WO2023182846A1 - 암의 약제 내성을 극복하기 위한 thbs1 저해제의 용도 - Google Patents

암의 약제 내성을 극복하기 위한 thbs1 저해제의 용도 Download PDF

Info

Publication number
WO2023182846A1
WO2023182846A1 PCT/KR2023/003905 KR2023003905W WO2023182846A1 WO 2023182846 A1 WO2023182846 A1 WO 2023182846A1 KR 2023003905 W KR2023003905 W KR 2023003905W WO 2023182846 A1 WO2023182846 A1 WO 2023182846A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
thbs1
inhibitor
anticancer
drug
Prior art date
Application number
PCT/KR2023/003905
Other languages
English (en)
French (fr)
Inventor
조광현
이수민
한영현
Original Assignee
한국과학기술원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국과학기술원 filed Critical 한국과학기술원
Publication of WO2023182846A1 publication Critical patent/WO2023182846A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/439—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom the ring forming part of a bridged ring system, e.g. quinuclidine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5011—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/308—Foods, ingredients or supplements having a functional effect on health having an effect on cancer prevention
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis

Definitions

  • the present invention relates to the use of THBS1 as a novel combination drug target that can overcome drug resistance of targeted anticancer drugs.
  • Cancer is a representative prevalent and incurable disease and is becoming a major socioeconomic problem. According to the 'Draft Cancer Prevention and Control Plan' published by the International Agency for Research on Cancer (IARC) under the World Health Organization (WHO) in 2017, the number of cancer patients worldwide has increased significantly, and the number of annual cancer cases in 2030 will be about 54% compared to 2012. It is estimated that the number will increase to close to 22 million, and in 2010 alone, the cost spent worldwide for cancer diagnosis and treatment was close to KRW 1,315 trillion.
  • IARC International Agency for Research on Cancer
  • WHO World Health Organization
  • targeted anticancer drugs are being developed to treat cancer. Because targeted anticancer drugs attack specific targets expressed only in cancer cells, they can dramatically increase treatment effectiveness while reducing side effects. However, despite great expectations, targeted anticancer drugs have limited effectiveness in clinical trials due to cancer resistance to the drugs. In particular, due to the complex dynamics of signaling networks with intertwined feedback regulatory relationships, cancers have adaptive resistance that can adapt to and offset the perturbation effects caused by drugs. Such drug resistance fundamentally inhibits the efficacy of targeted therapy. In this way, a network approach is needed to reveal the principles of drug resistance in cancer cells, in which various signaling networks are comprehensively involved, and to identify biomarkers for resistant patient groups and discover parallel treatment targets to overcome resistance.
  • targeted anticancer drugs are administered alone or together with chemotherapy to treat cancer, but treatment is more difficult for patients who are resistant to targeted anticancer drugs. Therefore, it is necessary to discover target genes that play a major role in overcoming anticancer drug resistance and identify the mechanisms of resistance development related to them.
  • p53 mutations are the most common in lung cancer, and when these p53 mutations exist, the prognosis is known to be worse.
  • Targeted anticancer drugs such as PRIMA-1MET (APR-246), show high therapeutic potential as anticancer drugs by reactivating p53 when a p53 mutation exists, but resistance is often still observed even after treatment with this drug.
  • the function of the p53 gene can be restored, it can be an effective and promising cancer treatment strategy, which can realize personalized medicine and improve patient survival rate and quality of life due to unnecessary anticancer drug treatment through targeted treatment.
  • the present inventors have made intensive research efforts to discover combination drug targets that can achieve excellent therapeutic activity against cancer and overcome the therapeutic limitations of targeted anticancer drugs.
  • the present inventors identified the THBS1 gene as a combination target that can increase the drug responsiveness of cancers resistant to p53-activating drugs due to loss-of-function mutations that occurred in the p53 gene, a tumor suppressor gene, and developed drug resistance to targeted anticancer drugs.
  • the present invention was completed by demonstrating that when THBS1 is inhibited as a target for concurrent treatment to overcome, not only can resistance to targeted anticancer drugs be overcome, but also the efficacy of targeted anticancer drugs can be increased.
  • one object of the present invention is to provide a composition for suppressing anticancer drug resistance containing a THBS1 inhibitor as an active ingredient.
  • Another object of the present invention is to provide a composition for enhancing anticancer drug responsiveness containing a THBS1 inhibitor as an active ingredient.
  • Another object of the present invention is to provide an anti-cancer adjuvant containing the composition.
  • Another object of the present invention is to provide a pharmaceutical composition for preventing or treating cancer containing a THBS1 inhibitor and an anticancer agent as active ingredients.
  • Another object of the present invention is to provide a food composition for suppressing anticancer drug resistance containing a THBS1 inhibitor as an active ingredient.
  • Another object of the present invention is to provide a screening method for substances that suppress anticancer drug resistance.
  • Another object of the present invention is to provide a method for providing information for determining resistance to p53 activators.
  • another object of the present invention is to provide a method for suppressing anticancer drug resistance, comprising administering to a subject a composition for suppressing anticancer drug resistance containing a Thrombospondin 1 (THBS1) inhibitor as an active ingredient.
  • THBS1 Thrombospondin 1
  • another object of the present invention is to provide a treatment method comprising administering to a subject a pharmaceutical composition for preventing or treating cancer containing a THBS1 inhibitor and an anticancer agent as active ingredients.
  • the present invention provides a composition for suppressing anticancer drug resistance containing a THBS1 (Thrombospondin 1) inhibitor as an active ingredient.
  • THBS1 Thrombospondin 1
  • THBS1 of the present invention was derived to provide a key positive feedback to the drug resistance mechanism of anticancer drugs through simulation of a model for discovery of combination targets to overcome target anticancer drug (drug, drug) resistance according to the present invention, overcoming drug resistance.
  • target anticancer drug drug, drug
  • the present invention relates to an excellent composition for suppressing anticancer drug resistance containing an inhibitor of THBS1 as an active ingredient.
  • the THBS1 inhibitor (inhibitor) of the present invention may include any agent or means known in the art, as long as it can reduce the THBS1 expression level or activity in cancer cells, which is the object of the present invention, such as
  • the inhibitor may include, but is not limited to, those that inhibit the expression of the target gene THBS1 or the activity of the THBS1 protein.
  • the THBS1 inhibitor is an antisense oligonucleotide, small interference RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), and ribozyme that bind complementary to the mRNA of the THBS1 gene.
  • siRNA small interference RNA
  • shRNA short hairpin RNA
  • miRNA microRNA
  • ribozyme that bind complementary to the mRNA of the THBS1 gene.
  • the THBS1 inhibitor may be one or more selected from the group consisting of compounds that specifically bind to the THBS1 protein, peptides, peptide mimetics, substrate analogs, aptamers, and antibodies, but is not limited thereto.
  • antisense nucleic acid refers to DNA or RNA or derivatives thereof containing a nucleic acid sequence complementary to the sequence of a specific mRNA, and has the effect of inhibiting the translation of mRNA into protein by binding to the complementary sequence in the mRNA. Do it.
  • the antisense sequence refers to a DNA or RNA sequence that is complementary to the mRNA of the gene and is capable of binding to the mRNA, and is involved in translation, translocation into the cytoplasm, maturation, or any other overall biological function of the mRNA. It may inhibit essential activities.
  • the antisense nucleic acid may be modified at one or more base, sugar, or backbone positions to improve efficacy.
  • the nucleic acid backbone can be modified with phosphorothioate, phosphotriester, methyl phosphonate, short-chain alkyl, cycloalkyl, short-chain heteroatomic, heterocyclic intersaccharide linkages, etc.
  • antisense nucleic acids may contain one or more substituted sugar moieties.
  • Antisense nucleic acids may contain modified bases.
  • Modified bases include hypoxanthine, 6-methyladenine, 5-methylpyrimidine (especially 5-methylcytosine), 5-hydroxymethylcytosine (HMC), glycosyl HMC, gentobiosyl HMC, 2-aminoadenine, 2 -Thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6(6-aminohexyl)adenine, 2,6-diaminopurine, etc.
  • the antisense nucleic acid may be chemically combined with one or more moieties or conjugates that improve the activity and cell adsorption of the antisense nucleic acid.
  • the antisense oligonucleotide can be synthesized in a test tube using a conventional method and administered in vivo, or the antisense oligonucleotide can be synthesized in vivo.
  • siRNA refers to a nucleic acid molecule capable of mediating RNA interference or gene silencing. Because siRNA can suppress the expression of target genes, it serves as an efficient gene knockdown method or gene therapy method.
  • the siRNA molecule of the present invention may have a double-stranded structure in which the sense strand (sequence corresponding to the mRNA sequence of the target gene, THBS1 gene) and the antisense strand (sequence complementary to the mRNA sequence) are located on opposite sides of each other, , the siRNA molecule of the present invention may have a single-stranded structure with self-complementary sense and antisense strands. Furthermore, siRNA is not limited to complete pairing of double-stranded RNA portions of RNA, but pairs can be formed by mismatch (corresponding bases are not complementary), bulge (corresponding base is missing in one chain), etc. Parts that are not completed may be included.
  • the siRNA end structure can be either a blunt end or a cohesive end as long as it can inhibit the expression of the target gene through the RNAi effect
  • the cohesive end structure includes a 3'-end protrusion structure and a 5'-end structure. Any protruding structure is possible.
  • shRNA of the present invention is called small hairpin RNA or short hairpin RNA, and is used to silence genes through RNA interference. It is usually introduced into target cells using a vector. This shRNA hairpin structure can be cleaved by other substances within the cell to become siRNA.
  • shRNA short hairpin RNA represented by SEQ ID NO: 1 was used as the THBS1 inhibitor, but it is not limited thereto as long as the purpose of the present invention can be achieved.
  • the present invention may include a functional equivalent of the shRNA base sequence represented by SEQ ID NO: 1.
  • the "functional equivalent” refers to a base sequence that is at least 70% or more, preferably 80% or more, more preferably 80% or more, as a result of deletion, substitution or insertion of bases, and the base sequence of SEQ ID NO: 1. refers to a polynucleotide that has a sequence homology of at least 90%, more preferably at least 95%, and exhibits substantially the same physiological activity as the polynucleotide represented by the base sequence of SEQ ID NO: 1.
  • the “% sequence homology” for a polynucleotide is determined by comparing a comparison region with two optimally aligned sequences, where a portion of the polynucleotide sequence in the comparison region is a reference sequence (additions or deletions) for the optimal alignment of the two sequences. may contain additions or deletions (i.e. gaps) compared to those that do not contain .
  • the significance of the present invention is that it has shown that the combined administration of a THBS1 inhibitor and an anticancer drug can overcome the resistance or drug resistance induced to the anticancer drug and significantly improve the anticancer effect of the existing anticancer drug. Therefore, the THBS1 inhibitor is It will be obvious to those skilled in the art that anything used in the technical field of the invention or found to have THBS1 inhibitory activity can be applied to the present invention regardless of its type, and is not limited to a specific type.
  • the THBS1 inhibitor may be administered simultaneously or sequentially with the anticancer agent.
  • the anticancer agent can be used without limitation as long as it is a drug effective in treating cancer, but is preferably a p53 activator, which is a targeted anticancer agent.
  • the p53 activator is, for example, APR-246 (Eprenetapopt, PRIMA-1MET), CP-31398, PK083, PK11007, NSC319726 (ZMC1), stictic acid, Nutlin-3a, RO6839921, NSC 146109 hydrochloride , RITA, Tenovin-1, HLI373, WR 0165, Idasanutlin, and YH 239-EE, but is not limited thereto.
  • APR-246 (Eprenetapopt, PRIMA-1MET) was used as the p53 activator, but it is not limited thereto.
  • composition for enhancing anticancer drug responsiveness comprising a THBS1 inhibitor as an active ingredient is provided.
  • co-treatment of sensitive cells can improve responsiveness to anticancer drugs, lower the dosage of anticancer drugs used, and improve anticancer drug side effects.
  • the present invention provides an anti-cancer adjuvant comprising the composition according to the present invention.
  • anticancer adjuvant refers to an agent that can improve, improve, or increase the anticancer effect of an anticancer agent by administering it in combination with an anticancer agent when administering an anticancer agent.
  • the anticancer adjuvant can be used as an anticancer agent or an anticancer adjuvant depending on the treatment concentration, and can enhance the sensitivity (sensitivity) of the anticancer agent.
  • the adjuvant of the present invention may be administered simultaneously (simutaneous), separately (separately), or sequentially (sequentially) with the anticancer drug.
  • the order of administration of the anti-cancer adjuvant according to the present invention that is, which of the anti-cancer agent and anti-cancer adjuvant is to be administered at what point and simultaneously, individually or sequentially, can be determined by a doctor or expert. This order of administration may vary depending on many factors.
  • the anti-cancer adjuvant may be administered in combination with a known compound that has the effect of preventing, improving, or treating cancer. In this regard, it can be administered simultaneously or sequentially with known compounds.
  • the THBS1 inhibitor according to the present invention can increase the responsiveness of p53 activator in cancer cell lines with p53 mutations, confirming that the THBS1 inhibitor according to the present invention can be used as an anticancer adjuvant.
  • the present invention provides a pharmaceutical composition for preventing or treating cancer containing a THBS1 inhibitor and an anticancer agent as active ingredients.
  • the combination comprising a THBS1 inhibitor and an anticancer agent of the present invention is provided as an effective combination administration strategy therapy in various cancer types.
  • the present invention provides a method for suppressing anticancer drug resistance, comprising administering to a subject a composition for suppressing anticancer drug resistance containing a THBS1 (Thrombospondin 1) inhibitor as an active ingredient.
  • a composition for suppressing anticancer drug resistance containing a THBS1 (Thrombospondin 1) inhibitor as an active ingredient.
  • a method for treating cancer comprising administering to a subject a pharmaceutical composition for preventing or treating cancer containing a THBS1 inhibitor and an anticancer agent as active ingredients.
  • the cancer prevention and/or treatment effect includes not only the effect of suppressing the growth of cancer cells, but also the effect of suppressing the worsening of cancer due to migration, invasion, metastasis, etc.
  • the cancer may include any cancer as long as the composition of the present invention achieves the intended effect, for example, lung cancer, liver cancer, and colon cancer.
  • lung cancer was the target, but it is not limited thereto.
  • the cancer may be a p53 mutant cancer.
  • the term “comprising an active ingredient” means containing the THBS1 inhibitor, which is an active ingredient of the present invention, in an amount sufficient to achieve a predetermined efficacy or activity.
  • the THBS1 inhibitor can be administered in a pharmaceutically effective amount, and the effective dose level can be determined depending on the type and age of the individual, gender, sensitivity to the drug, treatment period, drugs used simultaneously, and other medical factors.
  • the pharmaceutical composition may be in the form of a capsule, tablet, granule, injection, ointment, powder, or beverage, and the pharmaceutical composition may be intended for human subjects.
  • the pharmaceutical composition is not limited to these, but can be formulated and used in the form of oral dosage forms such as powders, granules, capsules, tablets, and aqueous suspensions, external preparations, suppositories, and sterile injection solutions according to conventional methods. .
  • the pharmaceutical composition according to the present invention may include a pharmaceutically acceptable carrier.
  • Pharmaceutically acceptable carriers include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, colorants, flavorings, etc. for oral administration.
  • buffers, preservatives, and analgesics can be used.
  • Topics, solubilizers, isotonic agents, stabilizers, etc. can be mixed and used, and for topical administration, bases, excipients, lubricants, preservatives, etc. can be used.
  • the dosage form of the pharmaceutical composition according to the present invention can be prepared in various ways by mixing it with a pharmaceutically acceptable carrier as described above.
  • oral administration it can be manufactured in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and in the case of injections, it can be manufactured in the form of unit dosage ampoules or multiple dosage forms. there is.
  • examples of carriers, excipients and diluents suitable for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, or mineral oil may be used.
  • fillers, anti-coagulants, lubricants, wetting agents, fragrances, emulsifiers, preservatives, etc. may be additionally included.
  • the route of administration of the pharmaceutical composition according to the present invention is not limited to these, but is oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, and topical. , sublingual or rectal.
  • parenteral includes subcutaneous, intradermal, intravenous, intramuscular, intra-articular, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques.
  • the pharmaceutical composition according to the invention can also be administered in the form of suppositories for rectal administration.
  • the pharmaceutical composition according to the present invention is influenced by various factors, including the activity of the specific active ingredient used, age, body weight, general health, gender, diet, administration time, administration route, excretion rate, drug formulation, and the severity of the specific disease to be prevented or treated.
  • the dosage of the pharmaceutical composition may vary depending on the patient's condition, body weight, degree of disease, drug form, administration route and period, but may be appropriately selected by a person skilled in the art.
  • the amount that can achieve the maximum effect with the minimum amount without side effects can be administered, more preferably 1 to 10,000 ⁇ g/kg of body weight/day, and even more preferably 10 to 1,000 mg.
  • the effective dose is /kg body weight/day and can be administered repeatedly several times a day. The above dosage does not limit the scope of the present invention in any way.
  • the pharmaceutical composition of the present invention can be used alone or in combination with surgery, radiation therapy, hormone therapy, chemotherapy, and methods using biological response regulators for the prevention or treatment of target indications.
  • a p53 activator and a THBS1 inhibitor by co-administering a p53 activator and a THBS1 inhibitor, not only can an excellent synergistic effect be achieved compared to the use of a single drug, but also an equivalent effect can be achieved when the administration concentration is reduced and/or the administration interval is increased compared to the use of a single drug. It exhibits excellent anticancer effects that can achieve the above effects.
  • the p53 activator has a limitation in that high concentration treatment is required to exhibit anticancer efficacy. This limitation can be overcome by significantly lowering the minimum concentration at which an anticancer effect can be achieved by co-administration with a THBS1 inhibitor, as proposed in the present invention.
  • the present invention provides a food composition for suppressing anticancer drug resistance containing a THBS1 inhibitor as an active ingredient.
  • Food compositions according to the present invention include all types of functional foods, nutritional supplements, health foods, health supplements, and food additives.
  • the food composition of the above type may be formulated in any form selected from the group consisting of powder, tablet, capsule, pill, and liquid according to a conventional method known in the art, but is not limited thereto. It can be manufactured in various forms using methods known in the art.
  • the THBS1 inhibitor of the present invention itself can be granulated, encapsulated, and powdered and consumed, or it can be prepared and consumed in the form of tea, juice, and drinks.
  • the THBS1 inhibitor of the present invention can be prepared in the form of a composition by mixing it with known substances or active ingredients known to have cancer prevention, improvement, or treatment activity.
  • functional foods include beverages (including alcoholic beverages), fruits and their processed foods (e.g. canned fruit, bottled foods, jam, marmalades, etc.), fish, meat and their processed foods (e.g. ham, sausage corn beef, etc.) , bread and noodles (e.g. udon, buckwheat noodles, ramen, spaghetti, macaroni, etc.), fruit juice, various drinks, cookies, taffy, dairy products (e.g. butter, cheese, etc.), edible vegetable oil, margarine, vegetable protein, retort. It can be manufactured by adding the THBS1 inhibitor of the present invention to food, frozen food, and various seasonings (e.g., soybean paste, soy sauce, sauce, etc.).
  • seasonings e.g., soybean paste, soy sauce, sauce, etc.
  • the food composition of the present invention may contain common food additives, and its suitability as a "food additive" is determined in accordance with the general provisions of the food additive code and general test methods approved by the Ministry of Food and Drug Safety, unless otherwise specified. It is determined based on the specifications and standards for the relevant item.
  • Items listed in the "Food Additives Code” include, for example, chemical compounds such as ketones, glycine, potassium citrate, nicotinic acid, and cinnamic acid; natural additives such as subchromic pigment, licorice extract, crystalline cellulose, high-liquid pigment, and guar gum; Examples include mixed preparations such as sodium L-glutamate preparations, noodle additive alkaline preparations, preservative preparations, and tar coloring preparations.
  • the THBS1 inhibitor may preferably be included in an amount of 0.00001 to 50% by weight relative to the food composition. If the content is less than 0.00001% by weight, the effect is insignificant, and if it exceeds 50% by weight, the increase in effect compared to the amount used is minimal, making it uneconomical.
  • the THBS1 inhibitor of the present invention in the form of a food additive, it can be manufactured and used in the form of tablets, capsules, powders, granules, liquids, pills, etc.
  • the composition of the present invention When the composition of the present invention is manufactured into a beverage, it may contain various flavoring agents or natural carbohydrates as additional ingredients, like conventional beverages.
  • the above-mentioned natural carbohydrates may include monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, natural sweeteners such as dextrin and cyclodextrin, and synthetic sweeteners such as saccharin and aspartame.
  • the proportion of natural carbohydrates is generally about 0.01 to 10 g, preferably about 0.01 to 0.1 g, per 100 ml of the composition of the present invention.
  • the composition of the present invention contains various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, It may include carbonating agents used in carbonated drinks. Additionally, the composition of the present invention may include pulp for the production of natural fruit juice, fruit juice beverages, and vegetable beverages. These ingredients can be used independently or in combination. The ratio of these additives is not very important, but is generally selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention.
  • health supplement or “health functional food” means food manufactured and processed using raw materials or ingredients with functionality useful to the human body in accordance with the Health Functional Food Act.
  • “Functional” means ingestion for the purpose of controlling nutrients for the structure and function of the human body or obtaining useful effects for health purposes such as physiological effects.
  • the present invention provides a method for screening a substance that inhibits anticancer drug resistance, comprising the following steps:
  • step (b) measuring the expression level of THBS1 in the cancer cells of step (a);
  • step (c) When the expression level of THBS1 measured in step (b) is low compared to the untreated control group, selecting the candidate substance as a substance that suppresses anticancer drug resistance.
  • the method of measuring the expression level of THBS1, that is, the expression level of the THBS1 gene or the amount of THBS1 protein is performed by using a known technique, including a known process of isolating mRNA or protein from a biological sample.
  • the biological sample refers to a sample collected from a living body whose expression level of the gene or protein level is different from that of the control group. Examples of the sample include tissue, cells, blood, serum, plasma, saliva, and urine. It may be included, but is not limited thereto.
  • the expression level of the gene is preferably measured by measuring the level of mRNA.
  • Methods for measuring the level of mRNA include reverse transcription polymerase chain reaction (RT-PCR), real-time reverse transcription polymerase chain reaction, RNase protection assay, and Northern PCR. These include, but are not limited to, blots and DNA chips.
  • the protein level can be measured using an antibody.
  • the marker protein in the biological sample and the antibody specific for it form a complex, that is, an antigen-antibody complex
  • the amount of the antigen-antibody complex formed is determined by the detection label ( It can be measured quantitatively through the size of the signal of the detection label.
  • detection labels may be selected from the group consisting of, but are not limited to, enzymes, fluorescent substances, ligands, luminescent substances, microparticles, redox molecules, and radioisotopes.
  • Analytical methods for measuring protein levels include Western blot, ELISA, radioimmunoassay, radioimmunodiffusion, Ouchteroni immunodiffusion, rocket immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay, complement fixation assay, FACS, and protein. Chips, etc., but are not limited thereto.
  • the candidate substance is an individual nucleic acid or protein that is estimated to have the potential as a medicine that inhibits the activity or expression level of the THBS1 protein or the gene encoding the THBS1 protein according to a conventional selection method, or is randomly selected. , other extracts, natural products, compounds, etc.
  • a THBS1 inhibitor when administered in combination with a p53 activator, anticancer drug resistance can be overcome and the anticancer effect can be increased through a synergistic effect.
  • the activity or expression level of the THBS1 protein or gene was confirmed.
  • Substances that reduce cancer can be used as agents for suppressing or improving resistance to anticancer drugs.
  • the present invention provides an information providing method for determining resistance to a p53 activator, comprising the following steps:
  • a method of providing information for determining resistance to a p53 activator refers to a method of providing information on the therapeutic effect of a p53 activator when the p53 activator is used as an anticancer agent for cancer treatment, It refers to a method of providing information on whether resistance to p53 activator is shown, whether cancer progression can be effectively inhibited, or whether cancer cells can be killed.
  • the method provides information that the p53 activator cannot be used for effective cancer treatment when the cancer patient has a mutation in the p53 gene, does not function normally, and THBS1 is expressed at a high level compared to the control sample.
  • the method is not limited to this as long as it can obtain information related to the cancer treatment effect of the p53 activator from biological samples.
  • the THBS1 inhibitor according to the present invention suppresses drug resistance to targeted anticancer agents and increases the anticancer effect when administered in combination with targeted anticancer agents. Therefore, the present invention can overcome resistance to targeted anticancer drugs and increase the treatment hit rate for anticancer drugs in cancer patients, suggesting new possibilities in treatment strategies using targeted anticancer drugs and contributing to the realization of precision medicine.
  • Figure 1 schematically shows the process of discovering a combination target to overcome anticancer drug resistance of the present invention.
  • (1) shows pathway information obtained from the database, gene expression level of cell lines, and drug response information.
  • (2) shows sensitive and resistant cell lines divided based on the drug response information of the cell lines obtained in (1).
  • (3) shows the process of learning the AnoDAN (anomalous gene detection using generative adversarial networks and graph neural networks for overcoming drug resistance) deep learning model presented in the present invention using the sensitive cell line data in (2).
  • (4) shows the process of calculating outlier scores at the pathway, sample, and gene levels by inputting the resistant cell line from (2) into the model learned in (3).
  • (5) uses the outlier score in (4) to select the pathway causing resistance, and shows the outlier score for each gene within the pathway.
  • (6) represents target genes for combination use to overcome resistance selected based on the high gene outlier score in the pathway selected in (5).
  • (7) shows the process of verifying the change in drug responsiveness and resistance development mechanism through controlling the expression level
  • Figure 2 schematically shows the process of identifying the effective resistance-overcoming combination target and mechanism of the present invention.
  • Figure 2A shows AnoDAN and the learning process with a new deep neural networks (DNN) structure utilizing generative adversarial networks (GAN) and graph neural networks (GNN) using gene expression and pathway data together.
  • Figure 2B shows a method of assigning outlier scores at the gene level, pathway level, and sample level using the difference between actual data and generated data.
  • Figure 2C shows that the loss functions of each of the generator, discriminator, and encoder that make up the proposed AnoDAN converge and the model is learned.
  • Figure 2D shows that the model was learned through good overlap between the actual data and the data generated from the model in 2C when they were mapped in two dimensions using UMAP (uniform manifold approximation and projection).
  • UMAP uniform manifold approximation and projection
  • Figure 3 shows the results of outputting sample-level outlier scores calculated for drug-sensitive cell lines and drug-resistant cell lines using a learning model for discovering combination targets to overcome target anticancer drug resistance of the present invention.
  • Figure 4 shows the results of learning using known trametinib data to confirm the reliability of the learning model of the present invention.
  • Figure 4A shows that the loss functions of the generator, discriminator, and encoder converge to learn the model.
  • Figure 4B shows that the model was learned through good overlap between the actual data and the data generated from the model in 4A when they were mapped in two dimensions using UMAP.
  • Figure 4C shows the ranking of pathways with high outlier scores for resistance to trametinib.
  • Figure 5 shows the process of selecting THBS1, a gene with a high outlier score and belonging to the p53 signaling pathway and the TGF-beta signaling pathway in common, obtained by applying the learning model of the present invention, as a combination target to overcome drug resistance.
  • Figure 5A shows the pathway-level outlier score obtained by applying drug-resistant cell line data to a model previously learned with a sensitive cell line.
  • Figure 5B shows the outlier score of each gene within the p53 signaling pathway, which had the highest outlier score in 5A. At this time, the outlier score is expressed in terms of color darkness.
  • Figure 5C shows the gene outlier score within the TGF-beta signaling pathway, which has the second highest outlier score in 5A.
  • Figure 5D shows that the THBS1 gene, which commonly belongs to the two signaling pathways of 5B and 5C and has a high outlier score, was selected as a combination target to overcome drug resistance.
  • Figure 6 shows the results of confirming the expression level of THBS1, selected as the combination target gene of the present invention, in cancer cell lines.
  • Figure 6A shows that the data used shows that the expression level of THBS1 is higher in drug-resistant cell lines than in sensitive cell lines.
  • Figure 6B shows that when comparing the level of THBS1 mRNA expression in resistant and sensitive cell lines in a directly performed experiment, it was higher in the resistant cell line.
  • Figure 7 shows the results of confirming the drug response to p53 activator in cancer cell lines with p53 mutations.
  • Figure 7A shows that in an actual experiment, a cell line resistant to the drug APR-246, a p53 activator, hardly responds to the drug.
  • Figure 7B shows that when sensitive cell lines are treated with the drug, a clear response to the drug appears.
  • Figure 7C shows the results of 7A and 7B once again confirmed by drug reaction by staining only living cells through a crystal violet experiment.
  • Figure 8 shows the results of regulating THBS1 expression and combined use of p53 activator in drug-resistant and drug-sensitive cancer cell lines, as well as the results of experimental verification of the resistance overcoming mechanism.
  • Figure 8A shows that the expression level of THBS1 was reduced in NCI-H1792 and NCI-H1793, which are cell lines resistant to the APR-246 drug, and then the mRNA level was confirmed, showing that the expression level was well reduced.
  • Figure 8B shows that the expression level of THBS1 was increased in NCI-H2009 and HCC827, which are highly drug-responsive cell lines, and then the mRNA level was confirmed, showing that the expression level was well increased.
  • Figure 8C shows that when THBS1 expression was inhibited in a resistant cell line, drug responsiveness increased, as demonstrated through cell viability graphs and crystal violet experiments.
  • Figure 8D shows that when THBS1 expression was increased in a drug-sensitive cell line, the cells became drug resistant.
  • Figure 8E shows a positive feedback relationship between THBS1 and TGF-beta signaling pathways that activate each other. At this time, when comparing the protein expression levels of TGF ⁇ 1 and p-SMAD2/3 to confirm the positive feedback relationship, it was found that the combined treatment of the drug and THBS1 in resistant cell lines decreased the protein expression in the TGF-beta signaling pathway. You can check it.
  • Figure 8F shows the results of experimentally verifying the positive feedback relationship through an increase in protein expression in the TGF-beta signaling pathway during combined treatment when the same experiment was performed on a drug-sensitive cell line.
  • Figure 8G shows that the positive feedback observed in the previous experiment is that THBS1 activates TGF ⁇ 1, and through TGF ⁇ R, p-SMAD2/3 is activated and THBS1 is expressed again.
  • Figure 8H shows that drug resistance occurs due to positive feedback between THBS1 and TGF-beta signaling pathways when APR-246 is treated alone, so drug responsiveness can be increased by combined treatment to inhibit THBS1.
  • Figure 9 shows the results confirming the effect depending on concentration when combined with a THBS1 inhibitor and a p53 activator in a cell line sensitive to the drug of the present invention.
  • Figures 9A and 9B show the results of observing cell survival after inhibiting THBS1 in a sensitive cell line.
  • Figure 10 shows the results confirming positive feedback between the THBS1 and TGF-beta signaling pathways of the present invention.
  • Figure 10A shows that the mRNA expression level of TGF ⁇ 1 is higher in drug-resistant cell lines compared to sensitive cell lines.
  • Figure 10B shows that when THBS1 was inhibited in the resistant cell line, TGF ⁇ 1 was also reduced.
  • Figure 10C shows that the activity score of the TGF-beta signaling pathway is higher in the resistant cell line in the Signaling Pathway Enrichment using Experimental Datasets (SPEED) data provided by the GDSC database.
  • SPEED Experimental Datasets
  • FIGS. 10D and 10E show that when cells were seeded in two sensitive cell lines and treated with a drug that activates the TGF-beta signaling pathway 24 hours later, the mRNA expression level of TGF ⁇ 1 increased and the expression level of THBS1 also increased.
  • NCI-H1793, NCI-H2009, and HCC827 were purchased from the Korea Cell Line Bank (KCLB), and NCI-H1792 was purchased from ATCC (American Type Culture Collection).
  • NCI-H1793 and HCC827 were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) and antibiotics (100 U/ml penicillin, 100 ⁇ g/ml of streptomycin, and 0.25 ⁇ g/ml of Fungizone). It has been done.
  • NCI-H1792 and NCI-H2009 were cultured with the same supplements in DMEM medium. All cell lines were cultured at 37°C in an incubator containing 5% carbon dioxide.
  • DMSO Dimethyl sulfoxide
  • APR-246 and TGF ⁇ 1 proteins were purchased from MedChemExpress (MCE).
  • MCE MedChemExpress
  • APR-246 was used by diluting 25mg to a final concentration of 10mM, and the cells were treated for 4-5 days when checking cell viability and for 24 hours when performing Western blot experiments.
  • TGF ⁇ 1 at a concentration of 10 ⁇ g/ml is a TGF-beta pathway activator.
  • Drug-sensitive cell lines were seeded and treated with 5 ng/ml 24 hours later, and the cells were harvested 24 hours later.
  • HEK 293T cells were used to transfect shRNA targeting THBS1 and overexpression vector.
  • shRNA shTHBS1; GTAGGTTATGATGAGTTTAAT; SEQ ID NO: 1
  • overexpression vector pDNA (VB220725-1808zjh); VectorBuilder
  • scramble and packaging mixes pLP1, pLP2, and pLP/VSVG
  • Cells were seeded in a 96-well plate at 3-5x10 cells per well. The drug was then treated within 24 hours after seeding. Cell growth was recorded every 3 hours using IncuCyte ZOOM for 4-5 days after drug treatment. Cell viability was analyzed using IncuCyte ZOOM 2016A software. After 4-5 days, cells were stained with 1% crystal violet for 30 minutes at room temperature and washed with distilled water to confirm the amount of viable cells.
  • RNA extraction and real-time polymerase chain reaction qRT-PCR
  • the present inventors conduct outlier detection analysis by applying gene expression information and pathway information to a GAN (Generative Adversarial Networks) model based on a signaling database.
  • GAN Geneative Adversarial Networks
  • the methodology was presented.
  • an experiment was conducted on APR-246, a p53-targeting drug that activates p53, as a targeted anticancer drug.
  • GDSC Genomics of Drug Sensitivity in Cancer
  • KEGG Kyoto Encyclopedia of Genes and Genomes
  • the outlier detection analysis was conducted in the following three steps. First, a GAN model was learned to simulate gene expression information of the APR-246 drug-sensitive cell line. At this time, GNN was applied to the discriminator of the GAN model to distinguish at the pathway level whether it was actual gene expression information or gene expression information generated by the generator. Second, an encoder was learned to embed the expression information of the APR-246 drug-sensitive cell line into the latent space of the pre-trained GAN.
  • the gene expression information of the cell line resistant to the APR-246 drug was regenerated using a pre-learned encoder and the generator of the GAN model, and then the difference from the actual expression level was calculated to detect outliers.
  • this method can utilize richer biological information to find resistance-overcoming genes, and through this, it is possible to identify the pathway-level resistance-overcoming mechanism.
  • the p53 signaling pathway and the TGF-beta signaling pathway which have the highest outlier scores, are the cause of drug resistance to APR-246, and that THBS1, which has a high outlier score in both signaling pathways, is responsible for drug resistance. It was discovered as a target gene for overcoming the disease.
  • AnoDAN a new DNN structure that utilizes the advantages of GAN and GNN, was proposed to identify effective resistance-overcoming combination targets and mechanisms by using gene expression and pathway information together (Figure 2A). Additionally, in order to determine which pathway and gene causes resistance, we proposed a method of assigning an outlier score using the difference between actual data and generated data (Figure 2B). It was confirmed that learning was successful through the good convergence of the loss function results of each of the generator, discriminator, and encoder (Figure 2C). In addition, as a result of the dimensionality reduction algorithm called Uniform Manifold Approximation and Projection (UMAP), it was confirmed that learning was successful as the actual data and the generated data matched well (Figure 2D).
  • UMAP Uniform Manifold Approximation and Projection
  • the outlier score presented above is calculated using the difference between real data and generated data using a pre-trained encoder and generator. Because the model is pre-trained using data from drug-sensitive cell lines, the generator has the ability to generate data that well replicates the characteristics of sensitive cell lines. Therefore, when drug-resistant cell line data is entered into the model, data similar to the real thing cannot be generated because the data is from a distribution that the creator has not seen, resulting in a higher outlier score. As a result, as shown in Figure 3, the outlier score of the drug-resistant cell line was higher than the score of the sensitive cell line, confirming that the model was sufficiently learned and well captured the characteristics of the sensitive cell line.
  • Example 1-1 Based on the discovery model constructed in Example 1-1, the present inventors targeted APR-246 among various p53 activators as a target anticancer agent, suppressing drug resistance to APR-246 and increasing sensitivity. A combination drug target that exerts a synergistic effect was discovered to ultimately achieve effective anticancer effects.
  • the present inventors confirmed the expression level of THBS1, selected as the target gene in Example 1-2, in cancer cell lines.
  • the present inventors confirmed the cell viability according to the APR-246 drug treatment concentration for lung cancer cell lines NCI-H1793, NCI-H1792, HCC827, and NCI-H2009, which are known to have p53 mutations. At this time, APR-246 drug-sensitive cell line and resistant cell line were distinguished based on z-score normalized IC 50 value.
  • NCI-H1793 and NCI-H1792 were used as the APR-246 drug-resistant (resistant) cell line, and HCC827 and NCI-H2009 cell lines were used as the APR-246 drug-sensitive (responsive) cell line.
  • the present inventors used a THBS1 inhibitor and a p53 activator in a lung cancer cell line resistant to APR-246 to determine whether the combination of a THBS1 inhibitor and a p53 activator (targeted anticancer agent) can overcome drug resistance to the p53 activator. And after treating lung cancer cell lines sensitive to APR-246, cancer cell survival rate and crystal violet staining were measured. In addition, THBS1 was overexpressed in NCI-H2009 and HCC827, lung cancer cell lines that are highly drug-responsive to APR-246, and the cell death effect due to overexpression was confirmed.
  • the present inventors compared the protein expression levels of TGF ⁇ 1 and p-SMAD2/3 to confirm the positive feedback relationship between THBS1 and TGF-beta signaling pathways that activate each other.
  • the combination of p53 activator and THBS1 inhibitor can overcome adaptive resistance to drugs (p53 activator) in cancer cells, and thus provide an effective treatment method for cancer patients with abnormalities in the p53 signaling pathway. It was confirmed that it exists.
  • the present inventors measured the expression level of TGF ⁇ 1 according to THBS1 in APR-246 drug-resistant cell line and sensitive cell line.
  • the mRNA expression level of TGF ⁇ 1 was higher in the APR-246 drug-resistant cell line than in the sensitive cell line ( Figure 10A).
  • TGF ⁇ 1 was also reduced ( Figure 10B).
  • the activity score of the TGF-beta signaling pathway was measured in the Signaling Pathway Enrichment using Experimental Datasets (SPEED) data provided by the GDSC database, it was confirmed that the score was higher in the resistant cell line ( Figure 10C). In other words, it is proven that since the TGF-beta signaling pathway is more activated in resistant cell lines, inhibiting THBS1 can lower its activity.
  • SPEED Experimental Datasets
  • TGF-beta signaling pathway activity increases the activity of THBS1, thus proving a positive feedback relationship between the two.
  • a targeted anticancer agent eg, p53 activator
  • an additional THBS1 inhibitor can overcome the adaptive resistance of the targeted anticancer agent and increase its anticancer effect through a synergistic effect.
  • p53 activator and THBS1 inhibitor showed excellent synergistic effect in cancer cell lines with genetic mutations in the p53 signaling pathway, demonstrating that treatment combining THBS1 inhibitor can be an effective strategy in various carcinomas.
  • the THBS1 inhibitor according to the present invention can be used as a combination drug in an oncogenic signaling network with a feedback structure that causes drug resistance, overcoming the drug resistance of existing targeted anticancer drugs and increasing the treatment hit rate for targeted anticancer drugs in cancer patients. It is expected that

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Pathology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Epidemiology (AREA)
  • Hematology (AREA)
  • Food Science & Technology (AREA)
  • Urology & Nephrology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • General Engineering & Computer Science (AREA)
  • Mycology (AREA)
  • Toxicology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Cell Biology (AREA)

Abstract

본 발명은 표적 항암제의 약제 내성을 극복할 수 있는 신규한 병용 약물 표적으로서의 THBS1의 용도에 관한 것이다. 본 발명에 따른 THBS1 저해제는 표적 항암제의 약제 내성을 억제하여, 표적 항암제와 병용 투여 시 항암 효과를 상승시킨다. 따라서, 본 발명은 표적 항암제에 대한 내성을 극복하고 암환자의 항암제에 대한 치료 적중률을 높일 수 있어 표적 항암제를 이용한 치료전략에 새로운 가능성을 제시하고, 정밀의학 실현에 기여할 수 있다.

Description

암의 약제 내성을 극복하기 위한 THBS1 저해제의 용도
본 발명은 표적 항암제의 약제 내성을 극복할 수 있는 신규한 병용 약물 표적으로서의 THBS1의 용도에 관한 것이다.
암은 대표적인 호발성 난치 질환으로서 사회경제적으로 큰 문제가 되고 있다. 세계보건기구(WHO) 산하 국제암연구센터(IARC)가 2017년 발표한 '암 예방 및 통제 계획 초안'에 따르면 세계적으로 암 환자가 크게 늘어나 2030년에는 연간 암 발병 건수가 2012년 대비 약 54% 증가한 2,200만명에 육박할 것으로 추정되며, 2010년 한 해에만 암 진단 및 치료를 위해 사용된 비용은 전 세계적으로 한화 1315조원에 육박하였다. 우리나라에서도 2014년에 발표된 '보건복지부 암등록통계'에 의하면 암 발생률이 2000년도 이후 꾸준히 증가하여, 2010년에는 발생한 암 환자가 20만 명(10만 명당 약 400명)을 넘어섰고, 2015년 발표된 '통계청 사망원인통계'에 따르면 최근 10년간 사망률이 가장 많이 증가한 사인은 암이며, 암 사망자수는 2015년 전체 사망자의 약 27.9%인 76,975명(10만명당 약 150.8명)에 이르렀다.
최근 암 치료를 위해 다양한 표적 항암제가 개발되고 있다. 표적 항암제는 암세포에만 발현되는 특정 표적을 공격하기 때문에 부작용은 줄이면서 치료 효과는 획기적으로 높일 수 있다. 그러나, 표적 항암제는 많은 기대에도 불구하고 임상에서 약물에 대한 암의 저항성 때문에 그 효과가 제한되고 있다. 특히, 피드백 조절관계가 얽혀있는 신호전달 네트워크의 복잡한 동역학 때문에, 암은 약물에 의한 섭동 효과에 적응하고 이를 상쇄시킬 수 있는 적응형 저항성을 가지고 있다. 이러한 약제 내성은 표적치료제의 효능을 근본적으로 저해한다. 이처럼 여러 신호전달 네트워크가 종합적으로 관여하는 암세포의 약제 내성의 원리를 밝히고, 내성 환자군에 대한 바이오마커 동정 및 내성 극복을 위한 병행치료 표적을 발굴하기 위해서는 네트워크적 접근을 필요로 한다.
이에, 많은 표적 항암제는 변이가 생긴 신호전달 경로를 억제하도록 개발되고 있다. 인간의 암세포는 돌연변이의 유무에 따라 항암제에 대한 반응이 달라지기 때문에 어떤 돌연변이를 가졌는지 파악하고 그에 맞는 항암제를 사용하는 것이 중요하다. 특히, 대표적인 종양 억제 유전자인 p53의 기능 소실 돌연변이는 상당수 암 환자, 특히 폐암에서 공통적으로 발견된다.
현재 암을 치료하기 위해 표적 항암제를 단독으로 투여하거나 항암 화학요법과 함께 시행되고 있으나, 표적 항암제에 내성을 가진 환자의 경우에는 치료가 더욱 어렵다. 따라서, 항암제 내성 극복에 주요한 역할을 하는 타겟 유전자를 발굴하고, 이와 관련된 내성 발생 메커니즘을 파악하는 것이 필요하다.
인간 암의 약 50%에는 p53 유전자의 돌연변이 또는 p53을 활성화시키는 기전의 결함을 통해 p53 단백질 기능의 불활성화가 나타난다. p53 기능의 이러한 장애는 p53 의존 반응으로부터 회피를 허용함으로써 종양의 진화에 결정적인 역할을 하게 된다. 최근의 많은 연구들은 p53의 돌연변이를 대폭 감소시키거나 p53의 종양 억제 기능을 복원하기 위하여 선택적인 저분자 화합물을 동정함으로써 p53의 돌연변이를 직접 표적하는 것에 초점을 두고 있다.
특히, 폐암에서는 p53 돌연변이가 가장 많으며, 이러한 p53 돌연변이가 존재하는 경우, 예후가 더욱 좋지 않은 것으로 알려져 있다. 표적 항암제, 예컨대, PRIMA-1MET (APR-246)은 p53 돌연변이가 존재하는 경우 p53을 재활성화시켜서 항암제로써 높은 치료 가능성을 보여주고 있으나, 이 약물을 처리한 후에도 여전히 저항성을 띄는 경우가 많다.
따라서, 암에서 가장 주요한 돌연변이 중 하나인 p53 돌연변이를 가진 암 환자에게, p53을 활성화시키는 APR-246와 같은 표적 항암제에 대한 내성을 극복할 수 있는 타겟을 새로운 병용 치료제로 제시함으로써, 치료 효과를 높일 수 있다.
즉, 이러한 p53 유전자의 기능을 복원할 수 있다면, 효과적이고 유망한 암 치료 전략이 될 수 있으며, 이는, 개인별 맞춤의학을 실현, 표적 치료를 통해 환자의 생존률 및 불필요한 항암제 치료로 인한 삶의 질의 향상에 기여할 것이다.
이러한 상황 하에서, 본 발명자들은 암에 대한 우수한 치료 활성을 달성하고 표적 항암제의 치료적 한계를 극복할 수 있는 병용 약물 표적을 발굴하기 위해 예의 연구노력하였다. 그 결과, 본 발명자들은 종양 억제 유전자인 p53 유전자 상에 발생한 기능 소실 돌연변이로 인해 p53 활성 약물에 저항성을 가진 암의 약물 반응성을 높일 수 있는 병용 타겟으로서 THBS1 유전자를 동정하였고, 표적 항암제에 대한 약물 내성 극복을 위한 병행치료 표적으로 상기 THBS1를 억제한 경우, 표적 항암제에 대한 내성을 극복할 뿐만 아니라 표적 항암제의 효능을 증대시킬 수 있음을 규명함으로써 본 발명을 완성하였다.
따라서, 본 발명의 일 목적은 THBS1 저해제를 유효성분으로 포함하는 항암제 내성 억제용 조성물을 제공하는 데 있다.
또한, 본 발명의 다른 목적은 THBS1 저해제를 유효성분으로 포함하는 항암제 반응성 증진용 조성물을 제공하는 데 있다.
또한, 본 발명의 다른 목적은 상기 조성물을 포함하는 항암 보조제를 제공하는 데 있다.
또한, 본 발명의 또 다른 목적은 THBS1 저해제 및 항암제를 유효성분으로 포함하는 암의 예방 또는 치료용 약학적 조성물을 제공하는 데 있다.
또한, 본 발명의 또 다른 목적은 THBS1 저해제를 유효성분으로 포함하는 항암제 내성 억제용 식품 조성물을 제공하는 데 있다.
또한, 본 발명의 또 다른 목적은 항암제 내성을 억제하는 물질의 스크리닝 방법을 제공하는 데 있다.
또한, 본 발명의 또 다른 목적은 p53 활성화제에 대한 내성을 판단하기 위한 정보 제공 방법을 제공하는 데 있다.
또한, 본 발명의 또 다른 목적은 THBS1(Thrombospondin 1) 저해제를 유효성분으로 포함하는 항암제 내성 억제용 조성물을 대상에게 투여하는 단계를 포함하는, 항암제 내성 억제 방법을 제공하는 데 있다.
또한, 본 발명의 또 다른 목적은 THBS1 저해제 및 항암제를 유효성분으로 포함하는 암의 예방 또는 치료용 약학적 조성물을 대상에게 투여하는 단계를 포함하는 치료 방법을 제공하는 데 있다.
본 명세서에서 사용한 용어는 단지 설명을 목적으로 사용된 것으로, 한정하려는 의도로 해석되어서는 안된다. 단수의 표현은 문맥상 명백하게 다르게 뜻하지 않는 한, 복수의 표현을 포함한다. 본 명세서에서, "포함하다" 또는 "가지다" 등의 용어는 명세서 상에 기재된 특징, 숫자, 단계, 동작, 구성요소, 부품 또는 이들을 조합한 것이 존재함을 지정하려는 것이지, 하나 또는 그 이상의 다른 특징들이나 숫자, 단계, 동작, 구성요소, 부품 또는 이들을 조합한 것들의 존재 또는 부가 가능성을 미리 배제하지 않는 것으로 이해되어야 한다.
다르게 정의되지 않는 한, 기술적이거나 과학적인 용어를 포함해서 여기서 사용되는 모든 용어들은 실시예가 속하는 기술 분야에서 통상의 지식을 가진 자에 의해 일반적으로 이해되는 것과 동일한 의미를 가지고 있다. 일반적으로 사용되는 사전에 정의되어 있는 것과 같은 용어들은 관련 기술의 문맥 상 가지는 의미와 일치하는 의미를 가지는 것으로 해석되어야 하며, 본 출원에서 명백하게 정의하지 않는 한, 이상적이거나 과도하게 형식적인 의미로 해석되지 않는다.
이하, 본 발명에 대하여 보다 상세히 설명한다.
본 발명의 일 양태에 따르면, 본 발명은 THBS1(Thrombospondin 1) 저해제를 유효성분으로 포함하는 항암제 내성 억제용 조성물을 제공한다.
본 발명의 THBS1는, 본 발명에 따른 표적 항암제(약물, 약제) 내성을 극복하기 위한 병용 타겟의 발굴 모델 시뮬레이션을 통해, 항암제의 약제 내성 메커니즘에 핵심적인 양성 피드백을 하는 것으로 도출된, 약물 내성 극복을 위한 병용 타겟 유전자로서, THBS1의 발현을 억제한 경우, 항암제 내성이 억제되어 항암제에 대한 민감도가 증가하고, 항암제 저항성 세포주의 생존률이 감소하는 것을 확인하였다. 따라서, 본 발명은, THBS1의 저해제를 유효성분으로 포함하는 우수한 항암제 내성 억제용 조성물에 관한 것이다.
본 발명의 THBS1 저해제(억제제)는, 본 발명의 목적, 즉, 암세포에서의 THBS1 발현 수준 또는 활성을 감소시킬 수 있는 한, 당업계에 공지된 임의의 제제 또는 수단을 포함할 수 있으며, 예를 들어, 상기 저해제는 타겟 유전자인 THBS1의 발현 또는 THBS1 단백질의 활성을 억제하는 것을 모두 포함할 수 있으며, 이에 제한되지 않는다.
본 발명의 바람직한 구현예에 따르면, 상기 THBS1 저해제는 THBS1 유전자의 mRNA에 상보적으로 결합하는 안티센스 올리고뉴클레오타이드, siRNA(small interference RNA), shRNA(short hairpin RNA), miRNA(microRNA) 및 리보자임(ribozyme)으로 이루어진 군으로부터 선택된 1 종 이상일 수 있거나; 또는, 상기 THBS1 저해제는 THBS1 단백질에 특이적으로 결합하는 화합물, 펩티드, 펩티드 모방체, 기질유사체, 앱타머 및 항체로 이루어진 군으로부터 선택된 1 종 이상일 수 있으나, 이에 한정되지 않는다.
본 발명에서 "안티센스 핵산"이란 특정 mRNA의 서열에 상보적인 핵산 서열을 함유하고 있는 DNA 또는 RNA 또는 이들의 유도체를 의미하고, mRNA 내의 상보적인 서열에 결합하여 mRNA의 단백질로의 번역을 저해하는 작용을 한다. 상기 안티센스 서열은 상기 유전자의 mRNA에 상보적이고 상기 mRNA에 결합할 수 있는 DNA 또는 RNA 서열을 의미하며, 상기 mRNA의 번역, 세포질내로의 전위(translocation), 성숙(maturation) 또는 다른 모든 전체적인 생물학적 기능에 대한 필수적인 활성을 저해할 수 있다.
또한, 상기 안티센스 핵산은 효능을 증진시키기 위하여 하나 이상의 염기, 당 또는 골격(backbone)의 위치에서 변형될 수 있다. 핵산 골격은 포스포로티오에이트, 포스포트리에스테르, 메틸 포스포네이트, 단쇄 알킬, 시클로알킬, 단쇄 헤테로아토믹, 헤테로시클릭 당간 결합 등으로 변형될 수 있다. 또한, 안티센스핵산은 하나 이상의 치환된 당 모이어티(sugar moiety)를 포함할 수 있다. 안티센스 핵산은 변형된 염기를 포함할 수 있다. 변형된 염기에는 하이포크잔틴, 6-메틸아데닌, 5-메틸피리미딘(특히 5-메틸시토신), 5-하이드록시메틸시토신(HMC), 글리코실 HMC, 젠토비오실 HMC, 2-아미노아데닌, 2-티오우라실, 2-티오티민, 5-브로모우라실, 5-하이드록시메틸우라실, 8-아자구아닌, 7-데아자구아닌, N6(6-아미노헥실)아데닌, 2,6-디아미노퓨린 등이 있다. 또한, 상기 안티센스 핵산은 상기 안티센스 핵산의 활성 및 세포 흡착성을 향상시키는 하나 이상의 모이어티(moiety) 또는 컨쥬게이트(conjugate)와 화학적으로 결합될 수 있다. 콜레스테롤 모이어티, 콜레스테릴 모이어티, 콜릭산, 티오에테르, 티오콜레스테롤, 지방성 사슬, 인지질, 폴리아민, 폴리에틸렌 글리콜 사슬, 아다맨탄 아세트산, 팔미틸 모이어티, 옥타데실아민, 헥실아미노카르보닐-옥시콜에스테롤 모이어티 등의 지용성 모이어티 등이 있으며 이에 제한되지 않는다. 상기 안티센스 올리고뉴클레오타이드는 통상의 방법으로 시험관에서 합성되어 생체 내로 투여하거나 생체 내에서 안티센스올리고뉴클레오타이드가 합성되도록 할 수 있다.
본 발명에서 "siRNA"란 RNA 방해 또는 유전자 사일런싱을 매개할 수 있는 핵산 분자를 의미한다. siRNA는 표적 유전자의 발현을 억제할 수 있기 때문에 효율적인 유전자 넉다운(knockdown) 방법 또는 유전자 치료 방법으로 제공된다.
본 발명의 siRNA 분자는, 센스 가닥(타겟 유전자인 THBS1 유전자의 mRNA 서열에 상응하는 서열)과 안티센스 가닥(상기 mRNA 서열에 상보적인 서열)이 서로 반대쪽에 위치하여 이중쇄를 이루는 구조를 가질 수 있으며, 본 발명의 siRNA 분자는 자기-상보성(self-complementary) 센스 및 안티센스 가닥을 가지는 단일쇄 구조를 가질 수 있다. 나아가 siRNA는 RNA끼리 짝을 이루는 이중사슬 RNA 부분이 완전히 쌍을 이루는 것에 한정되지 않고 미스매치(대응하는 염기가 상보적이지 않음), 벌지(일방의 사슬에 대응하는 염기가 없음) 등에 의하여 쌍을 이루지 않는 부분이 포함될 수 있다. 또한, siRNA 말단 구조는 타겟 유전자의 발현을 RNAi 효과에 의하여 억제할 수 있는 것이면 평활(blunt) 말단 혹은 점착(cohesive) 말단 모두 가능하고, 점착 말단 구조는 3'-말단 돌출 구조와 5'-말단 돌출 구조 모두 가능하다.
본 발명의 "shRNA"란 small hairpin RNA 혹은 short hairpin RNA으로 불리며, RNA 간섭으로 유전자를 침묵시킬 수 있는 용도로 사용되는 것이다. 보통 벡터를 이용하여 목적 세포로 도입한다. 이러한 shRNA 헤어핀 구조는 세포 내 다른 물질에 의하여 절단되어 siRNA가 되기도 한다.
본 발명의 일 실시예에서는, 상기 THBS1 억제제로, 서열번호 1로 표시되는 shRNA(short hairpin RNA)를 이용하였으나, 본 발명의 목적을 달성할 수 있는 한, 이에 제한되는 것은 아니다.
또한, 본 발명은 상기 서열번호 1로 표시되는 shRNA의 염기서열의 기능적 동등물을 포함할 수 있다. 상기 "기능적 동등물"이란 염기의 결실(deletion), 치환(substitution) 또는 삽입(insertion)의 결과로, 상기 서열번호 1의 염기서열과 적어도 70% 이상, 바람직하게는 80% 이상, 더욱 바람직하게는 90% 이상, 더 더욱 바람직하게는 95% 이상의 서열 상동성을 갖는 것으로, 서열번호 1의 염기서열로 표시되는 폴리뉴클레오타이드와 실질적으로 동질의 생리활성을 나타내는 폴리뉴클레오타이드를 말한다. 폴리뉴클레오타이드에 대한 "서열 상동성의 %"는 두 개의 최적으로 배열된 서열과 비교 영역을 비교함으로써 확인되며, 비교 영역에서의 폴리뉴클레오타이드 서열의 일부는 두 서열의 최적 배열에 대한 참고 서열(추가 또는 삭제를 포함하지 않음)에 비해 추가 또는 삭제(즉, 갭)를 포함할 수 있다.
즉, 본 발명은 THBS1 저해제와 항암제를 병용 투여하는 경우 항암제에 대하여 유도된 저항성 또는 약제 내성을 극복하고 기존 항암제의 항암 효과를 현저히 개선할 수 있음을 밝힌 것에 그 의의가 있으므로, 상기 THBS1 저해제는 본 발명의 기술분야에서 사용되거나 THBS1 저해 활성이 있는 것으로 밝혀진 것이라면 그 종류에 상관 없이 본 발명에 적용될 수 있고, 구체적인 종류에 한정되는 것이 아님은 당업자에게 자명하다고 할 것이다.
또한, 본 발명에 있어서, 상기 THBS1 저해제는 항암제와 동시 또는 순차적으로 투여될 수 있다.
본 발명에 있어서, 상기 항암제는, 항암제는 암을 치료하는 효과가 있는 약물이면 제한없이 이용가능하나, 바람직하게는 표적 항암제인 p53 활성화제인 것을 특징으로 할 수 있고, 상기 p53 활성화제는, 예컨대, APR-246(Eprenetapopt, PRIMA-1MET), CP-31398, PK083, PK11007, NSC319726 (ZMC1), 스틱트산(stictic acid), 뉴틀린-3a(Nutlin-3a), RO6839921, NSC 146109 하이드로클로라이드(hydrochloride), RITA, 테노빈-1(Tenovin-1), HLI373, WR 0165, 이다사뉴틀린(Idasanutlin) 및 YH 239-EE로 이루어진 군으로부터 선택된 1종 이상일 수 있으며, 이에 한정되지 않는다.
본 발명의 일 실시예에서는, 상기 p53 활성화제로 APR-246(Eprenetapopt, PRIMA-1MET)을 이용하였으나, 이에 한정되는 것은 아니다.
또한, THBS1 저해제를 유효성분으로 포함하는 항암제 반응성 증진용 조성물을 제공한다.
즉, 내성 억제 뿐만 아니라 민감성인 세포에서도 함께 병용처리하면 항암제에 대한 반응성을 증진시켜서 사용되는 항암제 투여량을 낮출 수 있고, 항암제 부작용 개선할 수 있다.
또한, 본 발명의 다른 양태에 따르면, 본 발명은 본 발명에 따른 조성물을 포함하는 항암 보조제를 제공한다.
본 발명에서, 용어 "항암 보조제"는 항암제 투여시 항암제와 병용하여 투여함으로써, 항암제의 항암 효과를 개선, 향상 또는 증대시킬 수 있는 제제를 의미한다.
본 발명에 있어서, 상기 항암 보조제는 처리농도에 따라 항암제 또는 항암보조제로서 사용할 수 있으며, 항암제의 감수성(민감성, 민감도)을 증진시킬 수 있다.
본 발명의 상기 보조제는 항암약물과 동시에(simutaneous), 별도로(separate) 또는 순차적(sequential)으로 투여될 수 있다. 상기 본 발명에 따른 항암 보조제의 투여 순서 즉, 항암제와 항암 보조제 중에서 어떤 것을 어느 시점에서, 동시에, 개별적 또는 순차적으로 투여할 것인지의 여부는 의사나 전문가에 의해 결정될 수 있다. 이러한 투여 순서는 많은 인자에 따라 달라질 수 있다. 상기 항암 보조제는 암을 예방, 개선 또는 치료하는 효과를 가지는 공지의 화합물과 병용하여 투여될 수 있다. 이에 있어, 공지의 화합물과 동시 또는 순차적으로 투여될 수 있다.
본 발명의 일 실시예에서, THBS1 저해제는 p53 돌연변이를 가진 암 세포주에서 p53 활성화제의 반응성을 증가시킬 수 있음을 확인하여, 본 발명에 따른 THBS1 저해제가 항암 보조제로 사용될 수 있음을 확인하였다.
또한, 본 발명의 또 다른 양태에 따르면, 본 발명은 THBS1 저해제 및 항암제를 유효성분으로 포함하는 암의 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명에서는, p53 돌연변이를 가진 암 세포주에서 THBS1에 대한 저해제를 p53 활성화제와 함께 사용하는 경우, 종양 억제 단백질로 알려진 p53의 작용을 활성화시킴으로써, 상승된 치료 효과가 달성됨을 입증하였다. 이에 따라, 본 발명의 THBS1 저해제 및 항암제를 포함하는 조합이 다양한 암종에서 효과적인 병용 투여 전략 요법으로 제공된다.
따라서, 본 발명에서는 THBS1(Thrombospondin 1) 저해제를 유효성분으로 포함하는 항암제 내성 억제용 조성물을 대상에게 투여하는 단계를 포함하는, 항암제 내성 억제 방법을 제공한다.
또한, THBS1 저해제 및 항암제를 유효성분으로 포함하는 암의 예방 또는 치료용 약학적 조성물을 대상에게 투여하는 단계를 포함하는, 암 치료 방법을 제공한다.
상기 암의 예방 및/또는 치료 효과는 암세포의 성장을 억제하는 효과뿐 아니라, 이동(migration), 침습 (invasion), 전이(metastasis) 등으로 인한 암의 악화를 억제하는 효과를 포함한다.
본 발명에 있어서, 상기 암은, 본 발명의 조성물이 목적 효과를 달성하는 한, 임의의 암을 대상으로 포함할 수 있으며, 예를 들어, 폐암(lung cancer), 간암(liver cancer), 대장암(colon cancer), 신장암(adrenal cancer), 위암(stomach cancer), 유방암(breast cancer), 혈액암(blood cancer), 뼈암(bone cancer), 췌장암(pancreatic cancer), 피부암(skin cancer), 머리 또는 목암(head or neck cancer), 피부 또는 안구 흑색종(cutaneous or intraocular melanoma), 자궁육종(uterine sarcoma), 난소암(ovarian cancer), 직장암(rectal cancer), 항문암(anal cancer), 난관암(fallopian tube carcinoma), 자궁내막암(endometrial carcinoma), 자궁경부암(cervical cancer), 소장암(small intestine cancer), 내분비암(endocrine cancer), 갑상선암(thyroid cancer), 부갑상선암(parathyroid cancer), 연조직종양(soft tissue tumor), 요도암(urethral cancer), 전립선암(prostate cancer), 기관지암(bronchogenic cancer) 및 골수암(bone marrow tumor)으로 이루어진 군으로부터 선택된 1 종 이상일 수 있고, 본 발명의 일 실시예에서는, 폐암을 대상으로 하였으나, 이에 이에 한정되지 않는다.
상기 암은 p53 돌연변이 암일 수 있다.
본 발명에서 사용되는 용어 "유효성분으로 포함하는"이란, 본 발명의 유효 성분인 THBS1 억제제를 소정의 효능 또는 활성을 달성하는 데 충분한 양으로 포함하는 것을 의미한다. 상기 THBS1 억제제는 약학적으로 유효한 양으로 투여할 수 있으며, 유효 용량수준은 개체의 종류 및 연령, 성별, 약물에 대한 민감도, 치료 기간, 동시에 사용되는 약물 및 기타 의학적 요소에 따라 결정될 수 있다.
본 발명에 있어서, 상기 약학적 조성물은 캡슐, 정제, 과립, 주사제, 연고제, 분말 또는 음료 형태임을 특징으로 할 수 있으며, 상기 약학적 조성물은 인간을 대상으로 하는 것을 특징으로 할 수 있다. 상기 약학적 조성물은 이들로 한정되는 것은 아니지만, 각각 통상의 방법에 따라 산제, 과립제, 캡슐, 정제, 수성 현탁액 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다.
본 발명에 따른 약학적 조성물은 약제학적으로 허용가능한 담체를 포함할 수 있다. 약제학적으로 허용되는 담체는 경구투여시에는 결합제, 활탁제, 붕해제, 부형제, 가용화제, 분산제, 안정화제, 현탁화제, 색소, 향료 등을 사용할 수 있으며, 주사제의 경우에는 완충제, 보존제, 무통화제, 가용화제, 등장제, 안정화제 등을 혼합하여 사용할 수 있으며, 국소투여용의 경우에는 기제, 부형제, 윤활제, 보존제 등을 사용할 수 있다. 본 발명에 따른 약학적 조성물의 제형은 상술한 바와 같은 약제학적으로 허용되는 담체와 혼합하여 다양하게 제조될 수 있다. 예를 들어, 경구투여 시에는 정제, 트로키, 캡슐, 엘릭서(elixir), 서스펜션, 시럽, 웨이퍼 등의 형태로 제조할 수 있으며, 주사제의 경우에는 단위 투약 앰플 또는 다수회 투약 형태로 제조할 수 있다.
한편, 제제화에 적합한 담체, 부형제 및 희석제의 예로는, 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말디톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 또는 광물유 등이 사용될 수 있다. 또한, 충진제, 항응집제, 윤활제, 습윤제, 향료, 유화제, 방부제 등을 추가로 포함할 수 있다.
본 발명에 따른 약학적 조성물의 투여 경로는 이들로 한정되는 것은 아니지만 구강, 정맥내, 근육내, 동맥내, 골수내, 경막내, 심장내, 경피, 피하, 복강내, 비강내, 장관, 국소, 설하 또는 직장이 포함된다. 상기 "비경구"는 피하, 피내, 정맥내, 근육내, 관절내, 활액낭내, 흉골내, 경막내, 병소내 및 두개골 내 주사 또는 주입기술을 포함한다. 본 발명에 따른 약학적 조성물은 또한 직장 투여를 위한 좌제의 형태로 투여될 수 있다.
본 발명에 따른 약학적 조성물은 사용된 특정 유효성분의 활성, 연령, 체중, 일반적인 건강, 성별, 정식, 투여시간, 투여경로, 배출율, 약물 배합 및 예방 또는 치료될 특정 질환의 중증을 포함한 여러 요인에 따라 다양하게 변할 수 있고, 상기 약학적 조성물의 투여량은 환자의 상태, 체중, 질병의 정도, 약물형태, 투여경로 및 기간에 따라 다르지만 당업자에 의해 적절하게 선택될 수 있다. 바람직하게는 상기 요소를 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여할 수 있으며, 더욱 바람직하게는 1~10000㎍/체중kg/day, 더욱더 바람직하게는 10~1000㎎/체중kg/day의 유효용량으로 하루에 수회 반복 투여될 수 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.
본 발명의 약학적 조성물은 대상 적응증의 예방 또는 치료를 위하여 단독으로, 또는 수술, 방사선 치료, 호르몬 치료, 화학 치료 및 생물학적 반응 조절제를 사용하는 방법들과 병용하여 사용할 수 있다.
본 발명에 있어서, p53 활성화제와 THBS1 저해제를 병용 투여함으로써, 단일 약물 사용시와 비교하여 우수한 상승 효과를 거둘 수 있을 뿐 아니라, 단일 약물 사용시와 비교하여 투여 농도 감소 및/또는 투여 간격 증가시에도 동등 이상의 효과를 얻을 수 있는, 우수한 항암 효과를 발휘한다.
즉, 상기 p53 활성화제는 항암 효능을 나타내기 위해서 고농도의 처리가 필요하다는 한계가 있어 왔다. 이러한 한계는 본 발명에서 제안되는 바와 같이 THBS1 저해제와 함께 병용 투여하여 항암 효과를 얻을 수 있는 최저 농도를 현격하게 낮춤으로써 극복 가능하다.
또한, 본 발명의 또 다른 양태에 따르면, 본 발명은 THBS1 저해제를 유효성분으로 포함하는 항암제 내성 억제용 식품 조성물을 제공한다.
본 발명에 따른 식품 조성물은 기능성 식품(functional food), 영양 보조제(nutritional supplement), 건강식품(health food), 건강보조식품(health supplement) 및 식품 첨가제(food additives) 등의 모든 형태를 포함한다. 상기 유형의 식품 조성물은 당업계에 공지된 통상적인 방법에 따라 분말제, 정제, 캡슐제, 환제 및 액제로 이루어진 군에서 선택된 어느 하나의 형태로 제형화 될 수 있으나, 이에 제한되는 것은 아니다. 당 업계에 공지된 방법을 이용하여 다양한 형태로 제조할 수 있다.
예를 들면, 건강식품으로는 본 발명의 THBS1 억제제 자체를 과립화, 캡슐화 및 분말화하여 섭취하거나 차, 쥬스 및 드링크의 형태로 제조하여 음용하도록 할 수 있다. 또한, 본 발명의 THBS1 억제제를 암의 예방, 개선 또는 치료 활성이 있다고 알려진 공지의 물질 또는 활성 성분과 함께 혼합하여 조성물의 형태로 제조할 수 있다.
또한, 기능성 식품으로는 음료(알콜성 음료 포함), 과실 및 그의 가공식품(예: 과일통조림, 병조림, 잼, 마멀레이드 등), 어류, 육류 및 그 가공식품(예: 햄, 소시지콘비이프 등), 빵류 및 면류(예: 우동, 메밀국수, 라면, 스파게티, 마카로니 등), 과즙, 각종 드링크, 쿠키, 엿, 유제품(예: 버터, 치이즈 등), 식용식물유지, 마아가린, 식물성 단백질, 레토르트 식품, 냉동식품, 각종 조미료(예: 된장, 간장, 소스 등) 등에 본 발명의 THBS1 억제제를 첨가하여 제조할 수 있다.
또한 본 발명의 식품 조성물은 통상의 식품 첨가물을 포함할 수 있으며, 상기 "식품 첨가물"로서의 적합 여부는 다른 규정이 없는 한, 식품의약품안전처에 승인된 식품 첨가물 공전의 총칙 및 일반시험법 등에 따라 해당 품목에 관한 규격 및 기준에 의하여 판정한다. 상기 "식품 첨가물 공전"에 수재된 품목으로는 예를 들어, 케톤류, 글리신, 구연산칼륨, 니코틴산, 계피산 등의 화학적 합성물, 감색소, 감초추출물, 결정셀룰로오스, 고량색소, 구아검 등의 천연첨가물, L-글루타민산나트륨 제제, 면류첨가알칼리제, 보존료제제, 타르색소제제 등의 혼합제제류들을 들 수 있다.
본 발명의 식품 조성물에 있어, 상기 THBS1 억제제는 바람직하게 식품 조성물 대비 0.00001~50 중량%로 포함될 수 있다. 상기 함량이 0.00001 중량% 미만일 경우에는 그 효과가 미비하고, 50 중량%를 초과하는 경우에는 사용량 대비 효과 증가가 미미하여 비경제적이다.
또한, 본 발명의 THBS1 억제제를 식품 첨가제의 형태로 사용하기 위해서는 정제, 캡슐, 분말, 과립, 액상, 환 등의 형태로 제조하여 사용할 수 있다.
본 발명의 조성물이 음료로 제조될 경우, 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 포함할 수 있다. 상술한 천연 탄수화물은 포도당, 과당과 같은 모노사카라이드, 말토오스, 수크로오스와 같은 디사카라이드, 및 덱스트린, 사이클로덱스트린과 같은 천연 감미제나, 사카린, 아스파르탐과 같은 합성 감미제 등을 사용할 수 있다. 상기 천연 탄수화물의 비율은 본 발명의 조성물 100 ml 당 일반적으로 약 0.01 내지 10 g, 바람직하게는 약 0.01 내지 0.1 g이다.
상기 외에 본 발명의 조성물은 여러 가지 영양제, 비타민, 전해질, 풍미제, 착색제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알코올, 탄산 음료에 사용되는 탄산화제 등을 포함할 수 있다. 그 밖에 본 발명의 조성물은 천연 과일주스, 과일주스 음료 및 야채 음료의 제조를 위한 과육을 포함할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 크게 중요하진 않지만 본 발명의 조성물 100 중량부 당 0.01 내지 0.1 중량부의 범위에서 선택되는 것이 일반적이다.
본 발명에 있어서, "건강보조식품" 또는 "건강기능식품(health functional food)"이란 건강기능식품에 관한 법률에 따른 인체에 유용한 기능성을 가진 원료나 성분을 사용하여 제조 및 가공한 식품을 의미하며, "기능성"이라 함은 인체의 구조 및 기능에 대하여 영양소를 조절하거나 생리학적 작용 등과 같은 보건 용도에 유용한 효과를 얻을 목적으로 섭취하는 것을 의미한다.
또한, 본 발명의 또 다른 양태에 따르면, 본 발명은 다음 단계를 포함하는, 항암제 내성을 억제하는 물질의 스크리닝 방법을 제공한다:
(a) THBS1를 발현하는 분리된 암세포에 후보물질을 접촉시키는 단계;
(b) 상기 (a) 단계의 암세포에서 THBS1의 발현 수준을 측정하는 단계; 및
(c) 아무 것도 처리하지 않은 대조군과 비교하여, 상기 (b) 단계에서 측정된 THBS1의 발현 수준이 낮은 경우, 상기 후보물질을 항암제 내성을 억제하는 물질로 선택하는 단계.
본 발명에 있어서, THBS1의 발현 수준, 즉, THBS1 유전자의 발현 수준 또는 THBS1 단백질의 양을 측정하는 방법은 공지의 기술을 이용하여 생물학적 시료로부터 mRNA 또는 단백질을 분리하는 공지의 공정을 포함하여 수행될 수 있다. 상기 생물학적 시료는 상기 유전자의 발현 수준 또는 단백질의 수준이 대조군과는 다른, 생체로부터 채취된 시료를 말하며, 상기 시료로는 예를 들면, 조직, 세포, 혈액, 혈청, 혈장, 타액 및 뇨 등이 포함될 수 있으나, 이에 제한되지 않는다.
상기 유전자의 발현 수준 측정은 바람직하게는 mRNA의 수준을 측정하는 것이며, mRNA의 수준을 측정하는 방법으로는 역전사 중합효소연쇄반응(RT-PCR), 실시간 역전사 중합효소연쇄반응, RNase 보호 분석법, 노던 블럿 및 DNA 칩 등이 있으나, 이에 제한되지 않는다.
상기 단백질 수준의 측정은 항체를 이용할 수 있는데, 이러한 경우 생물학적 시료 내의 상기 마커 단백질과 이에 특이적인 항체는 결합물, 즉, 항원-항체 복합체를 형성하며, 항원-항체 복합체의 형성량은 검출 라벨(detection label)의 시그널의 크기를 통해서 정량적으로 측정할 수 있다. 이러한 검출 라벨은 효소, 형광물, 리간드, 발광물, 미소입자(microparticle), 레독스 분자 및 방사선 동위원소로 이루어진 그룹 중에서 선택할 수 있으며, 이에 제한되지 않는다. 단백질 수준을 측정하기 위한 분석 방법으로는 웨스턴 블롯, ELISA, 방사선면역분석, 방사선 면역 확산법, 오우크테로니 면역 확산법, 로케트 면역전기영동, 조직면역 염색, 면역침전 분석법, 보체 고정분석법, FACS, 단백질 칩 등이 있으나, 이에 제한되지 않는다.
본 발명에 있어서, 상기 후보물질은 통상적인 선정방식에 따라 THBS1 단백질 또는 THBS1 단백질을 코딩하는 유전자의 활성 또는 발현 수준을 저해하는 의약으로서의 가능성을 지닌 것으로 추정되거나 또는 무작위적으로 선정된 개별적인 핵산, 단백질, 기타 추출물 또는 천연물, 화합물 등이 될 수 있다.
본 발명의 일 실시예에서는, THBS1 저해제를 p53 활성화제와 병용 투여 시 시너지 효과를 통하여 항암제 내성을 극복하고 항암 효과를 증대시킬 수 있음을 확인하였는바, 상기 THBS1 단백질 또는 유전자의 활성 또는 발현 수준을 감소시키는 물질은 항암제에 대한 내성 억제 또는 개선용 제제로서 사용될 수 있다.
또한, 본 발명의 또 다른 양태에 따르면, 본 발명은 다음 단계를 포함하는, p53 활성화제에 대한 내성을 판단하기 위한 정보 제공 방법을 제공한다:
(a) 대상체로부터 분리된 시료에서 THBS1의 발현 수준 및 p53의 돌연변이 여부를 측정하는 단계;
(b) 상기 THBS1의 발현수준이 대조군 시료보다 높게 나타나고 p53에 돌연변이가 발생한 경우, 상기 대상체가 p53 활성화제에 대한 내성을 갖는 것으로 판단하는 단계.
본 명세서에 있어서, "p53 활성화제에 대한 내성을 판단하기 위한 정보 제공 방법"이란 항암제로서 p53 활성화제를 암 치료에 사용할 경우에 상기 p53 활성화제에 대한 치료 효과에 대한 정보를 제공하는 방법으로서, p53 활성화제에 대한 저항성을 나타내지 않는지, 효과적으로 암의 진행을 억제하거나, 암세포를 사멸시킬 수 있는지 등에 대한 정보를 제공하는 방법을 의미한다.
바람직하게는, 암 환자의 p53 유전자에 돌연변이가 있어 p53 기능이 정상적으로 작용하지 않고, THBS1이 대조군 시료와 비교하여 높은 수준으로 발현될 때 p53 활성화제를 효과적인 암 치료에 사용할 수 없다는 정보를 제공하는 방법을 의미하나, 생물학적 시료로부터 p53 활성화제의 암 치료 효과와 관련된 정보를 획득할 수 있는 방법이라면 이에 제한되지 않는다.
본 발명의 방법은 상술한 THBS1를 이용하므로, 이와 중복된 내용은 본 명세서의 과도한 복잡성을 피하기 위하여 그 기재를 생략한다.
본 발명에 따른 THBS1 저해제는 표적 항암제에 대한 약제 내성을 억제하여, 표적 항암제와 병용 투여 시 항암 효과를 상승시킨다. 따라서, 본 발명은 표적 항암제에 대한 내성을 극복하고 암환자의 항암제에 대한 치료 적중률을 높일 수 있어 표적 항암제를 이용한 치료전략에 새로운 가능성을 제시하고, 정밀의학 실현에 기여할 수 있다.
도 1은 본 발명의 표적 항암제 내성을 극복하기 위한 병용 타겟의 발굴 과정을 개략적으로 보여준다. (1)은 데이터베이스로부터 얻은 pathway 정보와 세포주들의 유전자 발현량, 약물 반응 정보를 나타낸다. (2)는 (1)에서 얻은 세포주의 약물 반응 정보에 기반해 나눠진 민감한 세포주와 저항성을 가진 세포주를 나타낸다. (3)은 (2)의 민감한 세포주 데이터를 사용하여 본 발명에서 제시하는 AnoDAN (anomalous gene detection using generative adversarial networks and graph neural networks for overcoming drug resistance) 딥러닝 모델을 학습하는 과정을 나타낸 것이다. (4)는 (3)에서 학습된 모델에 (2)의 저항성 세포주를 세포주를 입력하여 pathway, sample, gene 레벨에서의 이상치 점수를 구하는 과정을 나타낸 것이다. (5)는 (4)의 이상치 점수를 이용해 내성을 초래하는 pathway를 선정하고, 그 경로 내에서 각 유전자의 이상치 점수를 나타낸 것이다. (6)은 (5)에서 선정된 경로 내의 높은 유전자 이상치 점수에 기반하여 선정된 내성 극복 병용 타겟 유전자를 나타낸다. (7)은 (6)의 선정된 타겟 유전자의 발현량 조절을 통한 약물 반응성의 변화와 내성 발생 메커니즘 검증 과정을 나타낸 것이다.
도 2는 본 발명의 효과적인 내성 극복 병용 타겟과 메커니즘을 규명한 과정을 개략적으로 보여준다. 도 2A는 유전자 발현과 pathway 데이터를 함께 사용하여 GAN (generative adversarial networks)과 GNN (graph neural networks)를 활용한 새로운 DNN (deep neural networks) 구조를 가진 AnoDAN과 학습 과정을 나타낸다. 도 2B는 실제 데이터와 생성된 데이터 간의 차이를 이용해 유전자 수준, pathway 수준, 샘플 수준 이상치 점수를 부여하는 방법을 나타낸다. 도 2C는 제안된 AnoDAN을 구성하고 있는 생성자 (generator), 판별자 (discriminator), 그리고 인코더 (encoder) 각각의 손실 함수 (loss function) 가 수렴하여 모델이 학습되었음을 나타낸 것이다. 도 2D는 실제 데이터와 2C의 모델에서 생성된 데이터가 UMAP (uniform manifold approximation and projection) 으로 2차원에 사상되었을 때 잘 겹치는 것을 통해 모델이 학습되었음을 나타낸 것이다.
도 3은 본 발명의 표적 항암제 내성을 극복하기 위한 병용 타겟의 발굴 학습 모델로 약물에 민감한 세포주와 저항성을 가지는 세포주에 대해 계산한 샘플 수준 이상치 점수를 출력한 결과를 보여준다.
도 4는 본 발명의 학습 모델의 신뢰성을 확인하기 위하여 공지된 트라메티닙 (trametinib) 데이터를 활용하여 학습을 진행한 결과를 보여준다. 도 4A는 생성자 (generator), 판별자 (discriminator), 그리고 인코더 (encoder)의 손실 함수 (loss function) 가 수렴하여 모델이 학습되었음을 나타낸 것이다. 도 4B는 실제 데이터와 4A의 모델에서 생성됨 데이터가 UMAP 으로 2차원에 사상되었을 때 잘 겹치는 것을 통해 모델이 학습되었음을 나타낸 것이다. 도 4C는 트라메티닙의 내성에 관해 높은 이상치 점수를 띄는 pathway의 순위를 보여준다.
도 5는 본 발명의 학습 모델에 적용하여 얻은 p53 신호전달경로와 TGF-beta 신호전달경로에 공통적으로 속하며 높은 이상치 점수를 가진 유전자인 THBS1를 목적 약물 내성 극복을 위한 병용 타겟으로 선정한 과정을 보여준다. 도 5A는 약물에 저항성을 가진 세포주 데이터를 미리 민감한 세포주로 학습된 모델에 적용하여 얻은 pathway 수준 이상치 점수를 나타낸 것이다. 도 5B는 5A에서 이상치 점수가 가장 높은 p53 신호전달경로 내에서의 각 유전자의 이상치 점수를 보여준다. 이때 이상치 점수는 색의 진함정도로 표현된다. 도 5C는 5A에서 이상치 점수가 두번째로 높은 TGF-beta 신호전달경로 내에서의 유전자 이상치 점수를 나타낸다. 도 5D는 5B, 5C의 두 신호전달경로에 공통적으로 속하며 높은 이상치 점수를 가진 THBS1 유전자가 목적 약물 내성 극복을 위한 병용 타겟으로 선정되었음을 나타낸 것이다.
도 6은 본 발명의 병용 타겟 유전자로 선정된 THBS1의 암 세포주에서의 발현 수준을 확인한 결과를 보여준다. 도 6A는 사용한 데이터 상에서 THBS1의 발현량이 약물에 저항성을 가진 세포주에서 민감한 세포주에 비해 높은 것을 보여준다. 도 6B는 직접 수행한 실험 상에서 내성 세포주와 민감 세포주에서의 THBS1 mRNA 발현량을 비교해 보았을 때 내성 세포주에서 더 높은 것을 보여준다.
도 7은 p53 돌연변이가 존재하는 암 세포주에서의 p53 활성화제에 대한 약물 반응을 확인한 결과를 보여준다. 도 7A는 실제 실험 상에서 p53 활성화제인 APR-246 약물에 대해 내성 세포주는 약물에 반응을 거의 하지 않는 것을 보여준다. 도 7B는 민감 세포주에서 약물을 처리하면 약물에 대한 반응이 뚜렷이 나타나는 것을 보여준다. 도 7C는 7A, 7B의 결과를 crystal violet 실험을 통해 살아있는 세포만을 염색해 약물 반응을 한번 더 확인한 결과이다.
도 8은 약물 저항성을 갖는 암 세포주와 약물 민감성을 나타내는 암세포주에서 THBS1 발현 조절 및 p53 활성화제 병용에 따른 결과와 내성 극복 메커니즘을 실험적으로 검증한 결과를 보여준다. 도 8A는 APR-246 약물에 저항성을 가진 세포주인 NCI-H1792와 NCI-H1793에 THBS1의 발현량을 감소시킨 후 mRNA level을 확인함으로써 발현량의 감소가 잘 된 것을 보여준다. 도 8B는 약물 반응성이 높은 세포주인 NCI-H2009와 HCC827에는 THBS1의 발현량을 증가시킨 후 mRNA level을 확인함으로써 발현량이 잘 증가된 것을 보여준다. 도 8C는 저항성을 가진 세포주에서 THBS1 발현을 저해했을 때, 약물의 반응성이 더 높아지는 것을 세포의 생존율 그래프와 crystal violet 실험을 통해 증명한 것을 보여준다. 도 8D는 약물에 민감한 세포주에서 THBS1 발현을 증가시켰을 때, 세포가 약물에 저항성을 띄는 것을 보여준다. 도 8E는 THBS1과 TGF-beta 신호전달경로 간의 서로 활성화 시키는 양성 피드백 관계를 보여준다. 이때 양성 피드백 관계를 확인하기 위해 TGFβ1과 p-SMAD2/3의 단백질 발현량을 비교하였을 때, 저항성을 띄는 세포주에서 약물과 THBS1의 병용 처리를 하면 TGF-beta 신호전달경로 내의 단백질 발현이 감소하는 것을 확인할 수 있다. 도 8F는 약물에 민감한 세포주에 동일한 실험을 했을 때 병용 처리시 TGF-beta 신호전달경로 내의 단백질 발현이 증가하는 것을 통해 양성 피드백 관계를 실험적으로 검증한 결과를 보여준다. 도 8G는 앞서 실험에서 관찰된 양성 피드백은 THBS1이 TGFβ1를 활성화시키고 TGFβR를 거쳐 p-SMAD2/3이 활성화되어 다시 THBS1이 발현되는 과정을 거친다는 것을 나타낸다. 도 8H는 APR-246을 단독 처리 했을 때는 THBS1과 TGF-beta 신호전달경로 간의 양성 피드백으로 인해 약물 내성이 생기므로, THBS1을 저해 시키는 병용처리를 함으로써 약물의 반응성을 높일 수 있다는 것을 보여준다.
도 9는 본 발명의 약물에 민감한 세포주에서의 THBS1 저해제 및 p53 활성화제 병용시 농도에 따른 효과를 확인한 결과를 보여준다. 도 9A와 9B는 민감 세포주에서 THBS1을 저해시킨 후 세포의 생존율을 관찰한 결과이다.
도 10은 본 발명의 THBS1과 TGF-beta 신호전달경로 간의 양성 피드백을 확인한 결과를 보여준다. 도 10A는 약물 내성 세포주에서 민감 세포주에 비해 TGFβ1의 mRNA 발현량이 높은 것을 보여준다. 도 10B는 내성 세포주에 THBS1을 저해했을 때 TGFβ1도 함께 감소되는 것을 보여준다. 도 10C는 GDSC 데이터베이스에서 제공하는 Signaling Pathway Enrichment using Experimental Datasets (SPEED) 데이터 상에서 TGF-beta 신호전달경로의 활동 점수가 내성 세포주에서 더 높은 것을 나타낸다. 도 10D와 10E는 두 가지 민감 세포주에서 세포를 씨딩한 후 24시간 후에 TGF-beta 신호전달경로 활성화 약물을 처리했을 때, TGFβ1의 mRNA 발현량이 증가함과 동시에 THBS1의 발현량도 증가하는 것을 보여준다.
이하, 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실험방법 및 재료
세포 배양
인간 폐암 세포주인 NCI-H1793, NCI-H2009, 그리고 HCC827은 한국세포주은행 (KCLB)에서, NCI-H1792는 ATCC (American Type Culture Collection)에서 구입했다. NCI-H1793과 HCC827은 10% 소태아혈청 (FBS; Fetal bovines serum)과 항생제 (100 U/ml penicillin, 100 μg/ml of streptomycin, 그리고 0.25 μg/ml of Fungizone)가 보충된 RPMI 1640 배지에서 배양되었다. NCI-H1792와 NCI-H2009는 DMEM 배지에서 동일한 보충제와 함께 배양되었다. 모든 세포주는 5% 이산화탄소가 포함된 인큐베이터에서 37℃로 배양되었다.
시약
Dimethyl sulfoxide (DMSO)는 Sigma-Aldrich에서 구입하였고, 약물의 컨트롤로 사용되었다. APR-246과 TGFβ1 단백질은 MedChemExpress (MCE)에서 구입했다. APR-246은 25mg을 최종농도 10mM 희석하여 사용하였고, 세포생존율을 확인할 때는 4-5일간, 그리고 웨스턴 블롯 실험을 할 때는 24시간동안 세포에 처리하였다. 그리고 10μg/ml 농도의 TGFβ1는 TGF-beta pathway activator로써 약물에 민감한 세포주를 씨딩하고 24시간 후에 5ng/ml을 처리하고, 24시간 후에 세포를 하베스트하였다.
유전자 넉다운 및 과발현 실험을 위한 바이러스 생산
HEK 293T 세포를 사용하여 THBS1을 표적으로 하는 shRNA와 과발현 벡터를 형질감염시켰다. shRNA (shTHBS1; GTAGGTTATGATGAGTTTAAT; 서열번호 1), 과발현 벡터 (pDNA(VB220725-1808zjh); VectorBuilder)에 더불어 스크램블과 패키징 믹스 (pLP1, pLP2, 그리고 pLP/VSVG)를 리포펙타민과 함께 사용하여 렌티바이러스를 생산하였다. 형질감염 후 48시간 후에 타겟 세포주인 NCI-H1792, NCI-H1793, NCI-H2009, 그리고 HCC827에는 바이러스 생성물과 4μg/ml의 폴리브렌을 사용하여 형질도입을 수행하였다. 최소 일주일 동안 1μg/ml의 퓨로마이신을 사용하여 감염된 세포를 선별하였다.
세포 성장 분석 및 크리스탈 바이올렛 분석
세포를 96well 플레이트에 3-5x103개의 세포를 각 well당 씨딩하였다. 그 다음 씨딩한 후 24시간 이내에 약물을 처리하였다. 약물 처리 후 4-5일 동안 IncuCyte ZOOM을 사용하여 3시간마다 세포 성장을 기록하였다. IncuCyte ZOOM 2016A 소프트웨어를 사용하여 세포 생존율을 분석하였다. 4-5일 후 세포를 실온에서 30분 동안 1% 크리스탈 바이올렛으로 염색하고 증류수로 세척하여 살아있는 세포의 양을 확인하였다.
Total RNA 추출 및 실시간 중합효소 연쇄 반응 (qRT-PCR)
인트론바이오테크놀로지의 total RNA 추출 키트를 사용하여 세포에서 total RNA를 추출하였다. RNase-free DNase I을 처리하여 genomic DNA를 제거하였다. Complementary DNA (cDNA)는 쏠젠트의 DiaStar RT 키트를 사용하여 합성하였다. 그리고 RT-PCR을 Applied Biosystems의 Veriti 96-well Thermal Cycler를 사용하여 수행하였고, QuantStudio 5 실시간 PCR 시스템, SYBR master mix (Genet Bio), 그리고 프라이머를 사용하여 실시간 중합효소 연쇄 반응 (qRT-PCR)을 수행하였다. 이 때 사용된 qRT-PCR 프라이머의 시퀀스는 하기 표 1에 정렬하였다.
[표 1]
Figure PCTKR2023003905-appb-img-000001
웨스턴 블롯
세포에 약물 처리 후 24시간 후에 수득하여 세포를 PBS (phosphate-buffered saline)로 세척하고, 용해 완충액 (20mM HEPES (pH7.2), 150mM NaCl, 0.5% Triton X-100, 10% glycerol, 0.1% SDS)와 0.1% protease inhibitor and phosphatase inhibitor cocktail로 용해시켰다. Santa Cruz Biotechnology Inc.의 anti-THBS1 (sc-59887), anti-TGFβ1 (sc-130348), anti-SMAD2/3 (sc-133098), mouse IgG (sc-2025), rabbit IgG (sc-2027)와 Cell Signaling Technology Inc.의 anti-phospho-SMAD2/3 (#8828) 안티바디를 사용하여 웨스턴 블롯 실험을 수행하였다.
실시예 1. 표적 항암제 내성을 극복하기 위한 병용 타겟의 발굴
1-1. 발굴 모델 구축
본 발명자들은, 표적 항암제에 대한 내성을 극복하는 데 효과적인 병용 타겟을 발굴하기 위해, 신호전달 데이터베이스를 기반으로 유전자 발현 정보와 pathway 정보를 GAN (Generative Adversarial Networks) 모델에 적용하여 이상치 탐지 분석을 진행하는 방법론을 제시하였다. 대표적으로, 표적 항암제로서 p53을 활성화하는 p53-표적 제제 약물인 APR-246을 대상으로 하여 실험을 실시하였다.
간략하게는 다음과 같다: Genomics of Drug Sensitivity in Cancer (GDSC)와 Kyoto Encyclopedia of Genes and Genomes (KEGG) 데이터베이스로부터 얻은 데이터를 사용하였다. Pathway 정보를 위해 KEGG 데이터베이스를 사용하였으나, 유전자 간 연결 정보를 제공하는 다른 데이터베이스 사용도 가능하다. 이상치 탐지 분석은 다음 세 단계로 진행하였다. 첫번째로 APR-246 약물에 민감한 세포주의 유전자 발현 정보를 모사하도록 GAN 모델을 학습하였다. 이 때 GAN 모델의 판별자 (discriminator)에는 GNN을 적용하여 실제 유전자 발현 정보인지, 생성자 (generator)가 생성한 유전자 발현 정보인지 pathway 수준에서 판별할 수 있도록 하였다. 두번째로 APR-246 약물에 민감한 세포주의 발현 정보를 미리 학습된 GAN의 내재 공간 (latent space)에 임베딩하기 위해 인코더 (encoder)를 학습하였다. 세번째로 APR-246 약물에 저항성을 가지는 세포주의 유전자 발현 정보를 미리 학습된 인코더와 GAN 모델의 생성자로 재생성한 후 실제 발현량과의 차이를 계산하여 이상치 탐지를 하였다. 이러한 방법은 pathway 정보를 학습 과정에서 사용함으로써 더욱 풍부한 생물학적 정보를 내성 극복 유전자를 찾는 것에 활용할 수 있고, 이를 통해 pathway 수준의 내성 극복 메커니즘을 규명하는 것이 가능하다. 이를 이용하여 상위 이상치 점수를 가진 p53 신호전달경로와 TGF-beta 신호전달경로가 APR-246 약물의 내성에 대한 원인이 된다는 것을 알 수 있었고, 두 신호전달 경로에서 모두 이상치 점수가 높은 THBS1이 약물 내성 극복을 위한 타겟 유전자로 발굴되었다.
보다 구체적으로, GDSC와 KEGG 데이터베이스에서 얻은 데이터를 약물에 대해 IC50 값을 기준으로 민감한 세포주와 저항성을 가진 세포주를 나누었다. 민감한 세포주 데이터를 사용하여 AnoDAN (anomalous gene detection using generative adversarial networks and graph neural networks for overcoming drug resistance)라는 모델을 학습하고, 저항성을 가진 세포주를 학습된 모델에 입력하여 pathway, sample, gene 수준에서의 이상치 점수를 구하였다. 이상치 점수를 바탕으로 내성을 초래하는 pathway를 선정하고, 그 pathway 내에서 이상치 점수가 높은 유전자를 내성 극복 병용 타겟으로 선정하였다. 선정된 타겟의 유전자 발현량을 증가시키거나 저해시켜 약물 반응성의 변화를 관찰하고, 내성 발생 메커니즘을 실험적으로 검증하였다(도 1).
또한, 유전자 발현과 pathway 정보를 함께 사용하여 효과적인 내성 극복 병용 타겟과 메커니즘 규명을 하기 위해 GAN과 GNN의 장점을 활용한 새로운 DNN 구조를 가진 AnoDAN을 제안하였다(도 2A). 또한, 어떤 pathway와 유전자가 내성 발생을 초래하는지 판단하기 위하여 실제 데이터와 생성된 데이터 간의 차이를 이용해 이상치 점수 부여하는 방법을 제안하였다(도 2B). 생성자 (generator), 판별자 (discriminator) 및 인코더 (encoder) 각각의 손실 함수 (loss function) 결과가 잘 수렴하는 것을 통해 학습이 제대로 된 것을 확인하였다(도 2C). 또한, Uniform Manifold Approximation and Projection (UMAP)이라는 차원 축소 알고리즘 결과 상 실제 데이터와 생성된 데이터가 잘 일치하는 것을 통해 학습이 잘 이루어진 것을 확인하였다(도 2D).
또한, 앞서 제시한 이상치 점수는 미리 학습된 인코더와 생성자를 사용하여 실제 데이터와 생성된 데이터의 차이를 사용하여 계산된다. 모델은 약물에 민감한 세포주 데이터를 사용하여 미리 학습되었기 때문에 생성자는 민감한 세포주의 특성을 잘 모사하는 데이터를 생성하는 능력을 지니게 된다. 따라서 모델에 약물에 저항성을 띄는 세포주 데이터를 입력하면 생성자는 보지 못한 분포의 데이터이기 때문에 실제와 유사한 데이터를 생성하지 못하게 되어 이상치 점수가 높아지게 된다. 결과적으로, 도 3에 나타낸 바와 같이, 약물에 저항성을 가진 세포주의 이상치 점수가 민감한 세포주의 점수보다 높은 것을 통해 모델의 학습이 충분이 되어 민감한 세포주의 특성을 잘 담고 있다는 것을 확인하였다.
또한, 모델의 신뢰성을 확인하기 위하여 동일한 파이프라인을 MEK 저해제로 잘 알려진 트라메티닙 (trametinib) 데이터를 활용하여 학습을 진행하였다. 제대로 수렴하는 손실 함수 (loss function) 결과를 통해 모델의 학습이 잘 된 것을 확인하였다(도 4A). UMAP 상에서 실제 데이터와 생성된 데이터가 잘 겹치는 것을 통해 모델 학습이 충분히 된 것을 한번 더 확인하였다(도 4B). MEK 저해제이기 때문에 MAPK 신호전달경로와 관련이 높은 약물이라는 것이 잘 알려져 있는 것과 동일하게 MAPK 신호전달경로가 상위 pathway로 나타남을 확인하였다(도 4C). 따라서, 모델의 신뢰성과 다른 약물에서의 적용성을 검증하였다.
1-2. 병용 약물 표적 발굴
본 발명자들은, 상기 실시예 1-1에서 구축한 발굴 모델을 기반으로, 표적 항암제로서 다양한 p53 활성화제 중 APR-246을 대상으로 하여, 상기 APR-246에 대한 약물 내성(저항성)을 억제하고 민감성을 증진시켜 궁극적으로 효과적인 항암 효과를 달성하는 데 시너지 효과를 발휘하는 병용 약물 표적을 발굴하였다.
그 결과, 약물 저항성을 가진 세포주 데이터를 미리 학습된 모델에 적용하여 얻은 이상치 점수 결과를 통해 높은 이상치 점수를 가진 유전자가 가장 많이 속한 상위 pathway로 p53 신호전달경로와 TGF-beta 신호전달경로임을 확인하였다(도 5A). P53 신호전달경로 내에서 각 유전자의 이상치 점수를 색의 진함 정도로 표현하였으며 이를 바탕으로 상위 유전자를 선정하였다(도 5B). TGF-beta 신호전달경로에서도 같은 과정을 거쳐 상위 유전자를 선정하였다(도 5C). 이 두 신호전달경로에 공통적으로 속하며 높은 이상치 점수를 가진 유전자인 THBS1를, APR-246 내성 극복을 위한 병용 타겟으로 선정하였다(도 5D).
1-3. 암 세포주에서의 발현 수준
본 발명자들은, 상기 실시예 1-2에서 타겟 유전자로 선정된 THBS1의 암 세포주에서의 발현 수준을 확인하였다.
그 결과, 사용한 데이터 상에서 THBS1은 APR-246 약물에 저항성(내성)을 가진 암 세포주에서 민감한 세포주에 비해 발현량이 높았다(도 6A). 또한, APR-246 약물에 내성을 갖는 폐암 세포주(NCI-H1792, NCI-H1793)와 APR-246 약물에 민감한 폐암 세포주(HCC827, NCI-H2009)에서의 THBS1 mRNA 발현 수준을 실제 실험 상에서 비교했을 때, 내성 세포주에서 더 높은 것을 관찰하였다(도 6B). 따라서, 내성 세포주에서 THBS1을 저해하는 전략이 필요하다는 것을 확인하였다.
1-4. p53 돌연변이가 존재하는 암 세포주에서의 p53 활성화제에 대한 약물 반응
본 발명자들은 p53 돌연변이를 가진 것으로 공지된 NCI-H1793, NCI-H1792, HCC827 및 NCI-H2009 폐암 세포주를 대상으로 APR-246 약물 처리 농도에 따른 세포생존율을 확인하였다. 이때, APR-246 약물-민감성 세포주와 내성 세포주는 z-score normalized IC50 값을 기준으로 구분하였다.
그 결과, NCI-H1793 및 NCI-H1792는 APR-246을 처리했음에도 반응을 거의 하지 못하는 것을 확인하였다(도 7A). 반면, HCC827 및 NCI-H2009는 APR-246 처리 후 반응이 뚜렷이 나타났다(도 7B). crystal violet 염색을 통해 한번 더 확인하였다(도 7C).
이에, 이하 실시예에서는 APR-246 약물-내성(저항성) 세포주로 NCI-H1793과 NCI-H1792를, APR-246 약물-민감성(반응성) 세포주로 HCC827과 NCI-H2009 세포주를 사용하였다.
실시예 2. THBS1 발현 조절 및 p53 활성화제 병용에 따른 효과 및 내성 메커니즘 확인
본 발명자들은, THBS1 저해제 및 p53 활성화제(표적 항암제)의 조합이 p53 활성화제에 대한 약물 내성을 극복할 수 있는지 확인하기 위하여, THBS1 저해제 및 p53 활성화제를, APR-246에 내성을 갖는 폐암 세포주 및 APR-246에 민감한 폐암 세포주에 처리한 후 암세포 생존율 및 crystal violet 염색을 측정하였다. 또한 APR-246에 약물 반응성이 높은 폐암 세포주인 NCI-H2009와 HCC827에는 THBS1를 과발현시키고, 과발현에 따른 세포 사멸 효과를 확인하였다.
이때, APR-246에 약물 저항성을 가진 폐암 세포주인 NCI-H1792와 NCI-H1793 세포주에 THBS1 저해제로서 THBS1을 타겟으로 하는 shRNA(서열번호 1; GTAGGTTATGATGAGTTTAAT)를 처리했을 때 THBS1 mRNA 발현 수준이 감소된 것을 확인하였다(도 8A). 또한, APR-246에 약물 반응성이 높은 폐암 세포주인 NCI-H2009와 HCC827에는 THBS1를 과발현시켰을 때 THBS1 mRNA 발현 수준이 증가된 것을 확인하였다(도 8B).
그 결과, APR-246 약물 저항성을 가진 암 세포주에, THBS1 저해제 및 p53 활성화제 APR-246를 처리했을 때, THBS1 저해제에 의해 THBS1의 발현이 감소되면서, 약물 반응성이 더 높아지는 것을 확인하였다(도 8C). 반면, APR-246에 민감한 암세포주에서 THBS1의 발현을 증가시켰을 때, 암세포가 약물에 저항성을 나타내는 것을 확인하였다(도 8D).
또한, 본 발명자들은 THBS1과 TGF-beta 신호전달경로 간의 서로 활성화시키는 양성 피드백 관계를 확인하기 위해 TGFβ1과 p-SMAD2/3의 단백질 발현량을 비교하였다.
그 결과, 저항성을 띄는 세포주에서 약물과 THBS1의 병용 처리를 했을 때 TGF-beta 신호전달경로 내의 단백질 발현이 감소하는 것을 확인하였다(도 8E). 또한, 약물에 민감한 세포주에 동일하게 병용 처리시 TGF-beta 신호전달경로 내의 단백질 발현이 증가하는 것을 통해 양성 피드백 관계를 실험적으로 검증하였다(도 8F). 상기 결과에서 관찰된 양성 피드백은 THBS1이 TGFβ1을 활성화시키고 TGFβR를 거쳐 p-SMAD2/3이 활성화되어 다시 THBS1이 발현되는 일련의 과정을 거친다(도 8G).
따라서, APR-246 약물만을 단독 처리했을 때는 THBS1과 TGF-beta 신호전달경로 간의 양성 피드백으로 인해 약물 내성이 생기게 되므로, THBS1를 저해시키는 저해제를 병용처리함으로써 약물에 대한 반응성을 높일 수 있다(도 8H).
또한, 민감 세포주에서도 THBS1을 저해시킨 결과, THBS1 를 저해시키지 않은 대조군과 비교하여 저농도에서 약물 반응성이 더욱 높아지는 것을 확인하였다(도 9A, B). 이러한 결과는 p53에 대한 내성을 갖지 않는 암세포에서도 THBS1 저해가 고농도 약물 처리시 발생하는 약물 독성 문제를 해결하는 데 도움이 될 수 있음을 시사한다.
상기 결과를 통해, p53 활성화제 및 THBS1 저해제의 조합으로 암세포에서 약물(p53 활성화제)에 대한 적응 내성을 극복할 수 있고, 따라서 p53 신호전달경로에 이상이 있는 암 환자에게 효과적인 치료방법 제공할 수 있음을 확인하였다.
실시예 3. THBS1과 TGF-beta 신호전달경로 간의 양성 피드백 확인
본 발명자들은, 앞서 제시한 THBS1과 TGF-beta 신호전달경로 간의 양성 피드백 관계를 추가적으로 증명하고자, APR-246 약물 내성 세포주 및 민감 세포주에서의 THBS1에 따른 TGFβ1의 발현수준을 측정하였다.
그 결과, APR-246 약물 내성 세포주에서, 민감 세포주에 비해, TGFβ1의 mRNA 발현량이 높았다(도 10A). APR-246 약물 내성 세포주에 THBS1을 저해했을 때 TGFβ1도 함께 감소되는 것을 확인하였다(도 10B). 또한, GDSC 데이터베이스에서 제공하는 Signaling Pathway Enrichment using Experimental Datasets (SPEED) 데이터 상에서 TGF-beta 신호전달경로의 활동 점수 (activity score)를 측정했을 때 내성 세포주에서 점수가 더 높은 것을 확인하였다(도 10C). 즉, 내성 세포주에서 TGF-beta 신호전달경로가 보다 더 활성화되어 있으므로, THBS1을 저해하면 활성도를 낮출 수 있음을 입증한다.
반면, 2 종의 민감 세포주에서 세포를 씨딩하고 24시간 후에 TGF-beta 신호전달경로 활성화 약물을 처리했을 때, TGFβ1의 mRNA 발현량이 증가함과 동시에 THBS1의 발현량도 증가하는 것을 확인하였다(도 10D, E).
상기 결과들을 통해 TGF-beta 신호전달경로 활성이 THBS1의 활성을 증가시킴을 검증하였고, 따라서 둘 사이의 양성 피드백 관계를 증명하였다.
종합적으로, 본 발명에서는, 목적 표적 항암제(예컨대, p53 활성화제)와 추가적인 THBS1 저해제의 병용 투여는 시너지 효과를 통하여 표적 항암제의 적응 내성을 극복하고 이의 항암 효과를 증대시킬 수 있음을 확인하였다. 특히, p53 활성화제와 THBS1 저해제는 p53 신호전달 경로에 유전적 변이가 있는 암 세포주에서 탁월한 시너지 효과를 나타내어 THBS1 저해제를 조합하는 치료법이 여러 암종에서 효과적인 전략이 될 수 있음을 입증하였다.
따라서, 본 발명에 따른 THBS1 저해제는 약제 내성을 일으키는 피드백 구조를 갖는 발암 신호전달 네트워크에서 병용 약물로 사용되어, 기존 표적 항암제의 약제 내성을 극복하고 암환자의 표적 항암제에 대한 치료 적중률을 높일 수 있을 것으로 기대된다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.

Claims (20)

  1. THBS1(Thrombospondin 1) 저해제를 유효성분으로 포함하는 항암제 내성 억제용 조성물.
  2. 제1항에 있어서,
    상기 THBS1 저해제는 THBS1 유전자의 mRNA에 상보적으로 결합하는 안티센스 올리고뉴클레오타이드, siRNA(small interference RNA), shRNA(short hairpin RNA), miRNA(microRNA) 및 리보자임(ribozyme)으로 이루어진 군으로부터 선택된 1 종 이상인 것을 특징으로 하는,
    항암제 내성 억제용 조성물.
  3. 제1항에 있어서,
    상기 THBS1 저해제는 THBS1 단백질에 특이적으로 결합하는 화합물, 펩티드, 펩티드 모방체, 기질유사체, 앱타머 및 항체로 이루어진 군으로부터 선택된 1 종 이상인 것을 특징으로 하는,
    항암제 내성 억제용 조성물.
  4. 제1항에 있어서,
    THBS1 저해제는 항암제와 동시 또는 순차적으로 투여되는 것을 특징으로 하는,
    항암제 내성 억제용 조성물.
  5. 제1항에 있어서,
    상기 항암제는 p53 활성화제인 것을 특징으로 하는,
    항암제 내성 억제용 조성물.
  6. 제5항에 있어서,
    상기 p53 활성화제는 APR-246(Eprenetapopt, PRIMA-1MET), CP-31398, PK083, PK11007, NSC319726 (ZMC1), 스틱트산(stictic acid), 뉴틀린-3a(Nutlin-3a), RO6839921, NSC 146109 하이드로클로라이드(hydrochloride), RITA, 테노빈-1(Tenovin-1), HLI373, WR 0165, 이다사뉴틀린(Idasanutlin) 및 YH 239-EE로 이루어진 군으로부터 선택된 1종 이상인 것을 특징으로 하는,
    항암제 내성 억제용 조성물.
  7. THBS1 저해제를 유효성분으로 포함하는 항암제 반응성 증진용 조성물.
  8. 제1항 내지 제7항 중 어느 한 항에 따른 조성물을 포함하는 항암 보조제.
  9. THBS1 저해제 및 항암제를 유효성분으로 포함하는 암의 예방 또는 치료용 약학적 조성물.
  10. 제9항에 있어서,
    상기 THBS1 저해제는 THBS1 유전자의 mRNA에 상보적으로 결합하는 안티센스 올리고뉴클레오타이드, siRNA(small interference RNA), shRNA(short hairpin RNA), miRNA(microRNA) 및 리보자임(ribozyme)으로 이루어진 군으로부터 선택된 1 종 이상인 것을 특징으로 하는,
    암의 예방 또는 치료용 약학적 조성물.
  11. 제9항에 있어서,
    상기 THBS1 저해제는 THBS1 단백질에 특이적으로 결합하는 화합물, 펩티드, 펩티드 모방체, 기질유사체, 앱타머 및 항체로 이루어진 군으로부터 선택된 1 종 이상인 것을 특징으로 하는,
    암의 예방 또는 치료용 약학적 조성물.
  12. 제9항에 있어서,
    상기 항암제는 p53 활성화제인 것을 특징으로 하는,
    암의 예방 또는 치료용 약학적 조성물.
  13. 제12항에 있어서,
    상기 p53 활성화제는 APR-246 (Eprenetapopt, PRIMA-1MET), CP-31398, PK083, PK11007, NSC319726 (ZMC1), 스틱트산(stictic acid), 뉴트린(Nutlin), RO6839921, NSC 146109 하이드로클로라이드(hydrochloride), RITA, 테노빈-1(Tenovin-1), HLI373, WR 0165, 이다사뉴틀린(Idasanutlin) 및 YH 239-EE로 이루어진 군으로부터 선택된 1종 이상인 것을 특징으로 하는,
    암의 예방 또는 치료용 약학적 조성물.
  14. 제9항에 있어서,
    상기 암은 폐암(lung cancer), 간암(liver cancer), 대장암(colon cancer), 신장암(adrenal cancer), 위암(stomach cancer), 유방암(breast cancer), 혈액암(blood cancer), 뼈암(bone cancer), 췌장암(pancreatic cancer), 피부암(skin cancer), 머리 또는 목암(head or neck cancer), 피부 또는 안구 흑색종(cutaneous or intraocular melanoma), 자궁육종(uterine sarcoma), 난소암(ovarian cancer), 직장암(rectal cancer), 항문암(anal cancer), 난관암(fallopian tube carcinoma), 자궁내막암(endometrial carcinoma), 자궁경부암(cervical cancer), 소장암(small intestine cancer), 내분비암(endocrine cancer), 갑상선암(thyroid cancer), 부갑상선암(parathyroid cancer), 연조직종양(soft tissue tumor), 요도암(urethral cancer), 전립선암(prostate cancer), 기관지암(bronchogenic cancer) 및 골수암(bone marrow tumor)으로 이루어진 군으로부터 선택된 1 종 이상인 것을 특징으로 하는,
    암의 예방 또는 치료용 약학적 조성물.
  15. 제14항에 있어서,
    상기 암은 p53 돌연변이 암인 것을 특징으로 하는,
    암의 예방 또는 치료용 약학적 조성물.
  16. THBS1 저해제를 유효성분으로 포함하는 항암제 내성 억제용 식품 조성물.
  17. 다음 단계를 포함하는, 항암제 내성을 억제하는 물질의 스크리닝 방법:
    (a) THBS1를 발현하는 분리된 암세포에 후보물질을 접촉시키는 단계;
    (b) 상기 (a) 단계의 암세포에서 THBS1의 발현 수준을 측정하는 단계; 및
    (c) 아무 것도 처리하지 않은 대조군과 비교하여, 상기 (b) 단계에서 측정된 THBS1의 발현 수준이 낮은 경우, 상기 후보물질을 항암제 내성을 억제하는 물질로 선택하는 단계.
  18. 다음 단계를 포함하는, 항암제에 대한 내성을 판단하기 위한 정보 제공 방법:
    (a) 대상체로부터 분리된 시료에서 THBS1의 발현 수준 및 p53의 돌연변이 여부를 측정하는 단계;
    (b) 상기 THBS1의 발현수준이 대조군 시료보다 높게 나타나고 p53에 돌연변이가 발생한 경우, 상기 대상체가 항암제에 대한 내성을 갖는 것으로 판단하는 단계.
  19. THBS1(Thrombospondin 1) 저해제를 유효성분으로 포함하는 항암제 내성 억제용 조성물을 대상에게 투여하는 단계를 포함하는, 항암제 내성 억제 방법.
  20. THBS1 저해제 및 항암제를 유효성분으로 포함하는 암의 예방 또는 치료용 약학적 조성물을 대상에게 투여하는 단계를 포함하는, 암 치료 방법.
PCT/KR2023/003905 2022-03-23 2023-03-23 암의 약제 내성을 극복하기 위한 thbs1 저해제의 용도 WO2023182846A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2022-0036220 2022-03-23
KR20220036220 2022-03-23

Publications (1)

Publication Number Publication Date
WO2023182846A1 true WO2023182846A1 (ko) 2023-09-28

Family

ID=88101874

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/003905 WO2023182846A1 (ko) 2022-03-23 2023-03-23 암의 약제 내성을 극복하기 위한 thbs1 저해제의 용도

Country Status (2)

Country Link
KR (1) KR20230140399A (ko)
WO (1) WO2023182846A1 (ko)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180107109A (ko) * 2015-12-22 2018-10-01 큐어백 아게 Rna 분자 조성물의 제조 방법
KR20190051744A (ko) * 2017-11-06 2019-05-15 한국과학기술원 Egfr 저해제 저항성 암 치료제
KR20190081763A (ko) * 2017-12-29 2019-07-09 한국과학기술원 소라페닙 저항성 암 치료 표적으로서의 edn1의 용도
KR20210039846A (ko) * 2019-10-02 2021-04-12 한국과학기술원 암의 약제 내성을 극복하기 위한 src 저해제의 용도

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180107109A (ko) * 2015-12-22 2018-10-01 큐어백 아게 Rna 분자 조성물의 제조 방법
KR20190051744A (ko) * 2017-11-06 2019-05-15 한국과학기술원 Egfr 저해제 저항성 암 치료제
KR20190081763A (ko) * 2017-12-29 2019-07-09 한국과학기술원 소라페닙 저항성 암 치료 표적으로서의 edn1의 용도
KR20210039846A (ko) * 2019-10-02 2021-04-12 한국과학기술원 암의 약제 내성을 극복하기 위한 src 저해제의 용도

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
VAN BEIJNUM, J. R. ET AL.: "miRNAs: micro-managers of anticancer combination therapies", ANGIOGENESIS, vol. 20, 4 May 2017 (2017-05-04), pages 269 - 285, XP036325027, DOI: 10.1007/s10456-017-9545-x *

Also Published As

Publication number Publication date
KR20230140399A (ko) 2023-10-06

Similar Documents

Publication Publication Date Title
Yan et al. Activating Nrf2 signalling alleviates osteoarthritis development by inhibiting inflammasome activation
Ren et al. Sirtuin 1 alleviates endoplasmic reticulum stress-mediated apoptosis of intestinal epithelial cells in ulcerative colitis
Kim et al. Induction of sustained unresponsiveness after egg oral immunotherapy compared to baked egg therapy in children with egg allergy
US11234968B2 (en) Use of VCP inhibitor and oncolytic virus in the preparation of an anti-tumor drug
US20080119426A1 (en) Compositions and methods for the treatment of muscle wasting
CA2558160C (en) Antisense oligonucleotide targeting myostatin or fox01 for treatment of muscle wasting
WO2017123046A1 (ko) 켈로이드성 피부 또는 켈로이드 흉터 진단용 바이오마커 단백질 및 이의 이용
Chang et al. Apelin enhances IL-1β expression in human synovial fibroblasts by inhibiting miR-144-3p through the PI3K and ERK pathways
CN107847551A (zh) 具有抗病毒作用的肽和包含其的组合物
US11938135B2 (en) Compositions and methods for treating vascular Ehlers Danlos syndrome and associated disorders
Kusano et al. Desloratadine inhibits heterotopic ossification by suppression of BMP2‐Smad1/5/8 signaling
WO2023182846A1 (ko) 암의 약제 내성을 극복하기 위한 thbs1 저해제의 용도
Qi et al. Trueperella pyogenes pyolysin inhibits lipopolysaccharide-induced inflammatory response in endometrium stromal cells via autophagy-and ATF6-dependent mechanism
Guo et al. Isoflavones from Semen Sojae Preparatum Improve Atherosclerosis and Oxidative Stress by Modulating Nrf2 Signaling Pathway through Estrogen‐Like Effects
WO2022146025A1 (ko) 암전이 억제 및 항암제 감수성 증진용 조성물
WO2023121404A1 (ko) Taf10 억제제를 포함하는 대장암 예방 또는 치료용 조성물
CN115998887A (zh) 一种结直肠癌合成致死基因对的应用
WO2023172075A1 (ko) Setmar 억제제를 포함하는 암 예방 또는 치료용 조성물
Harada et al. Effects of an elemental diet, Elental®, may differ between healthy oral cells and oral cancer cells
US20220339233A1 (en) Compositions and methods for preventing recurrence of cancer
Rong et al. Enalapril attenuates endoplasmic reticulum stress and mitochondrial injury induced by myocardial infarction via activation of the TAK1/NFAT pathway in mice
WO2023182847A1 (ko) 단일세포전사체를 통한 유전자 네트워크 구축방법 및 이를 이용한 분화에 핵심이 되는 유전자 발굴 방법
KR102194537B1 (ko) 피어스 1의 발현 또는 활성 억제제를 유효성분으로 함유하는, 암 예방, 치료 또는 전이 억제용 약학적 조성물
JP2016164138A (ja) 筋分化促進組成物
WO2021075662A1 (ko) miR-320c를 유효성분으로 포함하는 백금계 항암제에 대한 삼중음성유방암 환자의 약물 반응성 예측용 바이오마커 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23775341

Country of ref document: EP

Kind code of ref document: A1