WO2022146025A1 - 암전이 억제 및 항암제 감수성 증진용 조성물 - Google Patents

암전이 억제 및 항암제 감수성 증진용 조성물 Download PDF

Info

Publication number
WO2022146025A1
WO2022146025A1 PCT/KR2021/020161 KR2021020161W WO2022146025A1 WO 2022146025 A1 WO2022146025 A1 WO 2022146025A1 KR 2021020161 W KR2021020161 W KR 2021020161W WO 2022146025 A1 WO2022146025 A1 WO 2022146025A1
Authority
WO
WIPO (PCT)
Prior art keywords
inhibitor
cancer
smad4
pharmaceutical composition
erk
Prior art date
Application number
PCT/KR2021/020161
Other languages
English (en)
French (fr)
Inventor
조광현
김남희
황채영
김태영
Original Assignee
한국과학기술원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국과학기술원 filed Critical 한국과학기술원
Priority to EP21915823.5A priority Critical patent/EP4272739A1/en
Publication of WO2022146025A1 publication Critical patent/WO2022146025A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/496—Non-condensed piperazines containing further heterocyclic rings, e.g. rifampin, thiothixene or sparfloxacin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47—Quinolines; Isoquinolines
    • A61K31/4738—Quinolines; Isoquinolines ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/4745—Quinolines; Isoquinolines ortho- or peri-condensed with heterocyclic ring systems condensed with ring systems having nitrogen as a ring hetero atom, e.g. phenantrolines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/513—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim having oxo groups directly attached to the heterocyclic ring, e.g. cytosine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/555—Heterocyclic compounds containing heavy metals, e.g. hemin, hematin, melarsoprol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7028—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
    • A61K31/7034—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
    • A61K31/704—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin attached to a condensed carbocyclic ring system, e.g. sennosides, thiocolchicosides, escin, daunorubicin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/04—Antineoplastic agents specific for metastasis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00

Definitions

  • the present invention suppresses cancer metastasis that can be induced into a phenotype in which the reactivity to chemotherapy is restored by removing the heterogeneity and stem cell characteristics obtained by epithelial-to-mesenchymal transition (EMT) in cancer cells. And it relates to a composition for enhancing anticancer drug sensitivity.
  • EMT epithelial-to-mesenchymal transition
  • Cancer refers to a group of abnormal cells caused by continuous division and proliferation by disrupting the balance between cell division and death due to various causes, and is also referred to as a tumor. In general, it develops in more than 100 different parts of the body, including organs, white blood cells, bones, lymph nodes, etc., and develops into serious symptoms through infiltration into surrounding tissues and metastasis to other organs.
  • EMT Epithelial-to-mesenchymal transition
  • E-cadherin is a membranous glycoprotein, and the extracellular region binds to E-cadherin molecules of adjacent cells to maintain cell adhesion, and the intracellular region binds ⁇ -, ⁇ - and p120 cadherin to epithelial cells. Forms polarity and cytoskeleton. E-cadherin is regulated by various signaling systems involved in cell proliferation and apoptosis, such as TGF- ⁇ (Transforming growth factor beta), Integrin, Wnt, RTK (receptortyrosine kinase), and Notch.
  • TGF- ⁇ Transforming growth factor beta
  • Integrin Integrin
  • Wnt Integrin
  • RTK receptortyrosine kinase
  • TGF- ⁇ acts on SMAD or phosphatidylinositol 3-kinase/serine-threonine kinase (PI3K/AKT), and it has been reported that PI3K/AKT plays an important role in activating EMT.
  • PI3K/AKT phosphatidylinositol 3-kinase/serine-threonine kinase
  • epithelial-mesenchymal transition is a key process in cancer metastasis and drug resistance.
  • the EMT process is promoted by various signals secreted by the tumor microenvironment.
  • Cancer cells increase stem cell capacity through the EMT process, and acquire resistance to drugs and heterogeneity within the cancer cells.
  • the inventor of the present invention was studying to enhance the responsiveness to chemotherapeutic agents by removing both heterogeneity and stem cell characteristics obtained by EMT in cancer cells exhibiting metastatic and resistance, activation of p53 and SMAD4 and ERK signals
  • the present invention was completed by confirming that the combination of three combinations of pathway inhibition can induce a change to a phenotype with enhanced reactivity.
  • Another object of the present invention is to provide a pharmaceutical composition for combined administration for the prevention or treatment of cancer.
  • Another object of the present invention is to provide a pharmaceutical composition for enhancing anticancer drug sensitivity.
  • Another object of the present invention is to provide an anticancer adjuvant.
  • Another object of the present invention is to provide a food composition for preventing or improving cancer.
  • Another object of the present invention is to provide a method for treating cancer.
  • the present invention provides a pharmaceutical composition for inhibiting cancer metastasis comprising a p53 activator, a mothers against decapentaplegic homolog 4 (SMAD4) inhibitor, and an extracellular signal-regulated kinase (ERK) inhibitor.
  • a pharmaceutical composition for inhibiting cancer metastasis comprising a p53 activator, a mothers against decapentaplegic homolog 4 (SMAD4) inhibitor, and an extracellular signal-regulated kinase (ERK) inhibitor.
  • the present invention provides a pharmaceutical composition for combined administration for the prevention or treatment of cancer comprising a p53 activator, a mothers against decapentaplegic homolog 4 (SMAD4) inhibitor, and an extracellular signal-regulated kinase (ERK) inhibitor provides
  • the present invention provides a pharmaceutical composition for enhancing anticancer drug sensitivity comprising a p53 activator, a mothers against decapentaplegic homolog 4 (SMAD4) inhibitor, and an extracellular signal-regulated kinase (ERK) inhibitor.
  • a pharmaceutical composition for enhancing anticancer drug sensitivity comprising a p53 activator, a mothers against decapentaplegic homolog 4 (SMAD4) inhibitor, and an extracellular signal-regulated kinase (ERK) inhibitor.
  • the present invention provides an anticancer adjuvant comprising a p53 activator, a mothers against decapentaplegic homolog 4 (SMAD4) inhibitor, and an extracellular signal-regulated kinase (ERK) inhibitor.
  • a p53 activator comprising a p53 activator, a mothers against decapentaplegic homolog 4 (SMAD4) inhibitor, and an extracellular signal-regulated kinase (ERK) inhibitor.
  • SMAD4 decapentaplegic homolog 4
  • ERK extracellular signal-regulated kinase
  • the present invention provides a food composition for preventing or improving cancer comprising a p53 activator, a mothers against decapentaplegic homolog 4 (SMAD4) inhibitor, and an extracellular signal-regulated kinase (ERK) inhibitor.
  • a food composition for preventing or improving cancer comprising a p53 activator, a mothers against decapentaplegic homolog 4 (SMAD4) inhibitor, and an extracellular signal-regulated kinase (ERK) inhibitor.
  • the present invention is a method of treating cancer, comprising administering to a subject a p53 activator, a mothers against decapentaplegic homolog 4 (SMAD4) inhibitor, and an extracellular signal-regulated kinase (ERK) inhibitor provides
  • the combination of the p53 activator, SMAD4 inhibitor, and ERK inhibitor of the present invention not only restores the mesenchymal cell phenotype to the epithelial cell phenotype, but also overcomes the high variability and drug resistance of cancer cells, thereby inhibiting the metastatic ability of cancer cells. It can be widely used in the field of therapy.
  • TGF- ⁇ Transforming growth factor beta
  • FIG. 2 is a view showing changes in the phenotype of epithelial cells by the presence or absence of TGF- ⁇ and activation of p53 (Nutlin-3a treatment), and changes in the expression of mesenchymal cells and epithelial cells-related proteins and genes.
  • 3a is a diagram illustrating an EMT molecular regulatory network including EMT-related signaling pathways related to TGF- ⁇ and p53.
  • Figure 3b is the result of confirming the expression change of the phenotype-related protein according to the activation of p53 (Nutlin-3a treatment) and SMAD4 (shS4) combined treatment in the TGF- ⁇ -treated or untreated experimental group.
  • Figure 4a is a result confirming the reactivity to 5-fluorouracil (5-fluorouracil, 5-FU) and doxorubicin (DOX) according to the activation of p53 and inhibition of SMAD4 expression.
  • Figure 4b is the result of confirming the expression changes of mesenchymal cells, epithelial cell phenotype and stem cell ability-related genes according to p53 activation and inhibition of SMAD4 expression.
  • Fig. 5a shows p53 activation (Nutlin-3a treatment) and ERK inhibition using SMAD4 (shS4) and a MEK inhibitor in combination treatment or p53 activation (Nutlin-3a treatment) in the TGF- ⁇ -treated or untreated experimental group; This is the result of confirming the expression change of the phenotype-related protein according to the inhibition of SMAD4 (shS4) and ERK (shERKs).
  • Figure 5b is the result of confirming the expression changes of mesenchymal cells, epithelial cell phenotype and stem cell ability-related gene expression according to the combination treatment of the activation of p53 (Nutlin-3a treatment) and inhibition of SMAD4 (shS4) and ERK (shERKs).
  • 6A and 6B are results confirming the change in responsiveness to 5-FU and doxorubicin according to the combined treatment of activation of p53 ((Nutlin-3a(N3a) treatment) and inhibition of SMAD4(shS4) and ERK(shERKs).
  • 6c and 6d show oxaliplatin (Oxaliplatin, OX) and irinotecan (Irinotecan, CPT-11) following combination treatment of activation of p53 (Nutlin-3a (N3a) treatment) and inhibition of SMAD4 (shS4) and ERK (shERKs). This is the result of confirming the change in reactivity to
  • the present invention provides a pharmaceutical composition for inhibiting cancer metastasis comprising a p53 activator, a mothers against decapentaplegic homolog 4 (SMAD4) inhibitor, and an extracellular signal-regulated kinase (ERK) inhibitor.
  • a pharmaceutical composition for inhibiting cancer metastasis comprising a p53 activator, a mothers against decapentaplegic homolog 4 (SMAD4) inhibitor, and an extracellular signal-regulated kinase (ERK) inhibitor.
  • the three combined treatment treatments of the p53 activator, SMAD4 inhibitor and ERK inhibitor of the present invention not only restore the mesenchymal cell phenotype of cancer cells to the epithelial cell phenotype, but also overcome high variability and drug resistance to suppress the metastatic ability of cancer cells. characterized by doing.
  • the epithelial cell phenotype shown in cancer cells can be restored only by activation of p53, but TGF- In ⁇ -stimulated cancers, it was confirmed that recovery of the epithelial phenotype was impossible only with p53 activation, and converging to a hybrid phenotype that was neither an epithelial cell phenotype nor a mesenchymal cell phenotype.
  • TGF- ⁇ transforming growth factor beta
  • a combination of p53 activation and SMAD4 inhibitor is required, but a p53 activator, a SMAD4 inhibitor, and an ERK inhibitor 3
  • the combination treatment of eggplant combinations is most preferable, and it was confirmed that these combined treatments can suppress the expression of genes related to stem cell ability and enhance sensitivity to anticancer drugs.
  • the target cancer of the present invention is preferably a cancer that has advanced epithelial to mesenchymal transition (EMT), more preferably a cancer having p53 as a wild-type, even more preferably It may be one or more selected from the group consisting of lung cancer, colorectal cancer, pancreatic cancer, liver cancer, thyroid cancer, and breast cancer having p53 as a wild type, and more preferably, lung cancer having p53 as a wild type, but is not limited thereto.
  • EMT advanced epithelial to mesenchymal transition
  • the EMT may be induced by a tumor microenvironment containing TGF- ⁇ , but is not limited thereto.
  • the p53 activator is not limited thereto, but Nutlin-3a (Nutlin-3a), RO6839921, NSC 146109 hydrochloride, RITA, tenovin-1 (Tenovin-1), HLI373, It may be at least one selected from the group consisting of WR 0165, Idasanutlin and YH 239-EE. Preferably, it may be Nutlin-3a (Nutlin-3a).
  • SMAD4 inhibitors include genes or proteins of SMAD4, siRNAs, shRNAs, miRNAs, ribozymes, antisense nucleic acids, DNA/RNA chimeric polynucleotides, compounds, antibodies, and vectors that target the SMAD4 signaling pathway. It may be one or more selected.
  • ERK inhibitors include genes or proteins of ERK, siRNAs, shRNAs, miRNAs, ribozymes, antisense nucleic acids, DNA/RNA chimeric polynucleotides, compounds, antibodies, and vectors that target ERK signaling pathways from the group consisting of It may be one or more selected.
  • antisense nucleic acid means DNA or RNA or a derivative thereof containing a nucleic acid sequence complementary to a specific mRNA sequence, and inhibits translation of mRNA into protein by binding to a complementary sequence in mRNA. It works
  • the antisense sequence refers to a DNA or RNA sequence that is complementary to the mRNA of the gene and capable of binding to the mRNA, and is involved in translation of the mRNA, translocation into the cytoplasm, maturation or all other overall biological functions. It may inhibit essential activity for
  • the antisense nucleic acid may be modified at the position of one or more bases, sugars or backbones to enhance efficacy.
  • the nucleic acid backbone can be modified with phosphorothioates, phosphotriesters, methyl phosphonates, short chain alkyls, cycloalkyls, short chain heteroatomics, heterocyclic intersugar linkages, and the like.
  • Antisense nucleic acids may also include one or more substituted sugar moieties.
  • Antisense nucleic acids may include modified bases.
  • Modified bases include hypoxanthine, 6-methyladenine, 5-methylpyrimidine (particularly 5-methylcytosine), 5-hydroxymethylcytosine (HMC), glycosyl HMC, gentobiosyl HMC, 2-aminoadenine, 2 -Thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6(6-aminohexyl)adenine, 2,6-diaminopurine, etc. There is this.
  • the antisense nucleic acid may be chemically bound to one or more moieties or conjugates that enhance the activity and cell adsorption of the antisense nucleic acid.
  • the antisense oligonucleotide may be synthesized in vitro by a conventional method and administered in vivo, or the antisense oligonucleotide may be synthesized in vivo.
  • siRNA refers to a nucleic acid molecule capable of mediating RNA interference or gene silencing. Since siRNA can inhibit the expression of a target gene, it is provided as an efficient gene knockdown method or gene therapy method.
  • the siRNA molecule of the present invention includes a sense strand (according to one embodiment of the present invention, a sequence corresponding to the mRNA sequence of any one gene selected from the target gene SMAD4 or ERK) and the antisense strand (complementary to the mRNA sequence) sequence) may have a structure forming a double strand by being positioned opposite to each other, and the siRNA molecule of the present invention may have a single strand structure having self-complementary sense and antisense strands.
  • siRNA is not limited to the complete pairing of double-stranded RNA parts that are paired with each other, but pairs are formed by mismatch (corresponding bases are not complementary), bulges (there is no base corresponding to one chain), etc.
  • the siRNA end structure can have either a blunt end or a cohesive end as long as it can suppress the expression of a target gene by the RNAi effect, and the cohesive end structure includes a 3'-end protrusion structure and a 5'-end structure. Both protrusion structures are possible.
  • the "shRNA” of the present invention is called small hairpin RNA or short hairpin RNA, and is used for the purpose of silencing genes by RNA interference.
  • a vector is used to introduce into the target cell. This shRNA hairpin structure is cleaved by other substances in the cell to become siRNA.
  • the SMAD4 inhibitor is preferably an shRNA, which is a nucleotide represented by SEQ ID NO: 1, and the ERK inhibitor is selected from the group consisting of U0126, a nucleotide represented by SEQ ID NO: 2, and a nucleotide represented by SEQ ID NO: 3 Any one or more is preferable.
  • SMAD4 inhibitor (shS4): TACCATACAGAGAACATTGGA (SEQ ID NO: 1)
  • ERKs inhibitor (shERK1): CCTGAATTGTATCATCAACAT (SEQ ID NO: 2)
  • ERKs inhibitor (shERK2): CCATGAGGCAAGAAACTATAT (SEQ ID NO: 3)
  • the p53 activator, SMAD4 inhibitor, and ERK inhibitor may be administered simultaneously or sequentially with the anticancer agent.
  • the anticancer agent may include, without limitation, any anticancer agent known in the art, as long as the cancer treatment or cancer metastasis inhibitory effect can be enhanced by the combined treatment of a p53 activator, a SMAD4 inhibitor, and an ERK inhibitor, for example, 5 -From the group consisting of FU (5-fluorouracil), doxorubicin, oxaliplatin, irinotecan, carboplatin, paclitaxel, gemcitabine, and bortezomib It may be one or more selected anticancer agents.
  • composition according to the present invention can have an excellent effect in the prevention and treatment of cancer by inducing cancer cell death and inhibiting cancer metastasis by inhibiting EMT to inhibit cancer progression, and cancer cell migration and penetration due to EMT inhibitory action Back cancer metastasis can be suppressed from an early stage.
  • the present invention provides a pharmaceutical composition for combined administration for the prevention or treatment of cancer, comprising a p53 activator, a mothers against decapentaplegic homolog 4 (SMAD4) inhibitor, and an extracellular signal-regulated kinase (ERK) inhibitor.
  • a pharmaceutical composition for combined administration for the prevention or treatment of cancer comprising a p53 activator, a mothers against decapentaplegic homolog 4 (SMAD4) inhibitor, and an extracellular signal-regulated kinase (ERK) inhibitor.
  • SMAD4 decapentaplegic homolog 4
  • ERK extracellular signal-regulated kinase
  • the present invention provides a pharmaceutical composition for enhancing anticancer drug sensitivity comprising a p53 activator, a mothers against decapentaplegic homolog 4 (SMAD4) inhibitor, and an extracellular signal-regulated kinase (ERK) inhibitor.
  • a pharmaceutical composition for enhancing anticancer drug sensitivity comprising a p53 activator, a mothers against decapentaplegic homolog 4 (SMAD4) inhibitor, and an extracellular signal-regulated kinase (ERK) inhibitor.
  • the pharmaceutical composition for enhancing anticancer drug sensitivity according to the present invention is characterized in that it targets cancer that has undergone epithelial to mesenchymal transition (EMT).
  • EMT epithelial to mesenchymal transition
  • the anti-cancer agent may include, without limitation, anti-cancer agents known in the art, as long as the anti-cancer agent or cancer metastasis inhibitory effect can be enhanced by the combined treatment of a p53 activator, a SMAD4 inhibitor, and an ERK inhibitor, for example, 5-FU (5 -fluorouracil), doxorubicin, oxaliplatin, irinotecan, carboplatin, paclitaxel, gemcitabine, and one or more selected from the group consisting of bortezomib It may be an anticancer agent.
  • anti-cancer agents known in the art, as long as the anti-cancer agent or cancer metastasis inhibitory effect can be enhanced by the combined treatment of a p53 activator, a SMAD4 inhibitor, and an ERK inhibitor, for example, 5-FU (5 -fluorouracil), doxorubicin, oxaliplatin, irinotecan, carboplatin, paclitaxe
  • the composition may be characterized in the form of capsules, tablets, granules, injections, ointments, powders or beverages, and the pharmaceutical composition may be characterized in that it is intended for humans.
  • the pharmaceutical composition is not limited thereto, but may be formulated in the form of oral dosage forms such as powders, granules, capsules, tablets, aqueous suspensions, external preparations, suppositories, and sterile injection solutions, respectively, according to conventional methods. .
  • the pharmaceutical composition according to the present invention may include a pharmaceutically acceptable carrier.
  • Pharmaceutically acceptable carriers may include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, dyes, fragrances, etc. for oral administration, and in the case of injections, buffers, preservatives, pain-free agents
  • a topical agent, solubilizer, isotonic agent, stabilizer, etc. can be mixed and used, and in the case of topical administration, a base, excipient, lubricant, preservative, etc. can be used.
  • the dosage form of the pharmaceutical composition according to the present invention can be prepared in various ways by mixing with a pharmaceutically acceptable carrier as described above.
  • oral administration in the case of oral administration, it can be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and in the case of injections, it can be prepared in the form of unit dose ampoules or multiple doses. have.
  • it can be formulated as a solution, suspension, tablet, capsule, sustained release formulation, and the like.
  • suitable carriers, excipients and diluents for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil may be used.
  • it may further include a filler, an anti-agglomeration agent, a lubricant, a wetting agent, a flavoring agent, an emulsifier, a preservative, and the like.
  • the route of administration of the pharmaceutical composition according to the present invention is not limited thereto, but oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, topical , sublingual or rectal.
  • parenteral includes subcutaneous, intradermal, intravenous, intramuscular, intra-articular, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques.
  • the pharmaceutical composition according to the present invention may also be administered in the form of a suppository for rectal administration.
  • the pharmaceutical composition according to the present invention contains several factors including the activity of the specific active ingredient used, age, weight, general health, sex, formula, administration time, administration route, excretion rate, drug formulation, and the severity of the specific disease to be prevented or treated.
  • the dosage of the pharmaceutical composition may vary depending on the patient's condition, weight, disease severity, drug form, administration route and period, but may be appropriately selected by those skilled in the art.
  • an amount capable of obtaining the maximum effect with a minimum amount without side effects can be administered, more preferably from 1 to 10000 ⁇ g/weight kg/day, even more preferably from 10 to 1000 mg It can be administered repeatedly several times a day at an effective dose of /weight kg/day.
  • the above dosage does not limit the scope of the present invention in any way.
  • the present invention also provides an anticancer adjuvant comprising a p53 activator, a mothers against decapentaplegic homolog 4 (SMAD4) inhibitor, and an extracellular signal-regulated kinase (ERK) inhibitor.
  • a p53 activator comprising a p53 activator, a mothers against decapentaplegic homolog 4 (SMAD4) inhibitor, and an extracellular signal-regulated kinase (ERK) inhibitor.
  • SMAD4 decapentaplegic homolog 4
  • ERK extracellular signal-regulated kinase
  • the "anticancer adjuvant" refers to an agent capable of improving, enhancing, or enhancing the anticancer effect of an anticancer agent.
  • the anti-cancer adjuvant may be used as an anti-cancer agent or an anti-cancer adjuvant depending on the treatment concentration, and may enhance the sensitivity of the anti-cancer agent.
  • the anticancer adjuvant may be administered in combination with a known compound having an effect of preventing, improving or treating cancer.
  • the known compound is 5-FU (5-fluorouracil), doxorubicin, oxaliplatin (Oxaliplatin), irinotecan (Irinotecan), carboplatin (Carboplatin), paclitaxel (Paclitaxel), gemcitabine (Gemcitabin) and proteomib ( Bortezomib) may be one or more anticancer agents selected from the group consisting of, but is not limited thereto.
  • the present invention also provides a food composition for preventing or improving cancer, including a p53 activator, a mothers against decapentaplegic homolog 4 (SMAD4) inhibitor, and an extracellular signal-regulated kinase (ERK) inhibitor.
  • a food composition for preventing or improving cancer including a p53 activator, a mothers against decapentaplegic homolog 4 (SMAD4) inhibitor, and an extracellular signal-regulated kinase (ERK) inhibitor.
  • the food composition according to the present invention includes all types of functional food, nutritional supplement, health food, health functional food and food additives. .
  • the term "health functional food” refers to a food manufactured and processed by extracting, concentrating, refining, mixing, etc., a specific ingredient as a raw material or a specific ingredient contained in a food raw material for the purpose of health supplementation, It refers to a food designed and processed to sufficiently exert biological control functions such as biological defense, regulation of biological rhythm, prevention and recovery of disease, etc., by the above ingredients, and performs functions related to prevention of disease or recovery of health say what you can do
  • the food composition according to the present invention can be prepared in various forms according to conventional methods known in the art.
  • the p53 activator, SMAD4 inhibitor, and ERK inhibitor mixture according to the present invention may be ingested by granulating, encapsulating, and powdering itself, or may be prepared in the form of tea, juice or drink for drinking.
  • the p53 activator, SMAD4 inhibitor, and ERK inhibitor mixture of the present invention can be prepared in the form of a composition by mixing with a known substance or active ingredient known to have the effect of overcoming cancer treatment or anticancer drug resistance.
  • functional foods include beverages (including alcoholic beverages), fruits and their processed foods (eg, canned fruit, bottled, jam, marmalade, etc.), fish, meat, and their processed foods (eg, ham, sausage corn beef, etc.) , Breads and noodles (eg udon noodles, noodles, ramen, spaghetti, macaroni, etc.), fruit juice, various drinks, cookies, syrup, dairy products (eg butter, cheese, etc.), edible vegetable oils and fats, margarine, vegetable protein, retort It can be prepared by adding a mixture of the SYK inhibitor and MAPK signaling pathway inhibitor of the present invention to food, frozen food, various seasonings (eg, soybean paste, soy sauce, sauce, etc.).
  • beverages including alcoholic beverages
  • fruits and their processed foods eg, canned fruit, bottled, jam, marmalade, etc.
  • fish, meat, and their processed foods eg, ham, sausage corn beef, etc.
  • Breads and noodles eg udon noodles, noodles, ramen
  • the preferred content of the p53 activator, SMAD4 inhibitor and ERK inhibitor mixture of the present invention in the food composition of the present invention is not limited thereto, but may be, for example, 0.01 to 80% by weight of the final prepared food, preferably It may be 0.01 to 50% by weight of the final manufactured food.
  • the food composition of the present invention may contain various flavoring agents or natural carbohydrates as additional ingredients.
  • natural carbohydrates monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, and natural sweeteners such as dextrin and cyclodextrin, synthetic sweeteners such as saccharin and aspartame may be used.
  • the proportion of the natural carbohydrate may be generally about 0.01 to 0.4 g, preferably about 0.02 to 0.03 g per 100 ml of the composition of the present invention.
  • the food composition of the present invention includes various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol , a carbonation agent used in carbonated beverages, and the like.
  • the food composition of the present invention may contain fruit for the production of natural fruit juice, fruit juice beverage, and vegetable beverage. These components may be used independently or in combination. The proportion of these additives is generally selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention, but is not limited thereto.
  • the present invention also provides a method of treating cancer, comprising administering to a subject a p53 activator, a mothers against decapentaplegic homolog 4 (SMAD4) inhibitor, and an extracellular signal-regulated kinase (ERK) inhibitor.
  • SMAD4 decapentaplegic homolog 4
  • ERK extracellular signal-regulated kinase
  • the term “individual” refers to an individual having a cancer disease, preferably a mammal including a human having a cancer disease, such as horse, sheep, pig, goat, dog, etc., preferably means human
  • the SMAD4 (Mothers against decapentaplegic homolog 4) inhibitor and ERK (extracellular signal-regulated kinase) inhibitor may be administered simultaneously or sequentially with the anticancer agent.
  • TGF- ⁇ The activity of TGF- ⁇ in the tumor microenvironment performs various functions, such as promoting cancer growth and EMT.
  • an external stimulus, TGF- ⁇ was treated, and the results are shown in FIG. 1 .
  • lung cancer cell line A549 cells (KCBL No. 10185) were purchased from Korea Cell Line Bank (KCLB, Korean Cell Line Bank).
  • the A549 cells were treated with TGF- ⁇ (5 ng/mL, Peprotech, Cranbury, NJ, USA) for 48 hours to induce EMT. Changes in protein expression in cancer cells were confirmed by western blot analysis of the following procedure.
  • the cells were lysed with lysis buffer [20 mM HEPES, pH 7.2, 150 mM NaCl, 0.5% Triton X-100, 10% glycerol, and a protease/phosphatase inhibitor mixture (protease). / including phosphatase inhibitor cocktail (Thermofisher, Waltham, Mass.)] was dissolved using. Lysate was centrifuged at 13,000 rpm at 4° C. for 20 minutes, and the supernatant was obtained and separated by SDS-PAGE, followed by Western blot analysis.
  • lysis buffer 20 mM HEPES, pH 7.2, 150 mM NaCl, 0.5% Triton X-100, 10% glycerol, and a protease/phosphatase inhibitor mixture (protease). / including phosphatase inhibitor cocktail (Thermofisher, Waltham, Mass.)] was dissolved using. Lysate was centrifuged at 13,000 rpm at 4° C
  • E-cadherin E-Cadherin (sc-21791)
  • p53 sc-126
  • SMAD4 sc-7966
  • ZEB1 sc-515797
  • mouse IgG mouse IgG (mouse IgG (sc) -2025)
  • rabbit IgG #sc-2027
  • ERK1/2 #9102
  • phospho-ERK1/2 #9106
  • phospho-MEK1/2 #9121
  • MYC MYC (#13987) antibodies
  • the rabbit polyclonal anti-GAPDH antibody The rabbit polyclonal anti-GAPDH antibody was provided and used by the Korea Research Institute of Bioscience and Biotechnology.
  • the qRT-PCR analysis was performed using a PCR system (Veriti 96well Thermal Cycler, Applied Biosystems, Waltham, MA, USA), and the qRT-PCR analysis was performed using a QuantStudio 5 real-time PCR system (Applied Biosystems, Foster city, CA). and 20 ⁇ L of cDNA-containing samples, primers, and SYBR Master Mix (Genet Bio, Daejeon, Korea).
  • the sequences of the primers purchasedd from Neoprobe, Daejeon, Korea) for this purpose are shown in Table 1 below.
  • mesenchymal cell-related genes (SMAD4, ZEB1, VIM, SNAI1, SNAI2) were activated by TGF- ⁇ , and some of the epithelial cell-related genes (GRHL2, OVOL1) showed no significant change, but it was confirmed that the expression of CDH1 and EpCAM, which are representative epithelial cells-related genes, decreased. Therefore, it was confirmed that EMT of cancer cells was induced by TGF- ⁇ treatment.
  • Nutlin-3a (5 ⁇ M, Sigma, St. Louis, Mo) was treated with TGF- ⁇ -treated and untreated cancer cells to activate p53. It was confirmed whether the epithelial cell phenotype was restored according to p53 activation, and the results are shown in FIG. 2 . At this time, after inducing EMT of A549 cells under the same conditions as in Example 1-1, Nutlin-3a (1 ⁇ M, Sigma, St. Louis, Mo) was treated, and in the same manner as in Example 1-1 Western blot and qRT-PCR were performed.
  • an EMT molecular regulatory network was constructed to reveal the signaling pathway changed by TGF- ⁇ stimulation, and to find a combination that can restore the epithelial cell phenotype under the given TGF- ⁇ stimulation. 3a.
  • the EMT molecular regulatory network included EMT-related signaling pathways involving TGF- ⁇ and p53.
  • SMAD4 inhibition was derived as a target for restoring the epithelial cell phenotype (activation of E-CAD and inactivation of ZEB1; E-CAD+/ZEB1-) through computer simulation analysis using the EMT molecular regulatory network shown in FIG. 3a.
  • the SMAD4 gene was first deleted in the A549 cell line.
  • a vector Sigma-Aldrich
  • shS4 SEQ ID NO: 1 targeting SMAD4 in HEK 293T cells for Lentivirus production and a packaging mix (pLP1, pLP2 and pLP/VSVG) were used.
  • transfected with Lipofectamin Thermofisher scientific, Waltham, MA for 60 hours according to the manufacturer's instructions.
  • Example 1- Western blot analysis was performed in the same manner as in 1.
  • the epithelial cell phenotype (E-CAD activation and ZEB1 inactivation; E-CAD+/ZEB1) through the combined treatment of p53 activation and SMAD4 inhibitor (shS4) in the TGF- ⁇ treatment group. -) was confirmed by changing the expression of proteins related to the phenotype. Therefore, it was confirmed that the epithelial cell phenotype was restored through the combined treatment of p53 activation and SMAD4 inhibitor. Therefore, it could be expected that drug resistance would also be restored by this phenotypic shift (shScr in FIG. 3b means Scramble shRNA-expressing cells).
  • epithelial cells in ECAD+/ZEB1- state through high activity (Fig. 4a) of epithelial cell-related genes (E-CAD) and low activity of mesenchymal cell-related genes (SNAL1, ZEB1) It was confirmed that the phenotype was recovered.
  • the genes related to stem cell ability MYC, THY1 show low activity.
  • TWIST1 a gene related to mesenchymal cells, was still activated, and EpCAM activity related to stem cell ability was also high.
  • Example 2 Since it was confirmed through Example 2 that the combination control of SMAD4 inhibition and p53 activation was insufficient to improve cancer cell resistance, it was confirmed whether resistance could be improved by further inhibiting the ERK signaling pathway, and in FIGS. 5a to 5b indicated.
  • EMT was induced in A549 cells deficient in the SMAD4 gene in the same manner as in Example 2, treated with Nutlin-3a, and 5 ⁇ M MEK inhibitor (U0126, MEK1/2 inhibitor, APExBIO, Boston, MA, USA) ) was treated.
  • THY1 and MYC which are genes related to stem cell ability
  • TWIST1 a gene related to mesenchymal cells, which still maintained high activity in FIG. 4b, and EpCAM related to stem cell ability. It was confirmed that the expression of 53 was inhibited through three combination treatments: activation of 53 (Nutlin-3a treatment) and inhibition of SMAD4 (shS4) and ERK (shERKs).
  • TGF- ⁇ (5 ng/mL) was treated in A549 cells deficient in SMAD4 and ERK genes in the same manner as in Example 3, Nutlin-3a (1 ⁇ M) was processed.
  • 5-FU (1 ⁇ M), DOX (0.5 ⁇ M), OX (1 ⁇ M) or CPT-11 (1 ⁇ M) were each obtained from Sigma-Aldrich (Saint Louis, MO, USA). treated and cultured for 5 days.
  • Each experimental group consisted of TGF- ⁇ treated and untreated and Nuturin-3a treated and untreated experimental groups. After culturing for 5 days, images were taken using IncuCyte ZOOM (Sartorius, Goettingen, Germany) and cell growth was measured by confluence of adherent living cells using IncuCyte software. indicated.
  • the cells were cultured for 5 days and stained with crystal violet (0.5% (w/v) crystal violet (Sigma-Aldrich)) to measure cell growth, and are shown in FIGS. 6b and 6d. .
  • the present invention demonstrates that the combination of a p53 activator, a SMAD4 inhibitor, and an ERK inhibitor can induce a phenotype with a restored responsiveness to chemotherapeutic agents by eliminating both the heterogeneity and stem cell characteristics acquired by EMT in cancer cells. As confirmed, through this, it is possible to overcome the high variability and drug resistance of cancer cells, and it is possible to suppress the metastatic ability of cancer cells, so it can be usefully used for cancer treatment.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Oncology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 암세포에서 상피-중간엽 이행(EMT)에 의해 획득된 이질성 및 줄기세포의 특성을 제거하여 항암화학요법제에 대한 반응성이 회복된 표현형으로 유도할 수 있는 암전이 억제 및 항암제 감수성 증진용 조성물에 관한 것이다. 본 발명의 p53 활성화제, SMAD4 억제제 및 ERK 억제제의 조합은 중간엽 세포표현형을 상피세포 표현형으로 회복시키는 것뿐만 아니라 암세포의 높은 가변성과 약물 저항성을 극복하여 암세포의 전이 능력을 억제시킬 수 있으므로, 암 치료 분야에서 널리 활용될 수 있다.

Description

암전이 억제 및 항암제 감수성 증진용 조성물
본 발명은 암세포에서 상피간엽이행(epithelial-to-mesenchymal transition, EMT)에 의해 획득된 이질성 및 줄기세포의 특성을 제거하여 항암화학요법제에 대한 반응성이 회복된 표현형으로 유도할 수 있는 암전이 억제 및 항암제 감수성 증진용 조성물에 관한 것이다.
암이란 다양한 원인에 의해 세포의 분열과 사멸 간의 균형이 파괴됨으로써 계속적인 분열과 증식에 의해 발생한 비정상적인 세포의 집단을 의미하며, 종양이라고도 한다. 일반적으로 장기, 백혈구, 뼈, 림프절 등을 포함한 100가지 이상의 신체의 여러 부분에 발병하며, 주변조직으로 침윤하는 현상 및 다른 기관으로 이동하는 전이를 통해 심각한 증상으로 발전한다.
상피간엽이행(epithelial-to-mesenchymal transition, EMT)은 상피세포가 전이 능력과 침윤능력을 가지는 세포로 변환하는 과정이며 이는 척추동물과 무척추동물 모두에서의 태생기에 조직과 기관의 발생을 포함하는 형태학적 발생의 기본적인 현상으로 간주되었지만 과학의 발전과 더불어 성인의 상처 치유 및 암의 생성, 진행과정에 있어서도 EMT가 중요하게 작용함이 입증되었다. EMT에서 가장 초기에 일어나고 가장 중요한 과정은 E-카데린(E-cadherin)에서 N-카데린(N-cadherin)으로 전환하는 카데린 변환이다. E-카데린은 막성 당단백질로 세포외 영역은 인접 세포의 E-카데린 분자와 결합하여 세포 간의 부착을 유지하고, 세포 내 영역은 α-, β- 및 p120 카데린과 결합하여 상피 세포의 극성과 세포골격을 형성한다. E-카데린은 TGF-β(Transforming growth factor beta), 인테그린(Integrin), Wnt, RTK(receptortyrosine kinase), Notch 등 세포증식과 세포소멸에 관여하는 다양한 신호체계에 의해 조절된다. 이중 TGF-β는 SMAD나 PI3K/AKT(phosphatidylinositol 3-kinase/serine-threonine kinase)에 작용하는데 이중 PI3K/AKT는 EMT를 활성화시키는데 중요한 역할을 담당한다고 보고되고 있다.
즉 상피-중간엽 이행(EMT)는 암의 전이와 약물 저항성의 핵심 과정이다. 종양 미세환경에서 분비하는 다양한 신호에 의해 EMT 과정이 촉진된다. 암세포는 EMT 과정을 통해 줄기세포능 성질을 증가시키고 약물에 대한 내성과 암세포 내부의 이질성을 획득한다.
따라서, 암 세포의 전이성을 억제하고 항암제에 대한 저항성을 개선하기 위한 기술은 다양하게 연구되고 있으나, 아직까지 전이성 및 저항성을 나타내는 암세포를 민감성이 증진된 표현형으로 회복시키기 위한 치료제에 관한 연구에 대해서는 많은 노력이 필요한 실정이다.
이에 본 발명의 발명자는 전이성 및 저항성을 나타내는 암세포에서 EMT에 의해 획득된 이질성과 줄기세포 특성을 모두 제거하여 항암화학요법제에 대한 반응성을 증진시키기 위하여 연구하던 중, p53의 활성화 및 SMAD4와 ERK 신호전달경로 억제의 3가지 병용 조합이 반응성이 증진된 표현형으로의 변화를 유도할 수 있음을 확인하여 본 발명을 완성하였다.
따라서 본 발명의 목적은 암 전이 억제용 약학적 조성물을 제공하는 것이다.
또한 본 발명의 다른 목적은 암의 예방 또는 치료를 위한 병용 투여용 약학적 조성물을 제공하는 것이다.
또한 본 발명의 또 다른 목적은 항암제 감수성 증진용 약학적 조성물을 제공하는 것이다.
또한 본 발명의 또 다른 목적은 항암 보조제를 제공하는 것이다.
또한 본 발명의 또 다른 목적은 암의 예방 또는 개선용 식품 조성물을 제공하는 것이다.
또한 본 발명의 또 다른 목적은 암을 치료하는 방법을 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명은 p53 활성화제, SMAD4(Mothers against decapentaplegic homolog 4) 억제제 및 ERK(extracellular signal-regulated kinase) 억제제를 포함하는 암 전이 억제용 약학적 조성물을 제공한다.
상기 다른 목적을 달성하기 위하여, 본 발명은 p53 활성화제, SMAD4(Mothers against decapentaplegic homolog 4) 억제제 및 ERK(extracellular signal-regulated kinase) 억제제를 포함하는 암의 예방 또는 치료를 위한 병용 투여용 약학적 조성물을 제공한다.
상기 또 다른 목적을 달성하기 위하여, 본 발명은 p53 활성화제, SMAD4(Mothers against decapentaplegic homolog 4) 억제제 및 ERK(extracellular signal-regulated kinase) 억제제를 포함하는 항암제 감수성 증진용 약학적 조성물을 제공한다.
상기 또 다른 목적을 달성하기 위하여, 본 발명은 p53 활성화제, SMAD4(Mothers against decapentaplegic homolog 4) 억제제 및 ERK(extracellular signal-regulated kinase) 억제제를 포함하는 항암 보조제를 제공한다.
상기 또 다른 목적을 달성하기 위하여, 본 발명은 p53 활성화제, SMAD4(Mothers against decapentaplegic homolog 4) 억제제 및 ERK(extracellular signal-regulated kinase) 억제제를 포함하는 암의 예방 또는 개선용 식품 조성물을 제공한다.
상기 또 다른 목적을 달성하기 위하여, 본 발명은 p53 활성화제, SMAD4(Mothers against decapentaplegic homolog 4) 억제제 및 ERK(extracellular signal-regulated kinase) 억제제를 개체에 투여하는 단계를 포함하는, 암을 치료하는 방법을 제공한다.
본 발명의 p53 활성화제, SMAD4 억제제 및 ERK 억제제의 조합은 중간엽 세포표현형을 상피세포 표현형으로 회복시키는 것뿐만 아니라 암세포의 높은 가변성과 약물 저항성을 극복하여 암세포의 전이 능력을 억제시킬 수 있으므로, 암 치료 분야에서 널리 활용될 수 있다.
도 1은 TGF-β(Transforming growth factor beta)를 이용해 암세포에 상피간엽이행(Epithelial to Mesenchymal Transition, EMT) 과정을 유도한 결과 및 TGF-β에 의한 중간엽 세포와 관련된 유전자 및 상피 세포와 관련된 단백질과 유전자의 발현 변화를 나타낸 도이다.
도 2는 TGF-β 유무 및 p53의 활성화(Nutlin-3a 처리)에 의한 상피 세포 표현형 변화와 중간엽 세포 및 상피 세포와 관련된 단백질과 유전자의 발현 변화를 나타낸 도이다.
도 3a는 TGF-β 와 p53과 관련된 EMT 관련 신호전달경로를 포함하는 EMT 분자 조절 네트워크를 나타낸 도이다.
도 3b는 TGF-β 처리 또는 미처리 실험군에 있어서, p53의 활성화(Nutlin-3a 처리) 및 SMAD4(shS4) 병용 처리에 따른 표현형 관련 단백질의 발현 변화를 확인한 결과이다.
도 4a는 p53 활성화 및 SMAD4의 발현 억제에 따른 5-플루오로우라실플루오로우라실(5-fluorouracil, 5-FU)와 독소루비신(doxorubicin, DOX)에 대한 반응성을 확인한 결과이다.
도 4b는 p53 활성화 및 SMAD4의 발현 억제에 따른 중간엽 세포, 상피 세포 표현형 및 줄기세포능 관련 유전자의 발현 변화를 확인한 결과이다.
도 5a는 TGF-β 처리 또는 미처리 실험군에 있어서, p53의 활성화(Nutlin-3a 처리) 및 SMAD4(shS4)와 MEK 저해제를 이용한 ERK의 저해의 병용 처리 또는, p53의 활성화(Nutlin-3a 처리), SMAD4(shS4)와 ERK(shERKs)의 저해에 따른 표현형 관련 단백질의 발현 변화를 확인한 결과이다.
도 5b는 p53의 활성화(Nutlin-3a 처리) 및 SMAD4(shS4)와 ERK(shERKs)의 저해의 병용 처리에 따른 중간엽 세포, 상피 세포 표현형 및 줄기세포능 관련 유전자 발현 변화를 확인한 결과이다.
도 6a 및 도 6b는 p53의 활성화((Nutlin-3a(N3a) 처리) 및 SMAD4(shS4)와 ERK(shERKs)의 저해의 병용 처리에 따른 5-FU 및 독소루비신에 대한 반응성 변화를 확인한 결과이다.
도 6c 및 도 6d는 p53의 활성화(Nutlin-3a(N3a) 처리) 및 SMAD4(shS4)와 ERK(shERKs)의 저해의 병용 처리에 따른 옥살리플라틴(Oxaliplatin, OX) 및 이리노테칸(Irinotecan, CPT-11)에 대한 반응성 변화를 확인한 결과이다.
이하, 본 발명에 대해 상세히 설명한다.
본 발명은 p53 활성화제, SMAD4(Mothers against decapentaplegic homolog 4) 억제제 및 ERK(extracellular signal-regulated kinase) 억제제를 포함하는 암 전이 억제용 약학적 조성물을 제공한다.
본 발명의 p53 활성화제, SMAD4 억제제 및 ERK 억제제의 3 가지 병용 처리 처리는 암 세포의 중간엽세포 표현형을 상피세포 표현형으로 회복시키는 것뿐만 아니라 높은 가변성과 약물 저항성을 극복하여 암세포의 전이 능력을 억제시키는 것을 특징으로 한다.
본 발명의 일 실시예에 따르면 암 세포에 있어서, EMT를 유도하는 TGF-β(Transforming growth factor beta)가 주어지지 않은 상황에서는 p53의 활성화만으로 암세포에서 나타난 상피세포 표현형을 회복할 수 있으나, TGF-β로 자극된 암에서는 p53 활성화만으로는 상피세포 표현형 회복이 불가능하며, 상피세포 표현형과 중간엽 세포 표현형 중 어느 것도 아닌 하이브리드 표현형으로 수렴하는 것을 확인하였다.
또한 본 발명의 다른 실시예에 따르면, TGF-β로 자극되어 EMT가 유도된 암에서 상피세포 표현형을 회복하기 위해서는 p53 활성화 및 SMAD4 억제제의 조합이 필요하나, p53 활성화제, SMAD4 억제제 및 ERK 억제제 3가지 조합의 병용처리가 가장 바람직하고, 이들의 병용처리는 줄기세포능과 관련된 유전자들의 발현은 억제하고, 항암제에 대한 감수성을 증진시킬 수 있음을 확인하였다.
따라서 본 발명의 타깃이 되는 암은 상피간엽이행(Epithelial to Mesenchymal Transition, EMT)이 진행된 암인 것이 바람직하며, 보다 바람직하게는 p53을 야생형(wild-type)으로 가지는 암일 수 있고, 보다 더 바람직하게는 p53을 야생형으로 가지는 폐암, 대장암, 췌장암, 간암, 갑상선암 및 유방암으로 이루어진 군에서 선택된 하나 이상일 수 있고, 더욱더 바람직하게는 p53을 야생형으로 가지는 폐암일 수 있으나, 이에 제한되는 것은 아니다. 더불어 본 발명에 있어서, 상기 EMT는 TGF-β를 포함하는 종양미세환경(tumor microenvironment)에 의해 유도될 수 있으나, 이에 제한되는 것은 아니다.
본 발명에 있어서, 상기 p53 활성화제는 이에 제한되는 것은 아니나, 뉴틀린-3a(Nutlin-3a), RO6839921, NSC 146109 하이드로클로라이드(hydrochloride), RITA, 테노빈-1(Tenovin-1), HLI373, WR 0165, 이다사뉴틀린(Idasanutlin) 및 YH 239-EE로 이루어진 군에서 선택된 1종 이상일 수 있다. 바람직하게는 뉴틀린-3a(Nutlin-3a)일 수 있다.
더불어 SMAD4 억제제는 SMAD4의 유전자 또는 단백질, SMAD4의 신호전달 경로를 표적으로 하는 siRNA, shRNA, miRNA, 리보자임, 안티센스 핵산, DNA/RNA 키메라 폴리뉴클레오티드, 화합물, 항체 및 이들을 발현하는 벡터로 이루어진 군으로부터 선택된 1종 이상일 수 있다.
또한 ERK 억제제는 ERK의 유전자 또는 단백질, ERK의 신호전달 경로를 표적으로 하는 siRNA, shRNA, miRNA, 리보자임, 안티센스 핵산, DNA/RNA 키메라 폴리뉴클레오티드, 화합물, 항체 및 이들을 발현하는 벡터로 이루어진 군으로부터 선택된 1종 이상일 수 있다.
본 발명에 있어서 "안티센스 핵산"이란 특정 mRNA의 서열에 상보적인 핵산 서열을 함유하고 있는 DNA 또는 RNA 또는 이들의 유도체를 의미하고, mRNA 내의 상보적인 서열에 결합하여 mRNA의 단백질로의 번역을 저해하는 작용을 한다. 상기 안티센스 서열은 상기 유전자의 mRNA에 상보적이고 상기 mRNA에 결합할 수 있는 DNA 또는 RNA 서열을 의미하며, 상기 mRNA의 번역, 세포질내로의 전위(translocation), 성숙(maturation) 또는 다른 모든 전체적인 생물학적 기능에 대한 필수적인 활성을 저해할 수 있다.
또한, 상기 안티센스 핵산은 효능을 증진시키기 위하여 하나 이상의 염기, 당 또는 골격(backbone)의 위치에서 변형될 수 있다. 핵산 골격은 포스포로티오에이트, 포스포트리에스테르, 메틸 포스포네이트, 단쇄 알킬, 시클로알킬, 단쇄 헤테로아토믹, 헤테로시클릭 당간 결합 등으로 변형될 수 있다. 또한, 안티센스 핵산은 하나 이상의 치환된 당 모이어티(sugar moiety)를 포함할 수 있다. 안티센스 핵산은 변형된 염기를 포함할 수 있다. 변형된 염기에는 하이포크잔틴, 6-메틸아데닌, 5-메틸피리미딘(특히 5-메틸시토신), 5-하이드록시메틸시토신(HMC), 글리코실 HMC, 젠토비오실 HMC, 2-아미노아데닌, 2-티오우라실, 2-티오티민, 5-브로모우라실, 5-하이드록시메틸우라실, 8-아자구아닌, 7-데아자구아닌, N6(6-아미노헥실)아데닌, 2,6-디아미노퓨린 등이 있다. 또한, 상기 안티센스 핵산은 상기 안티센스 핵산의 활성 및 세포 흡착성을 향상시키는 하나 이상의 모이어티(moiety) 또는 컨쥬게이트(conjugate)와 화학적으로 결합될 수 있다. 콜레스테롤 모이어티, 콜레스테릴 모이어티, 콜릭산, 티오에테르, 티오콜레스테롤, 지방성 사슬, 인지질, 폴리아민, 폴리에틸렌 글리콜 사슬, 아다맨탄 아세트산, 팔미틸 모이어티, 옥타데실아민, 헥실아미노카르보닐-옥시콜에스테롤 모이어티 등의 지용성 모이어티 등이 있으며 이에 제한되지 않는다. 상기 안티센스 올리고뉴클레오타이드는 통상의 방법으로 시험관에서 합성되어 생체 내로 투여하거나 생체 내에서 안티센스 올리고뉴클레오타이드가 합성되도록 할 수 있다.
본 발명에서 "siRNA"란 RNA 방해 또는 유전자 사일런싱을 매개할 수 있는 핵산 분자를 의미한다. siRNA는 표적 유전자의 발현을 억제할 수 있기 때문에 효율적인 유전자 넉다운(knockdown) 방법 또는 유전자치료 방법으로 제공된다.
본 발명의 siRNA 분자는, 센스 가닥(본 발명의 일 구현예에 따르면, 타겟 유전자인 SMAD4 또는 ERK 중 선택되는 어느 하나의 유전자의 mRNA 서열에 상응하는 서열)과 안티센스 가닥(상기 mRNA 서열에 상보적인 서열)이 서로 반대쪽에 위치하여 이중쇄를 이루는 구조를 가질 수 있으며, 본 발명의 siRNA 분자는 자기-상보성(self-complementary) 센스 및 안티센스 가닥을 가지는 단일쇄 구조를 가질 수 있다. 나아가 siRNA는 RNA끼리 짝을 이루는 이중사슬 RNA 부분이 완전히 쌍을 이루는 것에 한정되지 않고 미스매치(대응하는 염기가 상보적이지 않음), 벌지(일방의 사슬에 대응하는 염기가 없음) 등에 의하여 쌍을 이루지 않는 부분이 포함될 수 있다. 또한, siRNA 말단 구조는 타겟 유전자의 발현을 RNAi 효과에 의하여 억제할 수 있는 것이면 평활(blunt) 말단 혹은 점착(cohesive) 말단 모두 가능하고, 점착 말단 구조는 3'-말단 돌출 구조와 5'-말단 돌출 구조 모두 가능하다.
본 발명의 "shRNA"란 small hairpin RNA 혹은 short hairpin RNA으로 불리며, RNA 간섭으로 유전자를 침묵시킬 수 있는 용도로 사용되는 것이다. 보통 벡터를 이용하여 목적 세포로 도입한다. 이러한 shRNA 헤어핀 구조는 세포 내 다른 물질에 의하여 절단되어 siRNA가 되기도 한다.
본 발명의 일실시예에 따르면 p53 활성화제로 뉴틀린-3a를 사용하고, SMAD4 억제제로 shS4를 사용하며, ERK 억제제로 shERKs를 사용하여 상기 3종을 TGF-β로 자극된 암에 병용처리하였을 때 상피간엽이행(epithelial-to-mesenchymal transition, EMT)에 의하여 중간엽세포 표현형이었던 암세포가 상피세포 표현형으로 회복되었으며, 항암제에 대한 저항성을 극복하는 것을 확인하였다.
따라서 본 발명에 있어서, 상기 SMAD4 억제제는 서열번호 1로 표시되는 뉴클레오티드인 shRNA인 것이 바람직하고, 상기 ERK 억제제는 U0126, 서열번호 2로 표시되는 뉴클레오티드, 서열번호 3으로 표시되는 뉴클레오티드로 이루어진 군에서 선택된 어느 하나 이상인 것이 바람직하다.
SMAD4 억제제(shS4): TACCATACAGAGAACATTGGA(서열번호 1)
ERKs 억제제(shERK1): CCTGAATTGTATCATCAACAT(서열번호 2)
ERKs 억제제(shERK2): CCATGAGGCAAGAAACTATAT(서열번호 3)
본 발명에 있어서, 상기 p53 활성화제, SMAD4 억제제 및 ERK 억제제는 항암제와 동시 또는 순차적으로 투여될 수 있다.
본 발명에 있어, 항암제는 p53 활성화제, SMAD4 억제제 및 ERK 억제제의 병용 처리에 의해 암 치료 또는 암 전이 억제 효과가 증진될 수 있는 항암제면 당 분야에 알려진 항암제를 제한없이 포함할 수 있으며, 예컨대 5-FU(5-fluorouracil), 독소루비신(Doxorubicin), 옥살리플라틴(Oxaliplatin), 이리노테칸(Irinotecan), 카보플라틴(Carboplatin), 파클리탁셀(Paclitaxel), 젬시타빈(Gemcitabin) 및 보테조밉(Bortezomib)으로 이루어진 군에서 선택된 1종 이상의 항암제일 수 있다.
본 발명에 따른 조성물은 EMT를 억제하여 암의 진행을 억제함으로써 암 세포 사멸을 유도하고 암의 전이를 억제하여 암의 예방 및 치료에 우수한 효과를 가질 수 있으며, EMT 억제작용으로 인한 암세포 이동 및 침투 등 암 전이를 초기 단계부터 억제할 수 있다.
따라서 본 발명은 p53 활성화제, SMAD4(Mothers against decapentaplegic homolog 4) 억제제 및 ERK(extracellular signal-regulated kinase) 억제제를 포함하는 암의 예방 또는 치료를 위한 병용 투여용 약학적 조성물을 제공한다.
더불어 본 발명의 또 다른 일실시예에 따르면, p53 활성화제, SMAD4 억제제 및 ERK 억제제를 TGF-β로 자극된 폐암 세포에 병용처리할 시, 항암제에 대한 반응성이 증가하였다.
따라서 본 발명은 p53 활성화제, SMAD4(Mothers against decapentaplegic homolog 4) 억제제 및 ERK(extracellular signal-regulated kinase) 억제제를 포함하는 항암제 감수성 증진용 약학적 조성물을 제공한다.
본 발명에 따른 항암제 감수성 증진용 약학적 조성물은 상피간엽이행(Epithelial to Mesenchymal Transition, EMT)이 진행된 암을 타깃으로 하는 것을 특징으로 한다.
상기 항암제는 p53 활성화제, SMAD4 억제제 및 ERK 억제제의 병용 처리에 의해 암 치료 또는 암 전이 억제 효과가 증진될 수 있는 항암제면 당 분야에 알려진 항암제를 제한없이 포함할 수 있으며, 예컨대 5-FU(5-fluorouracil), 독소루비신(Doxorubicin), 옥살리플라틴(Oxaliplatin), 이리노테칸(Irinotecan), 카보플라틴(Carboplatin), 파클리탁셀(Paclitaxel), 젬시타빈(Gemcitabin) 및 보테조밉(Bortezomib)으로 이루어진 군에서 선택된 1종 이상의 항암제일 수 있다.
본 발명에 있어서 상기 조성물은 캡슐, 정제, 과립, 주사제, 연고제, 분말 또는 음료 형태임을 특징으로 할 수 있으며, 상기 약학적 조성물은 인간을 대상으로 하는 것을 특징으로 할 수 있다. 상기 약학적 조성물은 이들로 한정되는 것은 아니지만, 각각 통상의 방법에 따라 산제, 과립제, 캡슐, 정제, 수성 현탁액 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다.
본 발명에 따른 약학적 조성물은 약제적으로 허용가능한 담체를 포함할 수 있다. 약제학적으로 허용되는 담체는 경구투여시에는 결합제, 활탁제, 붕해제, 부형제, 가용화제, 분산제, 안정화제, 현탁화제, 색소, 향료 등을 사용할 수 있으며, 주사제의 경우에는 완충제, 보존제, 무통화제, 가용화제, 등장제, 안정화제 등을 혼합하여 사용할 수 있으며, 국소투여용의 경우에는 기제, 부형제, 윤활제, 보존제 등을 사용할 수 있다. 본 발명에 따른 약학적 조성물의 제형은 상술한 바와 같은 약제학적으로 허용되는 담체와 혼합하여 다양하게 제조될 수 있다. 예를 들어, 경구투여 시에는 정제, 트로키, 캡슐, 엘릭서(elixir), 서스펜션, 시럽, 웨이퍼 등의 형태로 제조할 수 있으며, 주사제의 경우에는 단위 투약 앰플 또는 다수회 투약 형태로 제조할 수 있다. 기타, 용액, 현탁액, 정제, 캡슐, 서방형 제제 등으로 제형화할 수 있다.
한편, 제제화에 적합한 담체, 부형제 및 희석제의 예로는, 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말디톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 또는 광물유 등이 사용될 수 있다. 또한, 충진제, 항응집제, 윤활제, 습윤제, 향료, 유화제, 방부제 등을 추가로 포함할 수 있다.
본 발명에 따른 약학적 조성물의 투여 경로는 이들로 한정되는 것은 아니지만 구강, 정맥내, 근육내, 동맥내, 골수내, 경막내, 심장내, 경피, 피하, 복강내, 비강내, 장관, 국소, 설하 또는 직장이 포함된다. 상기 "비경구"는 피하, 피내, 정맥내, 근육내, 관절내, 활액낭내, 흉골내, 경막내, 병소내 및 두개골 내 주사 또는 주입기술을 포함한다. 본 발명에 따른 약학적 조성물은 또한 직장 투여를 위한 좌제의 형태로 투여될 수 있다.
본 발명에 따른 약학적 조성물은 사용된 특정 유효성분의 활성, 연령, 체중, 일반적인 건강, 성별, 정식, 투여시간, 투여경로, 배출률, 약물 배합 및 예방 또는 치료될 특정 질환의 중증을 포함한 여러 요인에 따라 다양하게 변할 수 있고, 상기 약학 조성물의 투여량은 환자의 상태, 체중, 질병의 정도, 약물형태, 투여경로 및 기간에 따라 다르지만 당업자에 의해 적절하게 선택될 수 있다. 바람직하게는 상기 요소를 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여할 수 있으며, 더욱 바람직하게는 1~10000㎍/체중㎏/day, 더욱더 바람직하게는 10~1000㎎/체중㎏/day의 유효용량으로 하루에 수회 반복 투여될 수 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.
또한 본 발명은 p53 활성화제, SMAD4(Mothers against decapentaplegic homolog 4) 억제제 및 ERK(extracellular signal-regulated kinase) 억제제를 포함하는 항암 보조제를 제공한다.
본 발명에 있어서, 상기 “항암 보조제”는 항암제의 항암효과를 개선, 향상 또는 증대시킬 수 있는 제제를 의미한다.
본 발명에 있어서, 상기 항암 보조제는 처리농도에 따라 항암제 또는 항암보조제로서 사용할 수 있으며, 항암제의 감수성을 증진시킬 수 있다.
본 발명에 있어서, 상기 항암 보조제는 암을 예방, 개선 또는 치료하는 효과를 가지는 공지의 화합물과 병용하여 투여될 수 있다.
상기 공지의 화합물은 5-FU(5-fluorouracil), 독소루비신(Doxorubicin), 옥살리플라틴(Oxaliplatin), 이리노테칸(Irinotecan), 카보플라틴(Carboplatin), 파클리탁셀(Paclitaxel), 젬시타빈(Gemcitabin) 및 보테조밉(Bortezomib)으로 이루어진 군에서 선택된 1종 이상의 항암제일 수 있으나, 이에 제한되는 것은 아니다.
또한 본 발명은 p53 활성화제, SMAD4(Mothers against decapentaplegic homolog 4) 억제제 및 ERK(extracellular signal-regulated kinase) 억제제를 포함하는 암의 예방 또는 개선용 식품 조성물을 제공한다.
본 발명에 따른 식품 조성물은 기능성 식품(functional food), 영양 보조제(nutritional supplement), 건강식품(health food), 건강기능식품(health functional food) 및 식품 첨가제(food additives) 등의 모든 형태를 포함한다.
본 발명에 있어서, 용어 "건강기능식품"이란 건강보조의 목적으로 특정성분을 원료로 하거나 식품 원료에 들어있는 특정성분을 추출, 농축, 정제, 혼합 등의 방법으로 제조, 가공한 식품을 말하며, 상기 성분에 의해 생체 방어, 생체리듬의 조절, 질병의 방지와 회복 등 생체조절기능을 생체에 대하여 충분히 발휘할 수 있도록 설계되고 가공된 식품을 말하는 것으로서, 질병의 예방 또는 건강의 회복 등과 관련된 기능을 수행할 수 있는 것을 말한다.
본 발명에 따른 식품 조성물은 당업계에 공지된 통상적인 방법에 따라 다양한 형태로 제조할 수 있다.
예를 들면, 건강식품으로는 본 발명에 따른 p53 활성화제, SMAD4 억제제 및 ERK 억제제 혼합 자체를 과립화, 캡슐화 및 분말화하여 섭취하거나 차, 쥬스 및 드링크의 형태로 제조하여 음용하도록 할 수 있다. 또한, 본 발명의 p53 활성화제, SMAD4 억제제 및 ERK 억제제 혼합을 암 치료 또는 항암제 내성 극복 효과가 알려진 공지의 물질 또는 활성 성분과 함께 혼합하여 조성물의 형태로 제조할 수 있다.
또한, 기능성 식품으로는 음료(알콜성 음료 포함), 과실 및 그의 가공식품(예: 과일통조림, 병조림, 잼, 마멀레이드 등), 어류, 육류 및 그 가공식품(예: 햄, 소시지콘비이프 등), 빵류 및 면류(예: 우동, 메밀국수, 라면,스파게티, 마카로니 등), 과즙, 각종 드링크, 쿠키, 엿, 유제품(예: 버터, 치이즈 등), 식용식물유지, 마아가린, 식물성 단백질, 레토르트 식품, 냉동식품, 각종 조미료(예: 된장, 간장, 소스 등) 등에 본 발명의 SYK 억제제 및 MAPK 신호전달경로 억제제 혼합을 첨가하여 제조할 수 있다.
본 발명의 식품 조성물 중 상기 본 발명의 p53 활성화제, SMAD4 억제제 및 ERK 억제제 혼합의 바람직한 함유량으로는 이에 한정되지 않지만 예를 들어 최종적으로 제조된 식품 중 0.01 내지 80 중량%일 수 있으며, 바람직하게는 최종적으로 제조된 식품 중 0.01 내지 50 중량%일 수 있다.
본 발명의 식품 조성물은 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 상술한 천연 탄수화물은 포도당, 과당과 같은 모노사카라이드, 말토스, 슈크로스와 같은 디사카라이드, 및 덱스트린, 사이클로덱스트린과 같은 천연 감미제나, 사카린, 아스파르탐과 같은 합성 감미제 등을 사용할 수 있다. 상기 천연 탄수화물의 비율은 본 발명의 조성물 100㎖ 당 일반적으로 약 0.01 내지 0.4g, 바람직하게는 약 0.02 내지 0.03g일 수 있다.
상기 외에 본 발명의 식품 조성물은 여러 가지 영양제, 비타민, 전해질, 풍미제, 착색제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산 음료에 사용되는 탄산화제 등을 함유할 수 있다. 그 밖에 본 발명의 식품 조성물은 천연 과일쥬스, 과일쥬스 음료 및 야채 음료의 제조를 위한 과육을 함유할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 본 발명의 조성물 100중량부 당 0.01 내지 0.1 중량부의 범위에서 선택되는 것이 일반적이나, 이에 제한되는 것은 아니다.
또한 본 발명은 p53 활성화제, SMAD4(Mothers against decapentaplegic homolog 4) 억제제 및 ERK(extracellular signal-regulated kinase) 억제제를 개체에 투여하는 단계를 포함하는, 암을 치료하는 방법을 제공한다.
본 발명에서 사용된 용어, "개체"는 암 질환을 가지고 있는 개체로서, 바람직하게는 암 질환을 가지고 있는 인간을 포함한 말, 양, 돼지, 염소, 개 등의 포유동물을 의미하나, 바람직하게는 인간을 의미한다.
본 발명의 암을 치료하는 방법에 있어서, 상기 SMAD4(Mothers against decapentaplegic homolog 4) 억제제 및 ERK(extracellular signal-regulated kinase) 억제제는 항암제와 동시 또는 순차적으로 투여될 수 있다.
본 발명의 내용을 하기 실시예 또는 실험예를 통해 더욱 상세히 설명하기로 한다. 다만, 본 발명의 권리범위가 하기 실시예 및 실험예에만 한정되는 것은 아니고, 그와 등가의 기술적 사상의 변형까지를 포함한다.
실시예 1. TGF-β 자극에 따른 EMT 관련 신호전달경로 확인
1-1. TGF-β 처리에 따른 암세포 EMT 유도
종양 미세환경에서 TGF-β의 활성은 암 성장 및 EMT를 촉진하는 등의 다양한 기능을 수행한다. 암세포에 EMT를 유도하기 위해 외부 자극인 TGF-β를 처리하였으며, 그 결과를 도 1에 나타내었다. 이를 위하여 폐암세포주인 A549 세포(KCBL No. 10185)를 한국세포주은행(KCLB, Korean Cell Line Bank)에서 구입하였다. 상기 A549 세포에 TGF-β(5 ng/mL, Peprotech, Cranbury, NJ, USA)를 48시간 처리하여 EMT를 유도하였다. 암 세포의 단백질 발현 변화는 다음 과정의 웨스턴블롯 분석(western blot analysis)을 통해 확인하였다. 먼저, 세포를 용해 완충액[20 mM HEPES, pH 7.2, 150 mM NaCl, 0.5% 트리톤 X-100(Triton X-100), 10% 글리세롤(glycerol), 단백질분해효소/인산가수분해효소 억제제 혼합(protease/phosphatase inhibitor cocktail (Thermofisher, Waltham, MA)) 포함]을 이용해 용해하였다. 용해물(Lysate)은 13,000 rpm으로 4℃에서 20분간 원심분리하였고, 상층액을 수득해 SDS-PAGE로 분리한 후 웨스턴블랏 분석을 실시하였다. 단백질들의 양을 관찰하기 위해 E-카데린(E-Cadherin (sc-21791)), p53 (sc-126), SMAD4 (sc-7966), ZEB1 (sc-515797), 마우스 IgG(mouse IgG (sc-2025)) 및 래빗 IgG(rabbit IgG (#sc-2027)) 항체들(Santa Cruz Biotechnology (Santa Cruz, CA, USA)에서 구입)을 사용하였다. 더불어 ERK1/2 (#9102), phospho-ERK1/2 (#9106), phospho-MEK1/2 (#9121) 및 MYC (#13987) 항체들(Cell Signaling Technology (Beverly, MA, USA))을 사용하여 단백질 양을 관찰하였다. 또한 래빗-다클론 항-GAPDH 항체(The rabbit polyclonal anti-GAPDH antibody)는 한국생명공학연구원으로부터 제공받아 사용하였다.
도 1 중 A에 나타낸 바와 같이, TGF-β 처리에 의해 E-카데린 단백질 발현이 감소된 바, 세포의 표현형이 달라졌음을 확인하였다.
더불어 qRT-PCR을 수행하여 모든 유전자에 대한 전사(Transcript) 분석을 수행하였다(n=3, mean ± SD). 상기 qRT-PCR 분석은 PCR 시스템(Veriti 96well Thermal Cycler, Applied Biosystems, Waltham, MA, USA)을 사용하여 수행하였으며, qRT-PCR 분석은 QuantStudio 5 real-time PCR system(Applied Biosystems, Foster city, CA)과 20 μL의 cDNA를 포함하는 시료, 프라이머(primers) 및 SYBR Master Mix (Genet Bio, Daejeon, Korea)을 사용하여 수행하였다. 이를 위한 프라이머(Neoprobe, Daejeon, Korea에서 구입)의 서열은 하기 표 1에 나타내었다.
타겟(Target) 정방향(Forward (5'→ 3')) 서열번호 역방향(Reverse (5'→ 3')) 서열번호
SMAD4 CAGCCTCCCATTTCCAATCATCC 4 GATCTCCTCCAGAAGGGTCCAC 5
GRHL2 GTGCCTTAGGCCTGTTGGAT 6 TTCTCTTGAAGGGGGAACGC 7
OVOL2 CATGCCCAAAGTCTTCCTGGTG 8 ACTGGGATGTAGGTGTCTGCC 9
NCAD GTCAGCTGTCGGTGACAAAGC 10 GATCAAGTCCAGCTGCCACTGTGA 11
FN1 CTTCTGGTCAGCAACCCAGT 12 ACCGTGTGGGTACAGGTGAT 13
ZEB1 AGCAGTGAAAGAGAAGGGAATG 14 TGACAGCAGTGTCTTGTTGTTG 15
MYC GTCAAGAGGCGAACACACAAC 16 TTGGACGGACAGGATGTATGC 17
ECAD GAAGATTGCACCGGTCGACAAAGGACA 18 GCAGCTGATGGGAGGAATAACCCAGTC 19
TWIST TCGGACAAGCTGAGCAAGATT 20 GCAGCTTGCCATCTTGGAGT 21
SNAI1 GCTGCTACAAGGCCATGT 22 CGGACTCTTGGTGCTTGT 23
CD90 GAAGGTCCTCTACTTATCCGCC 24 TGATGCCCTCACACTTGACCAG 25
VIM CCAGGCAAAGCAGGAGTC 26 CGAAGGTGACGAGCCATT 27
b-Actin AGAGCTACGAGCTGCCTGAC 28 AGCACTGTGTTGGCGTACAG 29
GAPDH TGATGACATCAAGAAGGTGGTGAAG 30 TCCTTGGAGGCCATGTGGGCCAT 31
그 결과, 도 1 중 B에 나타낸 바와 같이, TGF-β에 의해 중간엽 세포와 관련된 유전자들(SMAD4, ZEB1, VIM, SNAI1, SNAI2)은 활성화되었으며, 상피 세포와 관련된 유전자들 중 일부(GRHL2, OVOL1)는 큰 변화를 보이지 않았으나 대표적인 상피 세포와 관련된 유전자인 CDH1과 EpCAM 발현이 감소함을 확인하였다. 따라서 TGF-β 처리에 의하여 암세포의 EMT가 유도되었음을 확인하였다.
1-2. p53 활성화에 의한 상피세포 표현형 회복 여부 확인 및 EMT 분자 조절 네트워크 구축
뉴트린-3a(Nutlin-3a)(5 μM, Sigma, St. Louis, Mo)를 TGF-β를 처리한 암세포 및 미처리된 암세포에 처리하여 p53을 활성화시켰다. p53 활성화에 따라 상피 세포 표현형이 회복되는지 여부를 확인하여 그 결과를 도 2에 나타내었다. 이때 상기 실시예 1-1과 동일한 조건으로 A549 세포의 EMT를 유도한 후, 뉴트린-3a(1 μM, Sigma, St. Louis, Mo)를 처리하였고, 상기 실시예 1-1과 동일한 방법으로 웨스턴블롯 및 qRT-PCR을 수행하였다.
도 2 중 A.에 나타낸 바와 같이, TGF-β 미처리 실험군에서는 p53의 활성화(Nutlin-3a 처리)만으로 상피세포 표현형(E-CAD의 활성화와 ZEB1의 불활성화; E-CAD+/ZEB1-)을 회복할 수 있지만 TGF-β를 처리한 실험군(TGF-β 유지한 상태)에서 p53을 활성화시켰을 때는 E-CAD의 불활성화와 ZEB1의 불활성화; E-CAD-/ZEB1-표현형으로 수렴됨을 단백질 발현 변화를 통해 확인하였다.
더불어 도 2 중 B.에 나타낸 바와 같이, TGF-β를 처리한 실험군에서 p53을 활성화시키지 않은 경우에는 중간엽 세포와 관련된 유전자들(ZEB1, SNAI1, TWIST1)은 활성화되었지만, p53을 활성화시킨 경우 ZEB1은 현저하게 활성이 억제됨을 확인하였다. SNAI1의 경우 TGF-β를 처리한 실험군과 비교했을 때는 활성이 억제되었으나 TGF-β를 처리하지 않은 실험군과 비교했을 때는 그 활성이 여전히 높음을 확인하였다. TWIST1의 경우 어떤 실험군에서도 p53을 활성화에 의한 TWIST1 활성도 변화가 거의 없음을 확인하였다. 또한 TGF-β를 처리한 실험군에서 p53을 활성화시킨 경우, 상피 세포와 관련된 유전자들(CDH1, EpCAM)이 오히려 감소하거나 여전히 낮은 활성을 보이는 것을 확인하였다.
상기를 통해 TGF-β를 유지한 상태에서는 p53 활성화만으로 상피세포 표현형으로의 회복이 불가능함을 확인하였다.
따라서 이를 반영하여 TGF-β 자극에 의해 변화한 신호전달 경로를 밝히고, TGF-β 자극이 주어진 상황에서 상피세포 표현형을 회복할 수 있는 조합을 찾기 위하여 EMT 분자 조절 네트워크를 구축하였으며, 그 결과를 도 3a에 나타내었다.
도 3a에 나타낸 바와 같이, EMT 분자 조절 네트워크는 TGF-β 와 p53이 관련된 EMT 관련 신호전달경로를 포함하였다.
실시예 2. SMAD4 및 p53 활성화 병용 조절에 의한 저항성 개선 여부 확인
도 3a에 나타낸 EMT 분자 조절 네트워크를 활용한 컴퓨터 시뮬레이션 분석을 통해 상피세포 표현형(E-CAD의 활성화와 ZEB1의 불활성화; E-CAD+/ZEB1-)을 회복하기 위한 타겟으로 SMAD4 저해를 도출하였다.
이를 위하여 먼저 A549 세포주에서 SMAD4 유전자를 결실시켰다. 렌티바이러스(Lentivirus) 생산을 위하여 HEK 293T 세포에 SMAD4를 타깃하는 shRNA(shS4, 서열번호 1)를 인코딩하는 벡터(Sigma-Aldrich) 및 패키징 믹스(pacageing mix:pLP1, pLP2 및 pLP/VSVG)를 이용하여 리포펙타민(Lipofectamin (Thermofisher scientific, Waltham, MA)를 통해 제조사의 지침에 따라 60시간동안 형질주입하였다. 그후 원심분리하여 상등액을 수득하고, 0.22-μm 필터(surfactant-free cellulose acetate, Sartorius, Goettingen, Germany)를 이용하여 여과하였다. 이에 4 μg/ml 폴리브렌(polybrene (Sigma-Aldrich))을 처리한 후, A549 세포에 감염시켰다. 감염된 세포는 퓨로마이신(puromycin (1 mg/ml), (Sigma-Aldrich))을 이용해 선별했다.
상기와 같이 SMAD4 유전자가 결실된 A549 세포를 60 mm 디쉬에 씨딩(seeding)하고 24시간 후에 상기 실시예 1-2과 동일한 방법으로 EMT 유도 및 뉴트린-3a를 처리한 후, 상기 실시예 1-1과 동일한 방법으로 웨스턴블롯 분석을 수행하였다.
그 결과, 도 3b에 나타낸 바와 같이, TGF-β 처리 실험군에서 p53의 활성화와 SMAD4억제제(shS4)의 병용 처리를 통해 상피세포 표현형(E-CAD의 활성화와 ZEB1의 불활성화; E-CAD+/ZEB1-)을 회복되는 것을 표현형과 관련된 단백질들의 발현 변화를 통해 확인하였다. 따라서 이를 통해 p53의 활성화와 SMAD4 억제제의 병용 처리를 통해 상피세포 표현형이 회복되는 것을 확인하였다. 그러므로 이러한 표현형 천이에 의해 약물 저항성 또한 회복되기를 기대할 수 있었다(도 3b 중 shScr은 Scramble shRNA 발현 세포를 의미함).
더불어 세포 생존률을 측정하기 위하여 상기와 같이 SMAD4 유전자를 결손시킨 A549 세포를 96 웰 플레이트에 씨딩하고 24시간 후, EMT를 유도하고 뉴트린-3a (1 μM)를 처리한 후, 항암제인 5-FU (1 μM) 또는 DOX (0.5 μM)를 5일 동안 처리하였다. 5일 경과 후, IncuCyte ZOOM (Sartorius, Gottingen, Germany)을 이용해 세포의 이미지를 찍고 세포의 생존을 IncuCyte software을 이용한 부착 생존 세포(adherent living cells)의 컨플루언스(confluence)로 측정하여 도 4a에 나타내었다. 더불어 상기 실시예 1-1과 동일한 방법의 qRT-PCR로 확인하여 도 4b에 나타내었다(n = 3, mean ±SD).
도 4a에 나타낸 바와 같이, 뉴틀린-3a 처리에 따른 p53의 활성화와 SMAD4억제제(shS4)의 병용 처리에도 항암화학요법인 5-플루오로우라실플루오로우라실(5-fluorouracil, 5-FU)와 독소루비신(doxorubicin, DOX)을 처리했을 때, 세포의 사멸이 일어나지 않음을 확인하였으며, 이를 통해 p53의 활성화와 SMAD4 억제제의 병용 처리로 상피세포 표현형은 회복되었으나 약물 저항성이 완전히 개선되지 않음을 확인하였다.
더불어 도 4b와 같이, 상피 세포와 관련된 유전자들(E-CAD)의 높은 활성(도 4a)과 중간엽 세포와 관련된 유전자들(SNAL1, ZEB1)의 낮은 활성을 통해 ECAD+/ZEB1- 상태인 상피세포 표현형은 회복한 것을 확인하였다. 또한, 줄기세포능과 관련된 유전자유전자(MYC, THY1)는 낮은 활성을 보인다는 것을 확인하였다. 하지만 여전히 중간엽 세포와 관련된 유전자인 TWIST1이 활성화되어 있고, 줄기세포능과 관련되어 있는 EpCAM의 활성 또한 높은 것을 확인하였다.
실시예 3. p53의 활성화, SMAD4 및 ERK 억제에 따른 저항성 개선 여부 확인
상기 실시예 2를 통해 SMAD4 억제 및 p53 활성화 병용 조절이 암세포 저항성을 개선하기에 불충분함을 확인하였으므로, 추가적으로 ERK 신호전달 경로를 저해하여 저항성을 개선할 수 있는지 여부를 확인하여 도 5a 내지 도 5b에 나타내었다.
이를 위하여 상기 실시예 2와 동일한 방법으로 SMAD4 유전자를 결손시킨 A549 세포에 EMT를 유도하고 뉴트린-3a를 처리하였고 이에 5μM 농도의 MEK 저해제(U0126, MEK1/2 inhibitor, APExBIO, Boston, MA, USA)를 처리하였다.
또는 상기 실시예 2와 동일한 방법으로 SMAD4 유전자를 결손시킨 A549 세포에 서열번호 2(shERK1) 및 서열번호 3(shERK2)의 shRNA를 처리하여 ERK 유전자를 결손시켰다. 그 후 결과를 웨스턴 블롯 분석 또는 qRT-PCR로 확인하였다(n = 3, mean ±SD).
상기 ERK 유전자 결손을 위하여 상기 실시예 2와 동일한 방법으로 수행하였고, 이때 SMAD4를 타깃하는 shRNA를 인코딩하는 벡터 대신 ERK1을 타깃하는 shRNA (shERK1, 서열번호 2) 및 ERK2를 타깃하는 shRNA (shERK2, 서열번호 3)를 인코딩하는 벡터(Sigma-Aldrich)를 사용하였다.
도 5a 중 A.에 나타낸 바와 같이, TGF-β를 지속적으로 처리한 실험군에서 p53의 활성화, SMAD4억제와 MEK 저해제(U0126)을 통한 ERKs저해를 병용 처리하였을 때, 상피세포 표현형(E-CAD의 활성화와 ZEB1의 불활성화; E-CAD+/ZEB1-)을 회복되는 것을 표현형과 관련된 단백질들의 발현 변화를 통해 확인하였다.
더불어 도 5a 중 B.와 같이, TGF-β가 지속적으로 존재하더라도 p53의 활성화 및 SMAD4(shS4)와 ERK(shERKs)의 저해의 세가지 병용 처리는 세포를 E-CAD+/ZEB1-의 표현형으로 회복시켰고 경향성 또한 도 5a 중 A.와 유사함을 확인하였다.
또한 도 5b에 나타낸 바와 같이, 줄기세포능과 관련된 유전자인 THY1, MYC의 발현은 여전히 억제되었으며, 앞서 도 4b에서는 여전히 높은 활성을 유지했던 중간엽 세포와 관련된 유전자인 TWIST1와 줄기세포능과 관련된 EpCAM의 발현이 53의 활성화(Nutlin-3a 처리) 및 SMAD4(shS4)와 ERK(shERKs)의 저해의 세가지 병용 처리를 통해 억제되었음을 확인하였다.
실시예 4. p53의 활성화, SMAD4 및 ERK 억제에 따른 저항성 개선 여부 확인
병용 처리에 따른 저항성 개선 여부를 확인하기 위하여 상기 실시예 3과 동일한 방법으로 SMAD4 및 ERK 유전자를 결손시킨 A549세포에 TGF-β (5 ng/mL)를 처리하였고, 뉴트린-3a (1 μM)를 처리하였다. 더불어 Sigma-Aldrich (Saint Louis, MO, USA)에서 구입한 5-FU (1 μM), DOX (0.5 μM), OX (1 μM) 또는 CPT-11 (1 μM)를 각각 처리하여 5일 동안 배양하였다. 각 실험군은 TGF-β 처리 및 미처리와 뉴투린-3a 처리 및 미처리 실험군으로 구성하였다. 5일 배양 후, IncuCyte ZOOM (Sartorius, Goettingen, Germany)을 이용해 이미지를 찍고 세포 성장을 IncuCyte software을 이용한 부착 생존 세포(adherent living cells)의 컨플루언스(confluence)로 측정하여 도 6a 및 도 6c에 나타내었다.
또한 세포에 각 약물을 병용 처리한 후, 5일동안 배양하고 크리스탈 바이올렛(0.5% (w/v) crystal violet (Sigma-Aldrich))으로 염색하여 세포 성장을 측정하여 도 6b 및 도 6d에 나타내었다.
그 결과, p53의 활성화와 SMAD4억제제(shS4)의 병용 처리에 의해서는 항암제에 대한 반응성이 변화하지 않았으나 p53의 활성화(Nutlin-3a(N3a) 처리) 및 SMAD4(shS4)와 ERK(shERKs)의 억제제의 병용 처리에 의해, 상기 4 종 항암제에 대한 반응성이 모두 증가한 것을 확인하였다. 더불어 p53의 활성화(Nutlin-3a(N3a) 처리) 및 SMAD4(shS4)와 ERK(shERKs)의 억제제의 병용 처리에 의해 세포가 유의미하게 사멸되는 것을 확인하였다(도 6b 및 도 6d 중 가장 마지막 줄 참고).
이를 통해 p53의 활성화 및 SMAD4와 ERK 신호전달경로 저해의 3가지 병용 조합이 암 세포의 전이 능력 획득을 사전에 차단하고 항암제에 대한 저항성을 극복할 수 있음을 확인하였다.
종합적으로 본 발명은 p53 활성화제, SMAD4 억제제 및 ERK 억제제의 조합이 암세포에서 EMT에 의해 획득된 이질성과 줄기세포 특성을 모두 제거하여 항암화학요법제에 대한 반응성이 회복된 표현형으로 유도할 수 있음을 확인한 것으로, 이를 통해 암 세포의 높은 가변성과 약물 저항성을 극복할 수 있으며, 암 세포의 전이 능력을 억제시킬 수 있으므로, 암 치료를 위하여 유용하게 활용할 수 있다.

Claims (19)

  1. p53 활성화제, SMAD4(Mothers against decapentaplegic homolog 4) 억제제 및 ERK(extracellular signal-regulated kinase) 억제제를 포함하는 암 전이 억제용 약학적 조성물.
  2. 제 1항에 있어서,
    상기 암은 상피간엽이행(Epithelial to Mesenchymal Transition, EMT)이 진행된 암인, 암 전이 억제용 약학적 조성물.
  3. 제 2항에 있어서,
    상기 암은 p53을 야생형(wild-type)으로 가지는 암인 것을 특징으로 하는, 암 전이 억제용 약학적 조성물.
  4. 제 3항에 있어서,
    상기 암은 폐암, 대장암, 췌장암, 간암, 갑상선암 및 유방암으로 이루어진 군에서 선택된 하나 이상인 것을 특징으로 하는, 암 전이 억제용 약학적 조성물.
  5. 제 1항에 있어서,
    상기 p53 활성화제는 뉴틀린-3a(Nutlin-3a), RO6839921, NSC 146109 하이드로클로라이드(hydrochloride), RITA, 테노빈-1(Tenovin-1), HLI373, WR 0165, 이다사뉴틀린(Idasanutlin) 및 YH 239-EE로 이루어진 군에서 선택된 1종 이상인 것을 특징으로 하는, 암 전이 억제용 약학적 조성물.
  6. 제 1항에 있어서,
    상기 SMAD4 억제제는 siRNA, shRNA, miRNA, 리보자임, 안티센스 핵산, DNA/RNA 키메라 폴리뉴클레오티드, 화합물, 항체 및 이들을 발현하는 벡터로 이루어진 군으로부터 선택된 1종 이상인, 암 전이 억제용 약학적 조성물.
  7. 제 6항에 있어서,
    상기 SMAD4 억제제는 서열번호 1로 표시되는 뉴클레오티드인 shRNA인 것을 특징으로 하는, 암 전이 억제용 약학적 조성물.
  8. 제 1항에 있어서,
    상기 ERK 억제제는 siRNA, shRNA, miRNA, 리보자임, 안티센스 핵산, DNA/RNA 키메라 폴리뉴클레오티드, 화합물, 항체 및 이들을 발현하는 벡터로 이루어진 군으로부터 선택된 1종 이상인, 암 전이 억제용 약학적 조성물.
  9. 제 8항에 있어서,
    상기 ERK 억제제는 U0126, 서열번호 2로 표시되는 뉴클레오티드, 서열번호 3으로 표시되는 뉴클레오티드로 이루어진 군에서 선택된 어느 하나 이상인 것을 특징으로 하는, 암 전이 억제용 약학적 조성물.
  10. 제 1항에 있어서,
    상기 p53 활성화제, SMAD4 억제제 및 ERK 억제제는 암세포의 상피간엽이행(epithelial-to-mesenchymal transition, EMT)에 의한 중간엽 세포표현형을 상피세포 표현형으로 회복시키는 것을 특징으로 하는, 암 전이 억제용 약학적 조성물.
  11. 제 1항에 있어서,
    상기 p53 활성화제, SMAD4 억제제 및 ERK 억제제는 항암제와 동시 또는 순차적으로 투여되는 것을 특징으로 하는, 암 전이 억제용 약학적 조성물.
  12. 제 11항에 있어서,
    상기 항암제는 5-FU(5-fluorouracil), 독소루비신(Doxorubicin), 옥살리플라틴(Oxaliplatin), 이리노테칸(Irinotecan), 카보플라틴(Carboplatin), 파클리탁셀(Paclitaxel), 젬시타빈(Gemcitabin) 및 보테조밉(Bortezomib)으로 이루어진 군에서 선택된 1종 이상인 것을 특징으로 하는, 암 전이 억제용 약학적 조성물.
  13. p53 활성화제, SMAD4(Mothers against decapentaplegic homolog 4) 억제제 및 ERK(extracellular signal-regulated kinase) 억제제를 포함하는 암의 예방 또는 치료를 위한 병용 투여용 약학적 조성물.
  14. p53 활성화제, SMAD4(Mothers against decapentaplegic homolog 4) 억제제 및 ERK(extracellular signal-regulated kinase) 억제제를 포함하는 항암제 감수성 증진용 약학적 조성물.
  15. 제 14항에 있어서,
    상피간엽이행(Epithelial to Mesenchymal Transition, EMT)이 진행된 암을 타깃으로 하는, 항암제 감수성 증진용 약학적 조성물.
  16. 제 14항에 있어서,
    상기 항암제는 5-FU(5-fluorouracil), 독소루비신(Doxorubicin), 옥살리플라틴(Oxaliplatin), 이리노테칸(Irinotecan), 카보플라틴(Carboplatin), 파클리탁셀(Paclitaxel), 젬시타빈(Gemcitabin) 및 보테조밉(Bortezomib)으로 이루어진 군에서 선택된 1종 이상인 것을 특징으로 하는, 항암제 감수성 증진용 약학적 조성물.
  17. p53 활성화제, SMAD4(Mothers against decapentaplegic homolog 4) 억제제 및 ERK(extracellular signal-regulated kinase) 억제제를 포함하는 항암 보조제.
  18. p53 활성화제, SMAD4(Mothers against decapentaplegic homolog 4) 억제제 및 ERK(extracellular signal-regulated kinase) 억제제를 포함하는 암의 예방 또는 개선용 식품 조성물.
  19. p53 활성화제, SMAD4(Mothers against decapentaplegic homolog 4) 억제제 및 ERK(extracellular signal-regulated kinase) 억제제를 개체에 투여하는 단계를 포함하는, 암을 치료하는 방법.
PCT/KR2021/020161 2020-12-30 2021-12-29 암전이 억제 및 항암제 감수성 증진용 조성물 WO2022146025A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP21915823.5A EP4272739A1 (en) 2020-12-30 2021-12-29 Composition for inhibiting metastasis and enhancing anticancer drug sensitivity

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2020-0187110 2020-12-30
KR20200187110 2020-12-30

Publications (1)

Publication Number Publication Date
WO2022146025A1 true WO2022146025A1 (ko) 2022-07-07

Family

ID=82260722

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/020161 WO2022146025A1 (ko) 2020-12-30 2021-12-29 암전이 억제 및 항암제 감수성 증진용 조성물

Country Status (3)

Country Link
EP (1) EP4272739A1 (ko)
KR (1) KR20220097306A (ko)
WO (1) WO2022146025A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024026505A3 (en) * 2022-07-29 2024-04-25 Amit Patel Disruption of telocyte activity

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20240072366A (ko) * 2022-11-15 2024-05-24 제주대학교 산학협력단 펜타데칸산을 유효성분으로 포함하는 항암 보조제 및 이의 용도

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20090027241A (ko) * 2006-07-10 2009-03-16 바이오겐 아이덱 엠에이 인코포레이티드 Ｓｍａｄ４-결핍 암의 성장을 억제하기 위한 조성물 및 방법

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20090027241A (ko) * 2006-07-10 2009-03-16 바이오겐 아이덱 엠에이 인코포레이티드 Ｓｍａｄ４-결핍 암의 성장을 억제하기 위한 조성물 및 방법

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
AI XI, WU YANHUI, ZHANG WEI, ZHANG ZHANGUO, JIN GUANNAN, ZHAO JIANPING, YU JINGJING, LIN YOUZHI, ZHANG WANGUANG, LIANG HUIFANG, DA: "Targeting the ERK pathway reduces liver metastasis of Smad4-inactivated colorectal cancer", CANCER BIOLOGY & THERAPY, vol. 14, no. 11, 1 November 2013 (2013-11-01), US , pages 1059 - 1067, XP055947667, ISSN: 1538-4047, DOI: 10.4161/cbt.26427 *
KANG YIBIN, HE WEI, TULLEY SHAUN, GUPTA GAORAV P., SERGANOVA INNA, CHEN CHANG-RUNG, MANOVA-TODOROVA KATIA, BLASBERG RONALD, GERALD: "Breast cancer bone metastasis mediated by the Smad tumor suppressor pathway", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 102, no. 39, 27 September 2005 (2005-09-27), pages 13909 - 13914, XP055947661, ISSN: 0027-8424, DOI: 10.1073/pnas.0506517102 *
LILIANA RAIMUNDO; MARGARIDA ESPADINHA; JOANA SOARES; JOANA B LOUREIRO; MARCO G ALVES; MARIA M M SANTOS; LUCÍLIA SARAIVA: "Improving anticancer activity towards colon cancer cells with a new p53-activating agent", BRITISH JOURNAL OF PHARMACOLOGY, vol. 175, no. 20, 6 September 2018 (2018-09-06), UK , pages 3947 - 3962, XP071097476, ISSN: 0007-1188, DOI: 10.1111/bph.14468 *
LU YINLIANG, LIU BAOCAI, LIU YING, YU XINYUE, CHENG GUANGHUI: "Dual effects of active ERK in cancer: A potential target for enhancing radiosensitivity (Review)", ONCOLOGY LETTERS, vol. 20, no. 2, 1 August 2020 (2020-08-01), GR , pages 993 - 1000, XP055947663, ISSN: 1792-1074, DOI: 10.3892/ol.2020.11684 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024026505A3 (en) * 2022-07-29 2024-04-25 Amit Patel Disruption of telocyte activity

Also Published As

Publication number Publication date
EP4272739A1 (en) 2023-11-08
KR20220097306A (ko) 2022-07-07

Similar Documents

Publication Publication Date Title
WO2022146025A1 (ko) 암전이 억제 및 항암제 감수성 증진용 조성물
AU2015254309B2 (en) Muscle atrophy inhibitor containing quercetin glycoside
US10857119B2 (en) Composition containing monoacetyldiacylglycerol compound as active ingredient for inhibiting blood cancer or metastasis
Gao et al. Brazilin plays an anti-inflammatory role with regulating Toll-like receptor 2 and TLR 2 downstream pathways in Staphylococcus aureus-induced mastitis in mice
EP2124968A1 (en) Compositions and methods for the treatment of muscle wasting
WO2010062143A2 (ko) Ｌ１ｃａｍ의 활성 또는 발현을 억제하는 물질 및 항암제를 포함하는 항암용 조성물
US20220023359A1 (en) Identification of gut bacteria that promote an anti-tumor response to immunotherapy
WO2018043989A1 (ko) 아피제닌, 커큐민 및 호노키올을 유효성분으로 포함하는 폐암의 예방 또는 치료용 약학적 조성물
KR101780900B1 (ko) 옥시레스베라트롤을 포함하는 장질환을 예방 또는 치료하기 위한 조성물
KR102352127B1 (ko) Mitf 억제제를 유효성분으로 함유하는 골수-유래 억제세포 저해용 조성물
WO2023121404A1 (ko) Taf10 억제제를 포함하는 대장암 예방 또는 치료용 조성물
WO2013165061A1 (ko) Ｓｃｆ 또는 이의 수용체를 억제하는 물질을 포함하는 혈관 투과성 관련 질환의 치료 또는 예방용 조성물
KR20220058365A (ko) 비피도박테리움 비피덤 kctc3357의 신규 용도
CN111304327B (zh) 人grpel2基因的用途及相关产品
CN115068610B (zh) 抑制乳腺癌细胞中muc1表达的物质在降低抗乳腺癌药物耐药性中的应用
WO2023113129A1 (ko) Surf4 억제제를 포함하는 혈액암의 예방 또는 치료용 약학적 조성물
TWI847370B (zh) 用以預防或治療癌症或發炎的包含新穎腸膜明串珠菌菌株之組成物及使用其預防或治療癌症或發炎的方法
WO2024005289A1 (ko) 테노포비르 알라페나미드를 포함하는 비알콜성 지방간염 예방, 개선 또는 치료용 조성물
WO2024167277A1 (ko) 락토바실러스 플란타룸 균주 및 면역세포의 병용 요법을 이용한 암 예방 또는 치료용 조성물
WO2022103128A1 (ko) GRO-α를 발현하는 줄기세포 또는 GRO-α를 포함하는 근육 질환의 예방 또는 치료용 조성물
WO2023277571A1 (ko) 바이러스 및 박테리아의 중복 감염 치료용 조성물
WO2020222349A1 (ko) 말초신경계 퇴행성 질환의 예방 또는 치료용 약학적 조성물 및 건강기능식품
KR20220045852A (ko) miR-146a, miR-548e 또는 이들의 혼합물을 포함하는 영양막 세포 내 염증 완화용 조성물
KR101620999B1 (ko) Tet2의 억제를 이용한 지방세포 분화 억제용 조성물 및 이의 이용
KR101618806B1 (ko) Tet1의 억제를 이용한 지방세포 분화 억제용 조성물 및 이의 이용

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21915823

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021915823

Country of ref document: EP

Effective date: 20230731