WO2023038475A1 - 유도 자연살해세포의 제조방법 및 그의 용도 - Google Patents

유도 자연살해세포의 제조방법 및 그의 용도 Download PDF

Info

Publication number
WO2023038475A1
WO2023038475A1 PCT/KR2022/013561 KR2022013561W WO2023038475A1 WO 2023038475 A1 WO2023038475 A1 WO 2023038475A1 KR 2022013561 W KR2022013561 W KR 2022013561W WO 2023038475 A1 WO2023038475 A1 WO 2023038475A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
cancer
cell
drnk
virus
Prior art date
Application number
PCT/KR2022/013561
Other languages
English (en)
French (fr)
Inventor
조이숙
김한섭
김재윤
설빛나
Original Assignee
한국생명공학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국생명공학연구원 filed Critical 한국생명공학연구원
Publication of WO2023038475A1 publication Critical patent/WO2023038475A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses

Definitions

  • the present invention relates to directly reprogrammed natural killer (drNK) cells or CAR (Chimeric antigen receptor)-transgenic CAR- It relates to a method for producing drNK cells.
  • the present invention also relates to drNK cells or CAR-drNK cells prepared by a cell reprogramming method, and cell therapy agents for preventing or treating cancer diseases, infectious diseases and/or inflammatory diseases caused by viruses, bacteria, fungi, etc. and/or compositions.
  • NK (Natural killer) cells are one of the lymphoid blood cells that play an important role in innate and acquired immune responses, especially by recognizing abnormal cells such as cancer cells, viruses, bacteria (bacteria), fungi, parasites, and other infected cells. It has the function of removing it, and research on the development of therapeutic agents using this function is being actively conducted.
  • NK cells not only inhibit the occurrence, proliferation, and metastasis of cancer cells, but also have the function of preventing cancer recurrence by effectively controlling cancer stem cells
  • CAR-NK platform technology that introduces cancer cell-targeted chimeric antigen receptor (CAR) genes that are effective in promoting specificity and activation of target cancer cells as an innovative method to enhance anticancer treatment efficacy is being actively developed.
  • CRS cytokine release syndrome
  • NK-92 cells with excellent proliferative ability and pluripotent stem cells [PSC: Embryonic stem cells (ESC) and induced pluripotent stem cells (PSC) are the main cell sources for CAR-NK production. stem cell, iPSC)] and the like are being used.
  • NK-92 cells are an immortalized cell line, which is easy to continuously produce, but has safety issues because they are naturally derived cancer cells from non-Hodgkin's lymphoma patients, and their low anticancer effect in the body has been pointed out.
  • CAR-NK production based on pluripotent stem cells requires primarily producing CAR-PSCs loaded with CAR genes, going through a separation and amplification process, and then undergoing an additional step-by-step differentiation process into CAR-NK cells.
  • NK cell production using PSCs has the advantage of mass-proliferating and banking initial cells, but the process for producing CAR-NK, the final product from PSCs, is complicated and requires a lot of time and money. there is.
  • remaining undifferentiated PSCs have the potential to form tumors. Therefore, in order to utilize PSC-derived differentiated cells for therapeutic purposes, it is essential to first secure and maintain technology and quality control.
  • the present inventors differentiated from the existing method of securing NK cells through a PSC reprogramming process, and directly reprogrammed without going through an iPSC reprogramming process and a PSC differentiation process to secure NK cells or CAR-NK cells Efforts have been made to develop new approaches to solve various problems in the production of NK-based therapeutics.
  • drNK cells or CAR-drNK cells can be produced from isolated human somatic cells through somatic cell reprogramming culture by controlling the expression of the BCL11B (B-cell leukemia 11B) gene.
  • BCL11B B-cell leukemia 11B
  • the cells produced by the above method exhibit cancer cell killing ability and antiviral, antibacterial and antifungal effects and can be applied to the prevention or treatment of cancer and infectious diseases and / or inflammatory diseases, completing the present invention. did
  • One object of the present invention is a) inhibiting BCL11B gene expression in cells by introducing any one or more selected from the following i) or iii) into the isolated cells: i) BCL11B short hairpin RNA (shRNA), ii) BCL11B Short interfering RNA (siRNA), or iii) Clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9-gRNA-BCL11B; b) culturing the cells in step a) in a medium containing cytokines and growth factors to transform the cells into NK (Natural killer) cells; Manufacturing of directly reprogrammed natural killer (drNK) cells, including is to provide a way
  • Another object of the present invention is to provide drNK cells prepared by the above method.
  • Another object of the present invention is to further introduce a CAR gene selected from the group consisting of CD19-CAR, MSLN-CAR and HER2-CAR in any one or more steps selected from a) or b) in the method It is to provide a method for producing CAR-drNK cells, including that.
  • Another object of the present invention is to provide a method for preparing CAR-drNK cells prepared by the above method.
  • Another object of the present invention is to provide a cell therapy composition for preventing or treating cancer, comprising the cells prepared by the above method as an active ingredient.
  • Another object of the present invention is to provide a pharmaceutical composition for preventing or treating cancer, comprising the cell prepared by the above method as an active ingredient.
  • Another object of the present invention is to provide a cell therapy composition for preventing or treating infectious diseases, comprising the cells prepared by the above method as an active ingredient.
  • Another object of the present invention is to provide a pharmaceutical composition for preventing or treating infectious diseases comprising the cells prepared by the above method as an active ingredient.
  • the drNK cells or CAR-drNK produced through the present invention have excellent cell killing ability against cancer cells or cells infected with viruses, bacteria and fungi, they can be used to prevent or treat cancer, infectious diseases caused by bacteria and fungi, and/or inflammatory diseases. It can be applied as a cell therapy agent and composition.
  • FIG. 1 is a schematic diagram of a method for preparing shBCL11B-drNK cells (A) and a method for preparing CAR-shBCL11B-drNK cells (B).
  • FIG. 2 is a schematic diagram of a gBCL11B-drNK cell manufacturing method (A) and a CAR-gBCL11B-drNK cell manufacturing method (B) using gene editing CRISPR/Cas9.
  • FIG. 3 is a schematic diagram of an AAV vector including a lentiviral vector encoding a CAR (A), a gene editing plasmid vector targeting the exon1 region of the BCL11B gene, and an inserted gene expressing the CAR (B).
  • A a lentiviral vector encoding a CAR
  • B a gene editing plasmid vector targeting the exon1 region of the BCL11B gene
  • B an inserted gene expressing the CAR
  • shRNAs shBCL11B#1, shBCL11B#2, shBCL11B#3, shBCL11B#4, shBCL11B#5, shBCL11B#6, shBCL11B#7 and 4 types of siRNAs (siBCL11B-A, siBCL11B-B, siBCL11B -C, siBCL11B-D sequence and location (A), schematic diagram of shBCL11B/siBCL11B-drNK cell preparation from PBMC (B), and NK cell production confirmation result using NK marker (C).
  • Figure 5 is a diagram showing the effect of the culture components of the first medium (A) and the second medium (B) on the production yield of shBCL11B-drNK cells.
  • FIG. 9 shows the results of CD107a + cell frequency (A) and IFN-gamma expressing cell frequency (B) for cancer cell sensitization of shBCL11B-drNK cells and PBMC-NK cells.
  • FIG. 11 is a schematic diagram of a method for preparing CAR-shBCL11B-drNK cells from PBMC (A) and a result of confirming production using NK markers (B).
  • NK-specific markers of CAR MSLN-CAR
  • Figure 13 is a schematic diagram of gBCL11B-drNK cell production from PBMC (A) and NK cell production confirmation results using NK markers (B).
  • Figure 15 is a schematic diagram (A and B) of a method for producing CAR-gBCL11B-drNK cells from PBMC, and the results of confirming NK cell production using NK markers (C) and the results of confirming CAR-KI (Knock-in) inserted into the genome (D).
  • FIG. 16 shows cancer cell killing ability (A) and CD107a + cell frequency (B) results of shBCL11B-drNK, gBCL11B-drNK, CAR (MSLN-CAR)-shBCL11B-drNK and CAR (MSLN-CAR)-gBCL11B-drNK cells am.
  • FIG. 17 is an analysis result of antiviral efficacy of shBCL11B-drNK cells.
  • EBV Epstein-Barr Virus
  • A Cell killing ability against Epstein-Barr Virus (EBV)-infected B-lymphoma Raji cells
  • B CD107a + cell frequency in EBV-infected Raji cells
  • 18 is a cell death assay result according to co-culture of shBCL11B-drNK cells and cells infected with SARS-CoV-2 virus.
  • 21 shows the results of analysis of antifungal activity of shBCL11B-drNK against Aspergillus fumigatus .
  • FIG. 22 is a diagram showing a lentiviral vector expressing MSLN-CAR.
  • FIG. 23 is a diagram showing a CAR plasmid expressing MSLN-CAR.
  • FIG. 24 is a diagram showing an AAV plasmid expressing MSLN-CAR.
  • One aspect of the present invention is a) inhibiting BCL11B gene expression in cells by introducing any one or more selected from the following i) or iii) into the isolated cells: i) BCL11B short hairpin RNA (shRNA), ii) BCL11B Short interfering RNA (siRNA), or iii) Clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9-gRNA-BCL11B; b) culturing the cells in step a) in a medium containing cytokines and growth factors to transform the cells into NK (Natural killer) cells; Manufacturing of directly reprogrammed natural killer (drNK) cells, including is to provide a way
  • NK cells Natural killer cells
  • T cells which recognize target cells by expressing antigen-specific receptors
  • NK cells express killer immunoglobulin receptors (KIR), without antigen specificity and human leukocyte antigen (HLA) matching.
  • KIR killer immunoglobulin receptors
  • balance of inhibitory or activating receptors such as natural cytotoxicity receptors (NCR), DNAX accessory molecule-1 (DNAM-1) and NK group 2 member D (NKG2D), surface major histocompatibility complex (MHC) class ( It recognizes abnormal changes in target cells (especially cancer cells and infected cells), such as loss of Class I antigen, and exhibits contact-dependent cytotoxicity through various mechanisms.
  • NCR natural cytotoxicity receptors
  • DNAM-1 DNAX accessory molecule-1
  • NSG2D NK group 2 member D
  • MHC surface major histocompatibility complex
  • T cells which can induce graft-versus-host disease (GVHD) for non-self allogeneic cells with mismatched human leukocyte antigen (HLA), allogeneic NK cells It has been confirmed that there are few side effects of the host disease and rather strong anticancer effects.
  • HLA human leukocyte antigen
  • NK (CAR-NK) cells expressing a chimeric antigen receptor (CAR) specific for target cell antigens have been prepared. Accordingly, studies to enhance target cell killing activity and identify its therapeutic efficacy are being actively conducted.
  • a method for producing the CAR-NK cells a method of introducing the CAR- gene into a single NK cell line (NK-92, embryonic stem cell, induced pluripotent stem cell, etc.), which is relatively easy to proliferate, is mainly used, but still low production efficiency , complicated process, safety issues (possibility of tumor formation, etc.), and low therapeutic efficacy are emerging as problems to be overcome.
  • the term "direct reprogramming" refers to a method of converting a lineage into a target cell having completely different characteristics by regulating the global gene expression pattern of a specific cell. do.
  • the direct reprogramming is cell reprogramming, differentiation, direct differentiation, dedifferentiation, direct dedifferentiation, conversion, direct conversion, trans-differentiation, or direct crossing. It may be a concept including differentiation, but is not limited thereto.
  • the "direct reprogramming” may mean that "cell transformation” is performed by introducing oligonucleotides or vectors containing foreign genes or DNA into cells, and that cells change to a different state.
  • the “differentiation” refers to a phenomenon in which daughter cells produced by cell division acquire functions different from those of the original parent cell, and in the present invention, the “direct reprogramming” means “direct cell conversion induction” or “direct cell conversion”. , can be used interchangeably with “cell conversion”.
  • differentiated cells refers to a state in which cells with specialized structures or functions, that is, cells, tissues, etc. of organisms, have been changed into suitable forms and functions to perform their respective roles.
  • ectoderm, mesoderm, and endoderm cells derived from pluripotent stem cells such as embryonic stem cells are broadly differentiated cells, and narrowly, red blood cells, leukocytes, platelets, etc. derived from hematopoietic stem cells are differentiated cells. there is.
  • the term "cells whose lineages have been switched" refers to cells having different lineage characteristics in which the inherent lineage characteristics of the cells are changed embryologically or artificially (eg, direct cell conversion induction, reprogramming, etc.)
  • a cell that has been converted into a cell type it has characteristics of the cell type that are completely different from the characteristics of the cell type before conversion.
  • the cell whose lineage is converted may be a target cell.
  • peripheral blood mononuclear cells may be converted into lymphoid stem cells, specifically NK cells, which are a different lineage from peripheral blood mononuclear cells through direct cell transformation induction, but are not limited thereto.
  • NK cells are produced through primary isolation and culture of human-derived NK cells, differentiation from stem cells, or somatic cell reprogramming for use as immune cell therapeutic agents.
  • iPSC induced pluripotent stem cell
  • 1) induced pluripotent stem cells are first prepared from isolated somatic cells, and 2) hematopoietic stem cells as a differentiation intermediate from induced pluripotent stem cells (Precursor) cells must be differentiated, and 3) additional NK cell differentiation must be induced.
  • iPSC induced pluripotent stem cell
  • conventional reprogramming technology-based iPSC-NK production technology has disadvantages in that production efficiency is low and time and cost consumption are high because complicated culture and differentiation processes must be sequentially performed.
  • since it is manufactured via pluripotent iPS cells having pluripotency whether or not undifferentiated cells remain is closely related to the possibility of tumorigenicity, and thus securing safety has emerged as an important issue to be verified.
  • the present invention directly manufactures NK cells from somatic cells isolated through direct reprogramming induction without going through iPSCs, so the manufacturing time is short, the cost is reduced, and safety is secured, so it is differentiated from the prior art. and can provide an alternative to overcome the problems of existing NK cell sources.
  • the present invention is a material and method for inhibiting the expression and / or function of a single BCL11B (B-cell Leukemia 11B) gene by differentiating it from conventional cell reprogramming methods using overexpression of multiple pluripotent transcription factor gene combinations.
  • NK cells with improved genetic safety can be produced by producing “directly reprogrammed natural killer (drNK)” cells or “CAR-drNK” cells expressing CAR by additionally introducing a CAR gene thereto. confirmed that there is
  • the present invention provides an innovative alternative to overcome the problem of random gene insertion of existing reprogramming methods by limiting gene sequence editing for controlling BCL11B expression by grafting gene scissors technology.
  • the drNK cell production method may include the step of a) suppressing BCL11B gene expression in cells by directly introducing reprogramming factors into the isolated cells.
  • the reprogramming factor may be i) BCL11B short hairpin RNA (shRNA), ii) BCL11B short interfering RNA (siRNA), or iii) Clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9-gRNA-BCL11B.
  • shRNA BCL11B short hairpin RNA
  • siRNA BCL11B short interfering RNA
  • CRISPR Clustered regularly interspaced short palindromic repeats
  • isolated cell of the present invention is not particularly limited, but may be, for example, a cell whose lineage has already been specified, such as a germ cell, a somatic cell, or a progenitor cell.
  • the "somatic cell” refers to all cells that have completed differentiation constituting animals and plants, excluding reproductive cells, and the "progenitor cell” expresses a differentiated trait when a cell corresponding to a progeny is found to express a specific differentiated trait. It refers to a parental cell that does not, but has that differentiation fate.
  • hematopoietic stem cells correspond to progenitor cells for blood cells
  • mesenchymal stem cells correspond to progenitor cells for mesenchymal cells.
  • the isolated cells may be cells derived from humans, but are not limited thereto, and cells derived from various organisms may also fall within the scope of the present invention.
  • the isolated cells of the present invention may include both in vivo and ex vivo cells.
  • the isolated cells may be somatic cells, in another example, somatic cells other than NK cells, and in another example, blood cells and fibroblasts. It may be any one or more, but is not limited thereto.
  • the blood cells may be peripheral blood mononuclear cells (PBMCs), but are not limited thereto.
  • direct reprogramming inducing factor refers to a gene (or polynucleotide) that can be introduced into a cell to induce cell transformation, or a protein encoded therefrom.
  • the direct reprogramming inducing factor may vary depending on the target cell to be obtained through reprogramming and the type of cell before cell transformation.
  • the direct reprogramming-inducing factor introduced into the isolated somatic cells may be a substance that inhibits BCL11B (B-cell lymphoma/Leukemia 11B) gene expression, Specifically, it may be BCL11B antisense oligonucleotide, short hairpin RNA (shRNA), short interfering RNA (shRNA), microRNA, or CRISPR/Cas9-gRNA-BCL11B, but is not limited thereto, and BCL11B gene expression Any material or method known in the art may be included if it is a material or method for inhibiting.
  • BCL11B B-cell lymphoma/Leukemia 11B
  • Cell transformation using the direct reprogramming inducing factor induces conversion into a target cell by regulating the entire gene expression pattern of the cell, and by introducing the direct reprogramming inducing factor into the cell and culturing the cell for a certain period of time, Cells can be induced to transform into target cells that have the gene expression pattern of the cell type.
  • the "direct reprogramming inducing factor” may be used interchangeably with “direct cell conversion inducing factor”, “cell conversion inducing factor”, and "reprogramming factor”.
  • the term "directly introducing a reprogramming inducing factor” refers to a method of directly administering a reprogramming inducing factor to a cell culture medium; a method of directly injecting a direct reprogramming-inducing factor into cells; a method of increasing or decreasing the expression level of a direct reprogramming inducer present in a cell; a method of transforming cells with an expression vector containing a gene encoding a direct reprogramming-inducing factor; a method of modifying a gene sequence such that the expression of a gene encoding a direct reprogramming inducing factor is increased or decreased; a method of introducing an exogenous expression gene encoding a direct reprogramming-inducing factor; a method of treating a substance having an effect of directly inducing or inhibiting the expression of a reprogramming-inducing factor; And a method of increasing or decreasing the expression level of a direct reprogramming-inducing factor in
  • introduction of the direct reprogramming-inducing factor may directly induce expression of the reprogramming-inducing factor under a desired time and condition.
  • the method of introducing the direct reprogramming-inducing factor into cells includes a method of administering the direct reprogramming-inducing factor to a cell culture medium, and transforming an expression vector containing a gene encoding the direct reprogramming-inducing factor into the cell. It may be a method, but is not limited thereto.
  • any method known in the art may be selected and used, but is not limited thereto, such as microinjection or electroporation.
  • Particle bombardment, direct muscle injection, insulator, and transposon can be appropriately selected and applied.
  • the direct reprogramming inducing factor that inhibits BCL11B gene expression may be one or more selected from i) BCL11B shRNA, ii) BCL11B siRNA, or iii) CRISPR/Cas9-gRNA-BCL11B.
  • shRNA short hairpin RNA
  • shRNA short hairpin RNA
  • the shRNAs of the present invention may be those that inhibit BCL11B gene expression.
  • the target sense sequences of the shRNAs of the present invention are SEQ ID NO: 1, respectively. It may be any one or more selected from the group consisting of to 7, but is not limited thereto.
  • siRNA short interfering RNA
  • siRNA refers to a nucleic acid molecule capable of mediating RNA interference or gene silencing.
  • the siRNA of the present invention may be one that inhibits BCL11B gene expression.
  • the target sense sequences of the siRNAs (shBCL11B-A, shBCL11B-B, shBCL11B-C and shBCL11B-D) of the present invention may be any one or more selected from the group consisting of SEQ ID NOs: 8 to 11, respectively. However, it is not limited thereto.
  • CRISPR Clustered regularly interspaced short palindromic repeats
  • Cas9 Cas9 protein
  • gRNA Guard RNA
  • the CRISPR/Cas9 has the advantage of a very wide range of editing accuracy and applicability compared to Zinc Finger or TALEN (Transcription activator-like effector nuclease).
  • the CRISPR/Cas9 of the present invention may suppress BCL11B gene expression, and any gene editing technique for suppressing BCL11B gene expression may be included without limitation.
  • the CRISPR/Cas9 system of the present invention is sgRNA#1 (SEQ ID NO: 12) and sgRNA#2 (SEQ ID NO: 13) targeting Exon1 (BCL11B-ex1) derived from the genomic sequence (NC_000014.9) containing BCL11B.
  • gRNAs targeting genomic sequences including BCL11B may be included without limitation.
  • the present invention is significant in overcoming the problem of random gene insertion of existing reprogramming methods by limiting the BCL11B specific gene sequence by grafting gene editing technology such as the CRISPR/Cas9 system.
  • the CRISPR/Cas9-gRNA-BCL11B may be processed in one or more steps selected from step a) or step b), but is not limited thereto.
  • the direct reprogramming inducing factor that inhibits BCL11B gene expression of the present invention can be directly introduced into a target cell (parental cell) for reprogramming induction through an antisense oligonucleotide, a plasmid vector or a viral vector, or microRNA.
  • the term "vector” refers to a DNA product containing a suitable regulatory sequence and a nucleotide sequence of the target protein or polypeptide so as to express the target protein or polypeptide in a suitable host.
  • the regulatory sequence may include a promoter, an operator, an initiation codon, a stop codon, a polyadenylation signal, and an enhancer.
  • the vector of the present invention includes a signal sequence or a leader sequence for membrane targeting or secretion in addition to the control sequence, and can be prepared in various ways depending on the purpose.
  • the vector's promoter may be constitutive or inducible.
  • the vector also includes a selectable marker for selecting host cells containing the vector and, if the vector is replicable, an origin of replication. After transformation into a suitable host cell, the vector can replicate or function independently of the host genome and can integrate into the genome itself.
  • the vector used in the present invention is not particularly limited as long as it can be replicated in a host cell, and any vector known in the art can be used.
  • Examples of commonly used vectors include viral vectors in a natural or recombinant state, episomal vectors, plasmid vectors, cosmid vectors, and bacterial artificial chromosomes (BAC). , yeast artificial chromosome (YAC), and the like.
  • the viral vector is Sendai virus, Lenti virus, HIV (Human immunodeficiency virus), MLV (Murineleukemia virus), ASLV (Avian sarcoma / Leukosis), SNV (Spleen necrosis virus), RSV Vectors derived from retroviruses such as Rous sarcoma virus and MMTV (Mouse mammary tumor virus), adenovirus, adeno-associated virus, and herpes simplex virus It may include, and more specifically, may be an RNA-based viral vector, but is not limited thereto.
  • the episomal vector is a non-viral, non-insertable vector, and is known to have a characteristic capable of expressing a gene included in the vector without being inserted into a chromosome.
  • cells containing the episomal vector may include both cases in which the episomal vector is inserted into the genome or present in the cell in a state where the episomal vector is not inserted into the genome.
  • operably linked refers to functional linkage between a nucleic acid expression control sequence and a nucleic acid sequence encoding a protein of interest so as to perform general functions.
  • Operational linkage with a recombinant vector can be prepared using genetic recombination techniques well known in the art, and site-specific DNA cutting and linking uses enzymes generally known in the art.
  • the drNK cell production method may include b) culturing the cells of step a) in a medium containing cytokines and growth factors to transform them into NK cells.
  • the term “cultivation” refers to growing cells under controlled environmental conditions, and the culturing process of the present invention may be performed according to media and culture conditions known in the art. This culture process can be easily adjusted and used by those skilled in the art according to the selected cells.
  • the culture is a process of converting cells into which the direct reprogramming or cell transformation inducing factors are introduced into target cells of another lineage
  • the composition of the second medium may include a composition suitable for conversion into the target cell, for example, growth factors and cytokines, and thus GSK3 ⁇ (Glycogen synthase kinase 3 ⁇ ) inhibitor, PDK1 (3-phosphoinositide -dependent kinase 1) inhibitors and AHR (Aryl hydrocarbon receptor) inhibitors may be additionally included, but are not limited thereto.
  • the medium of b) may contain cytokines and growth factors.
  • cytokine is a variety of relatively small-sized proteins produced in cells and used for cell signal transduction, which can affect other cells including themselves. It is generally known to be related to the immune response to inflammation or infection.
  • the cytokine is, for example, IL (Interleukin) -2, IL-3, IL-5, IL-6, IL-7, IL-11, IL-15, IL-21, BMP4 (Bone morphogenetic protein 4) , Activin A (Acivin A), Notch ligand (Notch ligand), G-CSF (Granulocyte-colony stimulating factor) and SDF-1 (Stromal cell-derived factor-1), etc., specifically IL-2, IL It may be any one or more selected from the group consisting of -7, IL-15, IL-21, and combinations thereof, but is not limited thereto.
  • growth factor refers to a polypeptide that promotes division, growth, and differentiation of various cells.
  • the growth factors include, for example, EGF (Epidermal growth factor), PDGF-AA (Platelet-derived growth factor-AA), IGF-1 (Insulin-like growth factor 1), TGF- ⁇ (Transforming growth factor- ⁇ ) , Fibroblast growth factor (FGF), stem cell factor (SCF), and FMS-like tyrosine kinase ligand (FLT3L). Not limited to this.
  • the cytokines and growth factors are included in a medium for directly inducing cell conversion of isolated cells into target cells, and the types of growth factors and cytokines are particularly limited as long as they can be used for direct cell conversion induction. It doesn't work.
  • the medium of b) is any one selected from the group consisting of GSK3 ⁇ (Glycogen synthase kinase 3 ⁇ ) inhibitor, PDK1 (3-phosphoinositide-dependent kinase 1) inhibitor and AHR (Aryl hydrocarbon receptor) inhibitor It may further include the above.
  • GSK3 ⁇ inhibitor refers to a substance that inhibits or inhibits the activity of GSK3 ⁇ by directly/indirectly binding to a protein.
  • the GSK3 ⁇ inhibitors are, for example, 1-Azakenpaullone, 2-D08, 3F8, 5-Bromoindole, 6-Bio, A 1070722, Aloisine A, AR-A014418, Alsterpaullone, AZD-1080, AZD2858, Bikinin, BIO, BIO- acetoxime, Bisindolylmaleimide I, Bisindolylmaleimide I hydrochloride, CAS 556813-39-9, Cazpaullone, CHIR98014, CHIR98023, CHIR99021(CT99021), CP21R7, Dibromocantherelline, GSK-3 ⁇ inhibitor I, VI, VII, X, XI,XV, GSK-3 inhibitors IX
  • PDK1 (3-phosphoinositide-dependent kinase 1) inhibitor refers to a substance that inhibits or inhibits the activity of PDK1 by directly/indirectly binding to a protein.
  • the PDK1 inhibitor may be BX-795, BX-912, PHT-427, GSK2334470, OSU-03012, etc., for example, BX-795, but is not limited thereto.
  • AHR Aryl hydrocarbon receptor inhibitor
  • TCDD Dioxin (2,3,7,8-tetrachlorodibenzo-p-dioxin)
  • AHR A substance that downregulates or reduces activity.
  • the AHR inhibitor is, for example, StemRegenin I [StemRegenin I, SRI; 4-(2-(2-(benzo[b]thiophen-3-yl)-9-isopropyl-9H-purin-6-ylamino)ethyl)phenolhydrochloride, 4-(2-((2- Benzo[b]thiphen-3-yl)-9-isopropyl-9H-purin-6-yl)amino)ethyl)phenol hydrochloride], CH-223191(1-methyl-N-[2-methyl-4-[2 -(2-methylphenyl)diazenyl]phenyl-1H-pyrazole-5-carboxamide, 1-Methyl-N-[2-methyl-4-[2-(2-methylphenyl)diazenyl]phenyl-1H-pyrazole -5-carboxamide) and the like, and for example, it may be stemregenin I.
  • the inhibitor is not limited to the foregoing as long as it directly serves to increase reprogramming efficiency.
  • the medium of b) can be divided into a first medium and a second medium.
  • the first medium of the present invention may contain, for example, a growth factor, a cytokine, a GSK3 ⁇ inhibitor, a PDK1 inhibitor, and/or an AHR inhibitor.
  • the first medium may include SCF, FLT3L, IL-2, IL-7, IL-15, CT99021 and/or BX795, but is not limited thereto.
  • the first medium may further contain at least one selected from the group consisting of fetal bovine serum (FBS), antibiotics, and combinations thereof, but is not limited thereto.
  • FBS fetal bovine serum
  • antibiotics and combinations thereof, but is not limited thereto.
  • the antibiotic may be penicillin/streptomycin, but is not limited thereto.
  • the first medium of a) may include FBS, penicillin/streptomycin, SCF, FLT3L, IL-2, IL-7, IL-15, CT99021 and/or BX795, but is not limited thereto. .
  • the first medium of a) contains 8 to 12% of FBS, 0.1 to 2% of penicillin/streptomycin, 10 to 30 ng/ml of human SCF, 10 to 30 ng/ml of human FLT3L, 150 to 250 IU/ml human IL-2, 10 to 30 ng/ml human IL-7, 10 to 30 ng/ml human IL-15, 2 to 4 uM CT99021 and 2 to 10 uM BX795 It can be StemSpan SFEM II, and more specifically, 9-11% FBS, 0.5-1.5% penicillin/streptomycin, 15-25 ng/ml human SCF, 15-25 ng/ml human FLT3L, 180-220 IU/ml human IL-2, 15-25 ng/ml human IL-7, 15-25 ng/ml human IL-15, 2.5-3.5 uM CT99021 and/or 4-8 uM It may be StemSpan SFEM II including BX795, but is not limited thereto
  • the second medium of the present invention may, for example, contain growth factors, cytokines, and stemregenin I.
  • the second medium may include SCF, FLT3L, IL-2, IL-7, IL-15, IL-21 and stemregenin I, but is not limited thereto.
  • the second medium may further include at least one selected from the group consisting of FBS, antibiotics, and combinations thereof, but is not limited thereto.
  • the antibiotic may be penicillin/streptomycin, but is not limited thereto.
  • the second medium of step a) may contain FBS, penicillin/streptomycin, SCF, FLT3L, IL-2, IL-7, IL-15, IL-21, and stemregenin I, but Not limited.
  • the second medium of step a) contains 8 to 12% of FBS, 0.1 to 2% of penicillin/streptomycin, 10 to 30 ng/ml of human SCF, 10 to 30 ng/ml of human FLT3L, 150 to 250 IU/ml human IL-2, 10 to 30 ng/ml human IL-7, 10 to 30 ng/ml human IL-15, 10 to 30 ng/ml human IL-21 and 2 to 4
  • It may be StemSpan SFEM II comprising uM of stemregenin I, and more specifically, 9 to 11% FBS, 0.5 to 1.5% penicillin/streptomycin, 15 to 25 ng/ml human SCF, 12 to 12% FBS.
  • the first medium and the second medium of the present invention can maximize the efficiency of NK cell production in drNK cell production through inhibition of BCL11B gene expression.
  • NK production efficiency after culturing in a medium lacking one of human IL-2, human IL-15, or CHIR99021 in the elements constituting the first medium, or a medium supplemented with BX795, and then further culturing in the second medium
  • the positive control 100% cultured in the first medium
  • the cell group cultured in the IL-2-deficient medium was 43%
  • the cell group cultured in the IL-15-deficient medium was 75%.
  • the NK cell production efficiency can be improved by using the first medium and the second medium of the present invention.
  • the isolated cells directly introduced with cell transformation factors may be cultured in the first medium of a) for 4 to 8 days and then cultured in the second medium of b) for 10 to 14 days.
  • the first medium of a) for 4 to 8 days
  • the second medium of b) for 10 to 14 days.
  • BCL11B-specific shRNA is introduced into PBMC cells Transformation was performed by treatment with lentivirus or introduction of siRNA, cultured in the first medium until day 7, and then cultured in the second medium until day 18 to directly induce cell transformation drNK cells (shBCL11B-drNK) were prepared (Fig. 1A and Figure 4B).
  • PBMC cells are transformed by treatment with a lentivirus expressing a CRISPR/Cas9 vector containing an sgRNA targeting BCL11B as a cell transformation inducing factor, and cultured in the first medium until day 7 Then, by culturing in the second medium until day 18, drNK cells (gBCL11B-drNK) directly induced cell conversion were prepared (FIGS. 2A and 13A).
  • Another aspect of the present invention provides a method for producing CAR-drNK cells.
  • the CAR-drNK cell manufacturing method in the drNK cell manufacturing method of the present invention, in one or more steps selected from a) or b), the CAR gene selected from the group consisting of CD19-CAR, MSLN-CAR and HER2-CAR Additional introductions may be included.
  • the CAR gene may be introduced by knock-in (KI) to the BCL11B knock-out (KO) nucleotide sequence.
  • the term "CAR gene” includes genes encoding an extracellular domain including an antibody domain (scFv), a transmembrane domain, and an intracellular domain, including the extracellular domain, the transmembrane domain, and the intracellular domain. It means a gene encoding a chimeric antigen receptor.
  • the CAR gene of the present invention includes a CD19-CAR gene comprising a CD19 scFv, a MSLN-CAR gene comprising a Mesothelin (MSLN) scFv, and a HER2-CAR gene comprising a Human Epidermal Growth Factor Receptor 2 (HER2) scFv. It may be any one or more selected from the group consisting of CAR genes, but is not limited thereto.
  • CAR target factors for solid tumors include EGFRvIII (Morgan RA, Hum Gene Ther. 2012;23:1043-1053), MUC-1 (Wilkie S, J Immunol. 2008;180:4901-4909), MAGE (Willemsen RA , Gene Ther. 2001;8:1601-1608), CEA (Emtage PC, Clin Cancer Res. 2008;14:8112-8122), PSMA, GD2, CA125, Her2 and MSLN, FAP, VEGFR (Kakarla S, Cancer J 2014;20:151-155), etc. are known to be available.
  • CD19 is a cluster of differentiation (CD), which is assigned the number 19 for identifying cell surface molecules according to immunophenotypes, and CD19 refers to a marker for B lymphocytes.
  • CD19 is known to be expressed in most B-cell malignant cancer cells, providing an ideal target for these carcinomas.
  • the CAR gene is i) a CAR gene (CD19-CAR gene) including a CD8 leader, a CD19 scFv, a CD8 hinge, a CD8 transmembrane domain (TM), and an Fc- ⁇ (Gamma) receptor ; ii) a CAR gene comprising CD8 leader, MSLN (Mesothelin) scFv, CD8 hinge, CD8 transmembrane domain, CD28 intracellular domain, CD3 ⁇ (zetta) and IRES (MSLN-CAR gene); and iii) a CD8 leader, a HER2 (Human epidermal growth factor receptor 2) scFv, a CD8 hinge, a CD8 transmembrane domain, a CD28 intracellular domain, a CAR gene including CD3 ⁇ and an IRES (HER2-CAR gene); selected from the group consisting of It may be any one or more, but is not limited thereto.
  • CD19-CAR gene including a
  • the CD8 leader is SEQ ID NO: 14, the CD19 scFv is SEQ ID NO: 15, the MSLN scFv is SEQ ID NO: 16, the HER2 scFv is SEQ ID NO: 17, the CD8 hinge is SEQ ID NO: 18, the CD8 transmembrane domain is SEQ ID NO: 19, and the Fc- ⁇ receptor is SEQ ID NO: 20, CD28 intracellular domain is SEQ ID NO: 21, CD3 ⁇ is SEQ ID NO: 22, and the IRES inserted to clone the CAR gene into a vector constituting a double cistron may include the nucleotide sequence of SEQ ID NO: 23 , but not limited thereto.
  • the CAR gene may further include GFP (Green fluorescent protein), but is not limited thereto.
  • GFP Green fluorescent protein
  • the GFP may include the nucleotide sequence of SEQ ID NO: 24, but is not limited thereto.
  • nucleotide sequences of SEQ ID NO: 14 to SEQ ID NO: 24 can be confirmed in NCBI Genbank, a known database.
  • the nucleotide sequence of SEQ ID NO: 14 to SEQ ID NO: 24 is at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% of SEQ ID NO: 14 to SEQ ID NO: 24 , or a nucleotide sequence having 99% or more homology or identity.
  • a sequence having a nucleotide sequence in which some sequences are deleted, modified, substituted, or added is also a part of the present invention. Being included within the scope is self-evident.
  • homology and identity refer to the degree of relatedness between two given amino acid sequences or nucleotide sequences and can be expressed as a percentage.
  • homology and identity are often used interchangeably.
  • Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, together with default gap penalties established by the program used. Substantially homologous or identical sequences are usually at least about 50%, 60%, 70%, 80% of the entire or full-length sequence under moderate or high stringent conditions. or more than 90% hybrid. Hybridization is also contemplated for polynucleotides that contain degenerate codons in lieu of codons in the polynucleotide.
  • Homology or identity to the polypeptide or polynucleotide sequence can be determined, for example, by the algorithm BLAST according to the literature [Kalin and Altschul, Pro. Natl. Acad. Sci. USA, 90, 5873 (1993)], or FASTA by Pearson (Methods Enzymol., 183, 63, 1990). Based on this algorithm BLAST, a program called BLASTN or BLASTX has been developed (see: http://www.ncbi.nlm.nih.gov).
  • the CAR gene may be introduced into a cell by the same method as the direct cell conversion factor introduction method described above, and the direct cell conversion factor and the CAR gene may be introduced simultaneously or sequentially under desired time and conditions. .
  • lentivirus treatment or siRNA expressing BCL11B-specific shRNA is introduced into PBMC cells to transform them and transformed with a lentivirus expressing the MSLN-CAR gene.
  • the cell culture is cultured in the first medium and then additionally cultured in the second medium to induce direct cell transformation inducing drNK expressing the CAR (MSLN-CAR) gene.
  • Cells (MSLN-shBCL11B-drNK) were prepared (Fig. 1B and Fig. 11A).
  • CAR-AAV is introduced into BMC cells as a donor plasmid in which the CAR-encoding sequence is inserted into the cleavage site at the same time as BCL11B Knock-out (KO) and Knock-in (KI) Transformed, and transformed by treatment with a lentivirus expressing a CRISPR/Cas9 vector containing an sgRNA targeting BCL11B as a cell transformation inducing factor.
  • the cell culture was cultured in the first medium and then added in the second medium CAR (MSLN-CAR) gene-expressing drNK cells (MSLN-gBCL11B-drNK) were prepared by direct cell transformation by culturing (Fig. 2B and Fig. 15).
  • Another aspect of the present invention provides drNK cells produced by the method of the present invention.
  • Another aspect of the present invention provides a CAR-drNK cell produced by the method of the present invention.
  • the drNK cells prepared according to the method of the present invention may express at least one selected from the group consisting of CD56 + , CD3 - and combinations thereof, but are not limited thereto.
  • CD56 + and CD3 - are indicators on the surface of NK cells, and in the present invention, the expression of CD56 + , CD3 - and combinations thereof is analyzed by flow cytometry to prepare NK cells. confirmed that
  • NK cell populations CD56 + and CD3 -
  • CD56 + CD3 - CD56 + CD3 -
  • shBCL11B-drNK NK cell populations
  • shBCL11B#5 shBCL11B#6 and shBCL11B#7 treatment groups
  • siBCL11B-A, siBCL11B-B, siBCL11B-C and siBCL11B-D treatment groups the efficiency was 38% to 38%. It was confirmed that it was produced with an efficiency of 57% (FIG. 4C).
  • NK cell populations (CD56 + and CD3 - ) were analyzed using flow cytometry
  • CD56 + CD3 - (gBCL11B-drNK) cells were 83.9% and 72.2% respectively in the Cas9-sgRNA-BCL11B treatment group containing sgRNA-A, sgRNA-B or sgRNA-C compared to the untreated group (6.0%). , it was confirmed that it was produced with an efficiency of 72.0% (FIG. 13B).
  • the CAR-drNK cells prepared according to the method of the present invention may express one or more selected from the group consisting of CD56 + , CD3 - and combinations thereof, but are not limited thereto.
  • NK cell populations CD56 + and MSLN- As a result of analyzing CAR + ), it was confirmed that CD56 + MSLN + (MSLN-shBCL11B-drNK) cells were produced with an efficiency of 4.9% to 13.1% (FIG. 11B).
  • shBCL11B-drNK cells, MSLN-shBCL11B-drNK cells and gBCL11B-drNK cells are CD16, CD69, NKG2D, NKp30, NKp44 It was confirmed that activating receptors such as NKp46 and DNAM-1 were expressed at higher frequencies than inhibitory receptors such as KIR2DL1, KIR2DL2 and KIR3DL1, showing similar patterns (FIGS. 6, 12 and 14).
  • Another aspect of the present invention provides a cell therapy composition for preventing or treating cancer, comprising the cells prepared according to the method of the present invention as an active ingredient.
  • the cancer may be a cancer associated with the expression of one or more of CD19, MSLN, or HER2, and specifically may be a cancer that results in prevention or treatment by an immune response of drNK cells and/or CAR-drNK cells. .
  • the cancers include, for example, liver cancer, thyroid cancer, thyroid cancer, papillary thyroid cancer, medullary thyroid cancer, pseudomyxoma, intrahepatic cholangiocarcinoma, gamblastoma, bronchial carcinoma, basal cell cancer, testicular cancer, bone marrow cancer, myeloma, myelodysplasia, osteosarcoma, Osteogenic sarcoma, colon cancer, colon cancer, glioblastoma, oral cancer, oral cancer, mycosis fungoides, ovarian cancer, ovarian germ cell tumor, male breast cancer, cystic cancer, endothelial sarcoma, brain cancer, meningioma, pituitary adenoma, biliary duct carcinoma, colorectal cancer , head and neck cancer, craniopharyngioma, biliary tract cancer, gallbladder cancer, multiple myeloma, lymphangiogenic sarcoma, lymphoma,
  • the cancer may be a cancer associated with expression of MSLN.
  • lymphoma leukemia, myeloma, mesothelioma, uterine cancer, head and neck cancer, esophageal cancer, synovial sarcoma, kidney cancer, transitional cell carcinoma, thyroid cancer, germ cell tumor, cholangiocarcinoma/cholangiocarcinoma, papillary serous adenocarcinoma, colon cancer, liver cancer , lung cancer, pancreatic cancer, glioblastoma, colon cancer, ovarian cancer, breast cancer, prostate cancer, melanoma, myoma, thyroid cancer, osteosarcoma, choriocarcinoma, gastric cancer, glioma, soft tissue sarcoma, neuroendocrine tumor, pituitary tumor, oligodendrocyte tumor, Gastrointestinal stromal tumor, gallbladder cancer, small intestine cancer, solitary fibroma,
  • prevention refers to any activity that suppresses or delays the occurrence of cancer by administration of the composition.
  • treatment refers to all activities that improve or beneficially change symptoms caused by cancer by administration of the composition.
  • the term "cell therapy product” refers to cells and tissues manufactured through isolation, culture, and special manipulation from a subject, and is a drug (US FDA regulation) used for the purpose of treatment, diagnosis, and prevention, It refers to medicines used for the purpose of treatment, diagnosis, and prevention through a series of actions, such as proliferating and selecting living autologous, allogeneic, or heterogeneous cells in vitro or changing the biological characteristics of cells in other ways to restore them.
  • the cell therapy composition may be effective in preventing or treating cancer by including drNK cells and/or CAR-drNK cells prepared according to the method of the present invention.
  • the cell therapy composition may contain the drNK cells and/or CAR-drNK cells at 1.0X10 to 1.0X10 10 cells/ml, specifically 1.0X10 6 to 1.0X10 9 cells/ml, based on the total weight of the composition. , but not limited thereto.
  • the cell therapy composition may be formulated and administered as a unit dosage pharmaceutical preparation suitable for administration into the body of a patient according to a conventional method in the pharmaceutical field, and the preparation includes an effective dosage by one or several administrations. do.
  • Formulations suitable for this purpose may include injections such as ampoules for injection, injections such as infusion bags, and sprays such as aerosol formulations as preparations for parenteral administration.
  • the ampoule for injection may be mixed with an injection solution immediately before use, and physiological saline, glucose, mannitol, Ringer's solution, or the like may be used as the injection solution.
  • the infusion bag may be made of polyvinyl chloride or polyethylene, and may be manufactured by Baxter, Becton Dickinson, Medcep, National hospital products, or Terumo. An infusion bag of yarn can be exemplified.
  • one or more pharmaceutically acceptable conventional inert carriers for example, a preservative, pain reliever, solubilizer or stabilizer in the case of injection, and the like, in the case of formulation for topical administration
  • a base an excipient, a lubricant or a preservative may be further included.
  • the cell therapy composition or pharmaceutical preparation thereof of the present invention thus prepared may be administered together with other cells used for cancer treatment or in the form of a mixture with such cells using an administration method commonly used in the art. It is possible to engraft or transplant directly to the diseased area of a patient in need of treatment, or to directly transplant or inject into the abdominal cavity, but is not limited thereto.
  • the administration can be carried out by both non-surgical administration using a catheter and surgical administration methods such as injection or transplantation after incision in the diseased area.
  • parenteral for example, direct administration to a lesion according to conventional methods, transplantation by intravascular injection is also possible.
  • the cell therapy composition may be administered at a dose of 0.0001 to 1,000 mg/kg per day, specifically 0.01 to 100 mg/kg, and the administration may be administered once a day or divided into several times.
  • the actual dosage of the active ingredient should be determined in light of various related factors such as the disease to be treated, the severity of the disease, the route of administration, the weight, age and sex of the patient, and therefore, the dosage is It does not limit the scope of the present invention in any way.
  • the drNK cells and/or CAR-drNK cells prepared according to the method of the present invention may have excellent killing ability against various cancer cells.
  • the cancer cell killing ability of the prepared shBCL11B-drNK cells various types (lymphoma, colon cancer, liver cancer, lung cancer, pancreatic cancer, glioblastoma, colon cancer, ovarian cancer, breast cancer, prostate cancer, It was confirmed that it possesses cancer cell killing ability of melanoma, myoma, thyroid cancer, osteosarcoma, chorionic cancer, gastric cancer and bladder cancer), and the low E (Effector NK cell): T (Target cancer cell) ratio of each shBCL11B-drNK cell ( 0.25: 1 ⁇ 2.5: 1) was also confirmed to exhibit high cancer cell killing ability (FIG. 7). In addition, it was confirmed that shBCL11B-drNK cells showed about 5.2 to 5.5 times higher cancer cell killing ability than NK-92 cells, which are conventional human natural killer cells (FIG. 8).
  • CD107a + cells having cancer cell lysis ability expressed after co-culture of PBMC-NK cells (human peripheral blood cell-derived NK) with cancer cells, shBCL11B-drNK When cells and cancer cells were co-cultured, it was confirmed that the frequency (%) of CD107a + cells increased compared to the case of co-culture of PBMC-NK cells and cancer cells and the control group (no target) without co-culture (FIG. 9A ).
  • shBCL11B-drNK cells, gBCL11B-drNK cells, MSLN-shBCL11B-drNK cells and MSLN-gBCL11B-drNK cells were selected from K562 in which MSLN is not expressed, PC-3 and Mia in which MSLN is expressed.
  • the four types of NK cells showed similar cancer cell killing ability to K562, which does not express MSLN, and the cancer cell groups PC-3 and PC-3 expressing MSLN Low E:T ratio (0.25:1) in CAR-drNK cells (MSLN-shBCL11B-drNK, MSLN-gBCL11B-drNK) compared to non-CAR-drNK cells (shBCL11B-drNK, gBCL11B-drNK) for Mia-paca-2 ⁇ 2.5: 1) was also confirmed to exhibit high cancer cell killing ability (FIG. 16A).
  • drNK cells and/or CAR-drNK cells prepared according to the method of the present invention have excellent cancer cell killing ability, frequency of CD107a + cells and IFN-gamma + cells after co-culture with cancer cells, and antitumor effect. Bar, it can be seen that there is an anticancer effect.
  • Another aspect of the present invention provides a pharmaceutical composition for treating or preventing cancer, comprising the cell prepared according to the method of the present invention as an active ingredient.
  • the pharmaceutical composition may be effective in preventing or treating cancer by including drNK cells and/or CAR-drNK cells prepared according to the method of the present invention.
  • the pharmaceutical composition of the present invention comprises the drNK cells and/or CAR-drNK cells at 1.0X10 4 to 1.0X10 10 cells/ml, specifically 1.0X10 6 to 1.0X10 9 cells/ml, based on the total weight of the composition. It may, but is not limited thereto.
  • the pharmaceutical composition may further include a pharmaceutically acceptable carrier, excipient or diluent commonly used in the preparation of pharmaceutical compositions, and the carrier may include a non-naturally occurring carrier.
  • the carriers, excipients and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • the pharmaceutical composition may be formulated according to conventional methods such as tablets, pills, powders, granules, capsules, suspensions, internal solutions, emulsions, syrups, sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and transdermal formulations.
  • Absorbents, gels, lotions, ointments, creams, patches, cataplasma agents, pastes, sprays, skin emulsions, skin suspensions, transdermal delivery patches, drug-containing bandages, or suppositories may be formulated and used.
  • Solid dosage forms for oral administration include, but are not limited to, tablets, pills, powders, granules, capsules, and the like.
  • Such a solid preparation may be prepared by mixing at least one or more excipients, for example, starch, calcium carbonate, sucrose, lactose, gelatin, and the like.
  • lubricants such as magnesium stearate and talc may also be used in addition to simple excipients.
  • Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized formulations and suppositories.
  • Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspending agents.
  • Witepsol, Macrogol, Tween 61, cacao butter, laurin paper, glycerogelatin, and the like may be used as a base for the suppository.
  • the pharmaceutical composition of the present invention can be administered in a pharmaceutically effective amount.
  • pharmaceutically effective amount means an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is dependent on the type and severity of the subject, age, sex, drug activity, It may be determined according to factors including sensitivity to the drug, time of administration, route of administration and excretion rate, duration of treatment, drugs used concurrently, and other factors well known in the medical field.
  • the pharmaceutical composition may be administered at a dose of 0.0001 to 1,000 mg/kg per day, specifically 0.01 to 100 mg/kg, and the administration may be administered once a day or divided into several times.
  • the pharmaceutical composition may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents. And it can be single or multiple administrations. It is important to administer the amount that can obtain the maximum effect with the minimum amount without side effects in consideration of all the above factors, and can be easily determined by those skilled in the art.
  • the "administration” means introducing the composition of the present invention to a subject by any suitable method, and the administration route of the composition may be administered through any general route as long as it can reach the target tissue.
  • Intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, oral administration, topical administration, intranasal administration may be administered, but is not limited thereto.
  • the "individual” refers to all animals, including humans, monkeys, cows, horses, sheep, pigs, chickens, turkeys, quails, cats, dogs, mice, rats, rabbits, or guinea pigs that have or may develop cancer. .
  • the type of subject may be included without limitation as long as the disease can be effectively prevented or treated by administering the pharmaceutical composition of the present invention to the subject.
  • Another aspect of the present invention provides a method for treating cancer, comprising administering the cell therapy composition or pharmaceutical composition to a non-human subject.
  • Another aspect of the present invention provides a cell therapy composition for preventing or treating infectious and/or inflammatory diseases, comprising the cells prepared by the method of the present invention as an active ingredient.
  • the infectious disease may be caused or caused by any one or more selected from the group consisting of viruses, bacteria and fungi, but is not limited thereto.
  • the virus causing the infectious disease may be an RNA virus and/or a DNA virus, but is not limited as long as it is a virus known in the art.
  • the viruses include Aviadeno virus, Alphatorque virus, Arena virus, Alphapapilloma virus, Adeno virus (Ad5), Astro virus, Aichi ( Aichi) virus, Amapari virus, Aravan virus, Aura virus, Australian bat lyssa virus, Banna virus, Barmah forest virus, Batken ( Batken) virus, Bunyamwera virus, Bunga virus, Bunya virus La crosse, BK virus, BK polyoma virus, Cercopithecine herpes virus, Cardio (Cardio) virus, Crimean-congo hemorrhagic fever virus, Chapare virus, Chandipura virus, Chandipura vesiculo virus, Chikungunya virus, Cosa virus, Cowpox virus, Coxsackie virus, Corona virus, Corona virus alpha (beta, gamma, delta), Colti virus, Cytomegalo (cytomegalo) virus, Denso virus, Dependo virus, Dependoparvo virus,
  • the virus is Epstein-Barr (Epstein-Barr) virus (EBV), hepatitis virus, human immunodeficiency (human immunodeficiency) virus (HIV), Influenza (influenza) virus, Papilloma (papilloma) virus, SARS (Severe acute respiratory tract infection) syndrome) (SARS) virus, SARS corona virus, SARS-CoV-2 virus, etc., but is not limited thereto.
  • Epstein-Barr Epstein-Barr
  • HAV human immunodeficiency virus
  • Influenza influenza virus
  • Papilloma papilloma
  • SARS severe acute respiratory tract infection
  • SARS-CoV-2 virus etc.
  • the bacteria causing the infectious disease may be gram-negative bacteria and/or gram-positive bacteria, but are not limited to bacteria known in the art.
  • the bacteria are Achromobacter species (SPP), Acinetobacter spp, Actinomyces spp, Aeromonas spp, Alternaria spp, Anthrax ( Anthrax) spp, Aspergillus spp, Bacillus spp, Bacteroides spp, Bartonella spp, Brucella spp, Borrelia, spp, Bordetella spp, Burkholderia spp, Campylobacter spp, Capnocytophaga spp, Chlamydophila spp, Chlamydia spp, Citrobacter spp, Clostridium spp, Corynebacterium spp, Coxiella spp, Diphtheria spp, Ehrlichia spp, Escherichia Enterobacter spp, Enterococcus spp, Erysipelothrix spp, Eikenella spp, Erwini
  • the bacteria are Achromobacter xylosoxidans, Acinetobacter baumannii, Acinetobacter haemolyticus, Acinetobacter junil, Acinetobacter johnsonil, Actinomyces israeli, Aeromonas hydrophilia, Aeromonas veronol, Aspergillus fumigatus, Bacillus anthracis, Bacillus cereus, Bacillus thuringiensis, Bacteroides fragilis, Bacteroides melaninogenicii, , Brucella abortus, Brucella canis, Brucella melitensis, Brucella microti, Brucella suis, Borrelia afzelii, Borrelia burgdorferi, Borrelia garinii, Borrelia recurrentis, Bordetella pertussis, Burkholderia cepacia, Burkholderia mimosarum, Burkholderia thailandensis, Campylobacter jejuni
  • the bacteria may be bacteria belonging to Escherichia , Streptococcus , etc., and more specifically, E. coli , S. pseudopneumoniae , etc., but is not limited thereto.
  • the E. coli may include Enterotoxigenic E. Coli, Enteropathogenic E. coli, Enteroinvasive E. coli, Enterohemorrhagic E. Coli, etc., but is not limited thereto.
  • the fungus causing the infectious disease is, for example, Absidia (genus Bacteria) spp, Alternaria (genus Alternaria) spp, Aspergillus (genus Aspergillus) spp, Ascosphaera (Ascospera) spp, Ajellomyces (Ajellomyces) spp , Alternaria spp, Basidiobolus spp, Basidiomycete spp, Bipolaris spp, Blastomyces spp, Batrachochytrium spp, Beauveria Genus) spp, Bjerkandera spp, Botrytis spp, Blumeria spp, Candida spp, Coprinus spp, Chromoblastomycosis Cis) spp, Cladosporium spp, Cladophialphora spp, Chaeotomium spp, Conidiobolus spp.
  • Coccidioides spp Colletotrichum spp, Cordyceps spp, Cryptococcus spp, Cunninghamella spp, Curvularia spp, Dactylaria spp, Dacrymyces spp, Epidermophyton spp, Exophiala spp, Fusarium spp, Geotrichum spp, Geomyces (Geomyces) spp, Histoplasma spp, Lacazia spp, Lasiodiplodia spp, Leptosphaeria spp, Lomentospora spp, Malassezia Cecia spp, Madurella spp, Malassezia spp, Magnaporthe spp, Metarhizium spp, Microsporum spp, Mycosphaerella spp, Memnoniella spp, Melampsora spp, Mucor spp, Mucorales spp, Mucormycetes
  • the fungus is Absidia corymbifera, Alternaria alternate, Aspergillus alternate, Aspergillus versicolor, Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger, Ajellomyces dermatitidis, Basidiobolus ranarum, Bipolaris spicifera, Blastomyces dermatitidis, Blastomyces gilchristii, Batrachochytrium dendrobatidis, Beauvetiscinea basseriana , Blumeria graminis, Candida albicans, Candida auris, Candida glabrata, Candida krusei, Candida lusitaniae, Candida parapsilosis, Candida krusei, Candida silvativa, Candida tropicalis, Coprinus cinereus, Cladosporium herbarum, Cladosporium immitis, Cladophialphora bantianum, Conidiobolus coronatus, Conidiobolus in
  • the fungus is Aspergillus (Aspergillus mold), Candida (Candida) , Absidia (hair fungus), Mucor (hair mold), Rhizopus (spider web mold) It may be a fungus belonging to the genus, etc., and more specifically, Candida albicans, Aspergillus fumigatus, Aspergillus fumigatus , Absidia corymbifera , Mucor circillenoides, Mucor mucedo ( Mucor mucedo ), Mucor pusillus ( Mucor pusillus ), Rhizopus oryzae ( Rhizopus oryzae ), etc., but are not limited thereto.
  • composition of the present invention may be effective in preventing or treating infectious diseases and/or inflammatory diseases caused by the infectious diseases by including drNK cells and/or CAR-drNK cells prepared according to the method of the present invention.
  • drNK cells and/or CAR-drNK cells prepared according to the method of the present invention can exhibit antiviral effects against various viruses.
  • BCL11B-drNK in order to confirm the antiviral effect of BCL11B-drNK, cell killing ability and CD107a + cells were measured for B-lymphoma Ramos and EBV-infected B-lymphoma Raji cells that were not infected with the virus. , it was confirmed that BCL11B-drNK had higher killing toxicity against EBV-infected Raji cells than Ramos than control cells NK-92 and PBMC-NK (FIGS. 17A and 17B).
  • drNK cells are human immunodeficiency virus (Human immunodeficiency virus, HIV), Influenza virus, Papilloma virus, Hepatitis virus infected CEM T cells, HEK-293T cells, HK2 proximal tubular cells, It was confirmed that SNU449 liver cells exhibited high killing capacity (FIG. 17D) and high CD107a + expressing cell frequency even at a low E:T ratio compared to control cell NK-92 (FIG. 17E).
  • shBCL11B-drNK cells showed significant antibacterial efficacy against RNA viruses and DNA viruses compared to PBMC-NK cells and NK-92 cells.
  • drNK cells and/or CAR-drNK cells prepared according to the method of the present invention may exhibit antibacterial effects against various bacteria.
  • drNK As a result of confirming the killing effect of drNK cells on Gram-negative bacterium Escherichia coli after co-culture (Fig. 19A) and the frequency of CD107a + expressing cells (Fig. 19B), drNK It was confirmed that the antibacterial efficacy was higher than that of NK-92 and PBMC-NK cells.
  • drNK has higher antibacterial efficacy than NK-92 cells. confirmed (FIG. 19C).
  • shBCL11B-drNK cells exhibit remarkable antibacterial efficacy against Gram-negative bacteria and Gram-positive bacteria compared to PBMC-NK cells and NK-92 cells.
  • the drNK cells and/or CAR-drNK cells prepared according to the method of the present invention may exhibit antifungal effects against various fungi.
  • the antifungal effect of drNK cells against Candida albicans was confirmed through the frequency of CD107a + expressing cells after co-culture (FIG. 20), and as a result, drNK was NK- 92 and PBMC-NK cells were confirmed to have higher antifungal efficacy.
  • both shBCL11B-drNK cells and positive controls exhibit antifungal activity against Aspergillus fumigatus , particularly shBCL11B- It was confirmed that the antifungal activity of drNK cells was the most excellent (FIG. 21).
  • the cell therapy composition, the content of drNK cells and/or CAR-drNK cells in the composition, and the dosage of the cell therapy composition are as described above.
  • Another aspect of the present invention provides a pharmaceutical composition for preventing or treating infectious diseases and/or inflammatory diseases, comprising the cells prepared by the method of the present invention as an active ingredient.
  • the pharmaceutical composition, the amount of drNK cells and/or CAR-drNK cells in the composition, and the dose of the cell therapy composition are as described above.
  • Another aspect of the present invention provides a method for treating an infectious disease and/or an inflammatory disease, comprising administering the cell therapy composition or pharmaceutical composition to a non-human subject.
  • Another aspect of the present invention is a first container containing a) i) BCL11B shRNA, ii) BCL11B siRNA, or iii) CRISPR/Cas9-gRNA-BCL11B; b) a second container containing the first medium of the present invention; And c) a third container containing the second medium of the present invention; it provides a direct cell conversion induction medium kit for preparing drNK cells or CAR-drNK cells.
  • the kit of the present invention comprises the above i) BCL11B shRNA, ii) BCL11B siRNA, or iii) a first container containing CRISPR/Cas9-gRNA-BCL11B, a second container containing the first medium of the present invention, and the first container of the present invention It means a tool that can be used as a direct reprogramming medium for production of drNK cells or CAR-drNK cells, including a third container containing a second medium containing 2 medium.
  • the type of the kit is not particularly limited, and kits of a type commonly used in the art may be used.
  • the kit of the present invention comprises i) BCL11B shRNA, ii) BCL11B siRNA, or iii) CRISPR/Cas9-gRNA-BCL11B; 1st medium; and a second medium; each may be packaged in a form contained in an individual container, or contained in a form contained in a container divided into one or more compartments, wherein i) BCL11B shRNA, or ii) CRISPR/Cas9-gRNA-BCL11B; 1st medium; and the second medium; each may be packaged in a unit dosage form of a single dose.
  • said i) BCL11B shRNA, ii) BCL11B siRNA, or iii) CRISPR/Cas9-gRNA-BCL11B in said kit; 1st medium; and the second medium; may be administered sequentially at an appropriate time according to the experimental plan of those skilled in the art.
  • the kit of the present invention comprises i) BCL11B shRNA, ii) BCL11B siRNA, or iii) CRISPR/Cas9-gRNA-BCL11B; 1st medium; And a second medium; may further include an instruction manual describing the amount of addition, addition method and frequency of addition of each.
  • Example 1 Preparation of shBCL11B-drNK and verification of expression of NK (Natural killer) cell-specific markers
  • shRNA Short hairpin RNA
  • shBCL11B#1, shBCL11B#2, shBCL11B#3, shBCL11B#4, shBCL11B#5, shBCL11B#6 and shBCL11B#7 or 4 types of siRNAs were introduced into shBCL11B or siRNA (Fig. 4A) to shBCL11B-drNK cells. was manufactured.
  • lentiviruses expressing shBCL11B were placed in a 48-well plate, and the lentivirus was treated with MOI of 3 and 4 ⁇ g/ml polybrene or 6 ⁇ M Bx795, followed by 16 After culturing in RPMI medium for a period of time, the medium was replaced with fresh medium, and PBMC cells were transformed.
  • PBMC cells To introduce 4 types of siRNA into PBMC cells, 2X10 5 PBMC cells were placed in a 48-well plate and treated with 100 nM siRNA using Lipofectamine RNAiMAX (Thermo Fisher Scientific Inc.) according to the manufacturer's instructions, and PBMC cells were transformed.
  • Lipofectamine RNAiMAX Thermo Fisher Scientific Inc.
  • FIGS. 1A and 4B a schematic diagram of the method for preparing shBCL11B-drNK by somatic cell direct cell transformation through introduction of shBCL11B is shown in FIGS. 1A and 4B.
  • the cells were stained with CD56 antibody and CD3 antibody, and NK cell populations (CD56 + and CD3 - ) were analyzed using flow cytometry. The ratio of was analyzed.
  • NK cells CD56 + CD3 -
  • shBCL11B#1, shBCL11B#2, shBCL11B#3, and shBCL11B were present at a rate of 2.1% (No-treated) and 0.2% (sh-Control), respectively, in the control group, whereas shBCL11B#1, shBCL11B#2, shBCL11B#3, and shBCL11B
  • shBCL11B-drNK cells prepared by introducing or transforming #4 shBCL11B#5, shBCL11B#6, shBCL11B#7, siBCL11B-A, siBCL11B-B, siBCL11B-C or siBCL11B-D, 76.1%, 90.4%, and 85.1% respectively.
  • NK cells were produced with high efficiency when shBCL11B or siRNA was introduced into the cells (Fig. 4C).
  • NK-specific markers of the shBCL11B-drNK cells of Example 1-1 In order to verify the expression characteristics of the NK-specific markers of the shBCL11B-drNK cells of Example 1-1, only NK cells were recovered using the MACS (Magnetic Activated Cell Sorting) method using the NK isolation Kit (Miltenyl Biotec) , Expression patterns of NK cell-associated activating receptors (CD16, CD69, NKG2D, NKp30, NKp44, NKp46 and DNAM-1) or inhibitory receptors (KIR2DL1, KIR2DL2 and KIR3DL1) were analyzed using flow cytometry.
  • MACS Magnetic Activated Cell Sorting
  • activating receptors such as CD16, CD69, NKG2D, NKp30, NKp44, NKp46 and DNAM-1 were expressed at higher frequencies than inhibitory receptors such as KIR2DL1, KIR2DL2 and KIR3DL1 in shBCL11B-drNK cells (FIG. 6) .
  • somatic cells were converted into NK cells (shBCL11B-drNK) through direct somatic cell transformation using shBCL11B.
  • CAR-shBCL11B-drNK cells expressing the CAR gene were prepared by simultaneously introducing shBCL11B and CAR (Chimeric antigen receptor) genes into cells.
  • MSLN-CAR gene encoding MSLN-CAR specific for MSLN (Mesothelin) was constructed (FIG. 22).
  • the MSLN-CAR gene is CD8 Leader (SEQ ID NO: 14), MSLN (Mesothelin) scFv (SEQ ID NO: 16), CD8 hinge (SEQ ID NO: 18), CD8 transmembrane domain (SEQ ID NO: 19), CD28 intracellular domain ( SEQ ID NO: 21), CD3 ⁇ (SEQ ID NO: 22), IRES (SEQ ID NO: 23) and GFP (SEQ ID NO: 24) (Fig. 3A).
  • PBMC cells were transfected with lentivirus expressing shBCL11B#2 on Day 0 and transfected with lentivirus expressing MSLN-CAR gene on Day 0, Day 6, Day 12 and Day 18.
  • the cell culture from Day 0 to Day 18 was performed in the first medium from Day 0 to Day 7 and in the second medium thereafter, as in Example 1-1, shBCL11B-drNK expressing the MSLN-CAR gene. (MSLN-shBCL11B-drNK) was prepared (Fig. 11A).
  • FIGS. 1B and 11A a schematic diagram of a method for preparing CAR-shBCL11B-drNK by direct somatic cell transformation through shBCL11B and CAR gene introduction is shown in FIGS. 1B and 11A.
  • NK cell populations CD56 + and MSLN-CAR + .
  • CD56 + MSLN + (MSLN-shBCL11B-drNK) cells were Day 0 (4.9%), Day 6 (13.1%), Day 12 (9.9%), and Day 18 (8.8%) of the transformed cells. It was confirmed that it was produced with the highest efficiency in the cell group transformed in 6 (FIG. 11B).
  • Example 2-1 In order to verify the expression characteristics of the NK-specific markers of the MSLN-shBCL11B-drNK cells of Example 2-1, various natural killer cell-related activations of MSLN-shBCL11B-drNK cells were performed in the same manner as in Example 1-3. and expression patterns of inhibitory receptors were analyzed using flow cytometry.
  • activating receptors such as CD16, CD69, NKG2D, NKp30, NKp44, NKp46, and DNAM-1 were expressed at a higher frequency than inhibitory receptors such as KIR2DL1, KIR2DL2, and KIR3DL1 (FIG. 12 ), it was confirmed that it exhibited a similar pattern to shBCL11B-drNK.
  • Example 3 Preparation of gBCL11B-drNK using CRISPR (Clustered regularly interspaced short palindromic repeats)/Cas9 and verification of expression characteristics of NK-specific markers
  • CRISPR/Cas9 and sgRNA Single-guide RNA
  • BCL11B B-cell lymphoma/Leukemia 11B gene expression in cells.
  • a viral vector (Applied Biological Material, CAT#: K0013105) was used.
  • sgRNA included sgRNA-A, sgRNA-B or sgRNA-C included in the commercial lentiviral vector set.
  • lentivirus expressing CRISPR/Cas9 vectors containing sgRNA-A, sgRNA-B or sgRNA-C to transform PBMC cells with reprogramming factors MOI of 3, PBMC cells and polybrene (4 ⁇ g/ml ) for 16 hours and then replaced with fresh medium to transform PBMC cells. Thereafter, cell culture from Day 0 to Day 18 was carried out in the same manner as in Example 1-1, from Day 0 to Day 7 in the 1st medium and thereafter in the 2nd medium, directly inducing cell transformation drNK cells (gBCL11B-drNK). was prepared (FIG. 13A).
  • FIGS. 2A and 13A A schematic diagram of a method for preparing gBCL11B-drNK by direct reprogramming of somatic cells through introduction of CRISPR/Cas9 with scissors is shown in FIGS. 2A and 13A.
  • CD56 + CD3 - (gBCL11B-drNK) cells were 83.9% (sgRNA-A), 72.2% (sgRNA-B), and 72.0% (sgRNA-A) in the Cas9 and sgRNA-treated groups, respectively, compared to the untreated group (6.0%). It was confirmed that it was produced with the efficiency of C) (FIG. 13B).
  • Example 3-1 In order to verify the expression characteristics of the NK-specific markers of gBCL11B-drNK cells of Example 3-1, in the same manner as in Example 1-3, various natural killer cell-related activation and inhibitory receptors of gBCL11B-drNK cells Expression patterns were analyzed using flow cytometry.
  • activating receptors such as CD16, CD69, NKG2D, NKp30, NKp44, NKp46, and DNAM-1 were expressed at higher frequencies than inhibitory receptors such as KIR2DL1, KIR2DL2, and KIR3DL1 in the prepared gBCL11B-drNK cells (FIG. 14). , It was confirmed that it showed a similar aspect to shBCL11B-drNK.
  • drNK was produced in the same way as shBCL11B when Cas9/sgRNA was introduced.
  • CAR-gBCL11B-drNK cells expressing the CAR gene were constructed by simultaneously introducing Cas9, sgRNA, and CAR gene into cells.
  • the sgRNAs are sgRNA#1 (forward) and sgRNA#2 (reverse) in Table 1 below, targeting Exon1 (BCL11B-ex1) derived from the genomic sequence (NC_000014.9) containing BCL11B. included.
  • sequence number sequence name Sequence 5' -> 3') 12 sgRNA#1 (forward) GGCAATGTCCCGCCGCAAACAGG 13 sgRNA#2 (reverse) GCGGGTTGCCCTGTTTGCGGCGG
  • CAR-AAV was constructed by inserting the 2707-5740 bp region of the MSLN-CAR plasmid into the site where the 150-787 bp region was removed from pJEP300-pAAV-CMV-MCS2-pA (FIGS. 3B and 24).
  • PBMC cells were cultured in RPMI medium for 1 day, and then transformed by treatment with CAR-AAV (1 MOI) encoding MSLN-CAR one day before the start of the experiment (Day -1). 24 hours later, on Day 0, the plasmid vectors containing sgRNA#1 and sgRNA#2 were additionally transformed into AAV-treated PBMC 1X10 6 dogs by electroporation.
  • CAR MSLN-CAR
  • drNK cells MSLN-gBCL11B-drNK
  • FIGS. 2B and 15A A schematic diagram of a method for preparing CAR-gBCL11B-drNK by direct reprogramming of somatic cells through introduction of Cas9, sgRNA, and CAR gene is shown in FIGS. 2B and 15A.
  • NK cell populations (CD56 + , The ratio of CD3 ⁇ and MSLN-CAR + ) was analyzed.
  • PCR was performed on genomic DNA using a primer for the sequence before LHA (SEQ ID NO: 29) and a primer for the SFFV promoter (SEQ ID NO: 30).
  • genomic DNA gDNA
  • DNeasy Blood & Tissue kit QIAGEN, cat. no. 69504
  • 2x Premix EmeraldAmp GT PCR master mix, TAKARA, cat. no. RR310A
  • target primers were mixed to prepare a total reaction solution of 20ul.
  • PCR was performed by repeating 40 cycles of 95°C for 30 seconds, 57°C for 40 seconds, and 72°C for 1 minute, followed by extension at 72°C for 5 minutes.
  • the reacted PCR products were electrophoresed on a 1% agarose gel.
  • the production yield of drNK cells is lower than that of CAR-shBCL11B-drNK, but the CAR gene is specific only to the genome where BCL11B is located. Since it can be inserted, it was confirmed that the possibility of genetic modification by lentivirus can be minimized.
  • the ratio of the drNK cell population (CD56 + and CD3 - ) was analyzed using a flow cytometer after staining the cells with CD56 antibody and CD3 antibody.
  • CD56 + CD3 - (shBCL11B-drNK) cells based on the positive control (100%) cultured in the first medium, 43% of the cell group cultured in the IL-2-deficient medium and IL-15 deficient It was confirmed that the efficiency of the cell group cultured in the cultured medium was 75%, the cell group cultured in the medium lacking CHIR99021 was 92%, and the cell group cultured in the medium supplemented with BX795 was 113% (FIG. 5A).
  • the ratio of the drNK cell population (CD56 + and CD3 - ) was analyzed using a flow cytometer after staining the cells with CD56 antibody and CD3 antibody.
  • CD56 + CD3 - (shBCL11B-drNK) cells based on the positive control (100%) cultured in the second medium, the cell group cultured in the IL-2-deficient medium was 56% and IL-15 deficient. 69% of the cell population cultured in cultured medium, 82% in IL-7-deficient medium, 81% in SCF-deficient medium, and 38% in FLT3L-deficient medium , it was confirmed that the cell population cultured in the SR1-deficient medium was produced with an efficiency of 57% (FIG. 5B).
  • Raji Human B-lymphoma
  • HCT116 human colorectal carcinoma cell line
  • SNU-817 B lymphoma cell line
  • HepG2 hepatocellular carcinoma cell line
  • NCIH460 Human Non-small cell lung cancer
  • Mia-paca-2 hypertriploid human pancreatic cancer cell line
  • U373MG Human glioblastoma astrocytoma
  • SW620 human colon carcinoma cell line
  • SK-OV-3 human ovarian cancer cell line
  • MCF7 breast cancer cell
  • PC-3 human prostate cancer cell line
  • SK-MEL-3 human melanoma cell lines
  • A-673 human rhabdomyosarcoma
  • Caki-1 human clear cell renal cell carcinoma
  • SNU-790 human thyroid papillary carcinoma cell line
  • MG-63 human osteosarcoma cell line
  • BeWo human placental choriocarcinoma
  • Cancer cell killing ability (%) ⁇ (measured value-minimum value)/(maximum value-minimum value) ⁇ X100
  • the minimum value is a measured value of a well containing only calcein-labeled target cancer cells
  • the maximum value is a measured value of a well in which 1.0% TritonX-100 was added to the calcein-labeled target cancer cells to completely lyse the cells.
  • shBCL11B-drNK cells possessed the ability to kill various types of cancer cells, and it was confirmed that the higher the number of shBCL11B-drNK cells compared to the number of cancer cells, the higher the cancer cell killing ability (FIG. 7).
  • Example 6-1 The cancer cell killing ability of the shBCL11B-drNK cells of Example 6-1 and NK-92 cells (ATCC) (positive control), which are existing human natural killer cells, against K562 (human myelogenous leukemia cell line) was evaluated as in Example 6-1. Comparison was made in the same way as in 1.
  • CD107a + cells having cancer cell lysis ability are expressed, it was confirmed whether CD107a + cells were expressed when shBCL11B-drNK cells were co-cultured with cancer cells.
  • PBMC-NK cells were isolated from PBMC cells using an NK isolataion kit.
  • the PBMC-NK cells were cultured for 2 days in NK medium (RPMI1640 containing 1% penicillin/streptomycin, 200 IU/ml human IL-2 and 20 ng/ml human IL-15) after isolation from PBMC cells, and then used
  • NK medium RPMI1640 containing 1% penicillin/streptomycin, 200 IU/ml human IL-2 and 20 ng/ml human IL-15
  • Example 6-1 After co-cultivating the shBCL11B-drNK cells or PBMC-NK cells (positive control) of Example 6-1 with cancer cells (HCT116, HepG2 and Mia-paca-2) in the same manner as above, the expression IFN-gamma + cells were quantified.
  • Luciferase-expressing cancer cells were each 1X10 7 cells on the back of 8-week-old nude mice (Balb/c-nude mice, average weight 20-25 g).
  • a mouse prostate cancer model or a mouse ovarian cancer model was prepared by subcutaneous injection at 200 ul/ml.
  • PBMC-NK cells or shBCL11B-drNK cells of Example 6-1 were injected into the tail vein at the same dose (1X10 7 cells/150 ul). After injection, the tumor size was measured at 7-day intervals until the 21st day.
  • the PBMC-NK cells were used after being cultured in NK medium for 2 days after being separated from PBMC cells.
  • the tumor size (4.66X10 10 radiance) of the control group compared to the PBMC-NK cell-administered group (7.31X10 9 radiance) and shBCL11B- In the drNK cell-administered group (6.07X10 9 irradiance) the tumor size was significantly reduced, and it was confirmed that the shBCL11B-drNK cells showed superior anticancer effects compared to the PBMC-NK cells (FIG. 10A).
  • the tumor size was significantly reduced, and it was confirmed that shBCL11B-drNK cells showed superior anticancer effects compared to PBMC-NK cells (FIG. 10B).
  • Example 7 Verification of anticancer efficacy of drNK cells or CAR-drNK cells
  • shBCL11B-drNK (shRNA#2) cells prepared in Example 1-1, MSLN-shBCL11B-drNK (shRNA#2) cells prepared in Example 2-1, gBCL11B prepared in Example 3-1
  • sgRNA-A -drNK
  • MSLN-gBCL11B-drNK sgRNA#1 and sgRNA#2 cells prepared in Example 4-1
  • Example 6-1 Example 6-1 and In the same manner, the cancer cell killing ability was analyzed by co-culture with K562, which does not express MSLN, and PC-3 and Mia-paca-2, which express MSLN, as cancer cells.
  • MSLN-shBCL11B-drNK cells MSLN-shBCL11B-drNK cells, gBCL11B-drNK cells and MSLN-gBCL11B-drNK cells, they were co-cultured in the same manner as in Example 6-3.
  • the expression of CD107a + cells was quantitatively analyzed.
  • the frequency (%) of CD107a + cells was decreased in MSLN-shBCL11B-drNK and MSLN-gBCL11B-drNK cells compared to shBCL11B-drNK and gBCL11B-drNK in K562 without MSLN expression, whereas PC-3 with MSLN expression In CAR (MSLN)-drNK cells, MSLN-shBCL11B-drNK (32.0%) and MSLN-gBCL11B-drNK (37.2%) compared to non-CAR-drNK cells, shBCL11B-drNK (17.6%) and gBCL11B-drNK (19.4%). ), it was confirmed that the frequency (%) of CD107a + cells increased (FIG. 16B). Also, CD107a + cell frequency similar to that of PC-3 was confirmed in Mia-paca-2 where MSLN is expressed.
  • Example 8 Verification of antiviral efficacy of drNK cells
  • shBCL11B-drNK (shRNA#2) cells of Example 1-1
  • virus-infected Ramos Human B-lymphoma
  • Epstein-Barr Virus Epstein-Barr Virus, EBV
  • the cell killing ability of the infected Raji was measured in the same manner as in Example 6-1.
  • PBMC-NK cells or NK-92 cells were used as a positive control.
  • both shBCL11B-drNK cells (BCL11B-drNK) and positive controls (PBMC-NK cells and NK-92 cells) showed higher cell killing ability against EBV-infected Raji than non-infected Ramos, and shBCL11B-drNK cells were positive control cells.
  • PBMC-NK cells and NK-92 cells showed high cell killing ability for both non-infected Ramos and EBV-infected Raji (FIG. 17A).
  • EBV-infected Raji and non-infected Ramos were co-cultured with drNK cells to determine the frequency of CD107a + cells.
  • EBV-infected Raji and non-infected Ramos each of 1X10 6 cells/ml and the above shBCL11B-drNK cells, and PBMC-NK cells and NK-92 cells as a positive control, respectively 1X10 6 cells/ml were added to 1 ml of a 6-well plate. After dispensing each, centrifuged at 400 g for 1 minute, co-cultured in an incubator at 37°C, 5% CO 2 for 4 hours, and then washed and recovered the cells using a centrifuge, and FACS (Fluorescence-activated cell sorting) analysis to confirm the frequency of CD107a + cells responding to the infected cells.
  • FACS Fluorescence-activated cell sorting
  • shBCL11B-drNK cells as positive control, PBMC-NK cells and NK-92 cells, respectively, were 1X10 6 cells/ml in a FACS buffer containing fluorescent CD56 and antibodies against CD107a. After administration and reaction at room temperature for 20 minutes, the cells were washed and recovered using a centrifuge and subjected to FACS analysis.
  • both shBCL11B-drNK cells (BCL11B-drNK) and positive controls (PBMC-NK cells and NK-92 cells) increased CD107a + cell frequency (%) when co-cultured with EBV-infected Raji rather than Ramos, and shBCL11B- The frequency of CD107a + cells significantly increased in drNK cells compared to positive controls (PBMC-NK cells and NK-92 cells) (FIG. 17B).
  • LMP-1 latent membrane protein 1
  • lentivirus obtained from a GFP expressing lentiviral vector (control vector in CTIP2 (BCL11B) Human shRNA Plasmid Kit (Locus ID 64919), ORIGENE, CAT#: TL306424) was treated with 5 MOI and 8 ⁇ g/ml polybrene, , cultured in RPMI medium for 16 hours and then replaced with fresh medium, and Raji was transformed into GFP-Raji.
  • the prepared GFP-Raji 1X10 6 cells/ml and shBCL11B-drNK cell 1X10 6 cells/ml were pipetted by dispensing 1 ml each into a 6-well plate, and incubated at 37°C, 5% CO 2 for 24 hours. After co-culture, the reaction was recovered by centrifugation. As a positive control, PBMC-NK cells or NK-92 cells were used. Total RNA from cell reactions was extracted using the RNeasy Mini kit (Qiagen) and reverse transcribed using the SuperScript VILOTM cDNA synthesis kit (Thermo Fisher Scientific Inc.) according to the manufacturer's instructions. qRT-PCR was performed with SYBR Green and the expression level of LMP-1 was analyzed using a 7500 Fast real-time PCR system (Applied Biosystems).
  • sequence number sequence name Sequence 5' -> 3') 31 LMP-1 Forward TCCTCCTGTTTCTGGCGATT 32 LMP-1 Reverse GGAGTCATCGTGGTGGTGTTC 33 GFP Forward ATGGTGAGCAAGGGCGAGGAG 34 GFP Reverse CGGTGGTGCAGATGAACTTCAGG
  • CEM T cells infected with human immunodeficiency virus (HIV) of the above shBCL11B-drNK cells, HEK-293T cells infected with influenza virus, and HK2 proximal tubules infected with Papilloma virus The cell killing ability of cells and SNU449 liver cells infected with Hepatitis virus and the frequency of CD107a + cells expressed through co-culture were measured in the same manner as above and compared with NK-92 cells.
  • shBCL11B-drNK cells showed high cell killing ability (FIG. 17D) and high CD107a even at a low E (Effector NK cell):T (Target cancer cell) ratio for all virus-infected cells compared to NK-92 cells, a positive control group. + cell frequency was confirmed (FIG. 17E).
  • SARS-CoV-2-infected Calu-1 cells human lung epithelial cells
  • virus-uninfected Calu-1 cells Apoptosis was measured.
  • 10 x 10 4 of each of uninfected Calu-1 cells or SARS-CoV-2 infected Calu-1 cells and shBCL11B-drNK cells were dispensed into a 96-well plate, and incubated in an incubator at 37°C and 5% CO 2 for 4 hours. co-cultured during As a positive control, PBMC-NK cells were used.
  • APC Annexin V Apoptosis Detection Kit with Propidium Iodide (PI) according to the instructions of the manufacturer (Biolegend, Cat#: 640932).
  • the co-cultured cells were transferred to an e-tube, washed twice using a cell staining solution and a centrifuge, and suspended in annexin V binding buffer. 5 ul of APC Annexin V and 10 ul of PI were added to each tube and reacted at room temperature for 15 minutes while blocking light. Annexin V binding buffer was additionally added and measured using a flow cytometer.
  • shBCL11B-drNK cells exhibit excellent antiviral effects.
  • the cultured shBCL11B-drNK cells, positive control PBMC-NK cells, or NK-92 cells were injected into FACS buffer containing fluorescent CD56 and CD107a antibodies, reacted at room temperature for 20 minutes, and the cells were centrifuged. It was washed and recovered using a separator and measured by FACS analysis.
  • both the shBCL11B-drNK cells and positive controls showed low E. coli populations (FIG. 19A), confirming that they had high toxicity to E. coli (PBMC-NK cells and NK-92 cells).
  • NK 0h(0:1); average 20,000, 2h(0:1); average 28,000, 2h(0.3:1); average 3,640, 2h(1:1); average 860, 2h(3: 1); 85 average, NK-92: 0h(0:1); 19,825 average, 2h(0:1); 28,000 average, 2h(0.3:1); 5,200 average, 2h(1:1) ; Average 3,200, 2h(3:1); Average 88.5, BCL11B-drNK: 0h(0:1); Average 19,825, 2h(0:1); Average 28,000, 2h(0.3:1); Average 3,540, 2h(1:1); average of 397.5, 2h(3:1); average of 80).
  • shBCL11B-drNK cells had higher CD107a + cells compared to positive controls (PBMC-NK cells and NK-92 cells). It was confirmed that the frequency was indicated (FIG. 19B).
  • streptococci were suspended in TSB (tryptic soy broth) and washed with RPMI 1640 medium containing 10% FBS and no antibiotics.
  • the shBCL11B-drNK cells of Example 1-1 or NK-92 cells as a positive control were diluted to a density of 15X10 4 cells/100 ⁇ l using a culture medium, and then dispensed into a 96-well plate. 15X10 4 cells/100 ⁇ l of streptococci were added to the above 96-well plate, incubated at 37° C. for 2 hours under 5% CO 2 conditions, and then the frequency of CD107a + cells was confirmed by flow cytometry.
  • the frequency of CD107a + cells was measured by administering shBCL11B-drNK cells or NK-92 cells to FACS buffer supplemented with fluorescent CD56 and CD107a antibodies, reacting at room temperature for 20 minutes, and washing the cells using a centrifuge. and recovered and subjected to FACS analysis.
  • shBCL11B-drNK cells exhibit remarkable antibacterial efficacy against Gram-negative bacteria and Gram-positive bacteria compared to PBMC-NK cells and NK-92 cells.
  • Example 10 Antifungal efficacy of drNK cells
  • Candida albicans was taken from a YPD agar plate (containing 1% yeast extract, 2% peptone, 2% D-glucose, and 1% agar) and cultured in YPD medium (containing 1% yeast extract, 2% peptone, and 2% agar). D-glucose) for 2 hours at 37°C, centrifuged at 1000 xg for 5 minutes, and then washed with RPMI 1640 medium containing 10% FBS and no antibiotics.
  • the frequency of CD107a + cells was measured by administering cultured shBCL11B-drNK cells, positive control PBMC-NK cells or NK-92 cells to FACS buffer supplemented with fluorescent CD56-PE and CD107a-APC antibodies and incubating at room temperature for 20 min. After a minute reaction, the cells were washed and harvested using a centrifuge and measured by FACS analysis.
  • the frequency of CD107a + cells was the highest when shBCL11B-drNK cells and Candida were co-cultured (20.4%), PBMC-NK cells and Candida were co-cultured (10.0%), and shBCL11B-drNK cells were cultured alone. (8.5%), co-culture of NK-92 cells and Candida (6.3%), PBMC-NK cell culture alone (5.6%), and NK-92 cell culture alone (2.9%) showed the highest frequency of CD107a + cells in that order. (FIG. 20).
  • 5X10 three conidia were inoculated into a 96-well plate and cultured for 4 hours in an incubator at 37°C and 5% CO 2 , and shBCL11B-drNK cells of Example 1-1, PBMC-NK cells or NK-92 as a positive control Cells were co-cultured for 6 hours at an E:T ratio of 1:1. After removing the supernatant from the 96-well plate, cell lysis and washing with sterile distilled water, XTT (2,3-Bis- 150 ul of (2-Methoxy-4-Nitro-5-Sulfophenyl)-2H-Tetrazolium-5-Carboxanilide) solution was added.
  • shBCL11B-drNK cells and the positive control group showed antifungal activity, and in particular, it was confirmed that shBCL11B-drNK cells had the best antifungal activity (FIG. 21).
  • the drNK cells or CAR-drNK prepared through the present invention have excellent cell killing ability against cancer cells or cells infected with viruses, bacteria and fungi, and therefore, cancer, or infectious diseases caused by bacteria and fungi and / or It can be applied as a cell therapy agent and composition for preventing or treating inflammatory diseases.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Hematology (AREA)
  • Oncology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

본 발명은 BCL11B(B-cell leukemia 11B) 유전자 발현 및/또는 기능을 억제하는 물질 및 방법을 이용하여 유도 자연살해(Directly reprogrammed natural killer; drNK) 세포 또는 CAR(Chimeric antigen receptor)-유전자 도입 CAR-drNK 세포를 제조하는 방법에 관한 것이다. 본 발명은 또한, BCL11B 유전자 기반 세포 리프로그래밍 방법에 의해 제조된 drNK 세포 또는 CAR-drNK 세포, 이를 포함하는 암 및 바이러스, 세균, 곰팡이 등으로 인한 감염성 질환 및/또는 염증성 질환 예방 또는 치료용 세포치료제 및 조성물에 관한 것이다.

Description

유도 자연살해세포의 제조방법 및 그의 용도
본 발명은 BCL11B(B-cell leukemia 11B) 유전자 발현 및/또는 기능을 억제하는 물질 및 방법을 이용하여 유도 자연살해(Directly reprogrammed natural killer, drNK) 세포 또는 CAR(Chimeric antigen receptor)-유전자 도입 CAR-drNK 세포를 제조하는 방법에 관한 것이다. 본 발명은 또한, 세포 리프로그래밍 방법에 의해 제조된 drNK 세포 또는 CAR-drNK 세포, 이를 포함하는 암 질환, 바이러스, 세균, 곰팡이 등으로 인한 감염성 질환 및/또는 염증성 질환에 대한 예방 또는 치료용 세포치료제 및/또는 조성물에 관한 것이다.
NK(Natural killer) 세포는 선천 및 후천 면역 반응에 중요한 역할을 하는 림프구계 혈액세포의 하나로, 특히 암 세포, 바이러스, 세균(박테리아), 곰팡이, 기생충 등의 감염 세포 등 비정상 세포를 인지하여 즉각적으로 제거하는 기능을 가지고 있어 이러한 기능을 이용한 치료제 개발 연구가 활발히 진행되고 있다.
NK 세포가 암 세포의 발생과 증식, 전이를 억제하는 것 이외에도 암 줄기세포를 효과적으로 제어할 수 있음으로써 암 재발 방지 기능까지 있다는 것이 밝혀지면서 NK 세포를 이용한 항암 치료제 개발 연구의 중요성이 더욱 커지고 있다. 최근 기능적인 측면에서, 항암 치료 효용성을 증진하기 위한 혁신적인 방법으로 표적 암 세포에 대한 특이성과 활성화를 촉진하는데 효과적인 암 세포 표적 키메라 항원 수용체(Chimeric antigen receptor, CAR) 유전자를 도입하는 CAR-NK 플랫폼 기술이 활발히 개발되고 있다. 이에, CRA-NK 세포는 또 다른 면역세포치료제인 CAR-T 세포와 달리 사이토카인 방출 증후군(Cytokine release syndrome, CRS)을 유발할 가능성이 적고[K. Rezvani, et al., Mol. Ther., 25(2017), pp. 1769-1781], 면역 억제를 거의 유발하지 않으며, 항-PD-1 면역 요법을 향상시키는 등의 특성이 보고되면서 기존 세포치료제의 이슈를 극복하고 임상적 혜택을 극대화할 수 있는 치료제 개발의 장점이 부각되고 있다[K.C. Barry, et al., Nat. Med., 24(2018), pp. 1178-1191]. 또한, 전임상 및 임상시험에서 CAR-NK가 혈액암뿐만 아니라 치료가 어려운 고형암 세포를 효과적으로 제거할 수 있음이 확인되어[E.L. Siegler, et al., Cell Stem Cell, 23(2018), pp. 160-161], 광범위한 암 질환을 대상으로 부작용이 적으면서 기능이 개선된 효과적인 항암 면역세포치료제로 개발될 수 있는 잠재력이 인정되고 있다.
현재, CAR-NK 제작을 위한 주 세포원으로 증식능이 우수한 불멸화 NK-92 세포 및 전분화능줄기세포[Pluripotent stem cell, PSC: 배아줄기세포(Embryonic stem cell, ESC) 및 유도만능줄기세포(induced pluripotent stem cell, iPSC)] 등이 이용되고 있다. NK-92 세포는 불멸화세포주로 지속적인 생산이 용이하지만 태생적으로 비-호지킨 림프종(non-Hodgkin's lymphoma) 환자 유래 암세포이기 때문에 안전성 문제가 있으며 체내에서 항암 효과가 낮다는 단점이 지적되고 있다. 전분화능줄기세포를 기반으로 한 CAR-NK 생산은 일차적으로 CAR 유전자가 탑재된 CAR-PSC를 생산하고 분리 증폭 과정을 거친 후 추가적으로 CAR-NK 세포로의 단계별 분화 공정 과정을 거쳐야 한다. PSC를 이용한 NK 세포 생산은 초기세포를 대량 증식하고 뱅킹화할 수 있다는 장점을 가지고 있지만, PSC로부터 최종 산물인 CAR-NK를 생산하기 위한 공정 과정이 복잡하고 많은 시간과 비용이 소요된다는 문제점이 지적되고 있다. 이와 함께 잔류 미분화 PSC는 종양 형성 가능성을 내재하고 있어 PSC 유래 분화 세포를 치료적 목적으로 활용하기 위해서는 우선적으로 안전성을 확보, 유지할 수 있는 기술 확보 및 품질 관리가 필수적이다.
최근, 체세포 리프로그래밍 기술의 발전과 함께 임상적 유용성이 높은 기능성 세포를 iPSC 등 줄기세포 생산 공정 과정을 경유하지 않고 직접 생산하는 기술 개발이 활발히 진행되고 있다. 직접 리프로그래밍 기술을 통해 생산된 기능성 세포는 후성유전학적 리모델링 및 종양 형성 위험성이 낮고, 세포의 생산 공정 과정을 단순화하여 안전성, 신뢰성, 효율성을 증진하는 것이 용이하다는 기술적 장점이 높게 부각되고 있다. 이와 같은 특성은 궁극적으로 치료제 개발에 소요되는 시간과 비용을 획기적으로 단축, 절감해 실용화 장벽을 해소하는데 기여할 수 있을 것으로 예상되어 암질환을 포함한 다양한 질환을 대상으로 한 세포치료제 원재료를 직접 리포르그래밍 기술을 이용하여 확보하기위한 연구개발 노력이 지속적으로 증가하고 있다.
현재까지 직접 리프로그래밍에 의해 생산된 NK 세포의 바이러스, 세균 및 곰팡이 등에 의한 감염증 및/또는 염증에 대한 예방, 치료 및 개선 효과에 대해서는 보고된 바 없다.
이러한 배경 하에, 본 발명자들은 PSC 리프로그래밍 과정을 거쳐 NK 세포를 확보하는 기존 방법과는 차별화하여 iPSC 리프로그래밍 과정 및 PSC 분화과정을 거치지 않고 직접 리프로그래밍을 통해 NK 세포 또는 CAR-NK 세포를 확보하는 새로운 접근법을 개발하여 NK 기반 치료제 생산에서의 다양한 문제를 해결하고자 예의 노력하였다.
본 발명자들은 BCL11B(B-cell leukemia 11B) 유전자의 발현을 제어함으로써 분리된 인간 체세포로부터 drNK 세포 또는 CAR-drNK 세포를 체세포 리프로그래밍 배양을 통해 생산할 수 있음을 확인하였다. 또한, 상기 방법으로 생산된 세포가 암 세포 살상능 및 항바이러스, 항균 및 항곰팡이 효과를 나타내어 암 및 감염성 질환 및/또는 염증성 질환의 예방 또는 치료에 적용할 수 있음을 확인하고, 본 발명을 완성하였다.
본 발명의 하나의 목적은 a) 분리된 세포에 하기의 i) 또는 iii) 중 선택되는 어느 하나 이상을 도입하여 세포에서의 BCL11B 유전자 발현을 억제하는 단계: i) BCL11B shRNA(Short hairpin RNA), ii) BCL11B siRNA(Short interfering RNA), 또는 iii) CRISPR(Clustered regularly interspaced short palindromic repeats)/Cas9-gRNA-BCL11B; b) 상기 a) 단계의 세포를 사이토카인 및 성장인자를 포함하는 배지에서 배양하여 NK(Natural killer) 세포로 세포전환 시키는 단계;를 포함하는, 유도 자연살해(Directly reprogrammed natural killer, drNK) 세포 제조방법을 제공하는 것이다.
본 발명의 다른 하나의 목적은 상기 방법으로 제조된 drNK 세포를 제공하는 것이다.
본 발명의 또 다른 하나의 목적은 상기 방법에서 상기 a) 또는 b) 중 선택되는 어느 하나 이상의 단계에 CD19-CAR, MSLN-CAR 및 HER2-CAR로 이루어지는 군으로부터 선택되는 CAR 유전자를 추가로 도입하는 것을 포함하는, CAR-drNK 세포 제조방법을 제공하는 것이다.
본 발명의 또 다른 하나의 목적은 상기 방법으로 제조된 CAR-drNK 세포 제조방법을 제공하는 것이다.
본 발명의 또 다른 하나의 목적은 상기 방법으로 제조된 세포를 유효성분으로 포함하는, 암 예방 또는 치료용 세포치료제 조성물을 제공하는 것이다.
본 발명의 또 다른 하나의 목적은 상기 방법으로 제조된 세포를 유효성분으로 포함하는, 암 예방 또는 치료용 약학 조성물을 제공하는 것이다.
본 발명의 또 다른 하나의 목적은 상기 방법으로 제조된 세포를 유효성분으로 포함하는, 감염성 질환의 예방 또는 치료용 세포치료제 조성물을 제공하는 것이다.
본 발명의 또 다른 하나의 목적은 상기 방법으로 제조된 세포를 유효성분으로 포함하는, 감염성 질환의 예방 또는 치료용 약학 조성물을 제공하는 것이다.
본 발명을 통해 제작된 drNK 세포 또는 CAR-drNK는 암 세포 또는 바이러스, 세균 및 곰팡이 감염 세포에 대한 세포 살상능이 우수한 바, 암, 또는 세균 및 곰팡이에 의한 감염성 질환 및/또는 염증성 질환의 예방 또는 치료용 세포치료제 및 조성물로 적용할 수 있다.
도 1은 shBCL11B-drNK 세포 제조방법(A) 및 CAR-shBCL11B-drNK 세포 제조방법(B)의 모식도이다.
도 2는 유전자 가위 CRISPR/Cas9를 이용한 gBCL11B-drNK 세포 제조방법(A) 및 CAR-gBCL11B-drNK 세포 제조방법(B)의 모식도이다.
도 3은 CAR를 코딩하는 렌티바이러스 벡터(A), BCL11B 유전자의 exon1 부위를 타겟으로 하는 유전자 가위 플라스미드 벡터 및 CAR를 발현하는 삽입 유전자를 포함하는 AAV 벡터 모식도(B)이다.
도 4는 7종의 shRNA(shBCL11B#1, shBCL11B#2, shBCL11B#3, shBCL11B#4 shBCL11B#5, shBCL11B#6, shBCL11B#7) 및 4종의 siRNA(siBCL11B-A, siBCL11B-B, siBCL11B-C, siBCL11B-D 서열 및 위치(A), PBMC로부터 shBCL11B/siBCL11B-drNK 세포 제조 모식도(B) 및 NK 마커를 이용한 NK 세포 생산 확인 결과(C)이다.
도 5는 제1배지(A) 및 제2배지(B) 배양 구성 요소가 shBCL11B-drNK 세포 생산 수율에 미치는 영향을 나타낸 도이다.
도 6은 shBCL11B-drNK 세포의 NK 특이적 마커의 발현 특성을 검증한 결과이다.
도 7은 shBCL11B-drNK 세포의 암 세포 살상능 분석 결과이다.
도 8은 shBCL11B-drNK 세포와 NK-92 세포의 암 세포 살상능 비교 결과이다.
도 9는 shBCL11B-drNK 세포와 PBMC-NK 세포의 암 세포 감작에 대한 CD107a+ 세포 빈도(A) 및 IFN-gamma 발현 세포 빈도(B) 결과이다.
도 10은 shBCL11B-drNK 세포와 PBMC-NK 세포의 마우스 전립선암 모델(PC-3) (A) 및 마우스 난소암 모델(SK-OV-3) (B)에서의 생체내 암 세포 살상능 비교 결과이다.
도 11은 PBMC로부터 CAR-shBCL11B-drNK 세포 제조방법의 모식도(A) 및 NK 마커를 이용한 생산 확인 결과(B)이다.
도 12는 CAR(MSLN-CAR)-shBCL11B-drNK 세포의 NK 특이적 마커의 발현 특성을 검증한 결과이다.
도 13은 PBMC로부터 gBCL11B-drNK 세포 제조의 모식도(A) 및 NK 마커를 이용한 NK 세포 생산 확인 결과(B)이다.
도 14는 gBCL11B-drNK 세포의 NK 특이적 마커의 발현 특성 양상 검증 결과이다.
도 15는 PBMC로부터 CAR-gBCL11B-drNK 세포 제조방법의 모식도(A 및 B)이고, NK 마커를 이용한 NK 세포 생산 확인 결과(C) 및 게놈에 삽입된 CAR-KI(Knock-in)를 확인한 결과(D)이다.
도 16은 shBCL11B-drNK, gBCL11B-drNK, CAR(MSLN-CAR)-shBCL11B-drNK 및 CAR(MSLN-CAR)-gBCL11B-drNK 세포의 암 세포 살상능(A) 및 CD107a+ 세포 빈도(B) 결과이다.
도 17은 shBCL11B-drNK 세포의 항바이러스 효능 분석 결과이다. 엡스타인바 바이러스(Epstein-Barr Virus, EBV)에 감염된 B-lymphoma Raji 세포에 대한 세포 살상능(A), EBV 감염된 Raji 세포에서의 CD107a+ 세포 빈도(B), shBCL11B-drNK, NK-92, PBMC-NK 세포와의 공배양시 EBV 감염된 Raji 세포에서의 LMP-1(Latent Membrane Protein 1) 발현 수준(C) 및 인간면역결핍 바이러스(Human immunodeficiency virus, HIV), 인플루엔자(Influenza) 바이러스, 파필로마(Papilloma) 바이러스 및 헤파티티스(Hepatitis) 바이러스에 감염된 대한 항바이러스 효능 분석 결과(D)이다.
도 18은 shBCL11B-drNK 세포와 SARS-CoV-2 바이러스에 감염된 세포의 공배양에 따른 세포 사멸 분석 결과이다.
도 19는 shBCL11B-drNK 세포 배양에 따른 그람음성 세균 및 그람양성 세균에 대한 항균 효능을 분석한 결과이다. shBCL11B-drNK 세포 배양에 따른 그람음성 세균인 대장균 군집수(A) 및 CD107a+ 세포 빈도(B) 결과, shBCL11B-drNK 세포 배양에 따른 그람양성 세균인 연쇄상구균의 CD107a+ 세포 빈도(C) 결과이다.
도 20은 shBCL11B-drNK 세포와 칸디다 알비칸스(Candida albicans)와의 공배양에 따른 CD107a+ 세포 빈도 결과이다.
도 21은 shBCL11B-drNK의 아스페르길루스 푸미가투스(Aspergillus fumigatus)에 대한 항곰팡이 활성 분석 결과이다.
도 22는 MSLN-CAR을 발현하는 렌티바이러스 벡터를 나타낸 도이다.
도 23은 MSLN-CAR을 발현하는 CAR 플라스미드를 나타낸 도이다.
도 24는 MSLN-CAR을 발현하는 AAV 플라스미드를 나타낸 도이다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다.
본 발명의 하나의 양태는 a) 분리된 세포에 하기의 i) 또는 iii) 중 선택되는 어느 하나 이상을 도입하여 세포에서의 BCL11B 유전자 발현을 억제하는 단계: i) BCL11B shRNA(Short hairpin RNA), ii) BCL11B siRNA(Short interfering RNA), 또는 iii) CRISPR(Clustered regularly interspaced short palindromic repeats)/Cas9-gRNA-BCL11B; b) 상기 a) 단계의 세포를 사이토카인 및 성장인자를 포함하는 배지에서 배양하여 NK(Natural killer) 세포로 세포전환 시키는 단계;를 포함하는, 유도 자연살해(Directly reprogrammed natural killer, drNK) 세포 제조방법을 제공하는 것이다.
본 발명에서 용어, "NK(Natural killer) 세포"는 바이러스, 세균(박테리아), 곰팡이 및 기생충의 감염과 비정상적인 자가 세포(특히, 암 세포)를 즉각적으로 인식하여 제거하는 핵심 선천면역세포다. 항원-특이적인 수용체를 발현하여 표적세포를 인지하는 T 세포와는 달리 NK 세포는 항원에 대한 특이성 및 인간 백혈구 항원(human leukocyte antigen, HLA) 매칭 없이 킬러 면역 글로불린 수용체(Killer immunoglobulin receptors, KIR), 자연 세포 독성 수용체(Natural cytotoxicity receptors, NCR), DNAM-1(DNAX accessory molecule-1) 및 NKG2D(NK group 2 member D)와 같은 억제 수용체 또는 활성화 수용체의 균형, 표면 MHC(Major histocompatibility complex) 클래스(Class) I 항원의 소실 등 표적 세포(특히, 암 세포 및 감염된 세포)의 비정상적인 변화를 인지하며, 다양한 기전을 통해 접촉 의존성(Contact-dependent) 세포독성을 나타낸다. 인간 백혈구 항원(HLA)이 일치하지않은 비자기(non-self) 동종 세포에 대해 이식편대숙주질환(Graft-versus-host disease, GVHD)을 유발할 수 있는 T 세포와는 달리 동종 NK 세포는 이식편대숙주질환의 부작용이 거의 없고 오히려 항암효과가 강하게 나타남이 확인되고 있다.
최근, NK 세포의 질환 표적세포에 대한 특이성과 활성화를 촉진하기 위한 방안으로 표적세포 항원에 특이적인 키메라 항원 수용체(Chimeric antigen receptor, CAR)를 발현하는 NK(CAR-NK) 세포를 제작하고, 이에 따라 표적세포 살해 활성 증진 및 그 치료 효용성을 규명하는 연구가 활발히 진행되고 있다. 상기 CAR-NK 세포를 제조하는 방법으로 증식이 비교적 용이한 단일 NK 세포주 (NK-92, 배아줄기세포, 유도만능줄기세포 등)에 CAR- 유전자를 도입하는 방법이 주로 이용되고 있으나 여전히 낮은 생산효율, 복잡한 공정 과정, 안전성 문제(종양 형성 가능성 등), 낮은 치료 효능 등은 극복되어야 할 문제점으로 부각되고 있다.
본 발명에서 용어, "직접 리프로그래밍(Direct reprogramming)"은 특정 세포가 가지는 전체 유전자 발현 패턴(Global gene expression pattern) 등을 조절하여, 전혀 다른 특성을 가지는 목적하는 세포로 계통을 전환시키는 방법을 의미한다. 상기 직접 리프로그래밍은 세포의 리프로그래밍(Reprogramming), 분화(Differentiation), 직접 분화, 역분화(Dedifferentiation), 직접 역분화, 전환(Conversion), 직접 전환, 교차분화(Trans-differentiation), 또는 직접 교차분화를 포함하는 개념일 수 있으나, 이에 제한되지 않는다.
상기 "직접 리프로그래밍"은 외래 유전자 혹은 DNA를 포함하는 올리고뉴클레오타이드(Oligonucleotide) 또는 벡터를 세포에 도입함으로써 "세포전환"이 수행되는 것일 수 있으며, 세포가 다른 상태로 바뀌는 것을 의미할 수 있다. 상기 "분화"는 세포가 분열하여 만들어진 딸 세포들이 원래의 모 세포와 다른 기능을 얻는 현상을 의미하며, 본 발명에서, 상기 "직접 리프로그래밍"은 "직접 세포전환 유도", "직접 세포전환", " 세포전환"과 혼용될 수 있다.
본 발명에서 용어, "분화된 세포"는 구조나 기능이 특수화된 세포, 즉, 생물의 세포, 조직 등이 각각에게 주어지는 역할을 수행하기 위해 적합한 형태 및 기능으로 변화된 상태를 의미한다. 예를 들어, 넓게는 배아줄기세포와 같은 전분화능 줄기세포로부터 유래된 외배엽, 중배엽 및 내배엽 세포가 분화된 세포고, 좁게는 조혈모 세포로부터 유래된 적혈구, 백혈구, 혈소판 등이 분화된 세포일 수 있다.
본 발명에서 용어, "계통이 전환된 세포"는 세포가 가지고 있던 고유의 계통 특성이 발생학적으로 또는 인위적인 방법(예를 들면, 직접 세포전환 유도, 리프로그래밍 등)으로 바뀌어 다른 계통 특성을 가진 세포 유형으로 전환된 세포로서, 전환되기 전의 세포 유형의 특성과는 전혀 다른 세포 유형의 특성을 가진다. 본 발명에 있어서, 상기 계통이 전환된 세포는 목적 세포일 수 있다. 예를 들면, 말초혈액 단핵 세포가 직접 세포전환 유도를 통해 말초혈액 단핵 세포와 다른 계통인 림프계 줄기세포, 구체적으로는 NK 세포로 전환되는 것일 수 있으나, 이에 제한되지 않는다.
전술한 바와 같이 NK 세포는 면역 세포치료제 등으로써 사용하기 위해, 인체유래 NK 세포 일차 분리 및 배양, 줄기 세포로부터 분화, 또는 체세포 리프로그래밍 방법 등을 통해 생산되고 있다. 특히, 유도만능줄기세포(iPSC) 리프로그래밍 기술을 이용하여 NK 세포를 제조하기 위해서는 1) 우선적으로 분리된 체세포로부터 유도만능줄기세포를 제조한 후, 2) 유도만능줄기세포로부터 분화 중간체인 조혈줄기(전구)세포를 분화하고, 3) 추가적으로 NK 세포 분화를 유도하는 과정을 거쳐야 한다. 이와 같이 종래 리프로그래밍 기술 기반 iPSC-NK 생산 기술은 복잡한 배양 및 분화 과정을 순차적으로 거쳐야 하기 때문에 제조 효율이 낮고 시간적, 비용적 소모가 크다는 단점이 있다. 또한, 전분화능을 가진 유도만능줄기세포를 경유하여 제조되기 때문에 미분화 세포의 잔류 여부는 종양형성 가능성과 밀접하게 연관되어 안전성 확보 여부가 검증되어야 할 중요한 쟁점으로 부각되고 있다.
이에 반해, 본 발명은 iPSC를 경유하지 않고 직접 리프로그래밍 유도를 통해 분리된 체세포로부터 NK 세포를 직접 제조함으로써 제조 시간이 짧고, 비용이 절감된다는 장점과 함께, 안전성이 확보되는 바, 종래 기술과 차별화되며, 기존 NK 세포원의 문제점을 극복할 수 있는 대안을 제공할 수 있다.
구체적으로, 본 발명은 복수의 전분화능 전사인자 유전자 조합의 과발현을 이용한 기존의 세포 리프로그래밍 방법과는 차별화하여 단일 BCL11B(B-cell Leukemia 11B) 유전자 발현 및/또는 기능을 억제하는 물질 및 방법을 이용하여 “유도 자연살해(Directly reprogrammed natural killer, drNK)” 세포 또는 이에 CAR 유전자가 추가로 도입되어 CAR를 발현하는 “CAR-drNK” 세포를 제작함으로써 유전적 안전성이 개선된 NK 세포를 제조할 수 있음을 확인하였다. 특히, 본 발명은 유전자 가위 기술을 접목하여 BCL11B 발현 제어를 위한 유전자 서열 편집을 제한함으로써 기존 리프로그래밍 방법의 무작위 유전자 삽입 문제를 극복하는 획기적인 대안을 제시하였다.
본 발명에 있어서, 상기 drNK 세포 제조방법은, a) 분리된 세포에 직접 리프로그래밍 인자를 도입하여 세포에서의 BCL11B 유전자 발현을 억제하는 단계를 포함하는 것일 수 있다.
일 예로, 상기 리프로그래밍 인자는 i) BCL11B shRNA(Short hairpin RNA), ii) BCL11B siRNA(Short interfering RNA), 또는 iii) CRISPR(Clustered regularly interspaced short palindromic repeats)/Cas9-gRNA-BCL11B 일 수 있다.
본 발명의 용어, "분리된 세포"는 특별한 제한은 없으나, 일 예로 생식 세포, 체세포(Somatic cell) 또는 전구 세포(Progenitor cell) 등 이미 계통(Lineage)이 특정된 세포일 수 있다. 상기 "체세포"는 생식 세포를 제외한 동·식물을 구성하는 분화가 완결된 모든 세포를 뜻하며, 상기 "전구 세포"는 자손에 해당하는 세포가 특정 분화 형질을 발현하는 것으로 밝혀진 경우, 분화 형질을 발현하지 않으나, 그 분화 운명을 가지고 있는 모세포를 말한다. 예를 들면, 혈액 세포에 대해서는 조혈모세포가 전구세포에 해당하고, 중간엽 세포에 대해서는 중간엽줄기세포가 전구세포에 해당한다.
상기 분리된 세포는 인간에게서 유래한 세포일 수 있으나, 이에 제한되지 않으며, 다양한 개체에서 유래된 세포 역시 본 발명의 범위 내에 속할 수 있다. 또한, 본 발명의 분리된 세포에는 생체내 또는 생체외의 세포가 모두 포함될 수 있다.
일 예로, 상기 분리된 세포는 체세포일 수 있고, 다른 일 예로, NK 세포를 제외한 체세포일 수 있고, 또 다른 일 예로, 혈액 세포(Blood cell) 및 섬유아 세포(Fibroblast)로 이루어지는 군으로부터 선택되는 어느 하나 이상일 수 있으나, 이에 제한되지 않는다. 그 예로, 상기 혈액 세포는 말초혈액 단핵 세포(Peripheral blood mononuclear cell, PBMC)일 수 있으나, 이에 제한되지 않는다.
본 발명에서 용어, "직접 리프로그래밍 유도 인자"는 세포에 도입되어 세포전환을 유도할 수 있는 유전자(혹은 폴리뉴클레오티드), 또는 이로부터 코딩되는 단백질을 의미한다. 상기 직접 리프로그래밍 유도 인자는 리프로그래밍을 통해 얻고자 하는 목적 세포에 따라, 그리고 세포전환되기 전의 세포의 종류에 따라 달라질 수 있다. 본 발명의 목적상, 분리된 체세포를 NK 세포로 유도하기 위해, 상기 분리된 체세포에 도입되는 직접 리프로그래밍 유도 인자는 BCL11B(B-cell lymphoma/Leukemia 11B) 유전자 발현을 억제하는 물질일 수 있고, 구체적으로 BCL11B 안티센스 올리고뉴클레오타이드(Antisense oligonucleotide), shRNA(Short hairpin RNA), shRNA(Short interfering RNA), 마이크로알앤에이(microRNA), 또는 CRISPR/Cas9-gRNA-BCL11B일 수 있으나, 이에 제한되지 않고 BCL11B 유전자 발현을 억제하는 물질 또는 억제하는 방법이라면 당업계에 공지된 모든 물질 또는 방법을 포함할 수 있다. 상기 직접 리프로그래밍 유도 인자를 이용한 세포전환은 세포가 가지는 전체 유전자 발현 패턴을 조절하여 목적 세포로의 전환을 유도하는 것으로, 상기 직접 리프로그래밍 유도 인자를 세포에 도입하고 세포를 일정 기간 배양함으로써 목적하는 종류의 세포의 유전자 발현 패턴을 가지는 목적 세포로 세포가 전환되도록 유도할 수 있다. 본 발명에서, 상기 "직접 리프로그래밍 유도 인자"는 "직접 세포전환 유도 인자", " 세포전환 유도 인자", "리프로그래밍 인자"와 혼용될 수 있다.
본 발명에서 용어, "직접 리프로그래밍 유도 인자의 도입"은 직접 리프로그래밍 유도 인자를 세포의 배양액에 투여하는 방법; 직접 리프로그래밍 유도 인자를 세포에 직접 주입하는 방법; 세포 내에 존재하는 직접 리프로그래밍 유도 인자의 발현 수준을 증가 또는 감소시키는 방법; 직접 리프로그래밍 유도 인자를 코딩하는 유전자를 포함하는 발현 벡터를 세포에 형질전환시키는 방법; 직접 리프로그래밍 유도 인자를 코딩하는 유전자의 발현이 증가 또는 감소되도록 유전자 서열을 변형하는 방법; 직접 리프로그래밍 유도 인자를 코딩하는 외래 발현 유전자를 도입하는 방법; 직접 리프로그래밍 유도 인자의 발현 유도 또는 발현 억제 효과를 가지는 물질을 처리하는 방법; 및 이들의 조합을 통하여 세포 내의 직접 리프로그래밍 유도 인자의 발현 수준을 증가 또는 감소시키는 방법일 수도 있으나, 직접 리프로그래밍 유도 인자의 발현 수준을 증가 또는 감소시킬 수 있는 한, 이에 제한되지 않는다. 특히, 직접 리프로그래밍 유도 인자의 도입은 원하는 시간 및 조건 하에서 직접 리프로그래밍 유도 인자의 발현을 유도하는 것일 수 있다. 구체적으로, 상기 직접 리프로그래밍 유도 인자를 세포에 도입하는 방법은 직접 리프로그래밍 유도 인자를 세포의 배양액에 투여하는 방법, 직접 리프로그래밍 유도 인자를 코딩하는 유전자를 포함하는 발현 벡터를 세포에 형질전환시키는 방법일 수 있으나, 이에 제한되지 않는다.
일 예로, 상기 직접 리프로그래밍 유도 인자를 세포에 직접 주입하는 방법은 당업계에 공지된 임의의 방법을 선택하여 사용할 수 있으며, 이에 제한되지는 않으나, 미세주입법(Microinjection), 전기천공법(Electroporation), 입자분사법(Particle bombardment), 직접근육주입법, 인슐레이터(Insulator) 및 트랜스포존(Transposon)을 이용한 방법 중에서 적절하게 선택하여 적용할 수 있다.
본 발명에 있어서, BCL11B 유전자 발현을 억제하는 직접 리프로그래밍 유도 인자는 i) BCL11B shRNA, ii) BCL11B siRNA, 또는 iii) CRISPR/Cas9-gRNA-BCL11B 중 선택되는 어느 하나 이상일 수 있다.
본 발명에서 용어, "shRNA(Short hairpin RNA)"는 타이트한 헤어핀 회전을 갖는 인공 RNA 분자로서, 주로 RNA 간섭을 통해 표적 유전자 발현을 침묵시키는 데 사용된다. 본 발명의 목적상, 본 발명의 shRNA는 BCL11B 유전자 발현을 억제하는 것일 수 있다.
구체적으로, 본 발명의 shRNA(shBCL11B#1, shBCL11B#2, shBCL11B#3, shBCL11B#4, shBCL11B#5, shBCL11B#6 및 shBCL11B#7)의 타겟 센스 서열(Target sense sequence)은 각각 서열번호 1 내지 7로 이루어지는 군으로부터 선택되는 어느 하나 이상일 수 있으나, 이에 제한되지 않는다.
본 발명에서 용어, "siRNA(Short interfering RNA)"는 RNA 방해 또는 유전자 사일런싱을 매개할 수 있는 핵산 분자를 의미한다. 본 발명의 목적상, 본 발명의 siRNA는 BCL11B 유전자 발현을 억제하는 것일 수 있다.
구체적으로, 본 발명의 siRNA(shBCL11B-A, shBCL11B-B, shBCL11B-C 및 shBCL11B-D)의 타겟 센스 서열(Target sense sequence)은 각각 서열번호 8 내지 11로 이루어지는 군으로부터 선택되는 어느 하나 이상일 수 있으나, 이에 제한되지 않는다.
본 발명에서 용어, "CRISPR(Clustered regularly interspaced short palindromic repeats)/Cas9"는 유전자 편집 기술의 일종으로, CRISPR 단백질, Cas9 단백질, gRNA(Guide RNA)로 구성되며 gRNA로 특정되는 DNA 서열을 정확하게 잘라낼 수 있는 시스템이다. 상기 CRISPR/Cas9는 Zinc Finger나 TALEN(Transcription activator-like effector nuclease)에 비해 편집의 정확도와 적용가능 범위가 매우 넓은 장점이 있다. 본 발명의 목적상, 본 발명의 CRISPR/Cas9는 BCL11B 유전자 발현을 억제하는 것일 수 있으며, BCL11B 유전자 발현을 억제하는 유전자 가위 기법이라면 제한 없이 포함할 수 있다.
구체적으로, 본 발명의 CRISPR/Cas9 시스템은 BCL11B를 포함하는 게놈서열(NC_000014.9) 유래 Exon1(BCL11B-ex1)을 타겟으로 하는 sgRNA#1(서열번호 12) 및 sgRNA#2(서열번호 13)을 포함할 수 있으나, BCL11B를 포함하는 게놈서열을 타겟으로 하는 gRNA라면 제한 없이 포함할 수 있다.
특히, 본 발명은 CRISPR/Cas9 시스템과 같은 유전자 가위 기술을 접목하여 BCL11B 특정 유전자 서열을 제한함으로써 기존 리프로그래밍 방법의 무작위 유전자 삽입 문제를 극복한 것에 의의가 있다.
본 발명의 방법에 있어서, 상기 CRISPR/Cas9-gRNA-BCL11B는 a) 단계 또는 b) 단계 중 선택되는 어느 하나 이상의 단계에서 처리되는 것일 수 있으나, 이에 제한되지 않는다.
본 발명의 BCL11B 유전자 발현을 억제하는 직접 리프로그래밍 유도 인자는 안티센스 올리고뉴클레오타이드, 플라스미드 벡터 또는 바이러스 벡터, 마이크로 알앤에이(MicroRNA)를 통해 직접 리프로그래밍 유도 대상 세포(모세포)로 도입될 수 있다.
본 발명에서 용어, "벡터"는 적합한 숙주 내에서 목적 단백질 또는 폴리펩티드를 발현시킬 수 있도록, 적합한 조절 서열 및 상기 목적 단백질 또는 폴리펩티드의 염기서열을 함유하는 DNA 제조물을 의미한다. 상기 조절 서열은 프로모터, 오퍼레이터, 개시코돈, 종결코돈, 폴리아데닐화시그널, 인핸서를 포함할 수 있다. 본 발명의 벡터는 조절 서열 외에도 막 표적화 또는 분비를 위한 신호 서열 또는 리더 서열을 포함하며 목적에 따라 다양하게 제조될 수 있다. 벡터의 프로모터는 구성적 또는 유도성일 수 있다. 또한, 벡터는 벡터를 함유하는 숙주 세포를 선택하기 위한 선택성 마커를 포함하고, 복제 가능한 벡터인 경우 복제 기원을 포함한다. 상기 벡터는 적당한 숙주 세포 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다.
본 발명에서 사용되는 벡터는 숙주 세포 내에서 복제 가능한 것이면 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 바이러스 벡터(Viral vector), 에피솜 벡터(Episomal vector), 플라스미드 벡터(Plasmid vector), 코즈미드 벡터(Cosmid vector), 세균인공염색체(BAC), 효모인공염색체(YAC) 등을 들 수 있다.
구체적으로, 상기 바이러스 벡터는 센다이바이러스(Sendai virus), 렌티바이러스(Lenti virus), HIV(Human immunodeficiency virus), MLV(Murineleukemia virus), ASLV(Avian sarcoma/Leukosis), SNV(Spleen necrosis virus), RSV(Rous sarcoma virus), MMTV(Mouse mammary tumor virus) 등의 레트로바이러스(Retrovirus), 아데노바이러스(Adenovirus), 아데노 관련 바이러스(Adeno-associated virus), 헤르페스 심플렉스 바이러스(Herpes simplex virus) 등에서 유래한 벡터를 포함할 수 있고, 보다 구체적으로, RNA 기반 바이러스 벡터일 수 있으나, 이에 제한되지 않는다.
상기 에피솜 벡터는 비바이러스성 비삽입성 벡터로서, 염색체 내에 삽입되지 않고 벡터에 포함된 유전자를 발현시킬 수 있는 특성을 가지는 것으로 알려져 있다. 따라서, 상기 에피솜 벡터를 포함하는 세포는, 에피솜 벡터가 유전체 내에 삽입되거나, 또는 유전체 내에 삽입되지 않은 상태로 세포 내 존재하는 경우를 모두 포함할 수 있다.
본 발명의 용어 "작동가능하게 연결된(Operably linked)"은 일반적 기능을 수행하도록 핵산 발현조절 서열과 목적하는 단백질을 코딩하는 핵산 서열이 기능적으로 연결(Functional linkage)되어 있는 것을 말한다. 재조합 벡터와의 작동적 연결은 당해 기술 분야에서 잘 알려진 유전자 재조합 기술을 이용하여 제조할 수 있으며, 부위-특이적 DNA 절단 및 연결은 당해 기술 분야에서 일반적으로 알려진 효소 등을 사용한다.
본 발명에 있어서, 상기 drNK 세포 제조방법은, b) 상기 a) 단계의 세포를 사이토카인 및 성장인자를 포함하는 배지에서 배양하여 NK 세포로 세포전환 시키는 단계;를 포함하는 것일 수 있다.
본 발명에서 용어, "배양"은 세포를 조절된 환경 조건에서 생육시키는 것을 의미하며, 본 발명의 배양 과정은 당업계에 알려진 배지와 배양 조건에 따라 이루어질 수 있다. 이러한 배양 과정은 선택되는 세포에 따라 당업자가 용이하게 조정하여 사용할 수 있다. 본 발명의 목적상, 상기 배양은 직접 리프로그래밍 또는 세포전환 유도 인자가 도입된 세포를 다른 계통의 목적 세포로 전환하는 과정이므로, 상기 직접 리프로그래밍 유도 인자가 도입된 세포를 배양하는 제1배지, 또는 제2배지의 조성은 목적 세포로 전환되기에 적합한 조성, 예를 들면, 성장인자 및 사이토카인 등을 포함할 수 있고, 이에 GSK3β(Glycogen synthase kinase 3β) 저해제(Inhibitor), PDK1(3-phosphoinositide-dependent kinase 1) 저해제 및 AHR(Aryl hydrocarbon receptor) 저해제 등을 추가로 포함할 수 있으나, 이에 제한되지 않는다.
본 발명에 있어서, 상기 b)의 배지는 사이토카인 및 성장인자를 포함하는 것일 수 있다.
본 발명에서 용어, "사이토카인"은 세포에서 제조되어 세포 신호 전달에 사용되는 비교적 작은 크기의 다양한 단백질로서, 자신을 포함하는 다른 세포에 영향을 끼칠 수 있다. 일반적으로 염증 또는 감염에 대한 면역 반응과 관련이 있는 것으로 알려져 있다. 상기 사이토카인은 예를 들면, IL(Interleukin)-2, IL-3, IL-5, IL-6, IL-7, IL-11, IL-15, IL-21, BMP4(Bone morphogenetic protein 4), 액티빈 A(Acivin A), 노치 리간드(Notch ligand), G-CSF(Granulocyte-colony stimulating factor) 및 SDF-1(Stromal cell-derived factor-1) 등일 수 있고, 구체적으로 IL-2, IL-7, IL-15, IL-21 및 이들의 조합으로 이루어지는 군으로부터 선택되는 어느 하나 이상일 수 있으나, 이에 제한되지 않는다.
본 발명에서 용어, "성장인자"는 여러 세포의 분열, 성장 및 분화를 촉진하는 폴리펩티드를 의미한다. 상기 성장인자는 예를 들면, EGF(Epidermal growth factor), PDGF-AA(Platelet-derived growth factor-AA), IGF-1(Insulin-like growth factor 1), TGF-β(Transforming growth factor-β), FGF(Fibroblast growth factor), SCF(Stem cell factor) 및 FLT3L(FMS-like tyrosine kinase ligand) 등일 수 있고, 구체적으로, SCF, FLT3L 및 이들의 조합으로 이루어지는 군으로부터 선택되는 어느 하나 이상일 수 있으나, 이에 제한되지 않는다.
본 발명의 목적상, 상기 사이토카인 및 성장인자는 분리된 세포를 목적 세포로 직접 세포전환 유도하는 배지에 포함되며, 성장인자 및 사이토카인의 종류는 직접 세포전환 유도에 이용될 수 있는 것이라면 특별히 제한되지 않는다.
본 발명에 있어서, 상기 b)의 배지는 GSK3β(Glycogen synthase kinase 3β) 저해제(Inhibitor), PDK1(3-phosphoinositide-dependent kinase 1) 저해제 및 AHR(Aryl hydrocarbon receptor) 저해제로 이루어지는 군으로부터 선택되는 어느 하나 이상을 추가로 포함하는 것일 수 있다.
본 발명에서 용어, "GSK3β(Glycogen synthase kinase-3β) 저해제(Inhibitor)"는 GSK3β의 단백질에 직접/간접적으로 결합하여 활성을 저해 또는 억제하는 물질을 의미한다. 상기 GSK3β 저해제는 예를 들면, 1-Azakenpaullone, 2-D08, 3F8, 5-Bromoindole, 6-Bio, A 1070722, Aloisine A, AR-A014418, Alsterpaullone, AZD-1080, AZD2858, Bikinin, BIO, BIO-acetoxime, Bisindolylmaleimide I, Bisindolylmaleimide I hydrochloride, CAS 556813-39-9, Cazpaullone, CHIR98014, CHIR98023, CHIR99021(CT99021), CP21R7, Dibromocantherelline, GSK-3β inhibitor I, VI, VII, X, XI,XV, GSK-3 inhibitor IX, XVI, Hymenidin, Hymenialdisine, HMK-32, I3M(Indirubin-3-monoxime, Indirubin, Indole-3-acetamide, IM-12, Kenpaullone, L803-mts, Leucettine L41, Lithium, Lithium carbonate, LY-2090314, Manzamine A MeBIO, Meridianine A, NP00111, NP031115, NP031111, NSC 693868, Palinurin, Ro 31-8220 Methanesulfonate, SB-216763, SB-415286, TC-G 24, TCS 2002, TCS 21311, Tideglusib, Tricantin, Trihydrochloride, Tungstate, TWS-119, TZDZ-8, Zinc 등일 수 있고, 일 예로 CHIR99021(CT99021)일 수 있으나, 이에 제한되지 않는다.
본 발명에서 용어, "PDK1(3-phosphoinositide-dependent kinase 1) 저해제"는 PDK1의 단백질에 직접/간접적으로 결합하여 활성을 저해 또는 억제하는 물질을 의미한다. 상기 PDK1 저해제는 BX-795, BX-912, PHT-427, GSK2334470, OSU-03012 등일 수 있고, 일 예로 BX-795일 수 있으나, 이에 제한되지 않는다.
본 발명에서 용어, "AHR(Aryl hydrocarbon receptor) 저해제"는 TCDD(Dioxin(2,3,7,8-tetrachlorodibenzo-p-dioxin))에 의해 활성화되는 리간드-활성화 전사인자(Transcription factor)인 AHR의 활성을 하향조절하거나 감소시키는 물질을 의미한다. 상기 AHR 저해제는 예를 들면, 스템레게닌 I[StemRegenin I, SRI; 4-(2-(2-(벤조[b]티오펜-3-일)-9-이소프로필-9H-퓨린-6-일아미노)에틸)페놀하이드로클로라이드, 4-(2-((2-Benzo[b]thiphen-3-yl)-9-isopropyl-9H-purin-6-yl)amino)ethyl)phenol hydrochloride], CH-223191(1-메틸-N-[2-메틸-4-[2-(2-메틸페닐)디아제닐]페닐-1H-피라졸-5-카르복사미드, 1-Methyl-N-[2-methyl-4-[2-(2-methylphenyl)diazenyl]phenyl-1H-pyrazole-5-carboxamide) 등일 수 있고, 일 예로 스템레게닌 I일 수 있다.
그러나, 상기 저해제는 직접 리프로그래밍 효율을 높일 수 있는 역할을 하는 것이라면, 상기 전술한 바에 제한되지 않는다.
본 발명에 있어서, b)의 배지는 제1배지 및 제2배지로 구분할 수 있다.
본 발명의 제1배지는 일 예로, 성장인자, 사이토카인, GSK3β 저해제, PDK1 저해제 및/또는 AHR 저해제를 포함하는 것일 수 있다.
상기 제1배지는 SCF, FLT3L, IL-2, IL-7, IL-15, CT99021 및/또는 BX795를 포함하는 것일 수 있으나, 이에 제한되지 않는다.
상기 제1배지는 FBS(Fetal bovine serum), 항생제 및 이들의 조합으로 이루어지는 군으로부터 선택되는 어느 하나 이상을 추가로 포함하는 것일 수 있으나, 이에 제한되지 않는다.
상기 항생제는 페니실린/스트렙토마이신(Penicillin/Streptomycin)일 수 있으나, 이에 제한되지 않는다.
구체적으로, 상기 a)의 제1배지는 FBS, 페니실린/스트렙토마이신, SCF, FLT3L, IL-2, IL-7, IL-15, CT99021 및/또는 BX795를 포함하는 것일 수 있으나, 이에 제한되지 않는다.
보다 구체적으로, 상기 a)의 제1배지는 8 내지 12 %의 FBS, 0.1 내지 2 %의 페니실린/스트렙토마이신, 10 내지 30 ng/ml의 인간 SCF, 10 내지 30 ng/ml의 인간 FLT3L, 150 내지 250 IU/ml의 인간 IL-2, 10 내지 30 ng/ml의 인간 IL-7, 10 내지 30 ng/ml의 인간 IL-15, 2 내지 4 uM의 CT99021 및 2 내지 10 uM의 BX795을 포함하는 StemSpan SFEM II일 수 있고, 보다 더욱 구체적으로, 9 내지 11 %의 FBS, 0.5 내지 1.5 %의 페니실린/스트렙토마이신, 15 내지 25 ng/ml의 인간 SCF, 15 내지 25 ng/ml의 인간 FLT3L, 180 내지 220 IU/ml의 인간 IL-2, 15 내지 25 ng/ml의 인간 IL-7, 15 내지 25 ng/ml의 인간 IL-15, 2.5 내지 3.5 uM의 CT99021 및/또는 4 내지 8 uM의 BX795을 포함하는 StemSpan SFEM II일 수 있으나, 이에 제한되지 않는다.
본 발명의 제2배지는 일 예로, 성장인자, 사이토카인 및 스템레게닌 I을 포함하는 것일 수 있다.
상기 제2배지는 SCF, FLT3L, IL-2, IL-7, IL-15, IL-21 및 스템레게닌 I를 포함하는 것일 수 있으나, 이에 제한되지 않는다.
상기 제2배지는 FBS, 항생제 및 이들의 조합으로 이루어지는 군으로부터 선택되는 어느 하나 이상을 추가로 포함하는 것일 수 있으나, 이에 제한되지 않는다.
상기 항생제는 페니실린/스트렙토마이신일 수 있으나, 이에 제한되지 않는다.
구체적으로, a) 단계의 제2배지는 FBS, 페니실린/스트렙토마이신, SCF, FLT3L, IL-2, IL-7, IL-15, IL-21 및 스템레게닌 I를 포함하는 것일 수 있으나, 이에 제한되지 않는다.
보다 구체적으로, a) 단계의 제2배지는 8 내지 12 %의 FBS, 0.1 내지 2 %의 페니실린/스트렙토마이신, 10 내지 30 ng/ml의 인간 SCF, 10 내지 30 ng/ml의 인간 FLT3L, 150 내지 250 IU/ml의 인간 IL-2, 10 내지 30 ng/ml의 인간 IL-7, 10 내지 30 ng/ml의 인간 IL-15, 10 내지 30 ng/ml의 인간 IL-21 및 2 내지 4 uM의 스템레게닌 I을 포함하는 StemSpan SFEM II일 수 있고, 보다 더욱 구체적으로, 9 내지 11%의 FBS, 0.5 내지 1.5 %의 페니실린/스트렙토마이신, 15 내지 25 ng/ml의 인간 SCF, 12 내지 25 ng/ml의 인간 FLT3L, 180 내지 220 IU/ml의 인간 IL-2, 15 내지 25 ng/ml의 인간 IL-7, 15 내지 25 ng/ml의 인간 IL-15, 15 내지 25 ng/ml의 인간 IL-21 및/또는 1.5 내지 2.5 uM의 스템레게닌 I을 포함하는 StemSpan SFEM II일 수 있으나, 이에 제한되지 않는다.
본 발명의 제1배지 및 제2배지는 BCL11B 유전자 발현을 억제를 통한 drNK 세포 제조에 있어, NK 세포 제조 효율을 극대화할 수 있다.
본 발명의 일 구현예에서, 제1배지 및 제2배지의 배지 구성 요소가 shBCL11B-drNK 제조 수율에 미치는 영향을 확인하기 위해, PBMC에 shBCL11B를 형질전환한 후, 이를 제1배지(양성 대조군) 또는 제1배지를 구성하는 요소에서 인간 IL-2, 인간 IL-15 또는 CHIR99021가 한 가지씩 결핍된 배지, 또는 BX795가 추가된 배지에서 배양한 다음, 제2배지에서 추가로 배양한 후 NK 생산 효율을 분석한 결과, 제1배지에서 배양된 양성 대조군(100 %)을 기준으로, IL-2가 결핍된 배지에서 배양된 세포군은 43 %, IL-15가 결핍된 배지에서 배양된 세포군은 75 %, CHIR99021가 결핍된 배지에서 배양된 세포군은 92 %, BX795가 추가된 배지에서 배양된 세포군은 113 % 의 효율로 제조됨을 확인하였다(도 5A)
본 발명의 다른 일 구현예에서, PBMC에 shBCL11B를 형질전환한 후, 제1배지에서 배양하고, 제2배지(양성 대조군) 또는 제2배지를 구성하는 요소에서 200 IU/ml 인간 IL-2, 20 ng/ml 인간 IL-7, 20 ng/ml 인간 IL-15, 20 ng/ml 인간 FLT3L, 20 ng/ml 인간 SCF 또는 2 uM SR1가 한 가지씩 결핍된 배지에서 추가로 배양한 후 NK 생산 효율을 분석한 결과, 제2배지에서 배양된 양성 대조군(100 %)을 기준으로, IL-2가 결핍된 배지에서 배양된 세포군은 56 %, IL-15가 결핍된 배지에서 배양된 세포군은 69 %, IL-7가 결핍된 배지에서 배양된 세포군은 82 %, SCF가 결핍된 배지에서 배양된 세포군은 81 %, FLT3L가 결핍된 배지에서 배양된 세포군은 38 %, SR1가 결핍된 배지에서 배양된 세포군은 57 % 의 효율로 제조됨을 확인하였다(도 5B).
이에 따라, 본 발명의 제1배지 및 제2배지를 이용하여 NK 세포 제조 효율을 향상시킬 수 있음을 알 수 있다.
상기 방법에 있어서, 직접 세포전환 인자가 도입된 분리된 세포는 상기 a)의 제1배지에서 4 내지 8 일 동안 배양한 후, 상기 b)의 제2배지에서 10 내지 14 일 동안 배양하는 것일 수 있으나, 이에 제한되지 않는다.
본 발명의 일 구현예에서는, 말초혈액 단핵 세포(Peripheral blood mononuclear cell, PBMC) 세포에 세포전환을 유도하는 리프로그래밍 인자로써 BCL11B에 대한 shRNA 또는 siRNA을 도입하기 위해, PBMC에 BCL11B-특이적 shRNA를 발현하는 렌티바이러스 처리 또는 siRNA를 도입하여 형질전환하고, 7일째까지 제1배지에서 배양한 다음, 18일째까지 제2배지에서 배양하여 직접 세포전환 유도 drNK 세포(shBCL11B-drNK)를 제조하였다(도 1A 및 도 4B).
본 발명의 다른 일 구현예에서는, PBMC 세포에 세포전환 유도 인자로써 BCL11B를 타겟으로 하는 sgRNA를 포함하는 CRISPR/Cas9 벡터를 발현하는 렌티바이러스를 처리하여 형질전환하고, 7일째까지 제1배지에서 배양한 다음, 18일째까지 제2배지에서 배양하여 직접 세포전환 유도 drNK 세포(gBCL11B-drNK)를 제조하였다(도 2A 및 도 13A).
본 발명의 다른 하나의 양태는 CAR-drNK 세포 제조방법을 제공한다.
여기에서 사용되는 용어는 전술한 바와 같다.
상기 CAR-drNK 세포 제조방법은, 본 발명의 drNK 세포 제조방법에서 a) 또는 b) 중 선택되는 어느 하나 이상의 단계에 CD19-CAR, MSLN-CAR 및 HER2-CAR로 이루어지는 군으로부터 선택되는 CAR 유전자를 추가로 도입하는 것을 포함할 수 있다. 구체적으로, 상기 CAR 유전자는 BCL11B 넉아웃(Knock-out, KO) 염기서열에 넉인(Knock-in, KI)하여 도입하는 것일 수 있다.
본 발명에서 용어, "CAR 유전자"는 항체 도메인(scFv)을 포함하는 세포 바깥 도메인, 세포막 관통 도메인 및 세포내 도메인을 코딩하는 유전자를 포함하여, 상기 세포 바깥 도메인, 세포막 관통 도메인 및 세포내 도메인으로 이루어지는 키메라 항원 수용체(Chimeric antigen receptor)를 코딩하는 유전자를 의미한다. 본 발명의 목적상, 본 발명의 CAR 유전자는 CD19 scFv을 포함하는 CD19-CAR 유전자, MSLN(Mesothelin) scFv를 포함하는 MSLN-CAR 유전자 및 HER2(Human epidermal growth factor receptor 2) scFv를 포함하는 HER2-CAR 유전자로 이루어지는 군으로부터 선택되는 어느 하나 이상일 수 있으나, 이에 제한되지 않는다.
고형 종양에 대한 CAR 표적 인자로는 EGFRvIII(Morgan RA, Hum Gene Ther. 2012;23:1043-1053), MUC-1(Wilkie S, J Immunol. 2008;180:4901-4909), MAGE(Willemsen RA, Gene Ther. 2001;8:1601-1608), CEA(Emtage PC, Clin Cancer Res. 2008;14:8112-8122), PSMA, GD2, CA125, Her2 및 MSLN, FAP, VEGFR(Kakarla S, Cancer J. 2014;20:151-155) 등을 이용할 수 있다고 알려져 있다.
또한, 상기 CD19는 세포표면항원무리(Cluster of differentiation, CD)로서 면역표현형에 따라 세포 표면 분자를 식별하는 번호 19를 할당한 것으로, 상기 CD19는 B 림프구의 표지자를 의미한다. 상기 CD19는 대부분의 B-세포 악성 종양 암 세포에서 발현하여 이들 암종에 대한 이상적인 표적을 제공하는 것으로 알려져 있다.
일 예로, 상기 CAR 유전자는 i) CD8 리더(Leader), CD19 scFv, CD8 힌지(Hinge), CD8 막 관통 도메인(TM) 및 Fc-γ(Gamma) 수용체를 포함하는 CAR 유전자(CD19-CAR 유전자); ii) CD8 리더, MSLN(Mesothelin) scFv, CD8 힌지, CD8 막 관통 도메인, CD28 세포내 도메인, CD3ζ(zetta) 및 IRES를 포함하는 CAR 유전자(MSLN-CAR 유전자); 및 iii) CD8 리더, HER2(Human epidermal growth factor receptor 2) scFv, CD8 힌지, CD8 막 관통 도메인, CD28 세포내 도메인, CD3ζ 및 IRES를 포함하는 CAR 유전자(HER2-CAR 유전자);로 이루어지는 군으로부터 선택되는 어느 하나 이상일 수 있으나, 이에 제한되지 않는다.
상기 CD8 리더는 서열번호 14, CD19 scFv는 서열번호 15, MSLN scFv는 서열번호 16, HER2 scFv는 서열번호 17, CD8 힌지는 서열번호 18, CD8 막 관통 도메인은 서열번호 19, Fc-γ 수용체는 서열번호 20, CD28 세포내 도메인은 서열번호 21, CD3ζ은 서열번호 22, 상기 CAR 유전자를 이중 시스트론을 구성하는 벡터에 클로닝하기 위해 삽입하는 IRES는 서열번호 23의 염기서열을 포함하는 것일 수 있으나, 이에 제한되지 않는다.
상기 CAR 유전자는 GFP(Green fluorescent protein)를 추가로 포함하는 것일 수 있으나, 이에 제한되지 않는다.
상기 GFP는 서열번호 24의 염기서열을 포함하는 것일 수 있으나, 이에 제한되지 않는다.
상기 서열번호 14 내지 서열번호 24의 염기서열은 공지의 데이터 베이스인 NCBI Genbank에서 그 서열을 확인할 수 있다.
본 발명에 있어서, 상기 서열번호 14 내지 서열번호 24의 염기서열은 상기 서열번호 14 내지 서열번호 24와 적어도 70 %, 80 %, 85 %, 90 %, 95 %, 96 %, 97 %, 98 %, 또는 99 % 이상의 상동성(Homology) 또는 동일성(Identity)을 가지는 염기서열을 포함할 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 상기 서열번호 14 내지 서열번호 24의 염기서열과 상응하는 기능을 나타내는 염기서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 염기서열을 갖는 서열도 본 발명의 범위 내에 포함됨은 자명하다.
본 발명의 용어 "상동성(Homology) 및 동일성(Identity)"은 두 개의 주어진 아미노산 서열 또는 염기 서열과 관련된 정도를 의미하며 백분율로 표시될 수 있다. 용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.
보존된(Conserved) 폴리뉴클레오티드 또는 폴리펩티드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성을 갖거나(Homologous) 또는 동일한(Identical) 서열은 중간 또는 높은 엄격한 조건(Stringent condition)에서 일반적으로 서열 전체 또는 전체-길이의 적어도 약 50 %, 60 %, 70 %, 80 % 또는 90 % 이상으로 하이브리드할 수 있다. 하이브리드화는 폴리뉴클레오티드에서 코돈 대신 축퇴 코돈을 함유하는 폴리뉴클레오티드 또한 고려된다.
상기 폴리펩타이드 또는 폴리뉴클레오티드 서열에 대한 상동성 또는 동일성은 예를 들면, 문헌에 의한 알고리즘 BLAST[참조: Karlin 및 Altschul, Pro. Natl. Acad. Sci. USA, 90, 5873(1993)], 또는 Pearson에 의한 FASTA(참조: Methods Enzymol., 183, 63, 1990)을 사용하여 결정할 수 있다. 이러한 알고리즘 BLAST에 기초하여, BLASTN이나 BLASTX라고 불리는 프로그램이 개발되어 있다(참조: http://www.ncbi.nlm.nih.gov). 또한, 임의의 아미노산 또는 폴리뉴클레오티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는 정의된 엄격한 조건하에서 써던 혼성화 실험에 의해 서열을 비교함으로써 확인할 수 있으며, 정의되는 적절한 혼성화 조건은 해당 기술 범위 내이고, 당업자에게 잘 알려져 있다(예컨대, J. Sambrook et al., Molecular cloning, A laboratory manual, 2nd Edition, Cold spring harbor laboratory press, Cold spring harbor, New York, 1989; F.M. Ausubel et al., Current protocols in molecular miology).
본 발명에 있어서, 상기 CAR 유전자는 전술한 직접 세포전환 인자의 도입 방법과 동일한 방법으로 세포 내에 도입될 수 있으며, 직접 세포전환 인자와 CAR 유전자는 원하는 시간 및 조건 하에서 동시에 또는 순차적으로 도입될 수 있다.
본 발명의 일 구현예에서는, PBMC 세포에 세포전환을 유도하는 리프로그래밍 인자로써 BCL11B에 대한 shRNA 또는 siRNA을 도입하기 위해 PBMC에 BCL11B-특이적 shRNA를 발현하는 렌티바이러스 처리 또는 siRNA를 도입하여 형질전환하고, MSLN-CAR 유전자를 발현하는 렌티바이러스로 형질전환하였으며, 이때 세포 배양은 제1배지에서 배양한 후 제2배지에서 추가로 배양하여 CAR(MSLN-CAR) 유전자를 발현하는 직접 세포전환 유도 drNK 세포(MSLN-shBCL11B-drNK)를 제조하였다(도 1B 및 도 11A).
본 발명의 다른 일 구현예에서는, BMC 세포에 CAR를 코딩하는 서열이 BCL11B Knock-out(KO)과 동시에 절단부위에 삽입되어 Knock-in(KI) 될 수 있는 donor 플라스미드로서 CAR-AAV를 도입하여 형질전환하고, 세포전환 유도 인자로써 BCL11B를 타겟으로 하는 sgRNA를 포함하는 CRISPR/Cas9 벡터를 발현하는 렌티바이러스를 처리하여 형질전환하였으며, 이때 세포 배양은 제1배지에서 배양한 후 제2배지에서 추가로 배양하여 CAR(MSLN-CAR) 유전자를 발현하는 직접 세포전환 유도 drNK 세포(MSLN-gBCL11B-drNK)를 제조하였다(도 2B 및 도 15).
본 발명의 또 다른 하나의 양태는 본 발명의 방법으로 제조된 drNK 세포를 제공한다.
본 발명의 또 다른 하나의 양태는 본 발명의 방법으로 제조된 CAR-drNK 세포를 제공한다.
여기에서 사용되는 용어는 전술한 바와 같다.
본 발명의 방법에 따라 제조된 drNK 세포는 CD56+, CD3- 및 이들의 조합으로 이루어지는 군으로부터 선택되는 어느 하나 이상을 발현할 수 있으나, 이에 제한되지 않는다.
상기 "CD56+" 및 "CD3-"은 NK 세포의 표면에 있는 지표로서, 본 발명에서는 CD56+, CD3- 및 이들의 조합의 발현을 유세포 분석기(Flow cytometry)를 통해 분석하여 NK 세포가 제조된 것을 확인하였다.
본 발명의 일 구현예에서는, shBCL11B-drNK 세포의 생산 여부 및 수율을 확인하기 위해, CD56 항체, CD3 항체로 상기 세포를 염색 후 유세포 분석기(Flow cytometry)를 이용하여 NK 세포군(CD56+ 및 CD3-)을 분석한 결과, CD56+CD3-(shBCL11B-drNK) 세포가 대조군에서 각각 2 %(No-treated), 0 %(sh-Control)인 반면, shBCL11B#1, shBCL11B#2, shBCL11B#3, shBCL11B#4, shBCL11B#5, shBCL11B#6 및 shBCL11B#7 처리군에서는 73 %~92 %의 효율로 제조되고, siBCL11B-A, siBCL11B-B, siBCL11B-C 및 siBCL11B-D 처리군에서는 38 %~57 %의 효율로 제조됨을 확인하였다(도 4C).
본 발명의 다른 일 구현예에서는, gBCL11B-drNK 세포의 생산 여부 및 수율을 확인하기 위해, CD56 항체, CD3 항체로 상기 세포를 염색 후 유세포 분석기를 이용하여 NK 세포군(CD56+ 및 CD3-)을 분석한 결과, CD56+CD3-(gBCL11B-drNK) 세포가 비처리군(6.0 %) 대비 sgRNA-A, sgRNA-B 또는 sgRNA-C가 포함된 Cas9-sgRNA-BCL11B 처리군에서 각각 83.9 %, 72.2 %, 72.0 %의 효율로 제조됨을 확인하였다(도 13B).
본 발명의 방법에 따라 제조된 CAR-drNK 세포는 CD56+, CD3- 및 이들의 조합으로 이루어지는 군으로부터 선택되는 어느 하나 이상을 발현할 수 있으나, 이에 제한되지 않는다.
본 발명의 일 구현예에서는, MSLN-shBCL11B-drNK 세포의 생산 여부 및 수율을 확인하기 위해, CD56 항체, MSLN-CAR 항원으로 상기 세포를 염색 후 유세포 분석기를 이용하여 NK 세포군(CD56+ 및 MSLN-CAR+)을 분석한 결과, CD56+MSLN+(MSLN-shBCL11B-drNK) 세포는 4.9 %~13.1 % 효율로 제조됨을 확인하였다(도 11B).
본 발명의 다른 일 구현예에서는, MSLN-gBCL11B-drNK 세포의 생산 여부 및 수율을 확인하기 위해, CD56 항체, CD3 항체 및 MSLN-CAR 항원으로 상기 세포를 염색 후 유세포 분석기를 이용하여 drNK 세포군(CD56+, CD3- 및 MSLN-CAR+)을 분석한 결과, CD56+CD3- 세포군(22.8 %)대비 CD56+MSLN+ 세포군은 17.3 %의 효율로 제조됨을 확인하였다(도 15C).
또한, 본 발명의 또 다른 일 구현예에서, NK 특이적 마커의 발현 특성을 검증한 결과, shBCL11B-drNK 세포, MSLN-shBCL11B-drNK 세포 및 gBCL11B-drNK 세포는 CD16, CD69, NKG2D, NKp30, NKp44, NKp46 및 DNAM-1과 같은 활성화 수용체가 KIR2DL1, KIR2DL2 및 KIR3DL1와 같은 억제 수용체에 비해 높은 빈도로 발현되어, 유사한 양상을 나타냄을 확인하였다(도 6, 도 12 및 도 14).
이를 통해, BCL11B에 대한 shRNA, siRNA 또는 Cas9/sgRNA에 의한 직접 세포전환을 통해 인간 혈액 세포에서 NK 세포로의 전환이 가능함을 확인하였다.
본 발명의 또 다른 하나의 양태는 본 발명의 방법에 따라 제조된 세포를 유효성분으로 포함하는, 암 예방 또는 치료용 세포치료제 조성물을 제공한다.
여기에서 사용되는 용어는 전술한 바와 같다.
본 발명에 있어서, 상기 암은 CD19, MSLN 또는 HER2 중 어느 하나 이상의 발현과 연관된 암일 수 있고, 구체적으로 drNK 세포 및/또는 CAR-drNK 세포의 면역반응 등에 의해 예방 또는 치료의 결과를 나타내는 암일 수 있다. 상기 암은 예를 들면, 간암, 갑상선암, 갑상샘암, 갑상선유두암, 갑상선 수질암, 가성 점액종, 간내 담도암, 감모세포종, 기관지원성암종, 기저세포암, 고환암, 골수암, 골수종, 골수이형성증, 골육종, 골원성 육종, 결장암, 결장암, 교모세포종, 구강암, 구순암, 균상 식육종, 난소암, 난소생식세포종양, 남성 유방암, 낭종암, 내피육종, 뇌암, 뇌수막종, 뇌하수체선종, 담즙관 암종, 대장암, 두경부암, 두개인두종, 담도암, 담낭암, 다발성 골수종, 림프혈관내피육종, 림프종, 호지킨 림프종, 비-호지킨 림프종, 림프관육종, 막암종, 망막모세포종, 맥락막흑색종, 미만성거대 B세포 림프종, 방광암, 전백혈병, 급성골수성 백혈병, 급성림프구성 백혈병, B-세포 급성 림프성 백혈병(BALL), 급성 백혈병, 급성 림프성 백혈병(ALL), 만성 백혈병, 만성 골수 백혈병(CML), 만성 림프구성 백혈병(CLL), T-세포 급성 림프성 백혈병(TALL), 소림프구성 백혈병(SLL), 바터팽대부암, 비흑색종 피부암, 방광암, 복막암, 부감상선암, 부신암, 비부비동암, 편평상피세포암, 비소세포폐암, 빌름스 종양, 상피 암종, 상의세포종, 생식세포암, 신장암, 신장세포 암종, 신경교종, 신경모세포종, 신우암, 신경아세포종, 신경내분비종양, 십이지장암, 설암, 섬유육종, 선암종, 성상세포종, 소세포 송과체 세포종양, 소아뇌종양, 소아림프종, 소장암, 수막종, 수모 세포종, 신세포암, 식도암, 안구암, 악성 연부 조직 종양, 악성공종양, 악성 림프종, 악성중피종양, 악성 흑색종, 안종양, 외음부암, 어윙 연골육종암, 요관암, 요도암, 원발부위불명암, 육종, 유암종, 유방암, 융모암, 위암, 위림프종, 위유암종, 위장관간질종양, 윌름스종양, 음경암, 인두암, 임신융모질환, 자궁암, 자궁경부암, 자궁내막암, 자궁 육종, 전립선암, 점액육종, 정상피종, 지방육종, 중피종, 직장암, 질암, 전이성골종양, 전이성뇌종양, 종격동암, 척수암, 척색종, 청신경종, 청신경초종, 침샘암, 췌담관암, 췌장암, 치종암, 카포시육종, 파제트병, 편도암, 피지선암종, 핍지교종망막아 세포종, 평활근육종, 편평세포암, 편평상피세포암, 폐암,폐선암, 폐편평상피세포암, 피부암, 항문암, 후두암, 흉막암, 흉선암, 혈관아 세포종, 혈액암, 혈관육종, 활액막종, 횡문근육종, 흑색종, 희귀암, 태생성 암종, 땀샘 암종, 육종 및 이들의 조합일 수 있고, 구체적으로, 혈액암, 대장암, 간암, 폐암, 췌장암, 뇌암, 난소암, 유방암, 전립선암, 흑색종, 근육종, 신장암, 감상선암, 공육종, 자궁암, 위암 및 방광암 등일 수 있으나, 이에 제한되지 않는다.
일 예로, 상기 암은 MSLN의 발현과 연관된 암일 수 있다. 다른 일 예로, 림프종, 백혈병, 골수종, 중피종, 자궁암, 두경부암, 식도암, 활막육종, 신장암, 이행세포암종, 감상선암, 생식세포종, 담도암/담관암, 유두양 장액성 선암, 대장암, 간암, 폐암, 췌장암, 교모세포종, 결장암, 난소암, 유방암, 전립선암, 흑색종, 근육종, 갑상선암, 골육종, 융모암, 위암, 신경교종, 연조직 육종, 신경내분비종양, 뇌하수체종양, 희소돌기아교세포종, 위장관기질 종양, 쓸개암, 소장암, 고립성 섬유종, 흉선암, 및 방광암 등일 수 있으나, 이에 제한되지 않는다.
본 발명에서 용어 "예방"은 상기 조성물의 투여에 의해 암을 억제시키거나 발생을 지연시키는 모든 행위를 의미한다.
본 발명에서 용어, "치료"는 상기 조성물의 투여에 의해 암에 의한 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미한다.
본 발명에서 용어, "세포치료제"는 개체로부터 분리, 배양 및 특수한 조작을 통해 제조된 세포 및 조직으로 치료, 진단 및 예방의 목적으로 사용되는 의약품(미국 FDA 규정)으로서, 세포 혹은 조직의 기능을 복원시키기 위하여 살아있는 자가, 동종, 또는 이종 세포를 체외에서 증식 선별하거나 다른 방법으로 세포의 생물학적 특성을 변화시키는 등의 일련의 행위를 통하여 치료, 진단 및 예방의 목적으로 사용되는 의약품을 의미한다.
상기 세포치료제 조성물은 본 발명의 방법에 따라 제조된 drNK 세포 및/또는 CAR-drNK 세포를 포함함으로써 암 예방 또는 치료 효능이 있는 것일 수 있다.
상기 세포치료제 조성물은 조성물 총 중량에 대하여 상기 drNK 세포 및/또는 CAR-drNK 세포를 1.0X10 내지 1.0X1010개 세포/ml, 구체적으로 1.0X106 내지 1.0X109개 세포/ml로 포함할 수 있으나, 이에 제한되지 않는다.
상기 세포치료제 조성물은 약학 분야의 통상의 방법에 따라 환자의 신체 내 투여에 적합한 단위 투여형의 약학 제제로 제형화시켜 투여할 수 있으며, 상기 제제는 1회 또는 수회 투여에 의해 효과적인 투여량을 포함한다. 이러한 목적에 적합한 제형으로는 비경구투여 제제로서 주사용 앰플과 같은 주사제, 주입 백과 같은 주입제 및 에어로졸 제제와 같은 분무제 등이 바람직할 수 있다. 상기 주사용 앰플은 사용 직전에 주사액과 혼합 조제할 수 있으며, 주사액으로는 생리 식염수, 포도당, 만니톨, 링거액 등을 사용할 수 있다. 또한, 주입 백은 염화폴리비닐 또는 폴리에틸렌 재질의 것을 사용할 수 있으며, 박스터(Baxter), 벡톤 디킨슨(Becton dickinson), 메드셉(Medcep), 내셔날 호스피탈 프로덕츠(National hospital products) 또는 테루모(Terumo) 사의 주입 백을 예시할 수 있다.
상기 약학 제제에는 상기 유효성분 외에 하나 또는 그 이상의 약학적으로 허용가능한 통상의 불활성 담체, 예를 들어, 주사제의 경우에는 보존제, 무통화제, 가용화제 또는 안정화제 등을, 국소 투여용 제제의 경우에는 기제(base), 부형제, 윤활제 또는 보존제 등을 추가로 포함할 수 있다.
이렇게 제조된 본 발명의 세포치료제 조성물 또는 이의 약학 제제는 당업계에서 통상적으로 사용하는 투여방법을 이용하여 암 치료에 사용되는 다른 세포와 함께 또는 그러한 세포와의 혼합물의 형태로 투여될 수 있으며, 구체적으로 치료가 필요한 환자의 질환 부위에 직접 생착 또는 이식하거나 복강에 직접 이식 또는 주입하는 것이 가능하나 이에 한정되지는 않는다. 또한, 상기 투여는 카테터를 이용한 비외과적 투여 및 질환부위 절개 후 주입 또는 이식 등 외과적 투여방법 모두 가능하다. 또한 통상의 방법에 따라 비경구적으로, 예를 들면 직접 병변에 투여하는 것 외에 혈관 내 주입에 의한 이식도 가능하다.
상기 세포치료제 조성물은 1일 0.0001 내지 1,000 mg/kg으로, 구체적으로 0.01 내지 100 mg/kg의 용량으로 투여할 수 있으며, 상기 투여는 하루에 한 번 또는 수회 나누어 투여할 수도 있다. 그러나, 유효성분의 실제 투여량은 치료하고자 하는 질환, 질환의 중증도, 투여경로, 환자의 체중, 연령 및 성별 등의 여러 관련 인자에 비추어 결정되어야 하는 것으로 이해되어야 하며, 따라서, 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.
본 발명의 방법에 따라 제조된 drNK 세포 및/또는 CAR-drNK 세포는 다양한 암 세포에 대한 살상능이 우수한 것일 수 있다.
본 발명의 일 구현예에서는, 제작된 shBCL11B-drNK 세포의 암 세포 살상능을 확인한 결과, 다양한 종류(림프종, 대장암, 간암, 폐암, 췌장암, 교모세포종, 결장암, 난소암, 유방암, 전립선암, 흑색종, 근육종, 갑상선암, 골육종, 융모암, 위암 및 방광암)의 암 세포 살상능을 보유함을 확인하였으며, 각 shBCL11B-drNK 세포의 낮은 E(Effector NK cell):T(Target cancer cell) 비율(0.25:1 ~ 2.5:1)에서도 높은 암 세포 살상능을 나타냄을 확인하였다(도 7). 또한, 기존 인간 자연살해 세포인 NK-92 세포에 비해 shBCL11B-drNK 세포는 약 5.2 ~ 5.5배 이상 우수한 암 세포 살상능을 나타냄을 확인하였다(도 8).
본 발명의 다른 일 구현예에서, PBMC-NK 세포(인간 말초혈액세포 유래 NK)를 암 세포와 공배양한 후 발현되는, 암 세포 용해능을 가진 CD107a+ 세포를 정량분석한 결과, shBCL11B-drNK 세포와 암 세포를 공배양할 경우 PBMC-NK 세포와 암 세포를 공배양한 경우 및 공배양하지 않은 대조군(No target)에 비해 CD107a+ 세포의 빈도(%)가 증가함을 확인하였다(도 9A). 또한, shBCL11B-drNK 세포 또는 PBMC-NK 세포를 암 세포와 공배양한 후 암 세포 용해 IFN-감마 사이토카인이 발현되는, IFN-감마+ 세포를 정량분석한 결과, 공배양하지 않은 대조군(No target)에 비해 IFN-감마+ 세포의 빈도(%)가 증가함을 확인하였으며, 암 세포 종류에 따라서 상이한 빈도를 나타냄을 확인하였다(도 9B).
본 발명의 또 다른 일 구현예에서, PC-3가 이식된 마우스 전립선암 모델에 PBMC-NK 세포, OSKM-drNK 세포, shBCL11B-drNK 세포 또는 PBS(Phosphate-buffered saline)를 주입한 후 21일차에서 대조군의 종양 크기 대비 PBMC-NK 및 shBCL11B-drNK 투여군에서 종양 크기가 현저히 감소하여, shBCL11B-drNK가 PBMC-NK 대비 우수한 항암 효과를 나타냄을 확인하였다(도 10A). 또한, SK-OV-3가 이식된 마우스 난소암 모델에 PBMC-NK 세포, shBCL11B-drNK 세포 또는 PBS를 주입한 후 21 일차에서 대조군의 종양 크기 대비 PBMC-NK, OSKM-drNK 및 shBCL11B-drNK 투여군에서 종양 크기가 현저히 감소하여, shBCL11B-drNK가 PBMC-NK 대비 우수한 항암 효과를 나타냄을 확인하였다(도 10B).
본 발명의 또 다른 일 구현예에서, shBCL11B-drNK 세포, gBCL11B-drNK 세포, MSLN-shBCL11B-drNK 세포 및 MSLN-gBCL11B-drNK 세포를 MSLN이 발현되지 않는 K562, MSLN이 발현되는 PC-3 및 Mia-paca-2와 공배양한 후 암 세포 살상능을 확인한 결과, MSLN이 발현되지 않는 K562에 대하여 4종의 NK 세포가 서로 유사한 암 세포 살상능을 보이며, MSLN이 발현되는 암 세포군 PC-3 및 Mia-paca-2에 대하여 non-CAR-drNK 세포(shBCL11B-drNK, gBCL11B-drNK) 대비 CAR-drNK 세포(MSLN-shBCL11B-drNK, MSLN-gBCL11B-drNK)에서 낮은 E:T 비율(0.25:1 ~ 2.5:1)에서도 높은 암 세포 살상능을 나타냄을 확인하였다(도 16A).
또한, shBCL11B-drNK 세포, gBCL11B-drNK 세포, MSLN-shBCL11B-drNK 세포 및 MSLN-gBCL11B-drNK 세포를 암 세포와 공배양한 후 발현되는 CD107a+ 세포를 정량분석한 결과, MSLN이 발현되는 PC-3 및 Mia-paca-2에 대하여 non-CAR-drNK 세포(shBCL11B-drNK, gBCL11B-drNK) 대비 CAR-drNK 세포(MSLN-shBCL11B-drNK, MSLN-gBCL11B-drNK) 세포에서 CD107a+ 세포의 빈도(%)가 증가함을 확인하였다(도 16B).
이에 따라, 본 발명의 방법에 따라 제조된 drNK 세포 및/또는 CAR-drNK 세포는 암 세포 살상능, 암 세포와 공배양한 후 CD107a+ 세포 및 IFN-감마+ 세포의 빈도 및 항종양 효과가 우수한 바, 항암 효과가 있음을 알 수 있다.
본 발명의 또 다른 하나의 양태는 본 발명의 방법에 따라 제조된 세포를 유효성분으로 포함하는, 암 치료 또는 예방용 약학 조성물을 제공한다.
여기에서 사용되는 용어는 전술한 바와 같다.
상기 약학 조성물은 본 발명의 방법에 따라 제조된 drNK 세포 및/또는 CAR-drNK 세포를 포함함으로써 암 예방 또는 치료 효능이 있는 것일 수 있다.
본 발명의 약학 조성물은 조성물 총 중량에 대하여 상기 drNK 세포 및/또는 CAR-drNK 세포를 1.0X104 내지 1.0X1010개 세포/ml, 구체적으로 1.0X106 내지 1.0X109개 세포/ml로 포함할 수 있으나, 이에 제한되지 않는다.
상기 약학 조성물은 약학 조성물의 제조에 통상적으로 사용하는 약학적으로 허용가능한 담체, 부형제 또는 희석제를 추가로 포함할 수 있고, 상기 담체는 비자연적 담체(Non-naturally occurring carrier)를 포함할 수 있다. 상기 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다.
또한, 상기 약학 조성물은 각각 통상의 방법에 따라 정제, 환제, 산제, 과립제, 캡슐제, 현탁제, 내용액제, 유제, 시럽제, 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 경피흡수제, 겔제, 로션제, 연고제, 크림제, 첩부제, 카타플라스마제, 페이스트제, 스프레이, 피부 유화액, 피부 현탁액, 경피 전달성 패치, 약물 함유 붕대 또는 좌제의 형태로 제형화하여 사용할 수 있다.
구체적으로, 제형화할 경우 통상 사용하는 충진제, 중량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제될 수 있다. 경구투여를 위한 고형제제로는 정제, 환제, 산제, 과립제, 캡슐제 등을 포함하지만, 이에 제한되지 않는다. 이러한 고형제제는 적어도 하나 이상의 부형제, 예를 들면, 전분, 칼슘 카보네이트, 수크로오스, 락토오스, 젤라틴 등을 섞어 조제될 수 있다. 또한, 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제 등도 사용될 수 있다. 경구를 위한 액상물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등을 첨가하여 조제될 수 있다. 비경구 투여를 위한 제제는 멸균된 수용액, 비수성 용제, 현탁제, 유제, 동결건조 제제 및 좌제를 포함한다. 비수성 용제 및 현탁제로는 프로필렌 글리콜, 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 오일, 에틸올레이트와 같은 주사가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔, 마크로골, 트윈 61, 카카오지, 라우린지, 글리세로젤라틴 등이 사용될 수 있다.
본 발명의 약학 조성물은 약학적으로 유효한 양으로 투여될 수 있다. 상기 용어, "약학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효 용량 수준은 개체 종류 및 중증도, 연령, 성별, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료 기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 예를 들면, 상기 약학 조성물은 1일 0.0001 내지 1,000 mg/kg으로, 구체적으로 0.01 내지 100 mg/kg의 용량으로 투여할 수 있으며, 상기 투여는 하루에 한 번 또는 수회 나누어 투여할 수도 있다.
상기 약학 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있다. 그리고 단일 또는 다중 투여될 수 있다. 상기 요소를 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 당업자에 의해 용이하게 결정될 수 있다.
상기 "투여"는 어떠한 적절한 방법으로 개체에게 본 발명의 조성물을 도입하는 것을 의미하며, 상기 조성물의 투여 경로는 목적 조직에 도달할 수 있는 한 어떠한 일반적인 경로를 통하여 투여될 수 있다. 복강 내 투여, 정맥 내 투여, 근육 내 투여, 피하 투여, 피내 투여, 경구 투여, 국소 투여, 비 내 투여될 수 있으나, 이에 제한되지는 않는다.
상기 "개체"는 암이 발병하였거나 발병할 수 있는 인간, 원숭이, 소, 말, 양, 돼지, 닭, 칠면조, 메추라기, 고양이, 개, 마우스, 쥐, 토끼 또는 기니아 피그를 포함한 모든 동물을 의미한다. 본 발명의 약학 조성물을 개체에게 투여함으로써 상기 질환을 효과적으로 예방 또는 치료할 수 있다면 개체의 종류는 제한없이 포함될 수 있다.
본 발명의 또 다른 하나의 양태는, 상기 세포치료제 조성물 또는 약학 조성물을 인간을 제외한 개체에 투여하는 단계를 포함하는, 암의 치료방법을 제공한다.
여기에서 사용되는 용어는 전술한 바와 같다.
본 발명의 또 다른 하나의 양태는, 본 발명의 방법으로 제조된 세포를 유효성분으로 포함하는, 감염성 질환 및/또는 염증성 질환의 예방 또는 치료용 세포치료제 조성물을 제공한다.
여기에서 사용되는 용어는 전술한 바와 같다.
본 발명에 있어서, 감염성 질환은 바이러스, 세균 및 곰팡이로 이루어지는 군으로부터 선택되는 어느 하나 이상에 의해 발생 또는 발병하는 것일 수 있으나, 이에 제한되지 않는다.
상기 감염성 질환을 유발하는 바이러스는 RNA 바이러스 및/또는 DNA 바이러스일 수 있으나, 당업계에 알려진 바이러스라면 제한되지 않는다.
일 예로, 상기 바이러스는 Aviadeno(아비아데노) 바이러스, Alphatorque(알파토크) 바이러스, Arena(아레나) 바이러스, Alphapapilloma(알파유두종) 바이러스, Adeno(아데노) 바이러스(Ad5), Astro(아스트로) 바이러스, Aichi(아이치) 바이러스, Amapari(아마파리) 바이러스, Aravan(아라반) 바이러스, Aura(오라) 바이러스, Australian bat lyssa(호주 박쥐 리사) 바이러스, Banna(반나) 바이러스, Barmah forest(바마 포레스트) 바이러스, Batken(바트켄) 바이러스, Bunyamwera(부니암웨라) 바이러스, Bunga(분가) 바이러스, Bunya(분야) 바이러스 La crosse, BK(비케이) 바이러스, BK polyoma(비케이 폴리오마) 바이러스, Cercopithecine herpes(원숭이 헤르페스) 바이러스, Cardio(카디오) 바이러스, Crimean-congo hemorrhagic fever(크리미안 콩고 출혈열) 바이러스, Chapare(샤페어) 바이러스, Chandipura(찬디푸라) 바이러스, Chandipura vesiculo(찬디푸라 수포성) 바이러스, Chikungunya(치쿤구니야) 바이러스, Cosa(코사) 바이러스, Cowpox(우두) 바이러스, Coxsackie(콕삭키) 바이러스, Corona(코로나) 바이러스, Corona(코로나) 바이러스 알파(베타, 감마, 델타), Colti(콜티) 바이러스, Cytomegalo(거대세포) 바이러스, Denso(덴소) 바이러스, Dependo(데펜도) 바이러스, Dependoparvo(디펜도파르보) 바이러스, Dengue(댕기) 바이러스, Deltaretro(델타레트로) 바이러스, Dhori(도리) 바이러스, Dugbe(두그베) 바이러스, Duvenhage(두벤하게) 바이러스, Eastern equine encephalitis(동부 마 뇌염) 바이러스, Ebola(에볼라) 바이러스, Echo(에코) 바이러스, Ectromelia(엑트로멜리아) 바이러스, El Bo(엘보) 바이러스, Erbo(에르보) 바이러스, Entero(엔테로) 바이러스, Encephalomyocarditis(뇌심금염) 바이러스, Epstein-Barr(엡스타인바) 바이러스(EBV), European bat lyssa(유럽 박쥐 리사) 바이러스, Erythro(적아구증) 바이러스, Flavi(플라비) 바이러스, Flexal(플렉살) 바이러스, Fowl plague(조류독감) 바이러스, GB 바이러스 C/Hepatitis(감염) G 바이러스, Guanarito(구아나리토) 바이러스, Hantaan(한탄)/ Hantann river 바이러스, Hanta(한타) 바이러스, Hendra(헨드라) 바이러스, Hepato/Hepatitis(간염) 바이러스, Hepatitis(헤파티티스) 바이러스(A, B, C, D, E), Horsepox(마두) 바이러스, Human herpes(헤르페스) 바이러스(HHV-6, HHV-7), Henipa(헤니파) 바이러스, Herpes simplex(단순포진 헤르페스) 바이러스(1, 2), Hepaci(헤파시) 바이러스, Hepe(헤페) 바이러스, Henipa(헤니파) 바이러스, Human immunodeficiency(인간 면역결핍) 바이러스(HIV-1), Human cytomegalo(사이토메갈로) 바이러스, Ippy(입피) 바이러스, Influenza(인플루엔자) 바이러스(A, B, C), Isfahan(이스파한) 바이러스, John cunningham(JC) 바이러스, JC polyoma 바이러스, Japanese encephalitis(일본 뇌염) 바이러스, Junin(주닌) 바이러스 Junin arena(주닌 아레나) 바이러스, Kaposi's sarcoma-associated herpes(카포시 육종-관련 헤르페스) 바이러스(KSHV), KI polyoma 바이러스, Kobu(고부) 바이러스, Kunjin(쿤진) 바이러스, Lenti(렌티) 바이러스, Latino(라티노) 바이러스, Lassa(라싸) 바이러스, Lagos Bat(라고스 박쥐) 바이러스, Lake victoria Marburg(마르부르크) 바이러스, Lyssa(리사) 바이러스, Langat(란가트) 바이러스, Lordsdale(로즈데일) 바이러스, Louping ill(루핑병) 바이러스, Lugo(루고) 바이러스, Lymphocytic choriomeningitis(림프구성 맥락수막염) 바이러스, Lymphocrypto(수두-대상포진) 바이러스, Machupo(마추포) 바이러스, Mastadeno(마스타데노) 바이러스, Mamastro(마마스트로) 바이러스, Machupo(마추포) 바이러스, Mayaro(마야로) 바이러스, MERS corona(메르스 코로나) 바이러스, Measles(홍역) 바이러스, Marburg(마르크부르크) 바이러스, Mumps(볼거리) 바이러스, Mengo(멩고) 바이러스, Merkel cell polyoma(메르켈세포 폴리오마) 바이러스, Mokola(모콜라) 바이러스, Molluscum contagiosum(전염성 연속종) 바이러스, Mopeia(모페이아) 바이러스, Monkeypox(원두) 바이러스, Mobala(모발라) 바이러스, Morbili(모빌리) 바이러스, Mupapilloma(무파필로마) 바이러스, Molluscipox(몰루시폭스) 바이러스, Murray valley encephalitis(머레이 밸리 뇌염) 바이러스, New York(뉴욕) 바이러스, Nairo(나이로) 바이러스, Nipah(니파) 바이러스, Noro(노로) 바이러스, Norwalk(노워크) 바이러스, Oliveros(올리베로스) 바이러스, O'nyong-nyong(오니옹니옹) 바이러스, Orbi(오르비) 바이러스, Orthopox(오르쏘폭스) 바이러스, Orthobunya(오르쏘분야) 바이러스, Orthohepadna(오르쏘헤파드나) 바이러스, Orf(오알에프) 바이러스, Oropouche(오로퓨스) 바이러스, Orthomyxo(오르토믹소) 바이러스, Orthopox(오르토폭스) 바이러스, Orthopneumo(오르토뉴모) 바이러스, Papilloma(유두종) 바이러스, Papova(파포바) 바이러스, Parainfluenza(파라인플루엔자) 바이러스, Parecho(파레코) 바이러스, Pegi(페기) 바이러스, Parana(파라나) 바이러스, Pichinde(피친데) 바이러스, Pirital(피리탈) 바이러스, Parvo(파보) 바이러스, Polio(폴리오) 바이러스, Polyoma(폴리오마) 바이러스, Pox(폭스) 바이러스, Punta toro phlebo(펀다토로플레보) 바이러스, Puumala(푸말라) 바이러스, Phlebo(플레보) 바이러스, Roseolo(장미진) 바이러스, Rabies(광견병) 바이러스, Rhino(리노) 바이러스, Respiratory syncytial(호흡기세포융합) 바이러스, Rift valley fever(리프트 밸리열) 바이러스, Rhadino(라디노) 바이러스, Rosa(로사) 바이러스, Rubi(루비) 바이러스, Ross river(로스 리버) 바이러스, Rota(로타) 바이러스, Rubella(루벨라) 바이러스, Rubula(루불라) 바이러스, Respiro(레스피로) 바이러스, Sabia(사비아) 바이러스, Sapo(사포) 바이러스, Sagiyama(사기야마) 바이러스, Sali(살리) 바이러스, Sandfly fever Sicilian(모래파리열 시칠리아) 바이러스, Snowshoe hare(눈덧신토끼) 바이러스, Sicilian phlebo(시칠리아 플레보) 바이러스, Spumaretro(수프마레트로) 바이러스, Sapporo(삿포로) 바이러스, SARS(Severe acute respiratory syndrome) (사스) 바이러스, SARS corona(사스 코로나) 바이러스, SARS-CoV-2 바이러스, Semliki forest(셈리키삼림열) 바이러스, Seoul(서울) 바이러스, Simian foamy(유인원 거품) 바이러스, Seadorna('South eastern Asia dodeca RNA) 바이러스, Simian(유인원) 바이러스, Sindbis(신드비스) 바이러스, Spuma(스푸마) 바이러스, Southampton(사우스햄튼) 바이러스, St. Louis encephalitis(세인트 루이스 뇌염) 바이러스, Tacaribe(타카리베) 바이러스, Tamiami(타미아미) 바이러스, Tick-borne Powassan(진드기 포와센) 바이러스, Tick-borne encephalitis(진드기 뇌염) 바이러스, T-lymphotropic(T 세포 림프친화) 바이러스, Toro(토로) 바이러스, Torque teno(토크테노) 바이러스, Thogoto(토고토) 바이러스, Toscana(토스카나) 바이러스, Uukuniemi(우우케니에미) 바이러스, Vaccinia(백시니아) 바이러스, Varicella-zoster(수두대상포진) 바이러스, Variola(두창) 바이러스, Venezuelan equine encephalitis(베네주엘라 이콰인 뇌염) 바이러스, Vesicular stomatitis(수포성구내염) 바이러스, Western equine encephalitis(서부마뇌염) 바이러스, West nile(웨스트나일) 바이러스, Whitewater Arroyo(화이트워터 아로요) 바이러스, WU polyoma(폴리오마) 바이러스, Yaba monkey tumor(야바 원숭이 종양) 바이러스, Yaba-like disease(야바 유사 질환) 바이러스, Yellow fever(황열) 바이러스, Vesiculo(수포성) 바이러스, Varicello(수두) 바이러스 및 Zika(지카) 바이러스 등일 수 있으나, 이에 제한되지 않는다.
구체적으로, 상기 바이러스는 Epstein-Barr(엡스타인바) 바이러스(EBV), Hepatitis 바이러스, Human immunodeficiency(인간 면역결핍) 바이러스(HIV), Influenza(인플루엔자) 바이러스, Papilloma(유두종) 바이러스, SARS(Severe acute respiratory syndrome) (사스) 바이러스, SARS corona(사스 코로나) 바이러스, SARS-CoV-2 바이러스 등일 수 있으나, 이에 제한되지 않는다.
상기 감염성 질환을 유발하는 세균은 그람음성 세균 및/또는 그람양성 세균일 수 있으나, 당업계에 알려진 세균이라면 제한되지 않는다.
일 예로, 상기 세균은 Achromobacter(아크로모박터) species(SPP), Acinetobacter(아시네토박터) spp, Actinomyces(방선균속) spp, Aeromonas(에어로모나스속) spp, Alternaria(알터나리아속) spp, Anthrax(탄저균) spp, Aspergillus(누룩곰팡이속) spp, Bacillus(간균) spp, Bacteroides(박테로이데스속) spp, Bartonella(바르토넬라) spp, Brucella(브루셀라속) spp, Borrelia(보렐리아속), spp, Bordetella(보르데텔라속) spp, Burkholderia(버크홀데리아속) spp, Campylobacter(캄필로박터속) spp, Capnocytophaga(카프노이시트파가속) spp, Chlamydophila(클라미도필라) spp, Chlamydia(클라미디아) spp, Citrobacter(시트로박터) spp, Clostridium(클로스트리듐속) spp, Corynebacterium(코리네박테리움) spp, Coxiella(콕시엘라속) spp, Diphtheria(디프테리아) spp, Ehrlichia(에를리히아속) spp, Escherichia(에스케리키아속) spp, Enterobacter(엔테로박터) spp, Enterococcus(장내구균) spp, Erysipelothrix(에리시펠로트릭스속) spp, Eikenella(아이케넬라) spp, Erwinia(에르비니아속) spp, Francisella(프란시셀라속) spp, Fusobacterium(푸소박테륨속) spp, Gardnerella(가드네렐라) spp, Haemophilus(헤모필루스속) spp, Helicobacter(헬리코박테르속) spp, Klebsiella(클렙시엘라) spp, Lactobacillus(젖산간균) spp, Legionella(레지오넬라) spp, Listeria(리스테리아) spp, Leptospira(렙토스피라속) spp, Micrococcus(미크로코쿠스속) spp, Moraxella(모락셀라속) spp, Morganella(모르가넬라) spp, Moniliformis(모닐리포르미스) spp, Meningococcus(수막염균) spp, Mycobacterium(미코박테륨) spp, Mycoplasma(미코플라스마) spp, Neisseria(나이세리아속) spp, Nocardia(노카르디아속) spp, Pertussis(백일해균) spp, Pneumococcus(폐렴구균) spp, Pseudomonas(슈도모나스) spp, Pasteurella(파스퇴렐라속) spp, Peptostreptococcus(펩토스트렙토코커스속) spp, Photorhabdus(포토랍두스) spp, Porphyromonas(포필로모나스) spp, Propionibacterium(프로피오니박테리움속) spp, Proteus(프로튜스) spp, Providencia(프로비덴시아속) spp, Pseudomonas(슈도모나스) spp, Salmonella(살모넬라) spp, Serratia(세라티아속) spp, Spiroplasma(스피로플라스마속) spp, Shigella(이질균) spp, Staphylococcus(포도상구균) spp, Stenotrophomonas(스테노트로포모나스속) spp, Streptococcus(스트렙토코커스) spp, Treponema(트레포네마속) spp, Vibrio(비브리오) spp, Wolbachia(월바키아속) spp, Xenorhabdus(제노랍두스) spp 및 Yersinia(예르시니아속) spp 등일 수 있으나, 이에 제한되지 않는다.
그 예로, 상기 세균은 Achromobacter xylosoxidans, Acinetobacter baumannii, Acinetobacter haemolyticus, Acinetobacter junil, Acinetobacter johnsonil, Actinomyces israeli, Aeromonas hydrophilia, Aeromonas veronol, Aspergillus fumigatus, Bacillus anthracis, Bacillus cereus, Bacillus thuringiensis, Bacteroides fragilis, Bacteroides melaninogenicus, Bartonella chomelii, Brucella abortus, Brucella canis, Brucella melitensis, Brucella microti, Brucella suis, Borrelia afzelii, Borrelia burgdorferi, Borrelia garinii, Borrelia recurrentis, Bordetella(보르데텔라속) pertussis, Burkholderia cepacia, Burkholderia mimosarum, Burkholderia thailandensis, Campylobacter jejuni, Chlamydophila pneumoniae, Chlamydophila psittaci, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acidisoli, Clostridium aciditolerans, Clostridium bartlettii, Clostridium botulinum, Clostridium cellobioparum, Clostridium cellulovorans, Clostridium citroniae, Clostridium clariflavum, Clostridium cocleatum, Clostridium difficile, Clostridium hiranonis, Clostridium irregular, Clostridium perfringens, Clostridium return, Clostridium sulfidigenes, Clostridium tetani, Clostridium thermobutyricum, Corynebacterium appendics, Corynebacterium callunae, Corynebacterium diphtheria, Coxiella burnetii, Ehrlichia canis, Ehrlichia chaffeensis, Escherichia coli, Escherichia albertii, Enterobacter cloacae, Enterococcus aecalis, Enterococcus faecalis, Enterococcus faecium, Erysipelothrix inopinata, Erysipelothrix rhusiopathiae, Erysipelothrix rhusiopathiae, Eikenella corrodens, Erwinia carotovora, Francisella tularensis, Fusobacterium necrophorum, Gardnerella vaginalis, Haemophilus influenza, Helicobacter brantae, Helicobacter pylori, Klebsiella pneumoniae, Lactobacillus plantarum, Legionella brunensis, Legionella drancourtii, Legionella drozanskil, Legionella impletisoli, Legionella pneumophila, Listeria monocytogenes, Leptospira alexanderi, Leptospira meyeri, Leptospira wolbachil, Micrococcus luteus, Moraxella catarrhalis, Moniliformis streptococcus, Mycobacterium abscessus, Mycobacterium aurum, Mycobacterium brumae, Mycobacterium farcinogenes, Mycobacterium fortuitum, Mycobacterium leprae, Mycobacterium marinum, Mycobacterium moriokaense, Mycobacterium pallens, Mycobacterium pneumoniae, Mycobacterium smegmatis, Mycobacterium tuberculosis, Mycobacterium tusciae, Mycoplasma pneumonia, Neisseria gonorrhoeae, Neisseria meningitides, Nocardia asteroids, Nocardia nova, Pseudomonas aeruginosa, Pasteurella multocida, Photorhabdus luminescens, Porphyromonas gingivalis, Propionibacterium acnes, Pseudomonas aeruginosa, Pseudomonas entomophila, Rickettsia aeschlimannii, Rickettsia asiatica, Rickettsia canadensis, Rickettsia montanensis, Rickettsia raoultii, Rickettsia rickettsia, Salmonella enterica, Salmonella enteritis, Salmonella typhi, Salmonella typhimurium, Serratia liquefaciens, Serratia marcescens, Spiroplasma poulsonii, Shigella sonnei, Shigella dysenteriae, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Staphylococcus hominis, Staphylococcus saprophyticus, Staphylococcus xylosus, Stenotrophomonas maltophilia, Streptococcus agalactiae, Streptococcus anginosus group, Streptococcus pneumoniae, Streptococcus pseudopneumoniae, Streptococcus pyogenes(groups A, B, C, G, F), Streptococcus viridans, Treponema azotonutricium, Treponema berlinense, Treponema denticola, Treponema medium, Treponema pallidum, Treponema primitia, Vibrio cholera, Xenorhabdus nematophila, Yersinia pseudotuberculosis 및 Yersinia pestis 등일 수 있으나, 이에 제한되지 않는다.
구체적으로, 상기 세균은 Escherichia(에스케리키아), Streptococcus(스트렙토코커스) 속 등에 속하는 세균일 수 있고, 보다 구체적으로, E. coli, S. pseudopneumoniae 등일 수 있으나, 이에 제한되지 않는다. 상기 E. coli는 Enterotoxigenic E. Coli, Enteropathogenic E. coli, Enteroinvasive E.coli, Enterohemorrhagic E. Coli 등을 포함할 수 있으나, 이에 제한되지 않는다.
상기 감염성 질환을 유발하는 곰팡이는 일 예로, Absidia(활털곰팡이속) spp, Alternaria(알터나리아속) spp, Aspergillus(누룩곰팡이속) spp, Ascosphaera(아스코스패라) spp, Ajellomyces(아젤로미세스) spp, Alternaria(알터나리아속) spp, Basidiobolus(바시디오볼루스) spp, Basidiomycete(담자균) spp, Bipolaris(바이폴라리스속) spp, Blastomyces(블라스토미세스) spp, Batrachochytrium(항아리곰팡이) spp, Beauveria(백강균속) spp, Bjerkandera(브제르칸데라) spp, Botrytis(보트리티스) spp, Blumeria(밀흰가루병균) spp, Candida(칸디다) spp, Coprinus(먹물버섯속) spp, Chromoblastomycosis(크로모블라스토마이코시스) spp, Cladosporium(클라도스포륨속) spp, Cladophialphora(클라도피알로포라) spp, Chaeotomium(케토미움속) spp, Conidiobolus(코니디오볼루스속) spp. Coccidioides(콕시디오이데스속) spp, Colletotrichum(콜레토트리쿰속) spp, Cordyceps(동충하초속) spp, Cryptococcus(크립토코커스) spp, Cunninghamella(쿤닝하멜라속) spp, Curvularia(쿠르불라리아속) spp, Dactylaria(닥티라리아) spp, Dacrymyces(다크리미세스) spp, Epidermophyton(에피더모피톤) spp, Exophiala(엑소피알라속) spp, Fusarium(푸사리움속) spp, Geotrichum(게오트리쿰속) spp, Geomyces(지오미세스) spp, Histoplasma(히스토플라스마속) spp, Lacazia(라카지아) spp, Lasiodiplodia(라시오디플로디아) spp, Leptosphaeria(렙토스패리아) spp, Lomentospora(로멘토스포라) spp, Malassezia(말라세시아속) spp, Madurella(마두렐라) spp, Malassezia(말라세시아 속) spp, Magnaporthe(마그나포르테) spp, Metarhizium(메타르히지움) spp, Microsporum(소포자균) spp, Mycosphaerella(미코스페레라속) spp, Memnoniella(멤노니엘라) spp, Melampsora(멜람프소라) spp, Mucor(털곰팡이속) spp, Mucorales(털곰팡이목) spp, Mucormycetes(접합균류, Zygomycetes) spp, Myrothecium(미로쎄시움) spp, Nectria(알보리수버섯속) spp, Paracoccidioides(파라콕시디오이데스) spp, Penicillium(푸른곰팡이) spp, Pneumocystis(폐포자충속) spp, Pneumocystis(폐포자충속) spp, Puccinia(푸치니아속) spp, Pseudoallescheria(슈달레쉐리아) spp, Pythium(피시움속) spp, Ramichloridium(라미클로리디움) spp, Rhizopus(거미줄곰팡이속) spp, Rhizoctonia(라이족토니아속) spp, Saccharomyces(사카로미세스속) spp, Scedosporium(스케도스포륨) spp, Scedosporium(세도스포리움) spp, Schizophyllum(치마버섯) spp, Sclerotinia(균핵버섯속) spp, Scopulariopsis(빗자루곰팡이속) spp, Scytalidium(스키탈리디움) spp, Stachybotrys(스타키보트리스) spp, Sporotrix(스포로트릭스속) spp, Septoria(셉토리아속) spp, Syncephalastrum(신세팔라스트룸) spp, Talaromyces(탈라로미케스) spp, Tremella(흰목이속) spp, Trichophyton(백선균속) spp, Trichosporon(트리코스포론속) spp, Trichoderma(트리코데르마속) spp, Ulocladium(울로크라디움) spp, Ustilago(깜부기병균속) spp 및 Zymoseptoria(지모셉토리아) spp 등일 수 있으나, 이에 제한되지 않는다.
그 예로, 상기 곰팡이는 Absidia corymbifera, Alternaria alternate, Aspergillus alternate, Aspergillus versicolor, Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger, Ajellomyces dermatitidis, Basidiobolus ranarum, Bipolaris spicifera, Blastomyces dermatitidis, Blastomyces gilchristii, Batrachochytrium dendrobatidis, Beauveria bassiana, Botrytis cinerea, Blumeria graminis, Candida albicans, Candida auris, Candida glabrata, Candida krusei, Candida lusitaniae, Candida parapsilosis, Candida krusei, Candida silvativa, Candida tropicalis, Coprinus cinereus, Cladosporium herbarum, Cladosporium immitis, Cladophialphora bantianum, Conidiobolus coronatus, Conidiobolus incongruus, Coccidioides immitis, Coccidioides posadasii, Cryptococcus gattii, Cryptococcus neoformans, Cunninghamella bertholletiae, Curvularia lunata, Exophiala jeanselmei, Exophiala dermatitidis, Fusarium graminearum, Fusarium moniliforme, Fusarium oxysporum, Fusarium solani, Dactylaria gallopava, Geotrichum candidum, Geomyces destructans, Histoplasma capsulatum, Lacazia loboi, Lomentospora prolificans, Malassezia furfur, Magnaporthe oryzae, Metarhizium anisopliae, Mycosphaerella graminicola, Melampsora lini, Mucor circillenoides, Mucor mucedo, Mucor pusillus, Paracoccidioides brasiliensi, Paracoccidioides lutzii, Penicillium brevicompactum, Penicillium chrysogenum, Penicillium citrinum, Penicillium corylophilum, Penicillium cyclopium, Penicillium expansum. Penicillium fellutanum, Penicillium marneffei, Penicillium spinulosum, Penicillium viridicatum, Pneumocystis carinii, Pneumocystis jirovecii, Pneumocystis murina, Pseudoallescheria boydii, Pythium debaryanum, Rhizopus oryzae, Rhizoctonia solani, Saccharomyces cerevisiae, Scedosporium anamorphs, Scedosporium apiospermum, Scedosporium prolificans, Schizophyllum commune, Sclerotinia Americana, Stachybotrys chartarum, Sporothrix schenckii, Septoria tritici, Talaromyces marneffei, Trichophyton rubrum, Trichophyton interdigitale, Trichophyton purpureum, Trichophyton violaceum, Trichosporon asahii, Trichoderma lignorum, Trichoderma viride, Ustilago maydis 및 Zymoseptoria tritici 등일 수 있으나, 이에 제한되지 않는다.
구체적으로, 상기 곰팡이는 Aspergillus(누룩곰팡이), Candida(칸디다), Absidia(활털곰팡이), Mucor(털곰팡이), Rhizopus(거미줄곰팡이) 속 등에 속하는 곰팡이일 수 있고, 보다 구체적으로, 칸디다 알비칸스(Candida albicans), 아스페르길루스 푸미가투스(Aspergillus fumigatus), 압시디아 코림비페라(Absidia corymbifera), 뮤코 서시넬로이드(Mucor circillenoides), 뮤코 뮤세도(Mucor mucedo), 뮤코 푸실러스(Mucor pusillus), 리조푸스 오리제(Rhizopus oryzae) 등일 수 있으나, 이에 제한되지 않는다.
본 발명의 조성물은 본 발명의 방법에 따라 제조된 drNK 세포 및/또는 CAR-drNK 세포를 포함함으로써 감염성 질환 및/또는 상기 감염성 질환으로부터 야기되는 염증성 질환에 대한 예방 또는 치료 효능이 있는 것일 수 있다.
본 발명의 방법에 따라 제조된 drNK 세포 및/또는 CAR-drNK 세포는 다양한 바이러스에 대해 항바이러스 효과를 나타낼 수 있다.
본 발명의 일 구현예에서는, BCL11B-drNK의 항바이러스 효과를 확인하기 위해 바이러스에 감염되지 않은 B-lymphoma Ramos 및 EBV에 감염된 B-lymphoma Raji 세포에 대한 세포 살상능 및 CD107a+ 세포를 측정한 결과, 대조군 세포 NK-92 및 PBMC-NK 보다 BCL11B-drNK에서 Ramos보다 EBV 감염된 Raji 세포에 대한 높은 살상 독성을 가진 것을 확인하였다(도 17A 및 도 17B).
또한, EBV를 포함하는 Raji 세포를 렌티바이러스를 사용하여 GFP를 발현하도록 형질전환하여 GFP-Raji 세포를 확보한 후, GFP-Raji와 NK 세포의 공배양 후에 남아 있는 EBV 특이 유전자인 LMP-1(Latent membrane protein 1)의 발현량을 측정한 결과, 공배양하지 않은 대조군(Control)에 비해, NK 세포와 GFP-Raji 세포를 공배양할 경우 GFP 대비 LMP-1의 발현 정도가 감소함을 확인하였으며, LMP-1 발현 감소 정도가 대조군 NK-92 및 PBMC에 비해 shBCL11B-drNK 세포에서 높은 것을 확인하였다(도 17C).
본 발명의 다른 일 구현예에서는, drNK 세포가 인간면역결핍 바이러스(Human immunodeficiency virus, HIV), Influenza 바이러스, Papilloma 바이러스, Hepatitis 바이러스에 감염된 각각의 CEM T 세포, HEK-293T 세포, HK2 근위세뇨관 세포, SNU449 간 세포에 대해 대조군 세포 NK-92에 비교하여 낮은 E:T 비율에서도 높은 살상능(도 17D)과 높은 CD107a+ 발현 세포 빈도를 나타냄을 확인하였다(도 17E).
본 발명의 또 다른 일 구현예에서는, shBCL11B-drNK 세포와의 공배양은 양성 대조군(PMBC-NK 세포) 대비 SARS-CoV-2 바이러스에 감염된 세포의 사멸을 증가시킴을 확인하였다(도 18).
이를 통해, shBCL11B-drNK 세포가 PBMC-NK 세포 및 NK-92 세포에 비해 RNA 바이러스 및 DNA 바이러스에 대해 현저한 항균 효능을 나타냄을 확인하였다.
본 발명의 방법에 따라 제조된 drNK 세포 및/또는 CAR-drNK 세포는 다양한 세균에 대해 항균 효과를 나타낼 수 있다.
본 발명의 일 구현예에서는, drNK 세포의 그람음성 세균인 대장균에 대한 살상 효과를 공배양 후 E. coli 군집수(도 19A)와 CD107a+ 발현 세포 빈도(도 19B)를 통해 확인한 결과, drNK가 NK-92, PBMC-NK 세포에 비해 높은 항균 효능을 가진 것을 확인하였다.
본 발명의 다른 일 구현예에서는, drNK 세포의 그람양성 세균인 연쇄상구균에 대한 항균 효과를 공배양 후 CD107a+ 발현 세포 빈도를 통해 확인한 결과, drNK가 NK-92 세포에 비해 높은 항균 효능을 가진 것을 확인하였다(도 19C).
이를 통해, shBCL11B-drNK 세포가 PBMC-NK 세포 및 NK-92 세포에 비해 그람음성 세균 및 그람양성 세균에 대해 현저한 항균 효능을 나타냄을 확인하였다.
본 발명의 방법에 따라 제조된 drNK 세포 및/또는 CAR-drNK 세포는 다양한 곰팡이에 대해 항곰팡이 효과를 나타낼 수 있다.
본 발명의 일 구현예에서는, drNK 세포의 칸디다 곰팡이의 일종인 칸디다 알비칸스(Candida Albicans)에 대한 항곰팡이 효과를 공배양 후 CD107a+ 발현 세포 빈도(도 20)를 통해 확인한 결과, drNK가 NK-92 및 PBMC-NK 세포에 비해 높은 항곰팡이 효능을 가진 것을 확인하였다.
본 발명의 다른 일 구현예에서는, shBCL11B-drNK 세포 및 양성 대조군(PBMC-NK 세포 및 NK-92 세포) 모두 아스페르길루스 푸미가투스(Aspergillus fumigatus)에 대해 항곰팡이 활성을 나타내며, 특히 shBCL11B-drNK 세포의 항곰팡이 활성이 가장 우수함을 확인하였다(도 21).
상기 세포치료제 조성물, 상기 조성물 내 drNK 세포 및/또는 CAR-drNK 세포의 함량 및 세포치료제 조성물의 투여량 등은 전술한 바와 같다.
본 발명의 또 다른 하나의 양태는, 본 발명의 방법으로 제조된 세포를 유효성분으로 포함하는, 감염성 질환 및/또는 염증성 질환의 예방 또는 치료용 약학 조성물을 제공한다.
여기에서 사용되는 용어는 전술한 바와 같다.
상기 약학 조성물, 상기 조성물 내 drNK 세포 및/또는 CAR-drNK 세포의 함량 및 세포치료제 조성물의 투여량 등은 전술한 바와 같다.
본 발명의 또 다른 하나의 양태는, 상기 세포치료제 조성물 또는 약학 조성물을 인간을 제외한 개체에 투여하는 단계를 포함하는, 감염성 질환 및/또는 염증성 질환의 치료방법을 제공한다.
여기에서 사용되는 용어는 전술한 바와 같다.
본 발명의 또 다른 하나의 양태는, a) i) BCL11B shRNA, ii) BCL11B siRNA, 또는 iii) CRISPR/Cas9-gRNA-BCL11B를 함유하는 제 1용기; b) 본 발명의 제1배지를 함유하는 제 2용기; 및 c) 본 발명의 제2배지를 함유하는 제 3용기;를 포함하는, drNK 세포 또는 CAR-drNK 세포 제조용 직접 세포전환 유도 배지 키트를 제공한다.
여기에서 사용되는 용어는 전술한 바와 같다.
본 발명의 키트는 상기 i) BCL11B shRNA, ii) BCL11B siRNA, 또는 iii) CRISPR/Cas9-gRNA-BCL11B를 함유하는 제1용기, 본 발명의 제1배지를 함유하는 제2용기 및 본 발명의 제2배지를 함유하는 제2배지를 함유하는 제3용기를 포함하여 drNK 세포 또는 CAR-drNK 세포 제조용 직접 리프로그래밍 배지로 사용될 수 있는 도구를 의미한다. 상기 키트는 그 종류가 특별히 제한되지 아니하며, 당해 기술 분야에서 통상적으로 사용되는 형태의 키트를 사용할 수 있다.
본 발명의 상기 키트는 상기 i) BCL11B shRNA, ii) BCL11B siRNA, 또는 iii) CRISPR/Cas9-gRNA-BCL11B; 제1배지; 및 제2배지;가 각각 개별 용기에 담긴 형태, 또는 하나 이상의 구획으로 나누어진 한 개의 용기 내에 담긴 형태로 포장되어 있을 수 있으며, 상기 i) BCL11B shRNA, 또는 ii) CRISPR/Cas9-gRNA-BCL11B; 제1배지; 및 제2배지;는 각각 1회 투여 용량의 단위 용량 형태로 포장되어 있을 수 있다.
상기 키트 내의 상기 i) BCL11B shRNA, ii) BCL11B siRNA, 또는 iii) CRISPR/Cas9-gRNA-BCL11B; 제1배지; 및 제2배지;는 당업자의 실험 계획에 따라 적절한 시기에 순차적으로 투여될 수 있다.
본 발명의 상기 키트는 상기 i) BCL11B shRNA, ii) BCL11B siRNA, 또는 iii) CRISPR/Cas9-gRNA-BCL11B; 제1배지; 및 제2배지;의 각각의 첨가량, 첨가 방법과 첨가 빈도 등을 기재한 사용설명서를 더 포함할 수 있다.
이하, 실시예를 통하여 본 발명의 구성 및 효과를 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것일 뿐, 본 발명의 범위가 이들 실시예에 의해 한정되는 것은 아니다.
실시예 1: shBCL11B-drNK 제조 및 NK(Natural killer) 세포 특이적 마커의 발현 검증
1-1. shBCL11B-drNK 제조
세포에서의 BCL11B(B-cell lymphoma/leukemia 11B) 유전자 발현 억제를 통한 직접 세포전환을 유도하기 위해, 체세포에 세포전환을 유도하는 리프로그래밍 인자로써 BCL11B에 대한 shRNA(Short hairpin RNA) (shBCL11B) 또는 siRNA를 도입하였다.
구체적으로, 체세포로써 말초혈액 단핵 세포(Peripheral blood mononuclear cell: PBMC)에 리프로그래밍 인자로서 7종의 shBCL11B(shBCL11B#1, shBCL11B#2, shBCL11B#3, shBCL11B#4 shBCL11B#5, shBCL11B#6 및 shBCL11B#7)을 각각 발현하는 렌티바이러스 또는 4종의 siRNA(siBCL11B-A, siBCL11B-B, siBCL11B-C 및 siBCL11B-D)를 처리하여, shBCL11B 또는 siRNA(도 4A)를 도입함으로써 shBCL11B-drNK 세포를 제조하였다.
shBCL11B를 발현하는 렌티바이러스 7종을 PBMC 세포에 도입하기 위해, 48 웰 플레이트에 2X105 개의 PBMC 세포를 넣고, 상기 렌티바이러스 3 MOI 및 4 μg/ml 폴리브렌 또는 6 μM Bx795을 처리한 다음, 16 시간 동안 RPMI 배지에서 배양 후 신선한 배지로 교체하여, PBMC 세포를 형질전환시켰다.
siRNA 4종을 PBMC 세포에 도입하기 위해, 48 웰 플레이트에 2X105 개의 PBMC 세포를 넣고, 제조업체의 지침에 따라 Lipofectamine RNAiMAX(Thermo Fisher Scientific Inc.)를 사용하여 100 nM siRNA를 처리하여, PBMC 세포를 형질전환시켰다.
다음 날, 상기 형질전환된 세포 2X105 개를 48 웰 플레이트에 시딩하고, GSK3β(Glycogen synthase kinase 3β) 저해제(Inhibitor)를 포함하는 제1배지(3 μM CHIR99021(CT99021), 10 % FBS(Fetal bovine serum), 1 % 페니실린/스트렙토마이신, 20 ng/ml 인간 SCF, 20ng/ml 인간 FLT3L(FMS-like tyrosine kinase ligand), 20 ng/ml 인간 IL-7, 200 IU/ml 인간 IL-2 및 20 ng/ml 인간 IL-15 을 포함하는 StemSpan SFEM II)에서 6 일간 배양한 후, AHR(Aryl hydrocarbon receptor) 저해제를 포함하는 제2배지(10 % FBS, 1 % 페니실린/스트렙토마이신, 20 ng/ml 인간 SCF, 20 ng/ml 인간 FLT3L, 200 IU/ml 인간 IL-2, 20 ng/ml 인간 IL-7, 20 ng/ml 인간 IL-15, 2 uM 스템레게닌 I(StemRegenin I, SR1)을 포함하는 StemSpan SFEM II)에서 11 일 동안 배양하였다.
전술한 바에 따른, shBCL11B 도입을 통한 체세포 직접 세포전환에 의한 shBCL11B-drNK 제조방법의 모식도는 도 1A 및 도 4B에 나타낸 바와 같다.
1-2. NK 세포 제조 수율 확인
상기 실시예 1-1의 shBCL11B-drNK 세포의 생산 여부 및 수율을 확인하기 위해, CD56 항체 및 CD3 항체로 상기 세포를 염색하고 유세포 분석기(Flow cytometry)를 이용하여 NK 세포군(CD56+ 및 CD3-)의 비율을 분석하였다.
그 결과, NK 세포(CD56+CD3-)는 대조군에서 각각 2.1 %(No-treated), 0.2 %(sh-Control)의 비율로 존재한 반면, shBCL11B#1, shBCL11B#2, shBCL11B#3, shBCL11B#4 shBCL11B#5, shBCL11B#6, shBCL11B#7, siBCL11B-A, siBCL11B-B, siBCL11B-C 또는 siBCL11B-D를 도입 또는 형질전환하여 제조한 shBCL11B-drNK 세포에서는 각각 76.1 %, 90.4 %, 85.1 %, 72.6 %, 91.7 %, 77.9 %, 90.3 %, 57.1 %, 48.7 %, 38.2 % 또는 42.3 %의 비율로 존재하여, 세포에 shBCL11B 또는 siRNA 도입시 높은 효율로 NK 세포가 제조되었음을 확인하였다(도 4C).
1-3. NK 특이적 마커의 발현 특성 검증
상기 실시예 1-1의 shBCL11B-drNK 세포의 NK 특이적 마커의 발현 특성 특성을 검증하기 위해, NK isolation Kit(Miltenyl Biotec)를 사용한 MACS(Magnetic Activated Cell Sorting)법을 이용하여 NK 세포만을 회수하고, 유세포 분석기를 이용하여 NK 세포와 관련된 활성화 수용체(CD16, CD69, NKG2D, NKp30, NKp44, NKp46 및 DNAM-1) 또는 억제 수용체(KIR2DL1, KIR2DL2 및 KIR3DL1)의 발현 패턴을 분석하였다.
그 결과, shBCL11B-drNK 세포에서 CD16, CD69, NKG2D, NKp30, NKp44, NKp46 및 DNAM-1과 같은 활성화 수용체가 KIR2DL1, KIR2DL2 및 KIR3DL1와 같은 억제 수용체에 비해 높은 빈도로 발현됨을 확인하였다(도 6).
이를 통해, shBCL11B를 이용한 체세포 직접 세포전환을 통해 체세포가 NK 세포(shBCL11B-drNK)로 전환됨을 확인하였다.
실시예 2: CAR-shBCL11B-drNK 제조 및 NK 특이적 마커의 발현 특성 검증
2-1. CAR-shBCL11B-drNK 제조
세포에 shBCL11B 및 CAR(Chimeric antigen receptor) 유전자를 동시 도입하여 CAR 유전자를 발현하는 CAR-shBCL11B-drNK 세포를 제작하였다.
구체적으로, MSLN(Mesothelin)에 특이적인 MSLN-CAR를 코딩하는 이중 시스트론 렌티바이러스 벡터 유전자를 제작하였다(도 22). MSLN-CAR 유전자는 CD8 리더(Leader) (서열번호 14), MSLN(Mesothelin) scFv(서열번호 16), CD8 힌지(서열번호 18), CD8 막 관통 도메인(서열번호 19), CD28 세포내 도메인(서열번호 21), CD3ζ(서열번호 22), IRES(서열번호 23) 및 GFP(서열번호 24)를 포함하여 구성되었다(도 3A).
PBMC 세포를 Day 0에 shBCL11B#2를 발현하는 렌티바이러스로 형질전환하고, Day 0, Day 6, Day 12 및 Day 18에 MSLN-CAR 유전자를 발현하는 렌티바이러스로 형질전환하였다. 이때, Day 0부터 Day 18까지 세포 배양은 상기 실시예 1-1과 동일하게 Day 0부터 Day 7까지는 제1배지, 그 이후부터는 제2배지에서 배양하여, MSLN-CAR 유전자를 발현하는 shBCL11B-drNK(MSLN-shBCL11B-drNK)를 제조하였다(도 11A).
전술한 바에 따른, shBCL11B 및 CAR 유전자 도입을 통한 체세포 직접 세포전환에 의한 CAR-shBCL11B-drNK 제조방법의 모식도는 도 1B 및 도 11A에 나타낸 바와 같다.
2-2. NK 세포 제조 수율 확인
상기 실시예 2-1의 MSLN-shBCL11B-drNK 세포의 생산 여부 및 수율을 확인하기 위해, CD56 항체 및 MSLN-CAR 항원으로 상기 세포를 염색 후 유세포 분석기를 이용하여 NK 세포군(CD56+ 및 MSLN-CAR+)의 비율을 분석하였다.
그 결과, CD56+MSLN+(MSLN-shBCL11B-drNK) 세포는 Day 0(4.9 %), Day 6(13.1 %), Day 12(9.9 %) 및 Day 18(8.8 %)에 형질전환된 세포 중 Day 6에 형질전환된 세포군에서 가장 높은 효율로 제조됨을 확인하였다(도 11B).
2-3. NK 특이적 마커의 발현 특성 검증
상기 실시예 2-1의 MSLN-shBCL11B-drNK 세포의 NK 특이적 마커의 발현 특성 특성을 검증하기 위해, 상기 실시예 1-3과 동일한 방법으로 MSLN-shBCL11B-drNK 세포의 다양한 자연살해 세포 관련 활성화 및 억제 수용체의 발현 패턴을 유세포 분석기를 이용하여 분석하였다.
그 결과, 제조된 MSLN-shBCL11B-drNK에서는 CD16, CD69, NKG2D, NKp30, NKp44, NKp46 및 DNAM-1과 같은 활성화 수용체가 KIR2DL1, KIR2DL2 및 KIR3DL1와 같은 억제 수용체에 비해 높은 빈도로 발현되어(도 12), shBCL11B-drNK과 유사한 양상을 나타내는 것을 확인하였다.
실시예 3: CRISPR(Clustered regularly interspaced short palindromic repeats)/Cas9를 이용한 gBCL11B-drNK 제조 및 NK 특이적 마커의 발현 특성 검증
3-1. gBCL11B-drNK 제조
세포에서의 BCL11B(B-cell lymphoma/Leukemia 11B) 유전자 발현 억제를 통한 직접 세포전환을 유도하기 위해, 세포전환 유도 인자로써 유전자가위 CRISPR/Cas9 및 sgRNA(Single-guide RNA)를 도입한, 상용 렌티바이러스 벡터(Applied Biological Material, CAT#: K0013105)를 이용하였다.
본 실시예의 CRISPR/Cas9 시스템에서 sgRNA는 상기 상용 렌티바이러스 벡터 세트에 포함된 sgRNA-A, sgRNA-B 또는 sgRNA-C를 포함하였다.
구체적으로, PBMC 세포를 리프로그래밍 인자로 형질전환시키기 위해 sgRNA-A, sgRNA-B 또는 sgRNA-C를 포함하는 CRISPR/Cas9 벡터를 발현하는 렌티바이러스 3 MOI, PBMC 세포 및 폴리브렌(4 μg/ml)을 함께 16 시간 동안 배양 후 신선한 배지로 교체하여, PBMC 세포를 형질전환시켰다. 이후 Day 0부터 Day 18까지 세포 배양은 상기 실시예 1-1과 동일하게 Day 0부터 Day 7까지는 제1배지, 그 이후부터는 제2배지에서 배양하여, 직접 세포전환 유도 drNK 세포(gBCL11B-drNK)를 제조하였다(도 13A).
유전자가위 CRISPR/Cas9 도입을 통한 체세포 직접 리프로그래밍에 의한 gBCL11B-drNK 제조방법의 모식도는 도 2A 및 도 13A에 나타낸 바와 같다.
3-2. NK 세포 제조 수율 확인
상기 실시예 3-1의 gBCL11B-drNK 세포의 생산 여부 및 수율을 확인하기 위해, CD56 항체 및 CD3 항체로 상기 세포를 염색 후 유세포 분석기를 이용하여 NK 세포군(CD56+ 및 CD3-)의 비율을 분석하였다.
그 결과, CD56+CD3-(gBCL11B-drNK) 세포는 비처리군(6.0 %) 대비 Cas9 및 sgRNA 처리군에서 각각 83.9 %(sgRNA-A), 72.2 %(sgRNA-B), 72.0 %(sgRNA-C)의 효율로 제조됨을 확인하였다(도 13B).
3-3. NK 특이적 마커의 발현 특성 검증
상기 실시예 3-1의 gBCL11B-drNK 세포의 NK 특이적 마커의 발현 특성 특성을 검증하기 위해, 상기 실시예 1-3과 동일한 방법으로 gBCL11B-drNK 세포의 다양한 자연살해 세포 관련 활성화 및 억제 수용체의 발현 패턴을 유세포 분석기를 이용하여 분석하였다.
그 결과, 제조된 gBCL11B-drNK 세포에서는 CD16, CD69, NKG2D, NKp30, NKp44, NKp46 및 DNAM-1과 같은 활성화 수용체가 KIR2DL1, KIR2DL2 및 KIR3DL1와 같은 억제 수용체에 비해 높은 빈도로 발현되어(도 14), shBCL11B-drNK과 유사한 양상을 나타내는 것을 확인하였다.
이에 따라, Cas9/sgRNA 도입시 shBCL11B와 동일하게 drNK가 제조됨을 확인하였다.
실시예 4: CAR-gBCL11B-drNK 제조 및 NK 특이적 마커의 발현 특성 검증
4-1. CAR-gBCL11B-drNK 제조
세포에 Cas9, sgRNA 및 CAR 유전자를 동시 도입하여 CAR 유전자를 발현하는 CAR-gBCL11B-drNK 세포를 제작하였다.
본 실시예의 CRISPR/Cas9 시스템에서 sgRNA는 BCL11B를 포함하는 게놈서열(NC_000014.9) 유래 Exon1(BCL11B-ex1)을 타겟으로 하는 하기 표 1의 sgRNA#1(forward) 및 sgRNA#2(reverse)를 포함하였다.
서열번호 서열명 서열(5' -> 3')
12 sgRNA#1(forward) GGCAATGTCCCGCCGCAAACAGG
13 sgRNA#2(reverse) GCGGGTTGCCCTGTTTGCGGCGG
구체적으로, CAR를 코딩하는 서열이 BCL11B Knock-out(KO)과 동시에 절단부위에 삽입되어 Knock-in(KI) 될 수 있는 donor 플라스미드를 제작하기 위해, BCL11B-exon1을 중심으로 인트론 부분에 각각 오른쪽 염기 상동서열(Right homology arm, RHA) 600 bp(NC_000014.9에서 99270561-99271160 염기서열) (서열번호 25)과 왼쪽 염기 상동서열(Left homology arm, LHA) 600 bp(NC_000014.9에서 99271219-99271818 염기서열) (서열번호 26)를 선정하고, LHA와 RHA사이에 SEFV 프로모터(서열번호 27) 및 polyA 신호(서열번호 28)를 포함하는 CAR 플라스미드를 제작하였다(도 23). 이후, pJEP300-pAAV-CMV-MCS2-pA에서 150-787 bp 부위를 제거한 부위에 MSLN-CAR 플라스미드의 2707-5740 bp 부위를 삽입하여 CAR-AAV를 제작하였다(도 3B, 도 24).
PBMC 세포를 RPMI 배지에서 1 일간 배양한 후, 실험 시작 하루 전(Day -1) MSLN-CAR를 코딩하는 CAR-AAV(1 MOI)를 처리하여 형질전환하였다. 24시간 후인 Day 0에 AAV를 처리한 PBMC 1X106개에 sgRNA#1 및 sgRNA#2를 포함하는 플라스미드 벡터를 전기천공법(Electroporation)으로 추가 형질전환하였다. 형질전환된 세포를 RPMI 배지에서 1 일 배양한 후, 5X105개 세포를 상기 실시예 1-1과 동일하게 Day 6까지 제1배지, 그 이후부터는 제2배지에서 배양하여, CAR(MSLN-CAR) 유전자를 발현하는 직접 세포전환 유도 drNK 세포(MSLN-gBCL11B-drNK)를 제조하였다(도 15A 및 도 15B).
Cas9, sgRNA 및 CAR 유전자 도입을 통한 체세포 직접 리프로그래밍에 의한 CAR-gBCL11B-drNK 제조방법의 모식도는 도 2B 및 도 15A에 나타낸 바와 같다.
4-2. NK 세포 제조 수율 확인
상기 실시예 4-1의 MSLN-gBCL11B-drNK 세포의 생산 여부 및 수율을 확인하기 위해, CD56 항체, CD3 항체 및 MSLN-CAR 항원으로 상기 세포를 염색 후 유세포 분석기를 이용하여 NK 세포군(CD56+, CD3- 및 MSLN-CAR+)의 비율을 분석하였다.
그 결과, CD56+CD3- 세포군(22.8 %) 대비 CD56+MSLN+ 세포군은 17.3 %의 효율로 제조되었음을 확인하였다(도 15C).
다음으로, CAR 유전자가 drNK 세포 게놈에 삽입되었는지를 PCR 분석을 통해 확인하였다.
구체적으로, 게놈 DNA를 LHA 이전 서열에 대한 프라이머(서열번호 29) 및 SFFV 프로모터에 대한 프라이머(서열번호 30)를 이용하여 PCR을 수행하였다. 각각의 세포에서 게놈 DNA(gDNA)를 추출하기 위하여 DNeasy Blood & Tissue kit (QIAGEN, cat. no. 69504)를 사용하여 제조사의 프로토콜에 따라 전체 DNA를 추출한 후, 각 샘플당 gDNA 200ng, 2x Premix(EmeraldAmp GT PCR master mix, TAKARA, cat. no. RR310A) 및 타겟 프라이머를 혼합하여 총 20ul의 반응용액을 제조하였다. 이에 대해 95℃에서 10분간 변성 후, 95℃에서 30초, 57℃에서 40초, 72℃에서 1분으로 40회 반복하고, 72℃에서 5분간 신장하여 PCR을 수행하였다. 반응된 PCR 생산물을 1% 아가로즈 겔에서 전기영동하였다.
여기에서 사용된 프라이머 서열은 하기 표 2와 같다.
서열번호 서열명 서열(5' -> 3')
29 LHA primer ACC GAA CCG GGG CAG TTT TA
30 SFFV promoter primer TTT TCA TGT ACC CGC CCT TGA T
그 결과, CAR 유전자가 drNK 세포 게놈에 삽입(CAR Knock-in, CAR-KI)되었음을 확인하였다(도 15D).
이에 따라, Cas9, sgRNA 및 CAR 유전자를 동시 도입하여 CAR-gBCL11B-drNK 세포를 제작하는 경우, CAR-shBCL11B-drNK에 비해 drNK 세포의 제조 수율은 낮지만, BCL11B가 위치한 게놈에만 특이적으로 CAR 유전자를 삽입할 수 있으므로 렌티바이러스에 의한 유전자 변형 가능성을 최소화할 수 있음을 확인하였다.
실시예 5: 배지 구성 요소가 shBCL11B-drNK 제조 수율에 미치는 영향
5-1. 제1배지의 구성에 따른 shBCL11B-drNK 제조 수율
상기 실시예 1-1과 동일한 방법으로 PBMC에 BCL11B에 대한 shRNA#2를 도입한 후, 이를 제1배지(양성 대조군) 또는 제1배지를 구성하는 요소에서 200 IU/ml 인간 IL-2, 20 ng/ml 인간 IL-15 또는 3 uM CHIR99021가 한 가지씩 결핍된 배지, 또는 6 μM BX795가 추가된 배지에서 6 일 동안 배양한 다음, 제2배지에서 12 일 동안 배양하였다.
상기 배양을 통해 NK 세포가 제조되었는지 확인하기 위해, CD56 항체 및 CD3 항체로 상기 세포를 염색 후 유세포 분석기를 이용하여 drNK 세포군(CD56+ 및 CD3-)의 비율을 분석하였다.
그 결과, CD56+CD3-(shBCL11B-drNK) 세포는 제1배지에서 배양된 양성 대조군(100 %)을 기준으로, IL-2가 결핍된 배지에서 배양된 세포군은 43 %, IL-15가 결핍된 배지에서 배양된 세포군은 75 %, CHIR99021가 결핍된 배지에서 배양된 세포군은 92 %, BX795가 추가된 배지에서 배양된 세포군은 113 % 의 효율로 제조됨을 확인하였다(도 5A).
5-2. 제2배지의 구성에 따른 shBCL11B-drNK 제조 수율
상기 실시예 1-1과 동일한 방법으로 PBMC에 BCL11B에 대한 shRNA#2를 도입한 후, 이를 제1배지에서 6 일 동안 배양한 다음, 제2배지(양성 대조군) 또는 제2배지를 구성하는 요소에서 200 IU/ml 인간 IL-2, 20 ng/ml 인간 IL-7, 20 ng/ml 인간 IL-15, 20 ng/ml 인간 FLT3L, 20 ng/ml 인간 SCF 또는 2 uM SR1가 한 가지씩 결핍된 배지에서 12 일 동안 배양하였다.
상기 배양을 통해 NK 세포가 제조되었는지 확인하기 위해, CD56 항체 및 CD3 항체로 상기 세포를 염색 후 유세포 분석기를 이용하여 drNK 세포군(CD56+ 및 CD3-)의 비율을 분석하였다.
그 결과, CD56+CD3-(shBCL11B-drNK) 세포는 제2배지에서 배양된 양성 대조군(100 %)을 기준으로, IL-2가 결핍된 배지에서 배양된 세포군은 56 %, IL-15가 결핍된 배지에서 배양된 세포군은 69 %, IL-7가 결핍된 배지에서 배양된 세포군은 82 %, SCF가 결핍된 배지에서 배양된 세포군은 81 %, FLT3L가 결핍된 배지에서 배양된 세포군은 38 %, SR1가 결핍된 배지에서 배양된 세포군은 57 % 의 효율로 제조 됨을 확인하였다(도 5B).
실시예 6: shBCL11B-drNK 세포의 효능 검증
6-1. shBCL11B-drNK 세포의 암 세포 살상능 측정
상기 실시예 1-1의 shBCL11B-drNK (shRNA#2) 세포의 암 세포 살상능을 측정하기 위해, 칼세인-AM(Calcein-AM)을 사용한 암 세포 살상능 측정법을 수행하였다.
구체적으로, 암 세포로서 Raji(Human B-lymphoma), HCT116(human colorectal carcinoma cell line), SNU-817(B lymphoma cell line), HepG2(hepatocellular carcinoma cell line), NCIH460(Human Non-small cell lung cancer), Mia-paca-2(hypotriploid human pancreatic cancer cell line), U373MG(Human glioblastoma astrocytoma), SW620(human colon carcinoma cell line), SK-OV-3(human ovarian cancer cell line), MCF7(breast cancer cell line), PC-3(human prostate cancer cell line), SK-MEL-3(human melanoma cell lines), A-673(human rhabdomyosarcoma), Caki-1(human clear cell renal cell carcinoma), SNU-790(human thyroid papillary carcinoma cell line), MG-63(human osteosarcoma cell line), BeWo(human placental choriocarcinoma), KATO III(Human gastric carcinoma) 및 253j(human bladder cancer cell line)를 10 % FBS을 포함하는 DMEM 배지에서 각각 1X105개 세포/ml이 되도록 희석한 후, 칼세인-AM을 최종 농도가 25 μM이 되도록 첨가하고, 37℃에서 1 시간 배양 후에 DMEM 배지로 세척하여, 칼세인 표지 표적 암 세포를 제작하였다.
상기 실시예 1-1의 shBCL11B-drNK (shRNA#2) 세포의 배양액을 이용하여 각각 0.25X105개 세포/ml, 1X105개 세포/ml 및 2.5X105개 세포/ml의 밀도로 희석하여 준비한 후에 96 웰 플레이트에 100 ml씩 분주하였다. 상기의 96 웰 플레이트에 제작한 칼세인 표지 표적 암 세포(1X105개 세포/ml)를 100 ul/well씩 첨가한 후, 400 g로 1분간 원심분리하고, 37℃, 5 % CO2의 배양기에서 4시간 동안 공배양하였다. 각 웰로부터 상층액 100 ul를 취하여 형광 플레이트 리더(485 nm/535 nm)로 측정하였다. 암 세포 살상능(%)은 아래 수식에 따라서 산출하였다.　
암 세포 살상능(%)={(측정값-최소값)/(최대값-최소값)}X100
상기 식에서, 최소값은 칼세인 표지 표적 암 세포만 존재하는 웰의 측정값이고, 최대값은 칼세인 표지 표적 암 세포에 1.0 % TritonX-100을 첨가하여 세포를 완전 용해한 웰의 측정값이다.
그 결과, shBCL11B-drNK 세포는 다양한 종류의 암 세포에 대해 살상능을 보유함을 확인하였으며, 암 세포수 대비 shBCL11B-drNK 세포의 수가 많을수록 암 세포 살상능이 높아지는 것을 확인하였다(도 7).
6-2. shBCL11B-drNK 세포와 기존 인간 자연살해(Natural killer, NK) 세포의 암 세포 살상능 비교
상기 실시예 6-1의 shBCL11B-drNK 세포와 기존 인간 자연살해 세포인 NK-92 세포(ATCC) (양성 대조군)의 K562(human myelogenous leukemia cell line)에 대한 암 세포 살상능을 상기 실시예 6-1과 동일한 방법으로 비교하였다.
그 결과, shBCL11B-drNK 세포의 암 세포 살상능이 대조군인 NK-92에 비해 약 5.2~5.5배 이상 우수함을 확인하였다(도 8).
6-3. shBCL11B-drNK 세포와 인간 말초혈액세포 유래 자연살해 세포의 암 세포 감작에 대한 CD107a + 세포 및 인터페론 감마(IFN-gamma) 발현 세포 빈도 비교
NK 세포를 암 세포와 공배양하는 경우, 암 세포 용해능을 갖는 CD107a+ 세포가 발현되므로, shBCL11B-drNK 세포를 암 세포와 공배양시 CD107a+ 세포가 발현되는지의 여부를 확인하였다.
상기 실시예 6-1의 shBCL11B-drNK 세포 또는 인간 말초혈액세포 유래 자연살해 세포인 PBMC-NK 세포(양성 대조군)를 암 세포(HCT116, HepG2 및 Mia-paca-2)와 37℃, 5% CO2 배양기에서 4시간 동안 공배양하여 발현되는, 암 세포 용해능을 갖는 CD107a+ 세포를 정량분석하였다.
PBMC-NK 세포는 NK isolataion kit을 이용하여 PBMC 세포로부터 분리하였다. 상기 PBMC-NK 세포는 PBMC 세포로부터 분리 후에 NK 배지(1 % 페니실린/스트렙토마이신, 200 IU/ml 인간 IL-2 및 20 ng/ml 인간 IL-15을 포함하는 RPMI1640)에서 2 일 동안 배양한 다음 사용하였다.
그 결과, shBCL11B-drNK 세포 또는 PBMC-NK 세포를 암 세포와 공배양한 경우, 공배양하지 않은 대조군(No target)에 비해 CD107a+ 세포의 빈도(%)가 모두 증가하였다(도 9A). shBCL11B-drNK 세포와 암 세포를 공배양한 경우, PBMC-NK 세포와 암 세포를 공배양한 경우에 비해 CD107a+ 세포의 빈도가 더욱 증가하였다.
다음으로, 상기 실시예 6-1의 shBCL11B-drNK 세포 또는 PBMC-NK 세포(양성 대조군)를 암 세포(HCT116, HepG2 및 Mia-paca-2)와 상기와 동일한 방법으로 공배양한 후, 발현되는 IFN-감마+ 세포를 정량분석하였다.
그 결과, shBCL11B-drNK 세포 또는 PBMC-NK 세포를 암 세포와 공배양한 경우, 공배양하지 않은 대조군(No target)에 비해 IFN-감마+ 세포의 빈도(%)가 모두 증가함을 확인하였다(도 9B). shBCL11B-drNK 세포와 HepG2를 공배양한 경우, PBMC-NK 세포와 HepG2를 공배양한 경우에 비해 IFN-감마+ 세포의 빈도가 현저히 증가하였다.
6-4. shBCL11B-drNK 세포와 인간 말초혈액세포 유래 자연살해 세포의 생체내 암 세포 살상능 비교
생후 8주차의 누드 마우스(Balb/c-nude mouse, 평균무게 20-25 g)의 등에 루시퍼라제(Luciferase)를 발현하는 암 세포(PC-3 또는 SK-OV-3) 각각을 1X107개 세포/ml 200 ul로 피하주입(Subcutaneous injection)하여, 마우스 전립선암 모델 또는 마우스 난소암 모델을 제조하였다.
다음날, 음성 대조군으로 PBS(Phosphate-Buffered Saline) 200 ul, 양성 대조군으로 PBMC-NK 세포 또는 상기 실시예 6-1의 shBCL11B-drNK 세포를 동일 용량(1X107개 세포/150 ul)으로 꼬리 정맥에 주입한 후 7 일 간격으로 21일차까지 종양 크기를 측정하였다. 상기 PBMC-NK 세포는 PBMC 세포로부터 분리 후에 NK 배지에서 2 일 동안 배양한 다음 사용하였다.
그 결과, PC-3 종양을 가진 마우스에 각 세포 또는 PBS 주입 후 21 일차에서 대조군의 종양 크기(4.66X1010 복사휘도(Radiance)) 대비 PBMC-NK 세포 투여군(7.31X109 복사휘도) 및 shBCL11B-drNK 세포 투여군(6.07X109 복사휘도)에서 종양 크기가 현저히 감소하였으며, shBCL11B-drNK 세포가 PBMC-NK 세포 대비 우수한 항암 효과를 나타냄을 확인하였다(도 10A).
또한, SK-OV-3 종양을 가진 마우스에 각 세포 또는 PBS 주입 후 21 일차에서 대조군의 종양 크기(3.12X1010 복사휘도) 대비 PBMC-NK 세포 투여군(1.14X1010 복사휘도) 및 shBCL11B-drNK 세포 투여군(5.92X109 복사휘도)에서 종양 크기가 현저히 감소하였으며, shBCL11B-drNK 세포가 PBMC-NK 세포 대비 우수한 항암 효과를 나타냄을 확인하였다(도 10B).
실시예 7: drNK 세포 또는 CAR-drNK 세포의 항암 효능 검증
상기 실시예 1-1에서 제조된 shBCL11B-drNK (shRNA#2) 세포, 상기 실시예 2-1에서 제조된 MSLN-shBCL11B-drNK (shRNA#2) 세포, 상기 실시예 3-1에서 제조된 gBCL11B-drNK (sgRNA-A) 세포 및 상기 실시예 4-1에서 제조된 MSLN-gBCL11B-drNK (sgRNA#1 및 sgRNA#2) 세포의 암 세포 살상능을 검증하기 위해, 상기 실시예 6-1과 동일한 방법으로 암 세포로서 MSLN이 발현되지 않는 K562, MSLN이 발현되는 PC-3 및 Mia-paca-2와 공배양하여 암 세포 살상능을 분석하였다.
그 결과, MSLN이 발현되지 않는 K562에서는 4종의 drNK 세포가 서로 유사한 암 세포 살상능을 나타내었다(도 16A).
그러나, MSLN이 발현되는 Mia-paca-2에서는 암 세포수 대비 drNK 세포수가 1:1일 때 non-CAR-drNK 세포인 shBCL11B-drNK 세포(3.9 %) 및 gBCL11B-drNK 세포(4.8 %) 대비 CAR(MSLN)-drNK 세포인 MSLN-shBCL11B-drNK 세포(21.9 %) 및 MSLN-gBCL11B-drNK 세포(20.8 %)에서 높은 암 세포 살상능을 나타내었으며, 암 세포수 대비 CAR-drNK 세포의 수가 많을수록 암 세포 살상능이 높아지는 것을 확인하였다(도 16A).
또한, MSLN이 발현되는 PC-3에서는 암 세포수 대비 drNK 세포수가 1:1일 때 non-CAR-drNK 세포인 shBCL11B-drNK(25.1 %) 및 gBCL11B-drNK 세포(15.0 %) 대비 CAR-drNK 세포인 MSLN-shBCL11B-drNK 세포(41.4 %) 및 MSLN-gBCL11B-drNK 세포(44.7 %)에서 높은 암 세포 살상능을 나타내었으며, 암 세포수 대비 CAR-drNK 세포의 수가 많을수록 암 세포 살상능이 높아지는 것을 확인하였다(도 16A).
다음으로, 상기의 shBCL11B-drNK 세포, MSLN-shBCL11B-drNK 세포, gBCL11B-drNK 세포 및 MSLN-gBCL11B-drNK 세포의 암 세포 살상 가능성을 검증하기 위해, 상기 실시예 6-3과 동일한 방법으로 공배양하여 발현되는 CD107a+ 세포를 정량분석하였다.
그 결과, MSLN이 발현되지 않는 K562에서는 shBCL11B-drNK 및 gBCL11B-drNK 대비 MSLN-shBCL11B-drNK 및 MSLN-gBCL11B-drNK 세포에서 CD107a+ 세포의 빈도(%)가 감소한 반면, MSLN이 발현되는 PC-3에서는 non-CAR-drNK 세포인 shBCL11B-drNK(17.6 %) 및 gBCL11B-drNK(19.4 %) 대비 CAR(MSLN)-drNK 세포인 MSLN-shBCL11B-drNK(32.0 %) 및 MSLN-gBCL11B-drNK(37.2 %) 세포에서 CD107a+ 세포의 빈도(%)가 증가함을 확인하였다(도 16B). 또한, MSLN이 발현되는 Mia-paca-2에서도 PC-3와 유사한 CD107a+ 세포 빈도를 확인하였다.
실시예 8: drNK 세포의 항바이러스 효능 검증
상기 실시예 1-1의 shBCL11B-drNK (shRNA#2) 세포의 항바이러스 효과를 확인하기 위해, 바이러스에 감염되지 않은 Ramos(Human B-lymphoma) 및 엡스타인바 바이러스(Epstein-Barr Virus, EBV)에 감염된 Raji에 대한 세포 살상능을 상기 실시예 6-1과 동일한 방법으로 측정하였다. 양성 대조군으로 PBMC-NK 세포 또는 NK-92 세포를 사용하였다.
그 결과, shBCL11B-drNK 세포(BCL11B-drNK) 및 양성 대조군(PBMC-NK 세포 및 NK-92 세포) 모두 비감염 Ramos보다 EBV 감염 Raji에 대해 높은 세포 살상능을 나타내었으며, shBCL11B-drNK 세포는 양성 대조군(PBMC-NK 세포 및 NK-92 세포) 대비 비감염 Ramos와 EBV 감염 Raji 모두에 대해 높은 세포 살상능을 나타내었다(도 17A).
다음으로, EBV 감염 Raji 및 비감염 Ramos를 drNK 세포와 공배양하여 CD107a+ 세포의 빈도를 확인하였다.
구체적으로, EBV 감염 Raji 및 비감염 Ramos 각각 1X106개 세포/ml와 상기의 shBCL11B-drNK 세포, 양성 대조군으로 PBMC-NK 세포 및 NK-92 세포 각각 1X106개 세포/ml를 6 웰 플레이트에 1 ml씩 분주한 후 400 g로 1 분간 원심분리하고, 이를 37℃, 5 % CO2의 배양기에서 4 시간 동안 공배양한 다음, 상기 세포를 원심분리기를 이용하여 세척 및 회수하고 FACS(Fluorescence-activated cell sorting) 분석하여 감염 세포에 반응하는 CD107a+ 세포의 빈도를 확인하였다.
CD107a+ 세포의 빈도를 확인하기 위해, shBCL11B-drNK 세포, 양성 대조군으로 PBMC-NK 세포 및 NK-92 세포 각각 1X106개 세포/ml를 형광이 부착된 CD56 및 CD107a에 대한 항체가 첨가된 FACS 완충액에 투여하고 상온에서 20 분 반응 후, 상기 세포를 원심분리기를 이용하여 세척 및 회수하고 FACS 분석하였다.
그 결과, shBCL11B-drNK 세포(BCL11B-drNK) 및 양성 대조군(PBMC-NK 세포 및 NK-92 세포) 모두 Ramos보다 EBV 감염된 Raji와 공배양하였을 때 CD107a+ 세포 빈도(%)가 증가하였으며, shBCL11B-drNK 세포는 양성 대조군(PBMC-NK 세포 및 NK-92 세포) 대비 CD107a+ 세포 빈도가 현저히 증가하였다(도 17B).
다음으로, EBV 감염 Raji 및 비감염 Ramos를 drNK 세포와 공배양하여 EBV 특이 유전자인 LMP-1(Latent Membrane Protein 1)의 발현 정도를 확인하였다.
구체적으로, GFP 발현 렌티바이러스 벡터(CTIP2 (BCL11B) Human shRNA Plasmid Kit (Locus ID 64919) 내의 control vector, ORIGENE, CAT#: TL306424)로부터 얻은 렌티바이러스 5 MOI 및 8 μg/ml 폴리브렌을 처리한 다음, RPMI 배지에서 16 시간 동안 배양 후 신선한 배지로 교체하여, Raji를 GFP-Raji로 형질전환시켰다.
제조한 GFP-Raji 1X106개 세포/ml와 shBCL11B-drNK 세포 1X106개 세포/ml를 6 웰 플레이트에 각각 1 ml씩 분주하여 파이펫팅하고, 37℃, 5% CO2의 배양기에서 24 시간 동안 공배양한 후에 반응물을 원심분리하여 회수하였다. 양성 대조군으로 PBMC-NK 세포 또는 NK-92 세포를 사용하였다. 세포 반응물로부터 Total RNA를 RNeasy Mini 키트(Qiagen)를 사용하여 추출하고 제조업체의 지침에 따라 SuperScript VILOTM cDNA 합성 키트(Thermo Fisher Scientific Inc.)를 사용하여 역전사하였다. SYBR Green으로 qRT-PCR을 수행하고 7500 Fast real-time PCR 시스템(Applied Biosystems)을 사용하여 LMP-1의 발현 수준을 분석하였다.
여기에서 사용된 프라이머 서열은 하기 표 3과 같다.
서열번호 서열명 서열(5' -> 3')
31 LMP-1 Forward TCCTCCTGTTTCTGGCGATT
32 LMP-1 Reverse GGAGTCATCGTGGTGGTGTTC
33 GFP Forward ATGGTGAGCAAGGGCGAGGAG
34 GFP Reverse CGGTGGTGCAGATGAACTTCAGG
그 결과, shBCL11B-drNK 세포 및 양성 대조군(PBMC-NK 세포 및 NK-92 세포) 모두 GFP-Raji 세포와 공배양하는 경우, 공배양하지 않은 대조군(Control)에 비해 GFP 대비 LMP-1의 발현 정도가 감소하였으며, 특히 shBCL11B-drNK 세포에서 LMP-1 발현 감소 정도가 PBMC-NK, NK-92에 비해 현저함을 확인하였다(도 17C).
다음으로, 상기의 shBCL11B-drNK 세포의 인간면역결핍 바이러스(Human immunodeficiency virus, HIV)에 감염된 CEM T 세포, 인플루엔자(Influenza) 바이러스에 감염된 HEK-293T 세포, 파필로마(Papilloma) 바이러스에 감염된 HK2 근위세뇨관 세포 및 헤파티티스(Hepatitis) 바이러스에 감염된 SNU449 간 세포에 대한 세포 살상능 및 공배양을 통해 발현된 CD107a+ 세포 빈도를 상기와 동일한 방법으로 측정하여 NK-92 세포와 비교하였다.
그 결과, shBCL11B-drNK 세포가 양성 대조군인 NK-92 세포에 비해 모든 바이러스 감염 세포에 대해 낮은 E(Effector NK cell):T(Target cancer cell) 비율에서도 높은 세포 살상능(도 17D)과 높은 CD107a+ 세포 빈도를 나타냄을 확인하였다(도 17E).
다음으로, 상기의 shBCL11B-drNK 세포의 코로나 바이러스에 대한 항바이러스 효과를 확인하기 위해, SARS-CoV-2에 감염된 Calu-1 세포(human lung epithelial cells)와 바이러스에 감염되지 않은 Calu-1 세포에서의 세포 사멸(Apoptosis)을 측정하였다.
구체적으로, 비감염 Calu-1 세포 또는 SARS-CoV-2 감염 Calu-1 세포와 shBCL11B-drNK 세포 각각 10 x 104개를 96 웰 플레이트에 분주하고, 37℃, 5% CO2의 배양기에서 4시간 동안 공배양하였다. 양성 대조군으로 PBMC-NK 세포를 사용하였다.
세포 사멸은 요오드화 프로피듐(Propidium Iodide, PI)이 포함된 APC 아넥신 V(Annexin V) 아폽토시스 검출 키트를 사용하여 제조업체(Biolegend, Cat#: 640932)의 지침에 따라 측정하였다. 공배양한 세포를 이-튜브(e-tube)에 옮겨서 세포염색용액과 원심분리기를 이용하여 2번 세척하고, 아넥신 V 결합 버퍼로 현탁하였다. 각 튜브에 APC 아넥신 V 5ul와 PI 10ul를 넣고 빛을 차단한 상태로 상온에서 15분간 반응시켰다. 아넥신 V 결합 버퍼를 추가로 첨가한 다음 유세포 분석기를 이용하여 측정하였다.
그 결과, shBCL11B-drNK 세포와의 공배양은 양성 대조군(PMBC-NK 세포) 대비 SARS-CoV-2 바이러스에 감염된 세포의 사멸을 증가시켰다(도 18).
이에 따라, shBCL11B-drNK 세포가 우수한 항바이러스 효과를 나타냄을 확인하였다.
실시예 9: drNK 세포의 항균 효능
상기 실시예 1-1의 shBCL11B-drNK (shRNA#2) 세포의 그람음성 세균에 대한 항균 효과를 확인하기 위해, 대장균(Escherichia coli, E. coli)에 대한 세포 살상능 및 공배양을 통해 발현된 CD107a+ 세포의 빈도를 측정하였다.
구체적으로, LB 한천 플레이트에서 E. coli DH5a 군집 한 개를 취하여 LB 배지에서 37℃로 16-17 시간 동안 배양한 후, 5000 x g에서 5 분 동안 원심분리한 다음, 10 % FBS를 포함하고 항생제를 포함하지 않는 RPMI 1640 배지로 세척하였다. 상기 실시예 1-1의 shBCL11B-drNK 세포, 양성 대조군인 PBMC-NK 세포 또는 NK-92 세포를 배양액을 이용하여 각각 1X104개 세포/100μl, 3X104개 세포/100μl 및 9X104개 세포/100μl의 밀도로 희석하여 준비한 후에 96 웰 플레이트에 분주하였다. 상기의 96 웰 플레이트에 3X104 개 세포/100μl의 E. coli를 첨가한 후 37℃에서 각각 0 및 2 시간 동안 배양하였다. 상기의 연속 희석한 배양액을 LB 한천 플레이트에 접종하고, 20 시간 동안 37℃에서 배양한 다음, LB 한천 플레이트의 E. coli 군집수를 계산하였다.
CD107a+ 세포의 빈도는 3X104개 세포/100μl의 shBCL11B-drNK 세포 및 3X104 개 세포/100μl의 E. coli(E:T 비율 = 1:1) 반응 2 시간 후에 측정하였다. 배양이 완료된 shBCL11B-drNK 세포, 양성 대조군인 PBMC-NK 세포 또는 NK-92 세포를 형광이 부착된 CD56 및 CD107a에 대한 항체가 첨가된 FACS 완충액에 투여하고 상온에서 20 분간 반응시킨 후, 세포를 원심분리기를 이용하여 세척 및 회수하고 FACS 분석하여 측정하였다.
그 결과, shBCL11B-drNK 세포 및 양성 대조군(PBMC-NK 세포 및 NK-92 세포) 모두 낮은 E. coli 군집수(도 19A)를 나타내어, E. coli에 대해 높은 독성을 가짐을 확인하였다(PBMC-NK: 0h(0:1); 평균 20,000 개, 2h(0:1); 평균 28,000 개, 2h(0.3:1); 평균 3,640 개, 2h(1:1); 평균 860 개, 2h(3:1); 평균 85 개, NK-92: 0h(0:1); 평균 19,825 개, 2h(0:1); 평균 28,000 개, 2h(0.3:1); 평균 5,200 개, 2h(1:1); 평균 3,200 개, 2h(3:1); 평균 88.5 개, BCL11B-drNK: 0h(0:1); 평균 19,825개, 2h(0:1); 평균 28,000 개, 2h(0.3:1); 평균 3,540 개, 2h(1:1); 평균 397.5 개, 2h(3:1); 평균 80 개).
또한, 양성 대조군에 비해 현저히 낮은 E. coli 군집수를 나타낸 E:T 비율(1:1)에서, shBCL11B-drNK 세포는 양성 대조군(PBMC-NK 세포 및 NK-92 세포)에 비해 높은 CD107a+ 세포 빈도를 나타냄을 확인하였다(도 19B).
다음으로, 상기 실시예 1-1의 shBCL11B-drNK (shRNA#2) 세포의 그람양성 세균에 대한 항균 효과를 확인하기 위해, 연쇄상구균(Streptococcus pseudopneumoniae)과의 공배양을 통해 발현된 CD107a+ 세포의 빈도를 측정하였다.
구체적으로, TSB(Tryptic soy broth)에 연쇄상구균을 현탁하고, 10 % FBS를 포함하고 항생제를 포함하지 않는 RPMI 1640 배지로 세척하였다. 상기 실시예 1-1의 shBCL11B-drNK 세포 또는 양성 대조군인 NK-92 세포를 배양액을 이용하여 각각 15X104개 세포/100μl의 밀도로 희석하여 준비한 후에 96 웰 플레이트에 분주하였다. 상기의 96 웰 플레이트에 15X104개 세포/100μl의 연쇄상구균을 첨가한 후 37℃에서 2시간 동안 5% CO2 조건으로 배양한 후, 유세포 분석기를 통해 CD107a+ 세포의 빈도를 확인하였다.
CD107a+ 세포의 빈도는 shBCL11B-drNK 세포 또는 NK-92 세포를 형광이 부착된 CD56 및 CD107a에 대한 항체가 첨가된 FACS 완충액에 투여하고 상온에서 20분 반응시킨 후, 세포를 원심분리기를 이용하여 세척 및 회수하고 FACS 분석하였다.
그 결과, 양성 대조군인 NK-92 세포에 비해 shBCL11B-drNK 세포를 공배양한 시험군에서 연쇄상구균에 대하여 현저한 항균 효과를 나타냄을 확인하였다(도 19C).
이를 통해, shBCL11B-drNK 세포가 PBMC-NK 세포 및 NK-92 세포에 비해 그람음성 세균 및 그람양성 세균에 대해 현저한 항균 효능을 나타냄을 확인하였다.
실시예 10: drNK 세포의 항곰팡이 효능
상기 실시예 1-1의 shBCL11B-drNK (shRNA#2) 세포의 항곰팡이 효과를 확인하기 위해, 칸디다 알비칸스(Candida albicans)와의 공배양을 통해 발현된 CD107a+ 세포의 빈도를 측정하였다.
구체적으로, YPD 한천 플레이트(1 % 효모 추출물, 2 % 펩톤, 2 % D-글루코스 및 1 % 아가 포함)에서 칸디다 알비칸스 군집 한 개를 취하여 YPD 배지(1 % 효모 추출물, 2 % 펩톤 및 2 % D-글루코스 포함)에서 37℃에서 2시간 동안 배양한 후, 1000 x g에서 5분 동안 원심분리한 다음, 10 % FBS를 포함하고 항생제를 포함하지 않는 RPMI 1640 배지로 세척하였다. 상기 실시예 1-1의 shBCL11B-drNK 세포, 양성 대조군인 PBMC-NK 세포 또는 NK-92 세포를 배양액을 이용하여 각각 2X105 개 세포/100μl의 밀도로 희석하여 준비한 후에 96 웰 플레이트에 분주하였다. 상기의 96 웰 플레이트에 2X105 개 세포/100μl의 칸디다균을 첨가한 후(E:T 비율=1:1) 37℃에서 6 시간 동안 공배양한 후, CD107a+ 세포의 빈도를 측정하였다.
CD107a+ 세포의 빈도는 배양이 완료된 shBCL11B-drNK 세포, 양성 대조군인 PBMC-NK 세포 또는 NK-92 세포를 형광이 부착된 CD56-PE 및 CD107a-APC 항체가 첨가된 FACS 완충액에 투여하고 상온에서 20분간 반응 후, 세포를 원심분리기를 이용하여 세척 및 회수하고 FACS 분석하여 측정하였다.
그 결과, shBCL11B-drNK 세포와 칸디다균을 공배양한 경우 CD107a+ 세포의 빈도가 가장 높았으며(20.4 %), PBMC-NK 세포와 칸디다균의 공배양(10.0 %), shBCL11B-drNK 세포 단독 배양(8.5%), NK-92 세포와 칸디다균의 공배양(6.3 %), PBMC-NK 세포 단독 배양(5.6 %), NK-92 세포 단독 배양(2.9 %) 순으로 CD107a+ 세포의 빈도가 높았다(도 20).
다음으로, 상기의 shBCL11B-drNK 세포의 아스페르길루스 푸미가투스(Aspergillus fumigatus)에 대한 항곰팡이 효과를 확인하였다.
구체적으로, 아스페르길루스 푸미가투스 군집을 취하여 감자한천배지(Potato Dextrose Agar, PDA) 플레이트에서 25℃로 5일간 배양한 후, 0.05% Tween 20을 포함하는 PBS 12ml을 첨가하고 화염멸균한 슬라이드 글라스(Slide glass)로 긁어내어 균체 현탁액을 수득하였다. 40 μm 셀 스트레이너(Cell strainer)에 균체 현탁액을 여과하고 4000 rpm, 10분간 원심분리 후 상층액을 제거하여 분생자(Conidia)를 회수하였다. 회수한 분생자를 PBS로 현탁하고 원심분리 후 상층액을 제거하는 과정을 2차례 반복하여 세척하고, RPMI 1640 배지에 현탁하였다. 5X103 개의 분생자를 96 웰 플레이트에 접종하여 37℃, 5% CO2의 배양기에서 4시간 동안 배양하고, 상기 실시예 1-1의 shBCL11B-drNK 세포, 양성 대조군인 PBMC-NK 세포 또는 NK-92 세포와 E:T 비율=1:1로 6시간 동안 공배양하였다. 96 웰 플레이트에서 상층액을 제거하고 멸균 증류수로 세포 용해(cell lysis) 및 세척 후, Coenzyme Q0(2,3-Dimethoxy-5-methyl-p-benzoquinone)이 포함된 XTT(2,3-Bis-(2-Methoxy-4-Nitro-5-Sulfophenyl)-2H-Tetrazolium-5-Carboxanilide) 용액 150 ul를 첨가하였다. 37℃, 5% CO2의 배양기에서 1시간 동안 배양한 후, 상층액 100 ul를 새로운 96 웰 플레이트로 옮기고 마이크로플레이트 리더를 이용하여 450nm, 690nm에서 흡광도를 측정하였다.
그 결과, shBCL11B-drNK 세포 및 양성 대조군(PBMC-NK 세포 및 NK-92 세포) 모두 항곰팡이 활성을 나타내며, 특히 shBCL11B-drNK 세포의 항곰팡이 활성이 가장 우수함을 확인하였다(도 21).
상기 실시예의 결과로부터, 본 발명을 통해 제작된 drNK 세포 또는 CAR-drNK는 암 세포 또는 바이러스, 세균 및 곰팡이 감염 세포에 대한 세포 살상능이 우수한 바, 암, 또는 세균 및 곰팡이에 의한 감염성 질환 및/또는 염증성 질환의 예방 또는 치료용 세포치료제 및 조성물로 적용할 수 있다.
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.

Claims (30)

  1. a) 분리된 세포에 하기의 i) 또는 iii) 중 선택되는 어느 하나 이상을 도입하여 세포에서의 BCL11B 유전자 발현을 억제하는 단계:
    i) BCL11B shRNA(Short hairpin RNA),
    ii) BCL11B siRNA(Short interfering RNA), 또는
    iii) CRISPR(Clustered regularly interspaced short palindromic repeats)/Cas9-gRNA-BCL11B;
    b) 상기 a) 단계의 세포를 사이토카인 및 성장인자를 포함하는 배지에서 배양하여 NK(Natural killer) 세포로 세포전환 시키는 단계;를 포함하는, directly reprogrammed natural killer NK(drNK) 세포 제조방법.
  2. 제1항에 있어서, 상기 a) 단계의 분리된 세포는 NK 세포를 제외한 체세포인 것인, 제조방법.
  3. 제2항에 있어서, 상기 체세포는 혈액 세포(Blood cell) 및 섬유아 세포(Fibroblast)로 이루어지는 군으로부터 선택되는 어느 하나 이상인 것인, 제조방법.
  4. 제1항에 있어서, 상기 shRNA의 타겟 센스 서열(Target sense sequence)은 서열번호 1 내지 7로 이루어지는 군으로부터 선택되는 어느 하나 이상인 것인, 제조방법.
  5. 제1항에 있어서, 상기 siRNA의 타겟 센스 서열(Target sense sequence)은 서열번호 8 내지 11로 이루어지는 군으로부터 선택되는 어느 하나 이상인 것인, 제조방법.
  6. 제1항에 있어서, 상기 CRISPR/Cas9-gRNA-BCL11B는 a) 단계 또는 b) 단계 중 선택되는 어느 하나 이상의 단계에서 처리되는 것인, 제조방법.
  7. 제1항에 있어서, 상기 gRNA는 서열번호 12 내지 13으로 이루어지는 군으로부터 선택되는 어느 하나 이상인 것인, 제조방법.
  8. 제1항에 있어서, 상기 b)의 성장인자는 EGF(Epidermal growth factor), PDGF-AA(Platelet-derived growth factor-AA), IGF-1(Insulin-like growth factor 1), TGF-β(Transforming growth factor-β), FGF(Fibroblast growth factor), SCF(Stem cell factor) 및 FLT3L(FMS-like tyrosine kinase ligand)로 이루어지는 군으로부터 선택되는 어느 하나 이상인 것인, 제조방법.
  9. 제1항에 있어서, 상기 b)의 사이토카인은 IL(Interleukin)-2, IL-3, IL-5, IL-6, IL-7, IL-11, IL-15, IL-21, BMP4(Bone morphogenetic protein 4), 액티빈 A(Acivin A), 노치 리간드(Notch ligand), G-CSF(Granulocyte-colony stimulating factor) 및 SDF-1(Stromal cell-derived factor-1)로 이루어지는 군으로부터 선택되는 어느 하나 이상인 것인, 제조방법.
  10. 제1항에 있어서, 상기 b)의 성장인자 및 사이토카인은 IL-2, IL-15, IL-7, SCF 및 FLT3L로 이루어지는 군으로부터 선택되는 어느 하나 이상인 것인, 제조방법.
  11. 제1항에 있어서, 상기 b)의 배지는 GSK3β(Glycogen synthase kinase 3β) 저해제(Inhibitor), PDK1(3-phosphoinositide-dependent kinase 1) 저해제 및 AHR(Aryl hydrocarbon receptor) 저해제로 이루어지는 군으로부터 선택되는 어느 하나 이상을 추가로 포함하는 것인, 제조방법.
  12. 제1항 내지 제11항 중 어느 한 항의 방법으로 제조된 drNK 세포.
  13. 제12항에 있어서, 상기 세포는 CD56+, CD3- 및 이들의 조합으로 이루어지는 군으로부터 선택되는 어느 하나 이상을 발현하는 것인, 세포.
  14. 제1항의 방법에서 상기 a) 또는 b) 중 선택되는 어느 하나 이상의 단계에 CD19-CAR, MSLN-CAR 및 HER2-CAR로 이루어지는 군으로부터 선택되는 CAR 유전자를 추가로 도입하는 것을 포함하는 것인, CAR-drNK 세포 제조방법.
  15. 제14항에 있어서, 상기 CAR 유전자는 BCL11B 넉아웃 염기서열에 넉인(Knock-in)하여 도입하는 것인, 제조방법.
  16. 제14항에 있어서, 상기 CAR 유전자는
    i) CD8 리더(Leader), CD19 scFv, CD8 힌지(Hinge), CD8 막 관통 도메인 및 Fc-γ(Gamma) 수용체를 포함하는 CAR 유전자;
    ii) CD8 리더, MSLN(Mesothelin) scFv, CD8 힌지, CD8 막 관통 도메인, CD28 세포내 도메인, CD3ζ 및 IRES를 포함하는 CAR 유전자; 및
    iii) CD8 리더, HER2(Human epidermal growth factor receptor 2) scFv, CD8 힌지, CD8 막 관통 도메인, CD28 세포내 도메인, CD3ζ 및 IRES를 포함하는 CAR 유전자;로 이루어지는 군으로부터 선택되는 어느 하나 이상인 것인, 제조방법.
  17. 제14항 내지 제16항 중 어느 한 항의 방법으로 제조된 CAR-drNK 세포.
  18. 제17항에 있어서, 상기 세포는 CD56+, CD3- 및 이들의 조합으로 이루어지는 군으로부터 선택되는 어느 하나 이상을 발현하는 것인, 세포.
  19. 제1항 내지 제11항 및 제14항 내지 제16항 중 어느 한 항의 방법으로 제조된 세포를 유효성분으로 포함하는, 암 예방 또는 치료용 세포치료제 조성물.
  20. 제1항 내지 제11항 및 제14항 내지 제16항 중 어느 한 항의 방법으로 제조된 세포를 유효성분으로 포함하는, 암 예방 또는 치료용 약학 조성물.
  21. 제19항에 있어서, 상기 암은 CD19, MSLN 또는 HER2으로 이루어지는 군으로부터 선택되는 어느 하나 이상의 발현과 연관된 암인 것인, 조성물.
  22. 제21항에 있어서, 상기 CD19, MSLN 또는 HER2으로 이루어지는 군으로부터 선택되는 어느 하나 이상의 발현과 연관된 암은 림프종, 백혈병, 골수종, 중피종, 자궁암, 두경부암, 식도암, 활막육종, 신장암, 이행세포암종, 감상선암, 생식세포종, 담도암/담관암, 유두양 장액성 선암, 대장암, 간암, 폐암, 췌장암, 교모세포종, 결장암, 난소암, 유방암, 전립선암, 흑색종, 근육종, 갑상선암, 골육종, 융모암, 위암, 신경교종, 연조직 육종, 신경내분비종양, 뇌하수체종양, 희소돌기아교세포종, 위장관기질 종양, 쓸개암, 소장암, 고립성 섬유종, 흉선암, 및 방광암으로 이루어지는 군으로부터 선택되는 어느 하나 이상인 것인, 조성물.
  23. 제1항 내지 제11항 및 제14항 내지 제16항 중 어느 한 항의 방법으로 제조된 세포를 유효성분으로 포함하는, 감염성 질환의 예방 또는 치료용 세포치료제 조성물.
  24. 제1항 내지 제11항 및 제14항 내지 제16항 중 어느 한 항의 방법으로 제조된 세포를 유효성분으로 포함하는, 감염성 질환의 예방 또는 치료용 약학 조성물.
  25. 제23항에 있어서, 상기 감염성 질환은 바이러스, 세균 및 곰팡이로 이루어지는 군으로부터 선택되는 어느 하나 이상에 의해 발생하는 것인, 조성물.
  26. 제25항에 있어서, 상기 바이러스는 RNA 바이러스 및 DNA 바이러스로 이루어지는 군으로부터 선택되는 어느 하나 이상인 것인, 조성물.
  27. 제25항에 있어서, 상기 바이러스는 Epstein-Barr(엡스타인바) 바이러스(EBV), Hepatitis 바이러스, Human immunodeficiency(인간 면역결핍) 바이러스(HIV), Influenza(인플루엔자) 바이러스, Papilloma(유두종) 바이러스, SARS(Severe acute respiratory syndrome) (사스) 바이러스, SARS corona(사스 코로나) 바이러스 및 SARS-CoV-2 바이러스로 이루어지는 군으로부터 선택되는 어느 하나 이상인 것인, 조성물.
  28. 제25항에 있어서, 상기 세균은 그람음성 세균 및 그람양성 세균으로 이루어지는 군으로부터 선택되는 어느 하나 이상인 것인, 조성물.
  29. 제25항에 있어서, 상기 세균은 Escherichia(에스케리키아) 및 Streptococcus(스트렙토코커스)으로 이루어지는 군으로부터 선택되는 어느 하나 이상인 것인, 조성물.
  30. 제25항에 있어서, 상기 곰팡이는 Aspergillus(누룩곰팡이), Candida(칸디다), Absidia(활털곰팡이), Mucor(털곰팡이) 및 Rhizopus(거미줄곰팡이) 속으로 이루어지는 군으로부터 선택되는 어느 하나 이상인 것인, 조성물.
PCT/KR2022/013561 2021-09-10 2022-09-08 유도 자연살해세포의 제조방법 및 그의 용도 WO2023038475A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20210121118 2021-09-10
KR10-2021-0121118 2021-09-10

Publications (1)

Publication Number Publication Date
WO2023038475A1 true WO2023038475A1 (ko) 2023-03-16

Family

ID=85506848

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/013561 WO2023038475A1 (ko) 2021-09-10 2022-09-08 유도 자연살해세포의 제조방법 및 그의 용도

Country Status (2)

Country Link
KR (1) KR102604208B1 (ko)
WO (1) WO2023038475A1 (ko)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120288484A1 (en) * 2009-07-15 2012-11-15 Genome Research Limited Cells, compositions and methods
CN111607569A (zh) * 2020-06-01 2020-09-01 广东昭泰体内生物医药科技有限公司 一种基于CRISPR/Cas9重编程ITNK细胞的方法
CN112063653A (zh) * 2020-09-09 2020-12-11 广东昭泰体内生物医药科技有限公司 一种基于电转重编程质粒制备nk样细胞的方法
KR102298640B1 (ko) * 2019-03-28 2021-09-07 한국생명공학연구원 Car 유전자가 도입된 nk 세포의 제조방법 및 그의 용도

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120288484A1 (en) * 2009-07-15 2012-11-15 Genome Research Limited Cells, compositions and methods
KR102298640B1 (ko) * 2019-03-28 2021-09-07 한국생명공학연구원 Car 유전자가 도입된 nk 세포의 제조방법 및 그의 용도
CN111607569A (zh) * 2020-06-01 2020-09-01 广东昭泰体内生物医药科技有限公司 一种基于CRISPR/Cas9重编程ITNK细胞的方法
CN112063653A (zh) * 2020-09-09 2020-12-11 广东昭泰体内生物医药科技有限公司 一种基于电转重编程质粒制备nk样细胞的方法

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
KIM HAN-SEOP; KIM JAE YUN; SEOL BINNA; SONG CHO LOK; JEONG JI EUN; CHO YEE SOOK: "Directly reprogrammed natural killer cells for cancer immunotherapy", NATURE BIOMEDICAL ENGINEERING, NATURE PUBLISHING GROUP UK, LONDON, vol. 5, no. 11, 2 August 2021 (2021-08-02), London, pages 1360 - 1376, XP037617182, DOI: 10.1038/s41551-021-00768-z *
MALUSKI MARCEL, GHOSH ARNAB, HERBST JESSICA, SCHOLL VANESSA, BAUMANN ROLF, HUEHN JOCHEN, GEFFERS ROBERT, MEYER JOHANN, MAUL HOLGER: "Chimeric antigen receptor–induced BCL11B suppression propagates NK-like cell development", THE JOURNAL OF CLINICAL INVESTIGATION, B M J GROUP, GB, vol. 129, no. 12, 3 September 2019 (2019-09-03), GB , pages 5108 - 5122, XP055824196, ISSN: 0021-9738, DOI: 10.1172/JCI126350 *

Also Published As

Publication number Publication date
KR20230038629A (ko) 2023-03-21
KR102604208B1 (ko) 2023-11-23

Similar Documents

Publication Publication Date Title
WO2020197318A1 (ko) Car 유전자가 도입된 nk 세포의 제조방법 및 그의 용도
WO2018217064A2 (ko) 형질전환된 t세포를 이용한 자연살해세포의 배양방법
WO2018166307A1 (zh) 靶向nkg2dl的特异性嵌合抗原受体t细胞，其制备方法和应用
WO2014163425A1 (ko) Hmga2를 이용하여 비신경 세포로부터 리프로그래밍된 유도 신경줄기세포를 제조하는 방법
WO2012026712A2 (ko) Ｎｏｄ２의 아고니스트를 처리한 줄기세포 또는 그 배양물을 포함하는 면역질환 또는 염증질환의 예방 또는 치료용 약학조성물
WO2019182425A1 (ko) 신규 키메라 항원 수용체 암호화 유전자가 형질도입된 유전자 변형 nk 세포주 및 그의 용도
WO2020101361A1 (ko) 형질전환된 t세포를 이용한 제대혈 유래 자연살해세포의 배양방법
WO2016048107A1 (ko) 인터페론-감마 또는 인터류킨-1베타를 처리한 줄기세포 또는 그 배양물을 포함하는 면역질환 또는 염증질환의 예방 또는 치료용 약학조성물
WO2018030874A1 (ko) 조작된 면역조절요소 및 이에 의해 변형된 면역 활성
WO2018190656A1 (ko) In vitro에서 성숙된 인간 장관 오가노이드의 제조 방법 및 이의 용도
WO2011142514A1 (ko) Pias3을 유효성분으로 포함하는 암 또는 면역질환의 예방 또는 치료용 조성물
WO2018208067A1 (ko) 인위적으로 조작된 조작면역세포
WO2020251181A1 (ko) 줄기세포 유래 엑소좀 생성 촉진 및 줄기세포능 증가용 조성물
WO2022025559A1 (ko) 줄기세포 유래 엑소좀을 포함하는 조성물 및 이의 제조방법
WO2023038475A1 (ko) 유도 자연살해세포의 제조방법 및 그의 용도
WO2019132547A1 (ko) Chi3l1 억제제를 유효성분으로 하는 암의 폐 전이 예방 또는 치료용 약학 조성물
WO2019059713A2 (ko) 자연살해세포의 제조방법 및 그의 용도
WO2023038476A1 (ko) 자연살해세포의 제조방법 및 이의 감염성 질환 예방 또는 치료 용도
WO2016117960A1 (ko) 면역질환 치료 효능을 갖는 grim19이 과발현된 중간엽줄기세포 및 이의 용도
WO2022255793A1 (ko) 배양보조세포를 포함하는 자연살해세포 증식용 조성물
WO2021015584A1 (ko) 불사화된 줄기세포주의 제조 방법 및 이의 용도
WO2022030973A1 (ko) 종양 침윤성 림프구로부터 역분화된 줄기세포 기억 t세포를 포함하는 세포치료제 조성물 및 그 제조 방법
WO2021107635A1 (ko) Il-2 단백질 및 cd80 단백질을 포함하는 융합단백질 및 nk 세포를 포함하는 항암 치료용 조성물
WO2013162330A1 (ko) 키메라 중간엽 줄기세포군, 그의 제조방법 및 편도줄기세포를 이용하여 부갑상선 호르몬을 생산하는 방법
WO2020209636A1 (ko) 소변세포로부터 신장전구세포로의 직접 역분화를 유도하는 방법 및 이의 방법으로 역분화된 신장전구세포를 포함하는 신장세포 손상 질환 예방 또는 치료용 약학 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22867743

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE