성하기 위해, 이러한 후성유전학적 접근법을 통해 암세포를 정상 세포 또는 정상 유사 세포로 되돌릴 수 있다면, 효과적이고 새로운 암 치료법이 될 수 있으며, 이는, 개인별 맞춤의학을 실현, 표적 치료를 통해 환자의 생존률 및 불필요한 항암제 치료로 인한 삶의 질의 향상에 기여할 것이다.
이러한 상황 하에서, 본 발명자들은 부작용없이 안전하고 효과적으로 암을 치료하기 위한 방법을 개발하고자 예의 연구노력하였다. 그 결과, 본 발명자들은, 후성유전학적 변화를 확인하는 다양한 기술들에 의해서 생산된 데이터를 기반으로 하여, 전암 (Pan-cancer) 수준에서 암세포를 정상세포(또는 정상 유사 세포)로 되돌리는데 필요한 주요 인자를 발굴하던 중, 후성유전학적 조절인자로 알려진 SETMAR 유전자를 억제한 경우, 암세포를 정상 세포로 가역화할 수 있을 뿐만 아니라, 이에 따라 우수한 암 치료(관해) 효과가 달성됨을 규명함으로써, 본 발명을 완성하였다.
따라서, 본 발명의 일 목적은 암 예방 또는 치료용 약학적 조성물을 제공하는 데 있다.
또한, 본 발명의 다른 목적은 항암 보조제를 제공하는 데 있다.
또한, 본 발명의 또 다른 목적은 암 예방 또는 개선용 식품 조성물을 제공하는 데 있다.
또한, 본 발명의 또 다른 목적은 암세포의 정상세포 또는 정상 유사 세포로의 전환용 조성물을 제공하는 데 있다.
또한, 본 발명의 또 다른 목적은 암세포의 정상세포 또는 정상 유사 세포로의 전환 유도 방법을 제공하는 데 있다.
또한, 본 발명의 또 다른 목적은 암 치료용 제제의 스크리닝 방법을 제공하는 데 있다.
또한, 본 발명의 또 다른 목적은 암세포로부터 정상세포 또는 정상 유사 세포로 전환시킬 수 있는 제제의 스크리닝 방법을 제공하는 데 있다.
또한, 본 발명의 또 다른 목적은 암 치료 방법을 제공하는 데 있다.
본 명세서에서 사용한 용어는 단지 설명을 목적으로 사용된 것으로, 한정하려는 의도로 해석되어서는 안된다. 단수의 표현은 문맥상 명백하게 다르게 뜻하지 않는 한, 복수의 표현을 포함한다. 본 명세서에서, "포함하다" 또는 "가지다" 등의 용어는 명세서 상에 기재된 특징, 숫자, 단계, 동작, 구성요소, 부품 또는 이들을 조합한 것이 존재함을 지정하려는 것이지, 하나 또는 그 이상의 다른 특징들이나 숫자, 단계, 동작, 구성요소, 부품 또는 이들을 조합한 것들의 존재 또는 부가 가능성을 미리 배제하지 않는 것으로 이해되어야 한다.
다르게 정의되지 않는 한, 기술적이거나 과학적인 용어를 포함해서 여기서 사용되는 모든 용어들은 실시예가 속하는 기술 분야에서 통상의 지식을 가진 자에 의해 일반적으로 이해되는 것과 동일한 의미를 가지고 있다. 일반적으로 사용되는 사전에 정의되어 있는 것과 같은 용어들은 관련 기술의 문맥 상 가지는 의미와 일치하는 의미를 가지는 것으로 해석되어야 하며, 본 출원에서 명백하게 정의하지 않는 한, 이상적이거나 과도하게 형식적인 의미로 해석되지 않는다.
이하, 본 발명에 대하여 보다 상세히 설명한다.
본 발명의 일 양태에 따르면, 본 발명은 SETMAR(SET Domain And Mariner Transposase Fusion Gene) 억제제를 포함하는, 암 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명의 SETMAR은 다양한 암 및 정상 조직의 유전체, 후성 유전체, 전사체 데이터베이스(TCGA, ENCODE, GTEX, HPA, FANTOM)를 기반으로 발굴된 타겟 유전자로서 11종의 암 유래의 8000개 이상의 샘플하여 도출되었으므로, 다양한 암종에 활용될 수 있는 타겟 유전자이다. 보다 구체적으로, SETMAR은 유전자 조절 네트워크를 구성하는 데이터 분석을 통해, 다양한 조직 유래 정상 세포와 암세포에서 효과적인 구분 기준이 될 수 있는 히스톤 변형(histone modification)을 기초로, 후성유전학 조절자(epigenetic regulator)들을 전암(Pan-cancer) 수준에서 분석한 결과, 정상 세포로 가역화를 주도하는 주요 조절자로 도출된 것이다. 따라서, 간암, 대장암, 폐암 및 신장암세포를 포함하여 다양한 암 종에서 본 발명을 활용할 수 있다.
본 발명의 SETMAR 억제제는, 본 발명의 목적, 즉, 암세포에서의 SETMAR 발현 수준 또는 활성을 감소시킬 수 있는 한, 당업계에 공지된 임의의 제제 또는 수단을 이용할 수 있다.
바람직하게는, 상기 SETMAR 억제제는 SETMAR 유전자의 mRNA에 상보적으로 결합하는 안티센스 올리고뉴클레오타이드, siRNA(small interference RNA), shRNA(short hairpin RNA), miRNA(microRNA) 및 리보자임(ribozyme)으로 이루어진 군으로부터 선택된 1 종 이상이거나, 또는, SETMAR 단백질에 특이적으로 결합하는 화합물, 펩티드, 펩티드 모방체, 기질유사체, 앱타머 및 항체로 이루어진 군으로부터 선택된 1 종 이상일 수 있으나, 이에 한정되지 않는다.
본 발명에서 "안티센스 핵산"이란 특정 mRNA의 서열에 상보적인 핵산 서열을 함유하고 있는 DNA 또는 RNA 또는 이들의 유도체를 의미하고, mRNA 내의 상보적인 서열에 결합하여 mRNA의 단백질로의 번역을 저해하는 작용을 한다. 상기 안티센스 서열은 상기 유전자의 mRNA에 상보적이고 상기 mRNA에 결합할 수 있는 DNA 또는 RNA 서열을 의미하며, 상기 mRNA의 번역, 세포질내로의 전위(translocation), 성숙(maturation) 또는 다른 모든 전체적인 생물학적 기능에 대한 필수적인 활성을 저해할 수 있다.
또한, 상기 안티센스 핵산은 효능을 증진시키기 위하여 하나 이상의 염기, 당 또는 골격(backbone)의 위치에서 변형될 수 있다. 핵산 골격은 포스포로티오에이트, 포스포트리에스테르, 메틸 포스포네이트, 단쇄 알킬, 시클로알킬, 단쇄 헤테로아토믹, 헤테로시클릭 당간 결합 등으로 변형될 수 있다. 또한, 안티센스핵산은 하나 이상의 치환된 당 모이어티(sugar moiety)를 포함할 수 있다. 안티센스 핵산은 변형된 염기를 포함할 수 있다. 변형된 염기에는 하이포크잔틴, 6-메틸아데닌, 5-메틸피리미딘(특히 5-메틸시토신), 5-하이드록시메틸시토신(HMC), 글리코실 HMC, 젠토비오실 HMC, 2-아미노아데닌, 2-티오우라실, 2-티오티민, 5-브로모우라실, 5-하이드록시메틸우라실, 8-아자구아닌, 7-데아자구아닌, N6(6-아미노헥실)아데닌, 2,6-디아미노퓨린 등이 있다. 또한, 상기 안티센스 핵산은 상기 안티센스 핵산의 활성 및 세포 흡착성을 향상시키는 하나 이상의 모이어티(moiety) 또는 컨쥬게이트(conjugate)와 화학적으로 결합될 수 있다. 콜레스테롤 모이어티, 콜레스테릴 모이어티, 콜릭산, 티오에테르, 티오콜레스테롤, 지방성 사슬, 인지질, 폴리아민, 폴리에틸렌 글리콜 사슬, 아다맨탄 아세트산, 팔미틸 모이어티, 옥타데실아민, 헥실아미노카르보닐-옥시콜에스테롤 모이어티 등의 지용성 모이어티 등이 있으며 이에 제한되지 않는다. 상기 안티센스 올리고뉴클레오타이드는 통상의 방법으로 시험관에서 합성되어 생체 내로 투여하거나 생체 내에서 안티센스올리고뉴클레오타이드가 합성되도록 할 수 있다.
본 발명에서 "siRNA"란 RNA 방해 또는 유전자 사일런싱을 매개할 수 있는 핵산 분자를 의미한다. siRNA는 표적 유전자의 발현을 억제할 수 있기 때문에 효율적인 유전자 넉다운(knockdown) 방법 또는 유전자 치료 방법으로 제공된다.
본 발명의 siRNA 분자는, 센스 가닥(타겟 유전자인 SETMAR 유전자의 mRNA 서열에 상응하는 서열)과 안티센스 가닥(상기 mRNA 서열에 상보적인 서열)이 서로 반대쪽에 위치하여 이중쇄를 이루는 구조를 가질 수 있으며, 본 발명의 siRNA 분자는 자기-상보성(self-complementary) 센스 및 안티센스 가닥을 가지는 단일쇄 구조를 가질 수 있다. 나아가 siRNA는 RNA끼리 짝을 이루는 이중사슬 RNA 부분이 완전히 쌍을 이루는 것에 한정되지 않고 미스매치(대응하는 염기가 상보적이지 않음), 벌지(일방의 사슬에 대응하는 염기가 없음) 등에 의하여 쌍을 이루지 않는 부분이 포함될 수 있다. 또한, siRNA 말단 구조는 타겟 유전자의 발현을 RNAi 효과에 의하여 억제할 수 있는 것이면 평활(blunt) 말단 혹은 점착(cohesive) 말단 모두 가능하고, 점착 말단 구조는 3'-말단 돌출 구조와 5'-말단 돌출 구조 모두 가능하다.
본 발명의 "shRNA"란 small hairpin RNA 혹은 short hairpin RNA으로 불리며, RNA 간섭으로 유전자를 침묵시킬 수 있는 용도로 사용되는 것이다. 보통 벡터를 이용하여 목적 세포로 도입한다. 이러한 shRNA 헤어핀 구조는 세포 내 다른 물질에 의하여 절단되어 siRNA가 되기도 한다.
본 발명의 일 실시예에서는, 상기 SETMAR 억제제로, 서열번호 1로 표시되는 shRNA(short hairpin RNA)를 이용하였으나, 본 발명의 목적을 달성할 수 있는 한, 이에 제한되는 것은 아니다.
또한, 본 발명은 상기 서열번호 1로 표시되는 shRNA의 염기서열의 기능적 동등물을 포함할 수 있다. 상기 "기능적 동등물"이란 염기의 결실(deletion), 치환(substitution) 또는 삽입(insertion)의 결과로, 상기 서열번호 1의 염기서열과 적어도 70% 이상, 바람직하게는 80% 이상, 더욱 바람직하게는 90% 이상, 더 더욱 바람직하게는 95% 이상의 서열 상동성을 갖는 것으로, 서열번호 1의 염기서열로 표시되는 폴리뉴클레오타이드와 실질적으로 동질의 생리활성을 나타내는 폴리뉴클레오타이드를 말한다. 폴리뉴클레오타이드에 대한 "서열 상동성의 %"는 두 개의 최적으로 배열된 서열과 비교 영역을 비교함으로써 확인되며, 비교 영역에서의 폴리뉴클레오타이드 서열의 일부는 두 서열의 최적 배열에 대한 참고 서열(추가 또는 삭제를 포함하지 않음)에 비해 추가 또는 삭제(즉, 갭)를 포함할 수 있다.
본 발명의 일 실시예에 따르면, 본 발명은 SETMAR을 억제하는 경우 암세포의 정상세포 또는 정상 유사 세포로의 전환, 즉, 가역화를 유도하는 것을 특징으로 한다. 또한, 상기 정상세포 또는 정상 유사 세포로의 가역화는, 정상세포 형태로의 변화, 정상세포 기능 회복 또는 정상세포로의 후성 유전학적 변화를 유도하는 것이다.
본 명세서에서 암세포의 정상세포 또는 정상 유사 세포로의 변화를 언급하면서 이용된 용어, "가역화" 및 "전환"은, 본 발명에서 발굴된, 암화 과정에서의 후성유전학 조절자 타겟 유전자인 SETMAR를 암세포에서 억제했을 때, 암세포로부터 정상세포 또는 정상 유사 세포로 분화되는 것을 의미하며, 이들은 본 명세서에서 혼용된다.
본 발명에 있어서, 상기 "정상 유사 세포"란 암세포 유래 정상 세포의 전사체를 가진 세포를 의미하며, 정상 세포, 바람직하게는 정상 세포와 동일 또는 유사한 활성을 가진 세포를 의미한다.
본 발명의 일 실시예에 따르면, 정상세포 또는 정상 유사 세포로의 가역화는 정상세포 형태로의 변화, 정상 세포 기능 회복 또는 정상 세포로의 후성 유전학적 변화 유도일 수 있고, 본 발명의 바람직한 일 구현예에서는 간암세포에서 SETMAR을 억제하는 경우, 간암 세포주 2종(SNU475, SNU761)에서와 같이 정상 세포 또는 정상 세포로의 가역화가 유도되는 것을 확인하였다.
또한, 본 발명의 일 실시예에 따르면, 상기 SETMAR을 억제하는 경우, 암세포의 증식능, 성장능, 전이능, 침윤능 및 이동능으로 이루어진 군으로부터 선택된 1 종 이상을 억제됨을 확인하였다.
또한, 본 발명의 일 실시예에 따르면, 상기 SETMAR을 억제하는 경우, 암세포의 히스톤의 메틸화를 증가 또는 저해하였고, 보다 구체적으로 상기 SETMAR 억제는 리신 4에서의 히스톤 H3의 트리메틸화(H3K4me3)를 증가시키거나, 또는, 리신 27에서의 히스톤 H3의 트리메틸화(H3K27me3)를 저해하는 것을 확인하였다.
따라서, 본 발명의 SETMAR 억제는, 암세포를, 정상세포 또는 정상 유사 세포로 리프로그래밍 또는 전환할 수 있음을 입증한다.
본 발명의 SETMAR 억제제는 암 세포를 사멸시키는 기존의 항암제와 달리, 암세포에 처리되었을 때, 대상 세포의 암세포적 특성, 예컨대 증식능, 성장능, 전이능, 침윤능 또는 이동능을 억제함과 동시에 대상 세포가 가진 본래의 형태 및 기능, 예컨대 정상 세포 형태로의 변화, 정상 세포 기능 회복 또는 정상 세포로의 후성 유전학적 변화 유도를 증진시켜, 암 세포가 다시 정상 또는 정상 유사 세포로 전환되어 정상 세포와 같은 기능을 발휘하도록 할 수 있다. 따라서 기존 세포 사멸만을 유도하는 항암제와 달리, 세포 사멸에 의한 부작용을 해소할 수 있다.
또한, 본 발명의 암은, 본 발명의 조성물이 목적 효과를 달성하는 한, 임의의 암을 대상으로 포함할 수 있으며, 예를 들어, 간암(liver cancer), 대장암(colon cancer), 폐암(lung cancer), 신장암(adrenal cancer), 위암(stomach cancer), 유방암(breast cancer), 혈액암(blood cancer), 뼈암(bone cancer), 췌장암(pancreatic cancer), 피부암(skin cancer), 머리 또는 목암(head or neck cancer), 피부 또는 안구 흑색종(cutaneous or intraocular melanoma), 자궁육종(uterine sarcoma), 난소암(ovarian cancer), 직장암(rectal cancer), 항문암(anal cancer), 난관암(fallopian tube carcinoma), 자궁내막암(endometrial carcinoma), 자궁경부암(cervical cancer), 소장암(small intestine cancer), 내분비암(endocrine cancer), 갑상선암(thyroid cancer), 부갑상선암(parathyroid cancer), 연조직종양(soft tissue tumor), 요도암(urethral cancer), 전립선암(prostate cancer), 기관지암(bronchogenic cancer) 및 골수암(bone marrow tumor)으로 이루어진 군으로부터 선택된 1 종 이상일 수 있고, 본 발명의 일 실시예에서는, 간암을 대상으로 하였으나, 이에 이에 한정되지 않는다.
본 발명에서 사용되는 용어 "유효성분으로 포함하는"이란, 본 발명의 유효 성분인 SETMAR 억제제를 소정의 효능 또는 활성을 달성하는 데 충분한 양으로 포함하는 것을 의미한다. 상기 SETMAR 억제제는 약학적으로 유효한 양으로 투여할 수 있으며, 유효 용량수준은 개체의 종류 및 연령, 성별, 약물에 대한 민감도, 치료 기간, 동시에 사용되는 약물 및 기타 의학적 요소에 따라 결정될 수 있다.
본 발명에 있어서 상기 약학적 조성물은 캡슐, 정제, 과립, 주사제, 연고제, 분말 또는 음료 형태임을 특징으로 할 수 있으며, 상기 약학적 조성물은 인간을 대상으로 하는 것을 특징으로 할 수 있다. 상기 약학적 조성물은 이들로 한정되는 것은 아니지만, 각각 통상의 방법에 따라 산제, 과립제, 캡슐, 정제, 수성 현탁액 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다.
본 발명에 따른 약학적 조성물은 약학적으로 허용가능한 담체를 포함할 수 있다. 약제학적으로 허용되는 담체는 경구투여시에는 결합제, 활탁제, 붕해제, 부형제, 가용화제, 분산제, 안정화제, 현탁화제, 색소, 향료 등을 사용할 수 있으며, 주사제의 경우에는 완충제, 보존제, 무통화제, 가용화제, 등장제, 안정화제 등을 혼합하여 사용할 수 있으며, 국소투여용의 경우에는 기제, 부형제, 윤활제, 보존제 등을 사용할 수 있다. 본 발명에 따른 약학적 조성물의 제형은 상술한 바와 같은 약제학적으로 허용되는 담체와 혼합하여 다양하게 제조될 수 있다.
예를 들어, 경구투여 시에는 정제, 트로키, 캡슐, 엘릭서(elixir), 서스펜션, 시럽, 웨이퍼 등의 형태로 제조할 수 있으며, 주사제의 경우에는 단위 투약 앰플 또는 다수회 투약 형태로 제조할 수 있다. 기타, 용액, 현탁액, 정제, 캡슐, 서방형 제제 등으로 제형화할 수 있다.
한편, 제제화에 적합한 담체, 부형제 및 희석제의 예로는, 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말디톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 또는 광물유 등이 사용될 수 있다. 또한, 충진제, 항응집제, 윤활제, 습윤제, 향료, 유화제, 방부제 등을 추가로 포함할 수 있다.
본 발명에 따른 약학적 조성물의 투여 경로는 이들로 한정되는 것은 아니지만 구강, 정맥내, 근육내, 동맥내, 골수내, 경막내, 심장내, 경피, 피하, 복강내, 비강내, 장관, 국소, 설하 또는 직장이 포함된다. 상기 "비경구"는 피하, 피내, 정맥내, 근육내, 관절내, 활액낭내, 흉골내, 경막내, 병소내 및 두개골 내 주사 또는 주입기술을 포함한다. 본 발명에 따른 약학적 조성물은 또한 직장 투여를 위한 좌제의 형태로 투여될 수 있다.
본 발명에 따른 약학적 조성물은 사용된 특정 유효성분의 활성, 연령, 체중, 일반적인 건강, 성별, 정식, 투여시간, 투여경로, 배출률, 약물 배합 및 예방 또는 치료될 특정 질환의 중증을 포함한 여러 요인에 따라 다양하게 변할 수 있고, 상기 약학 조성물의 투여량은 환자의 상태, 체중, 질병의 정도, 약물형태, 투여경로 및 기간에 따라 다르지만 당업자에 의해 적절하게 선택될 수 있다. 바람직하게는 상기 요소를 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여할 수 있으며, 더욱 바람직하게는 1~10000㎍/체중㎏/day, 더욱더 바람직하게는 10~1000㎎/체중㎏/day의 유효용량으로 하루에 수회 반복 투여될 수 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.
본 발명의 약학적 조성물은 대상 적응증의 예방 또는 치료를 위하여 단독으로, 또는 수술, 방사선 치료, 호르몬 치료, 화학 치료 및 생물학적 반응 조절제를 사용하는 방법들과 병용하여 사용할 수 있다.
또한, 본 발명의 다른 양태에 따르면, 본 발명은 SETMAR(SET Domain And Mariner Transposase Fusion Gene) 억제제를 포함하는, 항암 보조제를 제공한다.
본 발명에서 항암 보조제는, 항암제 투여시 항암제와 병용하여 투여함으로써, 항암제의 항암 효과를 개선, 향상 또는 증대시킬 수 있는 제제를 의미한다. 본 발명에 있어서, 상기 항암 보조제는 처리농도에 따라 항암제 또는 항암보조제로서 사용할 수 있으며, 항암제의 감수성을 증진시킬 수도 있다.
본 발명의 상기 보조제는 항암약물과 동시에(simutaneous), 별도로(separate) 또는 순차적(sequential)으로 투여될 수 있다. 상기 본 발명에 따른 항암 보조제의 투여 순서 즉, 항암제와 항암 보조제 중에서 어떤 것을 어느 시점에서, 동시에, 개별적 또는 순차적으로 투여할 것인지의 여부는 의사나 전문가에 의해 결정될 수 있다. 이러한 투여 순서는 많은 인자에 따라 달라질 수 있다. 상기 항암 보조제는 암을 예방, 개선 또는 치료하는 효과를 가지는 공지의 화합물과 병용하여 투여될 수 있다. 이에 있어, 공지의 화합물과 동시 또는 순차적으로 투여될 수 있다.
상기 공지의 화합물은 옥살리플라틴(Oxaliplatin), 5-FU(5-fluorouracil), 독소루비신(Doxorubicin), 이리노테칸(Irinotecan), 카보플라틴(Carboplatin), 파클리탁셀(Paclitaxel), 젬시타빈(Gemcitabin) 및 보테조밉(Bortezomib) 으로 이루어진 군에서 선택된 1종 이상의 항암제일 수 있으나, 이에 제한되는 것은 아니다.
또한, 본 발명의 다른 양태에 따르면, 본 발명은 SETMAR(SET Domain And Mariner Transposase Fusion Gene) 억제제를 포함하는, 암 예방 또는 개선용 식품 조성물을 제공한다.
본 발명에 따른 식품 조성물은 기능성 식품(functional food), 영양 보조제(nutritional supplement), 건강식품(health food), 건강보조식품(health supplement) 및 식품 첨가제(food additives) 등의 모든 형태를 포함한다. 상기 유형의 식품 조성물은 당업계에 공지된 통상적인 방법에 따라 분말제, 정제, 캡슐제, 환제 및 액제로 이루어진 군에서 선택된 어느 하나의 형태로 제형화 될 수 있으나, 이에 제한되는 것은 아니다. 당 업계에 공지된 방법을 이용하여 다양한 형태로 제조할 수 있다.
예를 들면, 건강식품으로는 본 발명의 SETMAR 억제제 자체를 과립화, 캡슐화 및 분말화하여 섭취하거나 차, 쥬스 및 드링크의 형태로 제조하여 음용하도록 할 수 있다. 또한, 본 발명의 SETMAR 억제제를 암의 예방, 개선 또는 치료 활성이 있다고 알려진 공지의 물질 또는 활성 성분과 함께 혼합하여 조성물의 형태로 제조할 수 있다.
또한, 기능성 식품으로는 음료(알콜성 음료 포함), 과실 및 그의 가공식품(예: 과일통조림, 병조림, 잼, 마멀레이드 등), 어류, 육류 및 그 가공식품(예: 햄, 소시지콘비이프 등), 빵류 및 면류(예: 우동, 메밀국수, 라면, 스파게티, 마카로니 등), 과즙, 각종 드링크, 쿠키, 엿, 유제품(예: 버터, 치이즈 등), 식용식물유지, 마아가린, 식물성 단백질, 레토르트 식품, 냉동식품, 각종 조미료(예: 된장, 간장, 소스 등) 등에 본 발명의 SETMAR 억제제를 첨가하여 제조할 수 있다.
또한 본 발명의 식품 조성물은 통상의 식품 첨가물을 포함할 수 있으며, 상기 "식품 첨가물"로서의 적합 여부는 다른 규정이 없는 한, 식품의약품안전처에 승인된 식품 첨가물 공전의 총칙 및 일반시험법 등에 따라 해당 품목에 관한 규격 및 기준에 의하여 판정한다. 상기 "식품 첨가물 공전"에 수재된 품목으로는 예를 들어, 케톤류, 글리신, 구연산칼륨, 니코틴산, 계피산 등의 화학적 합성물, 감색소, 감초추출물, 결정셀룰로오스, 고량색소, 구아검 등의 천연첨가물, L-글루타민산나트륨 제제, 면류첨가알칼리제, 보존료제제, 타르색소제제 등의 혼합제제류들을 들 수 있다.
본 발명의 식품 조성물에 있어, 상기 SETMAR 억제제는 바람직하게 식품 조성물 대비 0.00001~50 중량%로 포함될 수 있다. 상기 함량이 0.00001 중량% 미만일 경우에는 그 효과가 미비하고, 50 중량%를 초과하는 경우에는 사용량 대비 효과 증가가 미미하여 비경제적이다.
또한, 본 발명의 SETMAR 억제제를 식품 첨가제의 형태로 사용하기 위해서는 정제, 캡슐, 분말, 과립, 액상, 환 등의 형태로 제조하여 사용할 수 있다.
본 발명의 조성물이 음료로 제조될 경우, 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 포함할 수 있다. 상술한 천연 탄수화물은 포도당, 과당과 같은 모노사카라이드, 말토오스, 수크로오스와 같은 디사카라이드, 및 덱스트린, 사이클로덱스트린과 같은 천연 감미제나, 사카린, 아스파르탐과 같은 합성 감미제 등을 사용할 수 있다. 상기 천연 탄수화물의 비율은 본 발명의 조성물 100 ml 당 일반적으로 약 0.01 내지 10 g, 바람직하게는 약 0.01 내지 0.1 g이다.
상기 외에 본 발명의 조성물은 여러 가지 영양제, 비타민, 전해질, 풍미제, 착색제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알코올, 탄산 음료에 사용되는 탄산화제 등을 포함할 수 있다. 그 밖에 본 발명의 조성물은 천연 과일주스, 과일주스 음료 및 야채 음료의 제조를 위한 과육을 포함할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 크게 중요하진 않지만 본 발명의 조성물 100 중량부 당 0.01 내지 0.1 중량부의 범위에서 선택되는 것이 일반적이다.
본 발명에 있어서, "건강보조식품" 또는 "건강기능식품(health functional food)"이란 건강기능식품에 관한 법률에 따른 인체에 유용한 기능성을 가진 원료나 성분을 사용하여 제조 및 가공한 식품을 의미하며, "기능성"이라 함은 인체의 구조 및 기능에 대하여 영양소를 조절하거나 생리학적 작용 등과 같은 보건 용도에 유용한 효과를 얻을 목적으로 섭취하는 것을 의미한다.
또한, 본 발명의 또 다른 양태에 따르면, 본 발명은 SETMAR(SET Domain And Mariner Transposase Fusion Gene) 억제제를 포함하는, 암 세포의 정상세포 또는 정상 유사 세포로의 전환용 조성물 및 In vitro에서 상기 SETMAR 억제제를 암세포에 처리하는 단계를 포함하는, 암세포의 정상세포 또는 정상 유사 세포로의 전환 유도 방법을 제공한다.
또한, 본 발명의 또 다른 양태에 따르면, 본 발명은 다음 단계를 포함하는, 암 치료용 제제의 스크리닝 방법을 제공한다:
(a) 암세포에 후보 물질을 처리하는 단계;
(b) 후보 물질이 처리된 암세포에서 SETMAR의 발현 수준을 측정하는 단계; 및
(c) 상기 SETMAR 발현 수준이 후보 물질 미처리 대조군에 비해 낮은 수준을 나타내는 경우, 상기 후보 물질을 암 치료용 제제로서 판정하는 단계.
본 발명의 스크리닝 방법에 따르면, 먼저 상기 유전자 또는 단백질을 포함하는 암 세포에 분석하고자 하는 후보 물질을 접촉시킬 수 있다. 상기 후보물질은 상기 유전자의 발현량, 단백질의 양 또는 단백질의 활성에 영향을 미치는지의 여부를 검사하기 위하여 스크리닝에서 이용되는 미지의 물질을 의미한다.
상기 후보 물질은 화학물질, 안티센스 올리고뉴클레오티드, 안티센스-RNA, siRNA, shRNA, miRNA, 상기 단백질에 특이적인 항체 또는 천연물 추출물을 포함할 수 있으나, 이에 제한되지 않는다.
본 발명에서는 SETMAR에 특이적인 siRNA, shRNA, miRNA 또는 항체를 포함할 수 있다.
이후, 후보물질이 처리된 세포에서 상기 유전자의 발현량, 단백질의 양 또는 단백질의 활성을 측정할 수 있으며, 측정 결과 상기 유전자의 발현량, 단백질의 양 또는 단백질의 활성이 감소되는 것이 측정되면 상기 후보 물질은 암을 치료 또는 예방할 수 있는 제제로 사용할 수 있을 것으로 판정할 수 있다.
상기 유전자의 발현 수준 또는 단백질의 양을 측정하는 방법은 공지의 기술을 이용하여 생물학적 시료로부터 mRNA 또는 단백질을 분리하는 공지의 공정을 포함하여 수행될 수 있다. 상기 "생물학적 시료"란 암의 발생 또는 진행 정도에 따른 상기 유전자의 발현 수준 또는 단백질의 수준이 정상 대조군과는 다른, 생체로부터 채취된 시료를 말하며, 상기 시료로는 예를 들면, 조직, 세포, 혈액, 혈청, 혈장, 타액 및 뇨 등이 포함될 수 있으나, 이에 제한되지 않는다.
상기 유전자의 발현 수준 측정은 바람직하게는 mRNA의 수준을 측정하는 것이며, mRNA의 수준을 측정하는 방법으로는 역전사 중합효소연쇄반응(RTPCR), 실시간 역전사 중합효소연쇄반응, RNase 보호 분석법, 노던 블럿 및 DNA 칩 등이 있으나, 이에 제한되지 않는다.
상기 단백질 수준의 측정은 항체를 이용할 수 있는데, 이러한 경우 생물학적 시료 내의 상기 마커 단백질과 이에 특이적인 항체는 결합물, 즉, 항원-항체 복합체를 형성하며, 항원-항체 복합체의 형성량은 검출 라벨(detection label)의 시그널의 크기를 통해서 정량적으로 측정할 수 있다. 이러한 검출 라벨은 효소, 형광물, 리간드, 발광물, 미소입자(microparticle), 레독스 분자 및 방사선 동위원소로 이루어진 그룹 중에서 선택할 수 있으며, 이에 제한되지 않는다. 단백질 수준을 측정하기 위한 분석 방법으로는 웨스턴 블랏, ELISA, 방사선면역분석, 방사선 면역 확산법, 오우크테로니 면역 확산법, 로케트 면역전기영동, 조직면역염색, 면역침전 분석법, 보체 고정분석법, FACS, 단백질 칩 등이 있으나, 이에 제한되지 않는다.
또한, 본 발명의 또 다른 양태에 따르면, 본 발명은 다음 단계를 포함하는, 암세포로부터 정상세포 또는 정상 유사 세포로 전환시킬 수 있는 제제의 스크리닝 방법을 제공한다:
(a) 암세포에 후보 물질을 처리하는 단계;
(b) 후보 물질이 처리된 암세포에서 SETMAR의 발현 수준을 측정하는 단계; 및
(c) 상기 SETMAR 발현 수준이 후보 물질 미처리 대조군에 비해 낮은 수준을 나타내는 경우, 상기 후보 물질을 암세포로부터 정상세포 또는 정상 유사 세포로 전환시킬 수 있는 제제로서 판정하는 단계.
또한, 본 발명의 또 다른 양태에 따르면, 본 발명은 SETMAR(SET Domain And Mariner Transposase Fusion Gene) 억제제를 대상에게 투여하는 단계를 포함하는, 암 치료 방법을 제공한다.
본 발명에서 사용된 용어, "대상"은 암 질환을 가지고 있는 개체로서, 바람직하게는 암 질환을 가지고 있는 인간을 포함한 말, 양, 돼지, 염소, 개 등의 포유동물을 의미하나, 바람직하게는 인간을 의미한다.
본 발명의 방법은 상술한 SETMAR 억제를 이용하므로, 이와 중복된 내용은 본 명세서의 과도한 복잡성을 피하기 위하여 그 기재를 생략한다.
본 발명에 따르면, 암세포에서 SETMAR을 억제하는 경우, 암세포의 정상 세포로의 분화인, 암화 과정의 가역화가 성공적으로 달성됨을 규명한 바, 본 발명은 단순히 암세포의 사멸을 유도하는 종래 항암제와 달리 항암 치료시 발생할 수 있는 정상 세포가 사멸되는 부작용을 배제하고, 암세포를 정상 세포로 전환시키는 치료 방법으로 유용하게 활용할 수 있다.
도 1a 내지 1h는 다양한 조직에서의 데이터 분석을 통해 암화 과정에서 중요한 후성유전학 조절 유전자들이 통계적으로 유의미한 상관관계가 있음을 확인한 결과이다. 도 1a는 공지된 데이터 베이스를 기반으로 하여 암세포와 정상세포간 차이를 나타내는 4kb 이상의 H3K4me3 Peaks(Broad H3K4me3)를 도출한 결과를 개략적으로 보여준다. 도 1b는 Total H3K4me3 Peaks와 Broad H3K4me3 Peaks를 기반으로 정상 조직 유래 H3K4me3 데이터와 암 세포주 유래 H3K4me3 데이터를 PCA(Principal Component Analysis) 분석한 결과를 보여준다. 도 1c는 PCA의 축을 구성하는 주요 유전자를 이용하여 GO(Gene Ontology) 분석한 결과를 보여준다. 도 1d는 Broad H3K4me3 Peaks에 연관된 유전자를 기존에 알려진 각 장기의 특징적인 유전자 데이터베이스 (GTEx, FANTOM5, HPA)를 이용하여 비교한 결과를 보여준다. 도 1e는 인간의 전체 지놈(Genome)을 10kb씩 분석하여 H3K4me3 및/또는 H3K27me3의 존재 여부를 확인하고 이를 기반으로 Broad H3K4me3 Peaks와 Total H3K4me3 Peaks가 정상과 암조직에서 나타낸 변화를 비교한 결과를 보여준다. 도 1f는 Total 및 Broad H3K4me3의 위치 및 연관 유전자를 선정하고 이를 전사체 및 후성유전체가 얼마나 증가하였는지 확인하는 방법을 보여준다. 도 1g는 정상 조직의 전사체 데이터베이스 GTEX와 암 세포주 전사체 데이터베이스를 통합하고, 두 데이터베이스에서 앞서 선정한 Broad H3K4me3 연관 유전자의 발현의 양을 비교하였다. 이때 Broad H3K4me3 연관 유전자는 암과 정상에서 크게 차이난다. 도 1h는 TCGA 데이터베이스에서 정상 조직과 암세포의 전사체 및 후성 유전체의 변화를 정리하였고, 데이터베이스에서 앞서 선정한 Broad H3K4me3 연관 유전자의 전사체의 발현양과 후성유전체의 변화량을 비교하였다. 이때 Broad H3K4me3 연관 유전자는 암과 정상에서 전사체 및 후성유전체 모두 크게 차이난다.
도 2는 정상 조직에서 중요한 것으로 알려진 Broad H3K4me3에 직접 결합해서 이를 조절할 수 있는 후성유전학 조절자(epigenetic regulator)들을 전암(Pan-cancer) 수준에서 분석하여 암화과정에서 중요한 후성유전학 조절자 타겟을 발굴한 결과를 보여준다.
도 3a 및 3b는 SETMAR-억제 암세포의 증식 억제 및 정상세포로의 표현형 변화를 확인한 결과를 보여준다. KD; knock-down
도 4a 및 4b는 SETMAR-억제 암세포에서의 정상 관련 유전자 및 이의 단백질 발현 수준을 확인한 결과를 보여준다.
도 5는 SETMAR-억제 암세포에서의 정상 세포 대사 기능의 회복을 확인한 결과를 보여준다.
도 6은 SETMAR-억제 암세포에서의 전이능 감소를 확인한 결과를 보여준다.
도 7a 및 7b는 SETMAR의 억제가 미치는 암세포에서의 다양한 후성 유전학적 변화를 확인한 결과를 보여준다.
도 8은 SETMAR의 억제가 미치는 암세포에서의 단일세포 전사체 및 후성유전체에 대한 영향을 확인한 결과를 보여준다.
도 9는 비교대조군으로서 SETMAR가 존재하는 간암 세포주와 본 발명의 SETMAR가 억제된 간암 세포주를 누드 마우스에 이식한 xenograft 모델에서의 암세포 성장을 비교한 결과를 보여준다.
이하, 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실험 재료 및 방법
본 발명에서 사용한 간암 세포주들(SNU-475, SNU-761)은 모두 서울대 세포중 은행에서 분양을 받았으며, 10% FBS과 Welgene 사의 DMEM을 사용하였다. 세포는 5% CO2 환경에서 습윤한 조건에서 37℃에서 배양하였으며, 모든 조건은 세포주를 확립한 서울대 세포주 은행의 프로토콜을 따랐다.
세포주에서 SETMAR를 억제하기 위해서 Lenti virus를 이용해서 shRNA(TCCGACTCCAATTACATTATA, 서열번호 1)를 세포내부로 전달함으로써 SETMAR의 발현을 억제하였다. 그리고 이들의 감소를 SETMAR-F(GGATGGCGGAGTTTAAGGAGA, 서열번호 2), SETMAR-R(GCTGGGTTCCTTCTCATTTCC, 서열번호 3) 프라이머를 이용해서 RT-qPCR을 통해 확인하였다.
본 발명에서 사용한 다양한 시퀀싱 및 Omics 데이터들은 제조사의 파이프라인을 따랐다. ChIP-seq은 Activie motif 사의 ChIP-IT high sensitive의 프로토콜을 따랐으며, 모든 분석은 Bowtie-MACS2 파이프라인을 따랐다. Single cell RNA-seq의 경우에 10x genomics 사의 single cell multiome Kit를 사용하여 데이터 생산을 진행하였으며, 이후 Cellranger-arc 프로그램을 이용하여, hg38 에 alignment 하였고, 추후 분석에서는 Seurat, Signac, FigR 을 사용하였다.
본 발명에서 동물실험은 한국과학기술원 동물 윤리 위원회에서 승인 받은 방법으로 실험이 진행되었으며, 마우스의 피부 아래에 암세포를 이식하여 Xenograft 마우스를 만들었고, 이 모델을 통해서 SETMAR의 치료효과를 확인하였다.
실시예 1. 암화과정에서의 후성유전학 조절자(Epigenetics regulator) 타겟 발굴
본 발명자들은, 암의 암화과정에서 중요한 후성유전학 조절자 타겟을 발굴하기 위해, 다양한 암 및 정상 조직의 유전체, 후성 유전체, 전사체 데이터베이스(TCGA, ENCODE, GTEX, HPA, FANTOM)를 기반으로 하여, 유전자 조절 네트워크를 구성하는 데이터 분석을 진행하였다.
먼저, 도 1a 내지 1h에 나타낸 바와 같이, 11 종의 장기에서 8000 개 이상의 샘플을 통합 분석하였다. 정상 세포와 암 세포에서 차이를 나타내는 4kb 이상의 H3K4me3 피크(Broad H3K4me3 Peaks)를 확인하였으며, 이들에 의해서 조절되는 유전자들은 각 장기의 주요기능을 조절하는 유전자들과 통계적으로 유의미한 상관관계가 있음을 확인하였다.
즉, 8000명 이상의 다양한 데이터를 통합 분석하여 Broad H3K4me3 Peaks를 획득하였고(도 1a), Total histone modification loci와 4kb 이상의 Broad H3K4me3 histone modification 마커를 이용하여 정상 세포와 암세포의 구분 여부를 확인했을 때, Total histone modification loci(Total H3K4me3 Peaks)로는 정상 세포와 암세포의 구분이 불가능한 반면, Broad H3K4me3 histone modification(Broad H3K4me3 Peaks)의 경우에는 정상 세포와 암세포를 효과적으로 구분할 수 있음을 확인하였다(도 1b). 상기 결과를 기반으로 주성분 분석하여, 주요 PC(Principal Component) 축에 해당되는 유전자를 확인한 결과, PC1은 주로 정상세포의 분화와, PC2는 주로 암세포의 특징과 관련된 것으로 확인되었다(도 1c). 또한, GTEx, FANTOM5, HPA 데이터를 이용하여 Broad H3K4me3 loci와 연관되어 있는 유전자를 확인한 결과, 각 장기의 특징과 일치함을 알 수 있었다(도 1d). 또한, 정상 조직의 Broad H3K4me3 loci는 암세포에서는 그 길이가 크게 줄어들면서, 동시에 H3K27me3의 특징을 획득하는 것으로 나타났다(도 1e). 또한, 상기 정상 세포와 암 세포주 비교외에, 추가적으로, TCGA, GTEx, CCLE 암 데이터를 이용하여 정상 조직의 Broad H3K4me3 및 Total H3K4me3와 연관된 유전자의 발현 및 epigenetic state change를 확인한 결과, Total H3K4me3에서는 암세포와 정상세포에서의 발현 수준 차이가 크지 않은 반면, Broad H3K4me3에서는 암세포와 정상세포간 발현 수준 차이가 크게 나타나는 것을 확인하였다(도 1f-1h).
또한, 도 2에 나타낸 바와 같이, 정상 조직에 중요한 것으로 알려진 Broad H3K4me3에 직접 결합해서 이들을 조절할 수 있는 후성유전학 조절자(epigenetic regulator)들을 전암(Pan-cancer) 수준에서 분석한 결과, 전암 수준에서 간암, 대장암, 폐암 및 신장암세포를 정상 세포로 가역화 변화(분화)를 주도하는 주요 후성유전학 조절자(master epigenetic regulator)로써 SETMAR(SET Domain And Mariner Transposase Fusion Gene)를 최종선별하였다.
이하, 본 실시예에서는 대표적으로 간암을 대상으로 하여 실험을 실시하였다.
실시예 2. 본 발명의 후성유전학 조절자 SETMAR의 억제가 암세포에 미치는 영향
2-1. SETMAR-억제 암세포의 증식 억제 및 정상세포로의 표현형 변화 유도 확인
본 발명자들은, 상기 실시예 1에서 선별된 후성유전학 조절자인 SETMAR의 억제가 암세포에 미치는 영향을 확인하고자, shRNA를 이용하여 SETMAR가 감소된 간암 세포주 2종(SNU475, SNU761)을 제작하여 상기 암세포주의 증식 수준 및 형태를 관찰하였다.
그 결과, 도 3a에 나타낸 바와 같이, SETMAR에 의해 가역화(reversion)된 세포들은, 세포 형태가 본래의 길죽하고 뾰족한 표현형 특징이 사라지고, 둥글고 짧아진 정상 간세포의 형태로 표현형이 변화한 것을 확인하였다. 또한, 도 3b에 나타낸 바와 같이, 두 개의 세포주 모두 증식이 크게 감소하였다.
이러한 결과는 SETMAR 억제가 단순히 암 세포를 사멸시키는 것이 아니라, 암세포가 정상 세포의 표현형 특징을 갖도록 정상 세포로 가역화시킬 수 있음을 보여주는 결과이다.
2-2. SETMAR-억제 암세포에서의 정상 관련 유전자의 발현 증가 유도
또한, 본 발명자들은, 실제로 간암세포에서 정상 세포(또는 정상 유사 세포)로 가역화된 것인지 입증하기 위해, 정상 세포에서 중요한 것으로 알려져 있는 마커로서 알부민 및 주요 간세포 기능 관련 유전자 및 단백질 발현 수준을, 상기 SETMAR-억제 간암 세포주 SNU475, SNU761에서 확인하였다.
상기 주요 간세포 기능 관련 유전자는 다음과 같다:
AAT : Alpha 1 anti-trypsin, ALB : Albumin, ALDOB : Aldolase, Fructose-Bisphosphate B, CYP1A2 : Cytochrome P450 1A2, G6P : Glucose 6-phosphate, GS : Glutamine synthetase, MRP2 : Multidrug Resistance-Associated Protein 2, PCK1 : Phosphoenolpyruvate Carboxykinase 1, PEPCK : Phosphoenolpyruvate Carboxykinase, ASGR2 : Asialoglycoprotein Receptor 2, CEBPA : CCAAT Enhancer Binding Protein Alpha, ONECUT1 (HNF6A) : One Cut Homeobox 1. TF : Transferrins, LIPC : Hepatic lipase, C3 : Complement subunit 3, ASGR1 : glycoprotein that forms the asialoglycoprotein receptor,　FOXA3 : Forkhead Box A3
그 결과, 도 4a에 나타낸 바와 같이, 본 발명의 SETMAR가 억제되어 정상 간세포로 가역화된 간암 세포주에서, 정상 간세포의 기능에 관계된 것으로 공지된 상기 유전자들의 발현 수준 변화를 qPCR로 확인한 결과, 이들 유전자는 최소 2배 이상 증가하였으며, 알부민은 최대 100배까지 증가함을 확인하였다. 이러한 알부민은 간세포에서 만들어내는 다양한 필수 단백질 중에 하나로, 간부전이나 간암이 발생해서 알부민의 생산이 억제되면, 체내 삼투압이 깨지면서, 복수가 차게된다. 따라서, 상기 알부민의 생산은 곧 정상적인 간기능이 발휘됨을 의미한다.
또한, 도 4b에 나타낸 바와 같이, 상기 알부민 단백질의 발현 수준도 크게 증가함을 확인하였다.
2-3. SETMAR-억제 암세포에서의 정상 세포 대사 기능의 회복 유도
또한, 본 발명자들은, 실제로 간암세포에서 정상 세포(또는 정상 유사 세포)로 가역화된 것인지 입증하기 위해, 상기 SETMAR-억제 간암 세포주의 정상 간세포 대사 기능 회복 수준을 측정하였다.
그 결과, 도 5에 나타낸 바와 같이, SETMAR의 감소에 따른 간암 세포의 간기능의 회복은 알부민의 증가로 확인하였고, 또한, glucose 대사 관련 PAS, 지질대사 관련 Oil red O 염색을 통해, 실제 간세포 대사 기능이 회복되었음을 확인하였다.
2-4. SETMAR-억제 암세포에서의 전이능 감소 유도
본 발명자들은, SETMAR의 억제(감소)가 암세포의 전이능력에 미치는 영향을 관찰하였다.
그 결과, 도 6에 나타낸 바와 같이, SETMAR의 억제는 실제 전이 능력이 있는 SNU475 세포주에서 그 전이 능력을 크게 감소시켰음을 확인하였다.
실시예 3. 본 발명의 후성유전학 조절자 SETMAR의 억제가 미치는 암세포에서의 다양한 후성 유전학적 변화
본 발명자들은, 본 발명의 선별된 후성유전학 조절자인 SETMAR의 억제가 암세포의 후성 유전학적 변화에 미치는 영향을 관찰하였다.
그 결과, SETMAR의 억제는 다양한 후성유전학적 변화를 유도하였는데, 도 7a에 나타낸 바와 같이, 실제로 H3K4me3의 변화(증가)를 유도하였고, 이러한 H3K4me3의 증가는 주로 간세포의 기능에 관련된 중요한 유전자인 알부민과 Phosphoenolpyruvate Carboxykinase에서 나타났다.
반면, 도 7b에 나타낸 바와 같이, SETMAR의 억제는 H3K27me3의 감소를 유도하였고, 이는 주로 종양 억제 유전자(tumor suppressor gene)에서 나타났다.
상기 결과들은, 본 발명의 SETMAR 억제에 의해, 정상세포에서 나타나는 특징인 리신 4에서의 히스톤 H3의 트리메틸화(H3K4me3)가 증가되었을 뿐만 아니라, 종양 억제 유전자에서 나타나는 특징인 리신 27에서의 히스톤 H3의 트리메틸화(H3K27me3)가 저해되는 후성 유전학적 변화가 유도되었고, 이는, 암세포의 정상세포로의 전환, 즉, 가역화가 일어났음을 입증한다.
실시예 4. 본 발명의 후성유전학 조절자 SETMAR의 억제가 미치는 암세포에서의 단일세포 전사체 및 후성유전체에 대한 영향
본 발명자들은, 본 발명의 선별된 후성유전학 조절자인 SETMAR의 억제가 암세포의 단일세포 전사체 및 후성유전체에 미치는 영향을 확인하기 위해 데이터를 분석하였다.
그 결과, 도 8에 나타낸 바와 같이, 실제 간암세포의 SETMAR를 억제한 후 시간이 지날수록 암세포가 정상 세포로 가역화되는 특징, 즉, 정상 간세포와 동일하게 알부민이 증가하는 동시에, 정상 간세포에 중요한 Transcription factor 인 HNF4A, FOXA1, HNF1A가 증가함을 확인하였다.
실시예 5. 본 발명의 후성유전학 조절자 SETMAR 억제에 의한 in vivo 상에서의 암세포 억제 효과 확인
본 발명자들은, 실제 in vivo 상에서 SETMAR 억제에 따른 암 세포의 성장 수준을 확인하고자 하였다.
이에, 대조군으로서 정상 SETMAR를 발현하는 HCC(SNU761)(WT_SETMAR)와 본 발명의 SETMA-넉다운 HCC(SETMAR_KD)를, 누드 마우스에 이식한 후, 7일 째에 이들의 암세포 크기를 측정하여 비교한 결과, 도 9에 나타낸 바와 같이, 종양을 형성한 SETMAR-발현 HCC 처리군과 달리, SETMAR-억제 HCC 처리군에서는 암이 생성되지 않았을 뿐만 아니라, 증식 역시 전혀 이뤄지지 않았음을 확인하였다(*** p-value < 0.001).
이는, 암세포주가 SETMAR 억제에 의해 암세포로서의 고유의 특성을 잃어버림에 따라, 암을 유발시키지 않을 뿐만 아니라, 정상 세포로 가역화되어, 암세포가 존재하지 않는 상태, 즉, 정상세포 또는 정상 유사 세포들만이 존재하는, 궁극의 목적인 암의 완전 관해를 달성했다는 것을 입증한다.
따라서, 본 발명의 SETMAR 억제는 항암 치료에 효과적으로 작용할 수 있다.
종합적으로, 본 발명에서는 SETMAR의 저해가 단순히 암 특성을 저해할 뿐만 아니라, 암세포에서 정상세포의 특징이 발현되도록 변화시켜 정상세포의 표현형 및 기능이 나타남을 입증하였다. 따라서, 이러한 후성유전학 조절자 제어를 통해 암세포를 정상 세포로 가역화함으로써 안전하고 효과적인 항암 치료 효과를 달성할 수 있을 것으로 기대된다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.

Claims (17)

  1. SETMAR(SET Domain And Mariner Transposase Fusion Gene) 억제제를 유효성분으로 포함하는, 암 예방 또는 치료용 약학적 조성물.
  2. 제1항에 있어서,
    상기 SETMAR 억제제는 SETMAR 유전자의 mRNA에 상보적으로 결합하는 안티센스 올리고뉴클레오타이드, siRNA(small interference RNA), shRNA(short hairpin RNA), miRNA(microRNA) 및 리보자임(ribozyme)으로 이루어진 군으로부터 선택된 1 종 이상인 것인,
    암 예방 또는 치료용 약학적 조성물.
  3. 제1항에 있어서,
    상기 SETMAR 억제제는 SETMAR 단백질에 특이적으로 결합하는 화합물, 펩티드, 펩티드 모방체, 기질유사체, 앱타머 및 항체로 이루어진 군으로부터 선택된 1 종 이상 것인,
    암 예방 또는 치료용 약학적 조성물.
  4. 제1항에 있어서,
    상기 SETMAR 억제제는, 암세포의 정상세포 또는 정상 유사 세포로의 가역화를 유도하는 것인,
    암 예방 또는 치료용 약학적 조성물.
  5. 제4항에 있어서,
    상기 정상세포 또는 정상 유사 세포로의 가역화는, 정상세포 형태로의 변화, 정상세포 기능 회복 또는 정상세포로의 후성 유전학적 변화 유도인 것인,
    암 예방 또는 치료용 약학적 조성물.
  6. 제1항에 있어서,
    상기 SETMAR 억제제는 암세포의 증식능, 성장능, 전이능, 침윤능 및 이동능으로 이루어진 군으로부터 선택된 1 종 이상을 억제하는 것인,
    암 예방 또는 치료용 약학적 조성물.
  7. 제1항에 있어서,
    상기 SETMAR 억제제는 암세포의 히스톤의 메틸화를 증가 또는 저해하는 것인,
    암 예방 또는 치료용 약학적 조성물.
  8. 제7항에 있어서,
    상기 SETMAR 억제제는 리신 4에서의 히스톤 H3의 트리메틸화(H3K4me3)를 증가시키는 것인,
    암 예방 또는 치료용 약학적 조성물.
  9. 제7항에 있어서,
    상기 SETMAR 억제제는 리신 27에서의 히스톤 H3의 트리메틸화(H3K27me3)를 저해하는 것인,
    암 예방 또는 치료용 약학적 조성물.
  10. 제1항에 있어서,
    상기 암은, 간암(liver cancer), 대장암(colon cancer), 폐암(lung cancer), 신장암(adrenal cancer), 위암(stomach cancer), 유방암(breast cancer), 혈액암(blood cancer), 뼈암(bone cancer), 췌장암(pancreatic cancer), 피부암(skin cancer), 머리 또는 목암(head or neck cancer), 피부 또는 안구 흑색종(cutaneous or intraocular melanoma), 자궁육종(uterine sarcoma), 난소암(ovarian cancer), 직장암(rectal cancer), 항문암(anal cancer), 난관암(fallopian tube carcinoma), 자궁내막암(endometrial carcinoma), 자궁경부암(cervical cancer), 소장암(small intestine cancer), 내분비암(endocrine cancer), 갑상선암(thyroid cancer), 부갑상선암(parathyroid cancer), 연조직종양(soft tissue tumor), 요도암(urethral cancer), 전립선암(prostate cancer), 기관지암(bronchogenic cancer) 및 골수암(bone marrow tumor)으로 이루어진 군으로부터 선택된 1 종 이상인 것인,
    암 예방 또는 치료용 약학적 조성물.
  11. SETMAR(SET Domain And Mariner Transposase Fusion Gene) 억제제를 유효성분으로 포함하는, 항암 보조제.
  12. SETMAR(SET Domain And Mariner Transposase Fusion Gene) 억제제를 유효성분으로 포함하는, 암 예방 또는 개선용 식품 조성물.
  13. SETMAR(SET Domain And Mariner Transposase Fusion Gene) 억제제를 유효성분으로 포함하는, 암세포의 정상세포 또는 정상 유사 세포로의 전환용 조성물.
  14. In vitro에서 SETMAR(SET Domain And Mariner Transposase Fusion Gene) 억제제를 암세포에 처리하는 단계를 포함하는, 암세포의 정상세포 또는 정상 유사 세포로의 전환 유도 방법.
  15. 다음 단계를 포함하는, 암 치료용 제제의 스크리닝 방법:
    (a) 암세포에 후보 물질을 처리하는 단계;
    (b) 후보 물질이 처리된 암세포에서 SETMAR의 발현 수준을 측정하는 단계; 및
    (c) 상기 SETMAR 발현 수준이 후보 물질 미처리 대조군에 비해 낮은 수준을 나타내는 경우, 상기 후보 물질을 암 치료용 제제로서 판정하는 단계.
  16. 다음 단계를 포함하는, 암세포로부터 정상세포 또는 정상 유사 세포로 전환시킬 수 있는 제제의 스크리닝 방법:
    (a) 암세포에 후보 물질을 처리하는 단계;
    (b) 후보 물질이 처리된 암세포에서 SETMAR의 발현 수준을 측정하는 단계; 및
    (c) 상기 SETMAR 발현 수준이 후보 물질 미처리 대조군에 비해 낮은 수준을 나타내는 경우, 상기 후보 물질을 암세포로부터 정상세포 또는 정상 유사 세포로 전환시킬 수 있는 제제로서 판정하는 단계.
  17. SETMAR(SET Domain And Mariner Transposase Fusion Gene) 억제제를 대상에게 투여하는 단계를 포함하는, 암 치료 방법.
PCT/KR2023/003198 2022-03-08 2023-03-08 Setmar 억제제를 포함하는 암 예방 또는 치료용 조성물 WO2023172075A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20220029596 2022-03-08
KR10-2022-0029596 2022-03-08

Publications (1)

Publication Number Publication Date
WO2023172075A1 true WO2023172075A1 (ko) 2023-09-14

Family

ID=87935449

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/003198 WO2023172075A1 (ko) 2022-03-08 2023-03-08 Setmar 억제제를 포함하는 암 예방 또는 치료용 조성물

Country Status (2)

Country Link
KR (1) KR20230132725A (ko)
WO (1) WO2023172075A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180061316A (ko) * 2015-10-09 2018-06-07 에이전시 포 사이언스, 테크놀로지 앤드 리서치 암의 치료 및 후성유전학을 위한 화합물
JP2019536456A (ja) * 2016-11-30 2019-12-19 エクソサム ダイアグノスティクス，インコーポレイティド 非小細胞肺癌患者由来のエクソソームｒｎａ及び無細胞ｄｎａを使用して血漿中の変異を検出するための方法と組成物
US20210308171A1 (en) * 2018-08-07 2021-10-07 The Broad Institute, Inc. Methods for combinatorial screening and use of therapeutic targets thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180061316A (ko) * 2015-10-09 2018-06-07 에이전시 포 사이언스, 테크놀로지 앤드 리서치 암의 치료 및 후성유전학을 위한 화합물
JP2019536456A (ja) * 2016-11-30 2019-12-19 エクソサム ダイアグノスティクス，インコーポレイティド 非小細胞肺癌患者由来のエクソソームｒｎａ及び無細胞ｄｎａを使用して血漿中の変異を検出するための方法と組成物
US20210308171A1 (en) * 2018-08-07 2021-10-07 The Broad Institute, Inc. Methods for combinatorial screening and use of therapeutic targets thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
APOSTOLOU PANAGIOTIS, TOLOUDI MARIA, KOURTIDOU ELENI, MIMIKAKOU GEORGIA, VLACHOU IOANNA, CHATZIIOANNOU MARINA, KIPOUROU VASILIKI, : "Potential Role for the Metnase Transposase Fusion Gene in Colon Cancer through the Regulation of Key Genes", PLOS ONE, vol. 9, no. 10, pages e109741, XP093090514, DOI: 10.1371/journal.pone.0109741 *
TELLIER MICHAEL, CHALMERS RONALD: "Human SETMAR is a DNA sequence-specific histone-methylase with a broad effect on the transcriptome", NUCLEIC ACIDS RESEARCH, OXFORD UNIVERSITY PRESS, GB, vol. 47, no. 1, 10 January 2019 (2019-01-10), GB , pages 122 - 133, XP093090517, ISSN: 0305-1048, DOI: 10.1093/nar/gky937 *

Also Published As

Publication number Publication date
KR20230132725A (ko) 2023-09-18

Similar Documents

Publication Publication Date Title
Moskaug et al. Polyphenols and glutathione synthesis regulation
KR102234745B1 (ko) 메르스 코로나바이러스 헬리케이즈 nsP13의 활성을 억제하는 화합물 및 이의 용도
WO2011049348A2 (ko) 울금으로부터 얻은 조류, 돼지 인플루엔자 및 신종플루에 대한 항바이러스제
WO2016137037A1 (ko) Dpp-4 억제제를 포함하는 판막 석회화의 예방 또는 치료용 조성물
KR100950445B1 (ko) 감초로부터 얻은 조류, 돼지 인플루엔자 및 신종플루에 대한 항바이러스제
Summart et al. Purple rice extract supplemented diet reduces DMH-induced aberrant crypt foci in the rat colon by inhibition of bacterial β-glucuronidase
CA2558160C (en) Antisense oligonucleotide targeting myostatin or fox01 for treatment of muscle wasting
WO2022146025A1 (ko) 암전이 억제 및 항암제 감수성 증진용 조성물
WO2011108699A1 (ja) イソフラボン類の作用に関連する遺伝子
CN108309982B (zh) 3位取代的5H-[1,2,4]三嗪[5,6-b]吲哚衍生物的用途
WO2023172075A1 (ko) Setmar 억제제를 포함하는 암 예방 또는 치료용 조성물
WO2023182847A1 (ko) 단일세포전사체를 통한 유전자 네트워크 구축방법 및 이를 이용한 분화에 핵심이 되는 유전자 발굴 방법
TW202345779A (zh) ｅＮＡＭＰＴ增加劑、沉默調節蛋白活化或表現增強劑、ＮＡＤ＋增加劑、及老化細胞抑制劑
WO2023121404A1 (ko) Taf10 억제제를 포함하는 대장암 예방 또는 치료용 조성물
WO2018080276A1 (ko) 담즙산을 포함하는 허혈성 재관류 손상의 예방 또는 치료용 약학적 조성물
WO2023182846A1 (ko) 암의 약제 내성을 극복하기 위한 thbs1 저해제의 용도
WO2017217796A1 (ko) Rhoa 억제제 및 이의 용도
KR102566433B1 (ko) 커피 실버스킨 추출물, 이의 분획물 또는 이로부터 분리된 화합물을 포함하는 근육질환의 예방 또는 치료용 조성물
RU2763021C2 (ru) Лекарственные экстракты растений амброзии
KR20160016030A (ko) 주박 에탄올 추출물의 에틸아세테이트 분획물을 유효성분으로 함유하는 대장암의 예방 또는 치료용 약학적 조성물 및 건강 기능 식품
KR102657354B1 (ko) Syk 저해제를 포함하는 대장암 예방 또는 치료용 병용투여 조성물
WO2024071848A1 (ko) 혈관석회화 치료제 스크리닝 방법
WO2023008978A1 (ko) Sncg를 표적으로 하는 퇴행성 질환 치료 또는 진단용 조성물
WO2023113129A1 (ko) Surf4 억제제를 포함하는 혈액암의 예방 또는 치료용 약학적 조성물
JP2003246734A (ja) インジゴイド含有グルクロノシルトランスフェラーゼ誘導剤

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23767176

Country of ref document: EP

Kind code of ref document: A1