WO2022254362A1 - 3-(1-oxoisoindolin-2-yl)piperidine-2,6-dione derivatives and medical uses thereof - Google Patents
3-(1-oxoisoindolin-2-yl)piperidine-2,6-dione derivatives and medical uses thereof Download PDFInfo
- Publication number
- WO2022254362A1 WO2022254362A1 PCT/IB2022/055131 IB2022055131W WO2022254362A1 WO 2022254362 A1 WO2022254362 A1 WO 2022254362A1 IB 2022055131 W IB2022055131 W IB 2022055131W WO 2022254362 A1 WO2022254362 A1 WO 2022254362A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cycloalkyl
- pharmaceutically acceptable
- solvate
- tautomer
- stereoisomer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
- C07D401/14—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing three or more hetero rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
- A61K31/445—Non condensed piperidines, e.g. piperocaine
- A61K31/4523—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems
- A61K31/4545—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a six-membered ring with nitrogen as a ring hetero atom, e.g. pipamperone, anabasine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/55—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/06—Antianaemics
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D405/00—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
- C07D405/14—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing three or more hetero rings
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D471/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
- C07D471/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
- C07D471/08—Bridged systems
Definitions
- the present disclosure relates to 3-(5-oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione compounds and pharmaceutical compositions and their use in reducing Widely Interspaced Zinc Finger Motifs (WIZ) protein expression levels and/or inducing fetal hemoglobin (HbF) protein expression levels, and in the treatment of inherited blood disorders (hemoglobinopathies, e.g., beta-hemoglobinopathies), such as sickle cell disease and beta-thalassemia.
- WIZ Widely Interspaced Zinc Finger Motifs
- HbF fetal hemoglobin
- Background of the Disclosure Sickle cell disease (SCD) is a group of severe inherited blood disorders that cause red blood cells to contort into a sickle shape.
- Beta thalassemias are a group of inherited blood disorders that are caused by reduced or absent synthesis of beta globin, causing anemia. Fetal hemoglobin (HbF) induction is known to ameliorate symptoms in SCD and beta- thalassemia patients, with both genetic (single nucleotide polymorphisms in the globin control locus & BCL11A) and pharmacologic (hydroxyurea) validation in the clinic (Vinjamur, D. S., et al. (2016), The British Journal of Haematology, 180(5), 630-643).
- HbF Fetal hemoglobin
- Hydroxyurea is the current standard of care for SCD and is thought to provide benefit via induction of HbF, but is genotoxic, causes dose-limiting neutropenia and has a response rate of less than 40%.
- Other mechanisms being targeted clinically and preclinically include inhibition of HDAC1/2 (Shearstone et al., 2016, PLoS One, 11(4), e0153767), LSD1 (Rivers et al., 2018, Experimental Hematology, 67, 60-64), DNMT1, PDE9a (McArthur et al., 2019, Haematologica.
- WIZ is ubiquitously expressed and plays a role in targeting the G9a/GLP histone methyltransferases to genomic loci to regulate chromatin structure and transcription (Bian, Chen, et al. (2015), eLife 2015;4:e05606. Summary of the Disclosure The disclosure relates to 3-(5-oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione compounds, which are effective in reducing WIZ protein expression levels and/or inducing fetal hemoglobin (HbF) expression, pharmaceutically acceptable salts thereof, compositions thereof, and their use in therapies for the conditions and purposes detailed above.
- HbF fetal hemoglobin
- each R 1 is independently selected from hydrogen, C 1 -C 6 alkyl, hydroxyl, halo, C 1 - C 6 haloalkyl, C 1 -C 6 haloalkoxyl, and C 1 -C 6 alkoxyl; or 2 R 1 on the same carbon atom together with the same carbon atom to which they are attached form a C 3 -C 8 cycloalkyl; or 2 R 1 on adjacent carbon atoms together with the adjacent carbon atoms to which they are attached form a C 3 - C 8 cycloalkyl; or 2 R 1 on non-adjacent carbon atoms together with the non-adjacent carbon atoms to which they are attached form a bridging ring; R 2 is selected from hydrogen, C 3 -C 11 cycloal
- each R 1 is independently selected from hydrogen, C 1 -C 6 alkyl, hydroxyl, halo, C 1 - C 6 haloalkyl, C 1 -C 6 haloalkoxyl, and C 1 -C 6 alkoxyl; or 2 R 1 on the same carbon atom together with the same carbon atom to which they are attached form a C 3 -C 8 cycloalkyl; or 2 R 1 on adjacent carbon atoms together with the adjacent carbon atoms to which they are attached form a C 3 - C 8 cycloalkyl; or 2 R 1 on non-adjacent carbon atoms together with the non-adjacent carbon atoms to which they are attached form a bridging ring; R 2 is selected from hydrogen, C 3 -C 11 cycloalky
- the disclosure provides, in a third aspect, a compound of formula (I) or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, wherein: 1 each R is independently selected from hydrogen, C 1 -C 6 alkyl, hydroxyl, halo, C 1 - C 6 haloalkyl, C 1 -C 6 haloalkoxyl, and C 1 -C 6 alkoxyl; or 2 R 1 on the same carbon atom together with the same carbon atom to which they are attached form a C 3 -C 8 cycloalkyl; or 2 R 1 on adjacent carbon atoms together with the adjacent carbon atoms to which they are attached form a C 3 - C 8 cycloalkyl; or 2 R 1 on non-adjacent carbon atoms together with the non-adjacent carbon atoms to which they are attached form a bridging ring; R 2 is selected from hydrogen, C 3 -C 11 cycloal
- the disclosure provides a pharmaceutical composition
- a pharmaceutical composition comprising a therapeutically effective amount of a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA- iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, and a pharmaceutically acceptable carrier or excipient.
- the disclosure provides a method of treating or preventing a disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA- iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- the disclosure provides a method of degrading WIZ protein in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB- iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- the disclosure provides a method of inhibiting WIZ protein expression in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I'), (II"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- the disclosure provides a method of inhibiting, reducing, or eliminating the activity of WIZ protein or WIZ protein expression, the method comprising administering to the subject a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- the disclosure provides a method of inducing or promoting fetal hemoglobin in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA- iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- the disclosure provides a method of reactivating fetal hemoglobin production or expression in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- the disclosure provides a method of increasing fetal hemoglobin expression in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA- iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- the disclosure provides a method of treating a hemoglobinopathy, e.g., a beta-hemoglobinopathy, in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- a hemoglobinopathy e.g., a beta-hemoglobinopathy
- the disclosure provides a method of treating a sickle cell disease in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- the disclosure provides a method of treating beta-thalassemia in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- the disclosure provides a method of treating a disease or disorder that is affected by the modulation of WIZ protein levels comprising administering to the patient in need thereof a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- the disclosure provides a method of treating or preventing a disorder that is affected by the reduction of WIZ protein levels, in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- the disclosure provides a method of reducing WIZ protein levels in a subject comprising the step of administering to a subject in need thereof a therapeutically effective amount of a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB- iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- the disclosure provides a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, for use as a medicament.
- the disclosure provides a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, for use in the treatment of a disease or disorder.
- the disclosure provides a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, for use in the treatment of a disease or disorder selected from sickle cell disease and beta- thalassemia.
- the disclosure provides a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, for use in treating or preventing a disease or disorder in a subject in need thereof.
- the disclosure provides a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, for use in the treatment or prevention of a disease or disorder that is affected by the reduction of WIZ protein levels.
- the disclosure provides a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, for use in inhibiting WIZ protein expression in a subject in need thereof.
- the disclosure provides a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, for use in degrading WIZ protein in a subject in need thereof.
- the disclosure provides a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, for use in inhibiting, reducing, or eliminating the activity of WIZ protein or WIZ protein expression in a subject in need thereof.
- the disclosure provides a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, for use in inducing or promoting fetal hemoglobin in a subject in need thereof.
- the disclosure provides a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, for use in reactivating fetal hemoglobin production or expression in a subject in need thereof.
- the disclosure provides a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, for use in increasing fetal hemoglobin production or expression in a subject in need thereof.
- the disclosure provides a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, for use in the treatment or prevention of a disease or disorder that is affected by the inhibition of WIZ protein expression.
- the disclosure provides a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, for use in the treatment or prevention of a disease or disorder that is affected by the degradation of WIZ protein.
- the disclosure provides a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, for use in the treatment of a hemoglobinopathy.
- the disclosure provides a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, for use in the treatment of a sickle cell disease.
- the disclosure provides a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, for use in the treatment of beta-thalassemia.
- the disclosure provides a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, for use in the treatment of a disease or disorder affected by an increase in fetal hemoglobin expression.
- the disclosure provides a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, for use in the treatment of a disease or disorder affected by the inhibition, reduction, or elimination of the activity of WIZ protein or WIZ protein expression.
- the disclosure provides a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, for use in the treatment of a disease or disorder affected by the induction or promotion of fetal hemoglobin.
- the disclosure provides a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, for use in the treatment of a disease or disorder affected by the reactivation of fetal hemoglobin production or expression.
- the disclosure provides the use of a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, in the manufacture of a medicament for treating a disease or disorder that is affected by the reduction of WIZ protein levels, inhibition of WIZ protein expression or degradation of WIZ protein.
- the disclosure provides the use of a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, in the manufacture of a medicament for treating a disease or disorder that is affected by inducing or promoting fetal hemoglobin.
- the disclosure provides the use of a compound of (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, in the manufacture of a medicament for treating a disease or disorder that is affected by reactivating fetal hemoglobin production or expression.
- the disclosure provides the use of a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, in the manufacture of a medicament for treating a disease or disorder that is affected by increasing fetal hemoglobin expression.
- the disclosure provides the use of a compound of (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, in the manufacture of a medicament for treating a disease or disorder that is affected by the reduction of WIZ protein levels, inhibition of WIZ protein expression or degradation of WIZ protein.
- the disclosure provides the use of a compound of (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, in the manufacture of a medicament for treating a disease or disorder that is affected by inducing fetal hemoglobin.
- the disclosure provides the use of a compound of (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, in the manufacture of a medicament for treating a disease or disorder that is affected by reactivating fetal hemoglobin production or expression.
- the disclosure provides the use of a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, in the manufacture of a medicament for treating a disease or disorder that is affected by increasing fetal hemoglobin expression.
- the disclosure provides the use of a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, in the treatment of a disease or disorder that is affected by the reduction of WIZ protein levels, inhibition of WIZ protein expression or degradation of WIZ protein.
- the disclosure provides the use of a compound of (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, in the treatment of a disease or disorder that is affected by inducing fetal hemoglobin, reactivating fetal hemoglobin production or expression, or increasing fetal hemoglobin expression.
- the disclosure provides a pharmaceutical combination comprising a compound of (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC- ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, and one or more additional therapeutic agent(s).
- a pharmaceutically acceptable salt hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, and one or more additional therapeutic agent(s).
- FIG.1A depicts a volcano plot of differentially expressed genes from WIZ KO cells as compared to a scrambled gRNA control. Each dot represents a gene.
- HBG1/2 genes are differentially upregulated with WIZ_6 and WIZ_18 gRNA targeting WIZ KO.
- FIG. 1B depicts a bar graph showing the frequency of HbF+ cells due to shRNA- mediated loss of WIZ in human mobilized peripheral blood CD34+ derived erythroid cells.
- FIG.1C depicts a bar graph showing the frequency of HbF+ cells due to CRISPR/Cas9-mediated loss of WIZ in human mobilized peripheral blood CD34+ derived erythroid cells.
- the compounds disclosed herein are effective in reducing WIZ protein expression levels, or inducing fetal hemoglobin (HbF) expression. Without wishing to be bound by any theory, it is believed that the disclosed compounds may treat blood disorders, such as inherited blood disorders, e.g., sickle cell disease, and beta-thalassemia by inducing fetal hemoglobin HbF expression.
- blood disorders such as inherited blood disorders, e.g., sickle cell disease, and beta-thalassemia by inducing fetal hemoglobin HbF expression.
- the terms “compounds of the present disclosure”, “compounds of the disclosure”, or “compound of the disclosure” refer to compounds of formulae of (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), exemplified compounds, salts thereof, particularly pharmaceutically acceptable salts thereof, hydrates, solvates, prodrugs, as well as all stereoisomers (including diastereoisomers and enantiomers), rotamers, tautomers, and isotopically labeled compounds (including deuterium substitutions), as well as inherently formed moieties.
- C 1 -C 10 alkyl means an alkyl group or radical having 1 to 10 carbon atoms.
- the last named group is the radical attachment point, for example, “alkylaryl” means a monovalent radical of the formula alkyl-aryl–, while “arylalkyl” means a monovalent radical of the formula aryl-alkyl–.
- alkylaryl means a monovalent radical of the formula alkyl-aryl–
- arylalkyl means a monovalent radical of the formula aryl-alkyl–.
- designating a monovalent radical where a divalent radical is appropriate shall be construed to designate the respective divalent radical and vice versa.
- an aryl substituted with a cycloalkyl may indicate that the cycloalkyl connects to one atom of the aryl with a bond or by fusing with the aryl and sharing two or more common atoms.
- C 1 -C 10 alkyl refers to a straight or branched hydrocarbon chain radical consisting solely of carbon and hydrogen atoms, containing no unsaturation, having from one to ten carbon atoms, and which is attached to the rest of the molecule by a single bond.
- C 1 -C 3 alkyl examples include, without limitations, methyl, ethyl, n-propyl, 1-methylethyl (iso- propyl), n-butyl, 1-methylpropyl (sec-butyl), 2-methylpropyl (iso-butyl), 1,1-dimethylethyl (t-butyl), n-pentyl, n-hexyl, n-heptyl, 4-heptyl, n-octyl, 2-isopropyl-3-methylbutyl, n-nonyl and n-decyl.
- C 1 -C 6 alkoxyl refers to a radical of the formula –OR a where R a is a C 1 -C 6 alkyl radical as generally defined above.
- Examples of C 1 -C 6 alkoxyl include, without limitations, methoxy, ethoxy, propoxy, iso-propoxy, butoxy, iso-butoxy, tert-butoxy, sec-butoxy, pentoxy, and hexoxy.
- Alkenyl means a straight or branched chain unsaturated hydrocarbon containing 2-12 carbon atoms. The “alkenyl” group contains at least one double bond in the chain.
- alkenyl group can be unconjugated or conjugated to another unsaturated group.
- alkenyl groups include ethenyl, propenyl, n-butenyl, isobutenyl, pentenyl, and hexenyl.
- An alkenyl group can be unsubstituted or substituted and may be straight or branched.
- C 2 -C 6 alkenyl is to be construed accordingly.
- C 2 -C 6 alkenyl examples include, without limitations, ethenyl (or vinyl), propenyl (e.g., prop-1-enyl, prop-2-enyl), butadienyl (e.g., buta-1,3-dienyl), butenyl (e.g., but-1-en-1-yl, but-2-en- 1-yl but-3-en-1-yl), pentenyl (e.g., pent-1-en-1-yl, pent-2-en-2-yl), hexenyl (e.g., hex-1-en-2-yl, hex-2-en-1-yl), 1-ethylprop-2-enyl, 1,1-(dimethyl)prop-2-enyl, 1-ethylbut-3-enyl, and 1,1- (dimethyl)but-2-enyl.
- propenyl e.g., prop-1-enyl, prop-2-enyl
- Alkynyl means a straight or branched chain unsaturated hydrocarbon containing 2-12 carbon atoms.
- the “alkynyl” group contains at least one triple bond in the chain.
- the term “C 2 - C 6 alkynyl” is to be construed accordingly.
- Examples of alkynyl groups include ethynyl, propargyl, n-butynyl, isobutynyl, pentynyl, and hexynyl.
- An alkynyl group can be unsubstituted or substituted.
- C 2 -C 6 alkynyl examples include, without limitations, ethynyl, prop-1-ynyl, prop-2-ynyl, and but- 2-ynyl.
- C 1 -C 6 haloalkyl refers to C 1 -C 6 alkyl radical, as defined above, substituted by one or more halo radicals, as defined herein.
- C 1 -C 6 haloalkyl examples include, without limitations, trifluoromethyl, difluoromethyl, fluoromethyl, trichloromethyl, 1,1-difluoroethyl, 2,2-difluoroethyl, 2,2,2-trifluoroethyl, 2-fluoropropyl, 3,3-difluoropropyl and 1-fluoromethyl-2- fluoroethyl, 1,3-dibromopropan-2-yl, 3-bromo-2-fluoropropyl and 1,4,4-trifluorobutan-2-yl.
- C 1 -C 6 haloalkoxyl means a C 1 -C 6 alkoxyl group as defined herein substituted with one or more halo radicals.
- Examples of C 1 -C 6 haloalkoxyl groups include, without limitations, trifluoromethoxy, difluoromethoxy, fluoromethoxy, trichloromethoxy, 1,1- difluoroethoxy, 2,2-difluoroethoxy, 2,2,2-trifluoroethoxy, 1-fluoromethyl-2-fluoroethoxy, pentafluoroethoxy, 2-fluoropropoxy, 3,3-difluoropropoxy and 3-dibromopropoxy.
- the one or more halo radicals of C 1 -C 6 haloalkoxyl is fluoro.
- C 1 -C 6 haloalkoxyl may be selected from trifluoromethoxy, difluoromethoxy, fluoromethoxy, 1,1-difluoroethoxy, 2,2- difluoroethoxy, 2,2,2-trifluoroethoxy, 1-fluoromethyl-2-fluoroethoxy, and pentafluoroethoxy.
- halo means fluorine, chlorine, bromine or iodine.
- cycloalkyl means a monocyclic or polycyclic saturated or partially unsaturated carbon ring containing 3-18 carbon atoms wherein there are no delocalized pi electrons (aromaticity) shared among the ring carbon.
- C 3 -C 11 cycloalkyl means a monocyclic or polycyclic saturated or partially unsaturated carbon ring containing 3-18 carbon atoms wherein there are no delocalized pi electrons (aromaticity) shared among the ring carbon.
- C 3 -C 11 cycloalkyl C 3 - C 8 cycloalkyl
- C 3 -C 6 cycloalkyl are to be construed accordingly.
- polycyclic encompasses bridged (e.g., norbomane), fused (e.g., decalin) and spirocyclic cycloalkyl.
- cycloalkyl e.g., "C 3 -C 11 cycloalkyl” and “C 3 -C 8 cycloalkyl"
- cycloalkyl is a monocyclic or spirocyclic hydrocarbon group of 3 to 11 and 3 to 8 carbon atoms, respectively.
- cycloalkyl groups include, without limitations, cyclopropenyl, cyclopropyl cyclobutyl, cyclobutenyl, cyclopentyl, cyclohexyl, cycloheptanyl, cyclooctanyl, norboranyl, norborenyl, spiro[2.3]hexanyl, spiro[3.3]heptyl, spiro[3.4]octanyl, spiro[2.5]octanyl, spiro[3.5]nonanyl, spiro[4.5]decanyl, spiro[5.5]undecanyl, spiro[4.4]nonanyl, bicyclo[2.2.2]octanyl, bicyclo[2.2.2]octenyl, bicyclo[1.1.1]pentanyl and derivatives thereof.
- C 3 -C 11 cycloalkyl examples include, without limitations, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, spiro[2.3]hexanyl, spiro[3.3]heptyl, spiro[3.4]octanyl, spiro[2.5]octanyl, spiro[3.5]nonanyl, spiro[4.5]decanyl, spiro[5.5]undecanyl, spiro[4.4]nonanyl, bicyclo[1.1.1]pentyl, bicyclo[2.1.1]hexyl, bicyclo[2.1.1]heptyl, bicyclo[2.2.2]octyl, and bicyclo[1.1.1]pentanyl.
- C 3 -C 8 cycloalkyl examples include, without limitations, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, spiro[3.3]heptanyl, and cyclooctyl.
- Examples of C 3 -C 6 cycloalkyl include, without limitations, cyclopropyl, cyclobutyl, cyclopentyl, and cyclohexyl.
- Heterocyclyl means a saturated or partially saturated monocyclic or polycyclic ring containing carbon and at least one heteroatom selected from oxygen, nitrogen, and sulfur (O, N, and S) and wherein there are no delocalized pi electrons (aromaticity) shared among the ring carbon or heteroatoms.
- the terms "4- to 11-membered heterocyclyl” and “4- to 6-membered heterocyclyl” are to be construed accordingly.
- the heterocyclyl ring structure may be substituted by one or more substituents. The substituents can themselves be optionally substituted.
- the heterocyclyl may be bonded via a carbon atom or heteroatom.
- polycyclic encompasses bridged, fused and spirocyclic heterocyclyl.
- heterocyclyl rings include, without limitations, oxetanyl, azetidinyl, tetrahydrofuranyl, tetrahydropyranyl, pyrrolidinyl, oxazolinyl, isoxazolinyl, oxazolidinyl, thiazolidinyl, pyranyl, thiopyranyl, tetrahydropyranyl, dioxalinyl, piperidinyl, morpholinyl, thiomorpholinyl, thiomorpholinyl S-oxide, thiomorpholinyl S-dioxide, piperazinyl, azepinyl, oxepinyl, diazepinyl, tropanyl, oxazolidinonyl, 1,4-dioxanyl, dihydrofuranyl, 1,3-
- Examples of 4- to 11-membered heterocyclyl include, without limitations, azetidinyl, pyrrolidinyl, tetrahydrofuranyl, tetrahydrothienyl, piperidinyl, piperazinyl, dihydroisoxazolinyl, tetrahydropyranyl, morpholinyl, dihydropyranyl (e.g., 3,6-dihydro-2H-pyranyl) 2- oxaspiro[3.3]heptanyl (e.g., 2-oxaspiro[3.3]heptan-6-yl), 7-oxaspiro[3.5]nonanyl (e.g., 7- oxaspiro[3.5]nonan-2-yl), 1-oxa-7-azaspiro[3.5]nonanyl, 2-azaspiro[3.3]heptanyl (e.g., 2- azaspiro[3.3]heptanyl),
- Examples of of 4- to 6-membered heterocyclyl include, without limitations, azetidinyl, pyrrolidinyl, tetrahydrofuranyl, tetrahydrothienyl, piperidinyl, piperazinyl, dihydroisoxazolinyl, tetrahydropyranyl, morpholinyl, dihydropyranyl (e.g., 3,6-dihydro-2H-pyranyl).
- aryl as used herein means monocyclic, bicyclic or polycyclic carbocyclic aromatic rings.
- aryl examples include, but are not limited to, phenyl, naphthyl (e.g., naphth-1-yl, naphth-2-yl), anthryl (e.g., anthr-1-yl, anthr-9-yl), phenanthryl (e.g., phenanthr-1-yl, phenanthr-9-yl), and the like.
- Aryl is also intended to include monocyclic, bicyclic or polycyclic carbocyclic aromatic rings substituted with carbocyclic aromatic rings.
- aryl examples include, without limitations, biphenyl (e.g., biphenyl-2-yl, biphenyl-3-yl, biphenyl-4-yl), phenylnaphthyl (e.g., 1-phenylnaphth-2-yl, 2-phenylnaphth-1-yl), and the like.
- Aryl is also intended to include partially saturated bicyclic or polycyclic carbocyclic rings with at least one unsaturated moiety (e.g., a benzo moiety).
- Examples include, without limitations, indanyl (e.g., indan-1-yl, indan-5- yl), indenyl (e.g., inden-1-yl, inden-5-yl), 1,2,3,4-tetrahydronaphthyl (e.g., 1,2,3,4- tetrahydronaphth-1-yl, 1,2,3,4-tetrahydronaphth-2-yl, 1,2,3,4-tetrahydronaphth-6-yl), 1,2- dihydronaphthyl (e.g., 1,2-dihydronaphth-1-yl, 1,2-dihydronaphth-4-yl, 1,2-dihydronaphth-6-yl), fluorenyl (e.g., fluoren-1-yl, fluoren-4-yl, fluoren-9-yl), and the like.
- indanyl e.g., indan-1-yl
- Aryl is also intended to include partially saturated bicyclic or polycyclic carbocyclic aromatic rings containing one or two bridges.
- Examples include, without limitations, benzonorbornyl (e.g., benzonorborn-3-yl, benzonorborn-6- yl), 1,4-ethano-1,2,3,4-tetrahydronapthyl (e.g., 1,4-ethano-1,2,3,4-tetrahydronapth-2-yl, 1,4- ethano-1,2,3,4-tetrahydronapth-10-yl), and the like.
- the term "C 6 -C 10 aryl" is to be construed accordingly.
- C 6 -C 10 aryl examples include, without limitations, phenyl and naphthyl. In an embodiment, C 6 -C 10 aryl is phenyl.
- heteroaryl as used herein is intended to include monocyclic heterocyclic aromatic rings containing one or more heteroatoms selected from oxygen, nitrogen, and sulfur (O, N, and S).
- Examples include, without limitations, pyrrolyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyrazolyl, isothiazolyl, isooxazolyl, triazolyl, (e.g., 1,2,4-triazolyl), oxadiazolyl, (e.g., 1,2,3-oxadiazolyl, 1,2,4-oxadiazolyl, 1,2,5-oxadiazolyl, 1,3,4-oxadiazolyl), thiadiazolyl (e.g., 1,2,3-thiadiazolyl, 1,2,4-thiadiazolyl, 1,2,5-thiadiazolyl, 1,3,4-thiadiazolyl), tetrazolyl, pyranyl, pyridinyl, pyridazinyl, pyrimidinyl, pyrazinyl, 1,2,3-triazinyl, 1,2,4-triazinyl
- Heteroaryl is also intended to include bicyclic heterocyclic aromatic rings containing one or more heteroatoms selected from oxygen, nitrogen, and sulfur (O, N, and S).
- examples include, without limitations, indolyl, isoindolyl, benzofuranyl, benzothiophenyl, indazolyl, benzopyranyl, benzimidazolyl, benzothiazolyl, benzisothiazolyl, benzoxazolyl, benzisoxazolyl, benzoxazinyl, benzotriazolyl, naphthyridinyl, phthalazinyl, pteridinyl, purinyl, quinazolinyl, cinnolinyl, quinolinyl, isoquinolinyl, quinoxalinyl, oxazolopyridinyl, isooxazolopyridinyl, pyrrolopyridinyl, furopyridinyl, thi
- Heteroaryl is also intended to include polycyclic heterocyclic aromatic rings containing one or more heteroatoms selected from oxygen, nitrogen, and sulfur (O, N, and S). Examples include, without limitations, carbazolyl, phenoxazinyl, phenazinyl, acridinyl, phenothiazinyl, carbolinyl, phenanthrolinyl, and the like. Heteroaryl is also intended to include partially saturated monocyclic, bicyclic or polycyclic heterocyclyls containing one or more heteroatoms selected oxygen, nitrogen, and sulfur (O, N, and S).
- Examples include, without limitations, imidazolinyl, indolinyl, dihydrobenzofuranyl, dihydrobenzothienyl, dihydrobenzopyranyl, dihydropyridooxazinyl, dihydrobenzodioxinyl (e.g., 2,3-dihydrobenzo[b][1,4]dioxinyl), benzodioxolyl (e.g., benzo[d][1,3]dioxole), dihydrobenzooxazinyl (e.g., 3,4-dihydro-2H-benzo[b][1,4]oxazine), tetrahydroindazolyl, tetrahydrobenzimidazolyl, tetrahydroimidazo[4,5-c]pyridyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, tetrahydroquinox
- the heteroaryl ring structure may be substituted by one or more substituents.
- the substituents can themselves be optionally substituted.
- the heteroaryl ring may be bonded via a carbon atom or heteroatom.
- the term “5-10 membered heteroaryl” is to be construed accordingly.
- Examples of 5-10 membered heteroaryl include, without limitations, indolyl, imidazopyridyl, isoquinolinyl, benzooxazolonyl, pyridinyl, pyrimidinyl, pyridinonyl, benzotriazolyl, pyridazinyl, pyrazolotriazinyl, indazolyl, benzimidazolyl, quinolinyl, triazolyl, (e.g., 1,2,4-triazolyl), pyrazolyl, thiazolyl, oxazolyl, isooxazolyl, pyrrolyl, oxadiazolyl, (e.g., 1,2,3-oxadiazolyl, 1,2,4- oxadiazolyl, 1,2,5-oxadiazolyl, 1,3,4-oxadiazolyl), imidazolyl, pyrrolopyridinyl, tetrahydroindazo
- Cyano or “–CN” means a substituent having a carbon atom joined to a nitrogen atom by a triple bond, e.g., –C ⁇ N.
- C 1 -C 3 alkylene refers to a straight or branched hydrocarbon chain bivalent radical consisting solely of carbon and hydrogen atoms, containing no unsaturation, having from one to three carbon atoms.
- C 1 -C 2 alkylene is to be construed accordingly.
- the term “optionally substituted” includes unsubstituted or substituted.
- the term nitrogen protecting group (abbreviated as PG) in a compound of formula (X) or (Y) or any intermediates in any of the General schemes 1 to 4 and subformulae thereof refers to a group that should protect the functional groups, concerned e.g., amino groups, against unwanted secondary reactions, such as acylations, etherifications, esterifications, oxidations, solvolysis and similar reactions. It may be removed under deprotection conditions. Depending on the protecting group employed, the skilled person would know how to remove the protecting group to obtain the free amine NH 2 group by reference to known procedures. These include reference to organic chemistry textbooks and literature procedures such as J. F. W.
- Preferred nitrogen protecting groups generally comprise: C 1 -C 6 alkyl (e.g., tert-butyl), preferably C 1 -C 4 alkyl, more preferably C 1 -C 2 alkyl, most preferably C 1 alkyl which is mono-, di- or tri-substituted by trialkylsilyl-C 1 -C 7 alkoxy (e.g., trimethylsilyethoxy), aryl, preferably phenyl, or a heterocyclic group (e.g., benzyl, cumyl, benzhydryl, pyrrolidinyl, trityl, pyrrolidinylmethyl, 1-methyl- 1,1-dimethylbenzyl, (phenyl)methylbenzene) wherein the aryl ring or the heterocyclic group is unsubstituted or substituted by one or more, e.g., two or three, residues, e.g., selected from the group consisting of C 1 -
- the preferred nitrogen protecting group (PG) can be selected from the group comprising tert-butyloxycarbonyl (Boc), benzyloxycarbonyl (Cbz), para-methoxy benzyl (PMB), methyloxycarbonyl, trimethylsilylethoxymethyl (SEM) and benzyl.
- the nitrogen protecting group (PG) is preferably tert-butyloxycarbonyl (Boc) or trimethylsilylethoxymethyl (SEM).
- the compounds of the disclosure are selective over other proteins.
- the term “therapeutic agent” in connection with methods of reducing WIZ protein expression levels and/or inducing fetal hemoglobin (HbF) expression refers to a substance that results in a detectably lower expression of WIZ gene or WIZ protein or lower activity level of WIZ proteins as compared to those levels without such substance.
- “modulator” or “degrader” means, for example, a compound of the disclosure, that effectively modulates, decreases, or reduces the levels of a specific protein (e.g., WIZ) or degrades a specific protein (e.g., WIZ).
- the amount of a specific protein (e.g., WIZ) degraded can be measured by comparing the amount of the specific protein (e.g., WIZ) remaining after treatment with a compound of the disclosure as compared to the initial amount or level of the specific protein (e.g., WIZ) present as measured prior to treatment with a compound of the disclosure.
- selective modulator means, for example, a compound of the disclosure, that effectively modulates, decreases, or reduces the levels of a specific protein (e.g., WIZ) or degrades a specific protein (e.g., WIZ) to a greater extent than any other protein.
- a “selective modulator”, “selective degrader”, or “selective compound” can be identified, for example, by comparing the ability of a compound to modulate, decrease, or reduce the levels of or to degrade a specific protein (e.g., WIZ) to its ability to modulate, decrease, or reduce the levels of or to degrade other proteins.
- the selectivity can be identified by measuring the EC 50 or IC 50 of the compounds. Degradation may be achieved through mediation of an E3 ligase, e.g., E3-ligase complexes comprising the protein Cereblon.
- the specific protein degraded is WIZ protein.
- At least about 30% of WIZ is degraded compared to initial levels. In an embodiment, at least about 40% of WIZ is degraded compared to initial levels. In an embodiment, at least about 50% of WIZ is degraded compared to initial levels. In an embodiment, at least about 60% of WIZ is degraded compared to initial levels. In an embodiment, at least about 70% of WIZ is degraded compared to initial levels. In an embodiment, at least about 75% of WIZ is degraded compared to initial levels. In an embodiment, at least about 80% of WIZ is degraded compared to initial levels. In an embodiment, at least about 85% of WIZ is degraded compared to initial levels. In an embodiment, at least about 90% of WIZ is degraded compared to initial levels.
- WIZ is degraded compared to initial levels. In an embodiment, over 95% of WIZ is degraded compared to initial levels. In an embodiment, at least about 99% of WIZ is degraded compared to initial levels. In an embodiment, the WIZ is degraded in an amount of from about 30% to about 99% compared to initial levels. In an embodiment, the WIZ is degraded in an amount of from about 40% to about 99% compared to initial levels. In an embodiment, the WIZ is degraded in an amount of from about 50% to about 99% compared to initial levels. In an embodiment, the WIZ is degraded in an amount of from about 60% to about 99% compared to initial levels.
- the WIZ is degraded in an amount of from about 70% to about 99% compared to initial levels. In an embodiment, the WIZ is degraded in an amount of from about 80% to about 99% compared to initial levels. In an embodiment, the WIZ is degraded in an amount of from about 90% to about 99% compared to initial levels. In an embodiment, the WIZ is degraded in an amount of from about 95% to about 99% compared to initial levels. In an embodiment, the WIZ is degraded in an amount of from about 90% to about 95% compared to initial levels.
- the terms “inducing fetal hemoglobin”, “fetal hemoglobin induction”, or “increasing fetal hemoglobin expression” refer to increasing the percentage of HbF in the blood of a subject. In an embodiment, the amount of total HbF in the blood of the subject increases. In an embodiment, the amount of total hemoglobin in the blood of the subject increases.
- the amount of HbF is increased by at least about 10%, or at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or at least about 100%, or more than 100%, for example, at least about 2-fold, or at least about 3-fold, or at least about 4-fold, or at least about 5-fold, or at least about 6-fold, or at least about 7-fold, or at least about 8-fold, or at least about 9-fold, or at least about 10-fold, or more than 10-fold as compared to either in the absence of a compound disclosed herein.
- the total hemoglobin in the blood is increased by at least about 10%, or at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or at least about 100%, or more than 100%, for example, at least about 2- fold, or at least about 3-fold, or at least about 4-fold, or at least about 5-fold, or at least about 6- fold, or at least about 7-fold, or at least about 8-fold, or at least about 9-fold, or at least about 10- fold, or more than 10-fold as compared to either in the absence of a compound disclosed herein.
- a therapeutically effective amount of a compound of the disclosure refers to an amount of the compound of the disclosure that will elicit the biological or medical response of a subject, for example, reduction or inhibition of an enzyme or a protein activity, or ameliorate symptoms, alleviate conditions, slow or delay disease progression, or prevent a disease, etc.
- a therapeutically effective amount refers to the amount of the compound of the disclosure that, when administered to a subject, is effective to (1) at least partially alleviate, prevent and/or ameliorate a condition, or a disorder or a disease (i) mediated by WIZ, or (ii) associated with WIZ activity, or (iii) characterized by activity (normal or abnormal) of WIZ: (2) reduce or inhibit the activity of WIZ; or (3) reduce or inhibit the expression of WIZ.
- a therapeutically effective amount refers to the amount of the compound of the disclosure that, when administered to a cell, or a tissue, or a non-cellular biological material, or a medium, is effective to at least partially reducing or inhibiting the activity of WIZ; or at least partially reducing or inhibiting the expression of WIZ.
- HbF-dependent disease or disorder means any disease or disorder which is directly or indirectly affected by the modulation of HbF protein levels.
- subject refers to primates (e.g., humans, male or female), dogs, rabbits, guinea pigs, pigs, rats and mice. In certain embodiments, the subject is a primate. In yet other embodiments, the subject is a human.
- the term “inhibit”, “inhibition” or “inhibiting” refers to the reduction or suppression of a given condition, symptom, or disorder, or disease, or a significant decrease in the baseline activity of a biological activity or process.
- the term “treat”, “treating” or “treatment” of any disease or disorder refers to alleviating or ameliorating the disease or disorder (i.e., slowing or arresting the development of the disease or at least one of the clinical symptoms thereof); or alleviating or ameliorating at least one physical parameter or biomarker associated with the disease or disorder, including those which may not be discernible to the patient.
- the term “prevent”, “preventing” or “prevention” of any disease or disorder refers to the prophylactic treatment of the disease or disorder; or delaying the onset or progression of the disease or disorder
- a subject is “in need of” a treatment if such subject would benefit biologically, medically or in quality of life from such treatment.
- the term “a,” “an,” “the” and similar terms used in the context of the disclosure are to be construed to cover both the singular and plural unless otherwise indicated herein or clearly contradicted by the context.
- Various enumerated embodiments of the disclosure are described herein.
- each R 1 is independently selected from hydrogen, C 1 -C 6 alkyl, hydroxyl, halo, C 1 - C 6 haloalkyl, C 1 -C 6 haloalkoxyl, and C 1 -C 6 alkoxyl; or 2 R 1 on the same carbon atom together with the same carbon atom to which they are attached form a C 3 -C 8 cycloalkyl; or 2 R 1 on adjacent carbon atoms together with the adjacent carbon atoms to which they are attached form a C 3 - C 8 cycloalkyl; or 2 R 1 on non-adjacent carbon atoms together with the non-adjacent carbon atoms to which they
- each R 1 is independently selected from hydrogen, C 1 -C 6 alkyl, hydroxyl, halo, C 1 - C 6 haloalkyl, C 1 -C 6 haloalkoxyl, and C 1 -C 6 alkoxyl; or 2 R 1 on the same carbon atom together with the same carbon atom to which they are attached form a C 3 -C 8 cycloalkyl; or 2 R 1 on adjacent carbon atoms together with the adjacent carbon atoms to which they are attached form a C 3 - C 8 cycloalkyl; or 2 R 1 on non-adjacent carbon atoms together with the non-adjacent carbon atoms to which they are attached form a bridging ring; R 2 is selected from hydrogen, C 3 -C 11 cycloalkyl, 4- to 11-
- each R 1 is independently selected from hydrogen, C 1 -C 6 alkyl, hydroxyl, halo, C 1 - C 6 haloalkyl, C 1 -C 6 haloalkoxyl, and C 1 -C 6 alkoxyl; or 2 R 1 on the same carbon atom together with the same carbon atom to which they are attached form a C 3 -C 8 cycloalkyl; or 2 R 1 on adjacent carbon atoms together with the adjacent carbon atoms to which they are attached form a C 3 - C 8 cycloalkyl; or 2 R 1 on non-adjacent carbon atoms together with the non-adjacent carbon atoms to which they are attached form a bridging ring; R 2 is selected from hydrogen, C 3 -C 11 cycloalkyl, 4- to 11-
- Embodiment 4 The compound of formula (I'), (I") or (I) according to any one of the preceding Embodiments, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, wherein m is 1 or 2.
- R 2 is selected from C 3 -C 11 cycloalkyl, 4- to 11- membered heterocyclyl comprising 1-2 heteroatoms independently selected from N, O, and S, C 1 -C 6 haloalkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, and C 1 -C 10 alkyl, wherein the C 3 -C 11 cycloalkyl, 4- to 11-membered heterocyclyl, C 2 -C 6 alkynyl, and C 1 -C 10 alkyl are each independently substituted with 0-5, e.g., 0-4, 0-3, 0-2, 0-1, occurrences of R 3 .
- Embodiment 6 The compound of formula (I'), (I") or (I) according to any one of the preceding Embodiments, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, wherein formula (I) is formula (IA): (IA).
- Embodiment 7. The compound of formula (I'), (I") or (I) according to any one of Embodiments 1 to 5, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, wherein formula (I) is formula (IB): (IB).
- each R 1 is independently selected from hydrogen, C 1 -C 6 alkyl, hydroxyl, halo, C 1 - C 6 haloalkyl, C 1 -C 6 haloalkoxyl, and C 1 -C 6 alkoxyl; or 2 R 1 on the same carbon atom together with the same carbon atom to which they are attached form a C 3 -C 8 cycloalkyl; or 2 R 1 on adjacent carbon atoms together with the adjacent carbon atoms to which they are attached form a C 3 - C 8 cycloalkyl; or 2 R 1 on non-adjacent carbon atoms together with the non-adjacent carbon atoms to which they are attached form a bridging ring; R 2 is selected from
- Embodiment 15 The compound of formula (I'), (I") or (I) according to any one of Embodiments 1, 2, 3, and 5 to 14, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, wherein: each R 1 is independently selected from hydrogen, C 1 -C 6 alkyl, hydroxyl, halo, and C 1 - C 6 alkoxyl; or 2 R 1 on the same carbon atom together with the same carbon atom to which they are attached form a C 3 -C 6 cycloalkyl; or 2 R 1 on adjacent carbon atoms together with the adjacent carbon atoms to which they are attached form a C 3 -C 6 cycloalkyl; or 2 R 1 on non-adjacent carbon atoms together with the non-adjacent carbon atoms to which they are attached form a C 1 -C 3 alkylene bridging ring; R 2 is selected from hydrogen, C 3 -C 11 cycloal
- Embodiment 16 The compound of formula (I'), (I") or (I) according to any one of the preceding Embodiments, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, wherein: each R 1 is independently selected from hydrogen, C 1 -C 6 alkyl, hydroxyl, fluoro, and C 1 - C 6 alkoxyl; or 2 R 1 on the same carbon atom together with the same carbon atom to which they are attached form a C 3 -C 6 cycloalkyl; or 2 R 1 on adjacent carbon atoms together with the adjacent carbon atoms to which they are attached form a C 3 -C 6 cycloalkyl; or 2 R 1 on non-adjacent carbon atoms together with the non-adjacent carbon atoms to which they are attached form a C 1 -C 2 alkylene bridging ring; R 2 is selected from hydrogen, C 3 -C 11 cycloalkyl,
- Embodiment 17 The compound of formula (I'), (I") or (I) according to any one of the preceding Embodiments, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, wherein: each R 1 is independently selected from hydrogen, C 1 -C 6 alkyl, hydroxyl, fluoro, and C 1 - C 6 alkoxyl; or 2 R 1 on the same carbon atom together with the same carbon atom to which they are attached form a C 3 -C 6 cycloalkyl; R 2 is selected from C 3 -C 8 cycloalkyl, 4- to 6-membered heterocyclyl comprising 1-2 heteroatoms independently selected from N, O, and S, C 2 -C 6 alkynyl, and C 1 -C 6 alkyl, wherein the C 3 -C 8 cycloalkyl is substituted with 0-3 occurrences of R 3 , wherein the C 1 -C 6 alkyl
- Embodiment 18 The compound of formula (I'), (I") or (I) according to any one of the preceding Embodiments, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, wherein R 2 is unsubstituted C 1 -C 6 alkyl, or –(CH 2 )-R 3 , wherein R 3 is defined according to any one of the preceding Embodiments.
- Embodiment 19 19.
- formula (I) is formula (I-i), wherein: (I-i) R 1a is independently selected from hydrogen and C 1 -C 6 alkyl; R 1b is independently selected from hydrogen and C 1 -C 6 alkyl; or R 1a and R 1b on the same carbon atom together with the same carbon atom to which they are attached form a C 3 -C 6 cycloalkyl; R 1c is independently selected from hydrogen and C 1 -C 6 alkyl; R 1d is independently selected from hydrogen, C 1 -C 6 alkyl, and C 1 -C 6 alkoxyl; or R 1c and R 1d on the same carbon atom together with the same carbon atom to which they are attached form a C 3 -C 6 cycloalkyl;
- Embodiment 27 The compound of formula (I'), (I") or (I) according to any one of Embodiments 1 to 6, and 14 to 26, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, wherein formula (I) is formula (IA-i), wherein: (IA-i) R 1a is independently selected from hydrogen and C 1 -C 6 alkyl; R 1b is independently selected from hydrogen and C 1 -C 6 alkyl; or R 1a and R 1b on the same carbon atom together with the same carbon atom to which they are attached form a C 3 -C 6 cycloalkyl; R 1c is independently selected from hydrogen and C 1 -C 6 alkyl; R 1d is independently selected from hydrogen, C 1 -C 6 alkyl, and C 1 -C 6 alkoxyl; or R 1c and R 1d on the same carbon atom together with the same carbon atom to which they are attached form a C 3 -C
- Embodiment 28 The compound of formula (I'), (I") or (I) according to any one of Embodiments 1 to 6, 8, 10, and 14 to 27, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, wherein formula (I) is formula (IA-ii): Embodiment 29.
- formula (I) is formula (IB-i), wherein: R 1a is independently selected from hydrogen and C 1 -C 6 alkyl; R 1b is independently selected from hydrogen and C 1 -C 6 alkyl; or R 1a and R 1b on the same carbon atom together with the same carbon atom to which they are attached form a C 3 -C 6 cycloalkyl; R 1c is independently selected from hydrogen and C 1 -C 6 alkyl; R 1d is independently selected from hydrogen, C 1 -C 6 alkyl, and C 1 -C 6 alkoxyl; or R 1c and R 1d on the same carbon atom together with the same carbon atom to which they are attached form a C 3 -C 6 cycloalkyl; R 1e
- Embodiment 31 The compound of formula (I'), (I") or (I) according to any one of Embodiments 1 to 5, 7, 8, 11, 14 to 26, and 30, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, wherein formula (I) is formula (IB-ii): (IB-ii).
- Embodiment 32 The compound of formula (I'), (I") or (I) according to any one of Embodiments 1 to 5, 7, 9, 13, 14 to 26, and 30, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, wherein formula (I) is formula (IB-iii): (IB-iii).
- Embodiment 33 The compound of formula (I'), (I") or (I) according to any one of Embodiments 26 to 32, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, wherein R 1a and R 1b are both hydrogen.
- Embodiment 34 The compound of formula (I'), (I") or (I) according to any one of Embodiments 26 to 33, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, wherein R 1e is C 1 -C 6 alkyl, and R 1a , R 1b , R 1c , and R 1d are all hydrogen.
- Embodiment 35 The compound of formula (I'), (I") or (I) according to any one of Embodiments 26 to 32, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, wherein R 1a
- R 1c and R 1d are each independently selected from hydrogen, C 1 -C 6 alkyl and C 1 -C 6 alkoxyl, e.g., R 1c is hydrogen and R 1d is C 1 -C 6 alkyl or C 1 -C 6 alkoxyl, or R 1c and R 1d on the same carbon atom together with the same carbon atom to which they are attached form a C 3 -C 6 cycloalkyl, and R 1a , R 1b , and R 1e are all hydrogen.
- Embodiment 37 The compound of formula (I'), (I") or (I) according to any one of the preceding Embodiments, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, wherein each R 3 is independently selected from 4- to 11- membered heterocyclyl comprising 1-2 heteroatoms independently selected from N, O, and S, C 3 -C 8 cycloalkyl, and halo, wherein the 4- to 11-membered heterocyclyl, and C 3 -C 8 cycloalkyl are each independently substituted with 0-2 occurrences of R 4 , wherein each R 4 is independently selected from C 1 -C 6 alkyl, C 1 -C 6 alkoxyl, halo, and C 3 -C 8 cycloalkyl.
- Embodiment 38 The compound of formula (I'), (I") or (I) according to any one of the preceding Embodiments, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, wherein each R 4 is independently selected from C 1 -C 6 alkyl, and fluoro.
- Embodiment 39 The compound according to any of the preceding Embodiments, wherein the glutarimide moiety of the compound of formula (I'), (I") or (I) is .
- Embodiment 40 The compound according to any of the preceding Embodiments, wherein the glutarimide moiety of the compound of formula (I'), (I") or (I) is .
- Embodiment 41 The compound according to any of the preceding Embodiments, wherein the glutarimide moiety of the compound of formula (I'), (I") or (I) is .
- Embodiment 42 The compound of formula (I'), (I") or (I) according to any one of Embodiments 1 to 3, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, selected from:
- Embodiment 43 A compound of formula (I'), (I") or (I) according to any one of Embodiments 1 to 3 and 42, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, wherein the absolute configuration at the glutarimide stereocentre is S.
- Embodiment 44 A compound of formula (I'), (I") or (I) according to any one of Embodiments 1 to 3 and 42, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, wherein the absolute configuration at the glutarimide stereocentre is R.
- Embodiment 45 A compound of formula (I'), (I") or (I) according to any one of Embodiments 1 to 3 and 42, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, wherein the absolute configuration at the glutarimide stereocentre is R.
- Embodiment 46 A pharmaceutical composition comprising a therapeutically effective amount of a compound according to any one of the preceding Embodiments, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, and a pharmaceutically acceptable carrier or excipient.
- Embodiment 47 A method of treating or preventing a disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound according to any one of Embodiments 1 to 45, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- Embodiment 48 A pharmaceutical composition comprising a therapeutically effective amount of a compound according to any one of the preceding Embodiments, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- a method of degrading WIZ protein in a subject in need thereof comprising administering to the subject a therapeutically effective amount of a compound according to any one of Embodiments 1 to 45, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- Embodiment 49 A method of inhibiting WIZ protein expression in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound according to any one of Embodiments 1 to 45, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- Embodiment 50 Embodiment 50.
- a method of inhibiting, reducing, or eliminating the activity of WIZ protein or WIZ protein expression comprising administering to the subject a compound according to any one of Embodiments 1 to 45, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- Embodiment 51 A method of inducing or promoting fetal hemoglobin in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound according to any one of Embodiments 1 to 45, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- Embodiment 52 A method of inhibiting, reducing, or eliminating the activity of WIZ protein or WIZ protein expression, the method comprising administering to the subject a compound according to any one of Embodiments 1 to 45, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof
- a method of reactivating fetal hemoglobin production or expression in a subject in need thereof comprising administering to the subject a therapeutically effective amount of a compound according to any one of Embodiments 1 to 45, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- Embodiment 53 A method of increasing fetal hemoglobin expression in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound according to any one of Embodiments 1 to 45, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- Embodiment 54 A method of reactivating fetal hemoglobin production or expression in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound according to any one of Embodiments 1 to 45, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug
- Embodiment 55 A method of treating a sickle cell disease in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound according to any one of Embodiments 1 to 45, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- Embodiment 56 A method of treating a hemoglobinopathy, e.g., a beta-hemoglobinopathy, in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound according to any one of Embodi
- a method of treating beta-thalassemia in a subject in need thereof comprising administering to the subject a therapeutically effective amount of a compound according to any one of Embodiments 1 to 45, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- Embodiment 57 A method of treating a disease or disorder that is affected by the modulation of WIZ protein levels comprising administering to the patient in need thereof a compound according to any one of Embodiments 1 to 45, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- Embodiment 58 A method of treating beta-thalassemia in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound according to any one of Embodiments 1 to 45, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- Embodiment 59. A method for reducing WIZ protein levels in a subject comprising the step of administering to a subject in need thereof a therapeutically effective amount of a compound according to any one of Embodiments 1 to 45, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- Embodiment 60 A method of treating or preventing a disorder that is affected by the reduction of WIZ protein levels, in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound according to any one of Embodiments 1 to 45, or a
- Embodiment 70 Embodiment 70.
- Embodiment 74 Embodiment 74.
- Embodiment 75 Use of a compound according to any one of Embodiments 1 to 45, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, in the manufacture of a medicament for treating a disease or disorder that is affected by inducing or promoting fetal hemoglobin.
- Embodiment 75 Use of a compound according to any one of Embodiments 1 to 45, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, in the manufacture of a medicament for treating a disease or disorder that is affected by reactivating fetal hemoglobin production or expression.
- Embodiment 76 Use of a compound according to any one of Embodiments 1 to 45, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, in the manufacture of a medicament for treating a disease or disorder that is affected by reactivating feta
- Embodiment 77 Use of a compound according to any one of Embodiments 1 to 45, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, in the manufacture of a medicament for treating a disease or disorder that is affected by increasing fetal hemoglobin expression.
- Embodiment 77 The use according to any one of Embodiments 73 to 76, wherein the disease or disorder is selected from sickle cell disease and beta-thalassemia.
- Embodiment 78 Use of a compound according to any one of Embodiments 1 to 45, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, in the manufacture of a medicament for treating a disease or disorder that is affected by increasing fetal hemoglobin expression.
- Embodiment 77 The use according to any one of Embodiments 73 to 76, wherein the disease or disorder is selected from sickle cell disease and beta-th
- Embodiment 80 Use of a compound according to any one of Embodiments 1 to 45, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, in the manufacture of a medicament for treating a disease or disorder that is affected by the reduction of WIZ protein levels, inhibition of WIZ protein expression or degradation of WIZ protein.
- Embodiment 79 Use of a compound according to any one of Embodiments 1 to 45, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, in the manufacture of a medicament for treating a disease or disorder that is affected by inducing fetal hemoglobin.
- Embodiment 80 Use of a compound according to any one of Embodiments 1 to 45, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, in the manufacture of a medicament for treating a disease or disorder that is affected by induc
- Embodiment 81 Use of a compound according to any one of Embodiments 1 to 45, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, in the manufacture of a medicament for treating a disease or disorder that is affected by reactivating fetal hemoglobin production or expression.
- Embodiment 81 Use of a compound according to any one of Embodiments 1 to 45, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, in the manufacture of a medicament for treating a disease or disorder that is affected by increasing fetal hemoglobin expression.
- Embodiment 82 Use of a compound according to any one of Embodiments 1 to 45, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, in the manufacture of a medicament for treating a disease or disorder that is affected by increasing fetal hemoglobin expression
- Embodiment 84 Use of a compound according to any one of Embodiments 1 to 45, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, in the treatment of a disease or disorder that is affected by the reduction of WIZ protein levels, inhibition of WIZ protein expression or degradation of WIZ protein.
- Embodiment 84 Use of a compound according to any one of Embodiments 1 to 45, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, in the treatment of a disease or disorder that is affected by the reduction of WIZ protein levels, inhibition of WIZ protein expression or degradation of WIZ protein.
- Embodiment 85 The use according to any one of Embodiments 83 and 84, wherein the disease or disorder is selected from sickle cell disease and beta-thalassemia.
- Embodiment 86 The use according to any one of Embodiments 83 and 84, wherein the disease or disorder is selected from sickle cell disease and beta-thalassemia.
- a pharmaceutical combination comprising a compound according to any one of Embodiments 1 to 45, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, and one or more additional therapeutic agent(s).
- Embodiment 87 A pharmaceutical combination comprising a compound according to any one of Embodiments 1 to 45, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, and one or more additional therapeutic agent(s).
- each R 1 is independently selected from hydrogen, C 1 -C 6 alkyl, hydroxyl, halo, C 1 - C 6 haloalkyl, C 1 -C 6 haloalkoxyl, and C 1 -C 6 alkoxyl; or 2 R 1 on the same carbon atom together with the same carbon atom to which they are attached form a C 3 -C 8 cycloalkyl; or 2 R 1 on adjacent carbon atoms together with the adjacent carbon atoms to which they are attached form a C 3 - C 8 cycloalkyl; or 2 R 1 on non-adjacent carbon atoms together with the non-adjacent carbon atoms to which they are attached form a bridging ring (e.g., C 1 -C 3 alkylene bridging ring); R 2
- Embodiment 88 A compound of formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, for use in a method defined by any one of Embodiments 61 to 72, wherein the compound of formula (I) is defined according to Embodiment 87.
- Embodiment 89 A method as defined by any one of Embodiments 47 to 59, wherein the compound is defined according to Embodiment 87.
- Embodiment 90 A method as defined by any one of Embodiments 47 to 59, wherein the compound is defined according to Embodiment 87.
- a compound of formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof in a method as defined by any one of Embodiments 73 to 85, wherein the compound of formula (I) is defined according to Embodiment 87.
- the compounds can be present in the form of one of the possible isomers or as mixtures thereof, for example as pure optical isomers, or as isomer mixtures, such as racemates and diastereomeric mixtures, depending on the number of asymmetric centres.
- Optically active (R)- and (S)- isomers may be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques. If the compound contains a disubstituted or trisubstituted cycloalkyl, the cycloalkyl substituent(s) may have a cis- or trans-configuration.
- the disclosure includes cis and trans configurations of substituted cycloalkyl groups as well as mixtures thereof. All tautomeric forms are also intended to be included.
- salts refers to an acid addition or base addition salt of a compound of the disclosure. “Salts” include in particular “pharmaceutically acceptable salts”.
- pharmaceutically acceptable salts refers to salts that retain the biological effectiveness and properties of the compounds of this disclosure and, which typically are not biologically or otherwise undesirable.
- the compounds of the disclosure may be capable of forming acid and/or base salts by virtue of the presence of amino and/or carboxyl groups or groups similar thereto.
- Pharmaceutically acceptable acid addition salts can be formed with inorganic acids and organic acids.
- Inorganic acids from which salts can be derived include, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like.
- Organic acids from which salts can be derived include, for example, acetic acid, propionic acid, glycolic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, toluenesulfonic acid, sulfosalicylic acid, formic acid, trifluoroacetic acid, and the like.
- Pharmaceutically acceptable base addition salts can be formed with inorganic and organic bases.
- Inorganic bases from which salts can be derived include, for example, ammonium salts and metals from columns I to XII of the periodic table.
- the salts are derived from sodium, potassium, ammonium, calcium, magnesium, iron, silver, zinc, and copper; particularly suitable salts include ammonium, potassium, sodium, calcium and magnesium salts.
- Organic bases from which salts can be derived include, for example, primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines, basic ion exchange resins, and the like. Certain organic amines include isopropylamine, benzathine, cholinate, diethanolamine, diethylamine, lysine, meglumine, piperazine and tromethamine.
- the disclosure provides compounds in acetate, ascorbate, adipate, aspartate, benzoate, besylate, bromide/hydrobromide, bicarbonate/carbonate, bisulfate/sulfate, camphorsulfonate, caprate, chloride/hydrochloride, chlortheophyllonate, citrate, ethandisulfonate, fumarate, gluceptate, gluconate, glucuronate, glutamate, glutarate, glycolate, hippurate, hydroiodide/iodide, isethionate, lactate, lactobionate, laurylsulfate, malate, maleate, malonate, mandelate, mesylate, methylsulphate, mucate, naphthoate, napsylate, nicotinate, nitrate, octadecanoate, oleate, oxalate, palmitate, pamoate, phosphate/
- the disclosure provides compounds in sodium, potassium, ammonium, calcium, magnesium, iron, silver, zinc, copper, isopropylamine, benzathine, cholinate, diethanolamine, diethylamine, lysine, meglumine, piperazine or tromethamine salt form.
- pharmaceutically acceptable salts of compounds of formulae (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), and (ID-ii) are acid addition salts.
- Isotopically Labelled Compounds Any formula given herein is also intended to represent unlabeled forms as well as isotopically labeled forms of the compounds. lsotopically labeled compounds have structures depicted by the formulas given herein except that one or more atoms are replaced by an atom having a selected atomic mass or mass number.
- isotopes that can be incorporated into compounds of the disclosure include isotopes of hydrogen, carbon, nitrogen, oxygen, sulfur, fluorine, chlorine and iodine, such as 2 H, 3 H, 11 C, 13 C, 14 C, 18 O, 15 N, 18 F, 17 O, 18 O, 35 S, 36 Cl, 123 I, 124 I, 125 I respectively.
- the disclosure includes various isotopically labeled compounds as defined herein, for example those into which radioactive isotopes, such as 3 H and 14 C, or those into which non-radioactive isotopes, such as 2 H and 13 C are present.
- isotopically labelled compounds are useful in metabolic studies (with 14 C), reaction kinetic studies (with, for example 2 H or 3 H), detection or imaging techniques, such as positron emission tomography (PET) or single-photon emission computed tomography (SPECT) including drug or substrate tissue distribution assays, or in radioactive treatment of patients.
- PET positron emission tomography
- SPECT single-photon emission computed tomography
- an 18 F compound may be particularly desirable for PET or SPECT studies.
- Isotopically-labeled compounds of formulae (I'), (I"), (I), (I-i), (IA), (IA- i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), and (ID-ii) can generally be prepared by conventional techniques known to those skilled in the art or by processes analogous to those described in the accompanying Examples and General Schemes (e.g., General Schemes 5a and 5b) using an appropriate isotopically-labeled reagent in place of the non-labeled reagent previously employed.
- the hydrogens in the compound of formula (I'), (I") or (I) are present in their normal isotopic abundances.
- the hydrogens are isotopically enriched in deuterium (D), and in a particular embodiment of the invention the hydrogen(s) at the glutarimide portion in compounds of Formula (I) are enriched in D, for example,
- substitution with heavier isotopes, particularly deuterium (i.e., 2 H or D) may afford certain therapeutic advantages resulting from greater metabolic stability, for example increased in vivo half-life or reduced dosage requirements or an improvement in therapeutic index.
- deuterium in this context is regarded as a substituent of a compound of the formula ((I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii).
- concentration of such a heavier isotope, specifically deuterium may be defined by the isotopic enrichment factor.
- isotopic enrichment factor as used herein means the ratio between the isotopic abundance and the natural abundance of a specified isotope.
- a substituent in a compound of this disclosure is denoted deuterium, such compound has an isotopic enrichment factor for each designated deuterium atom of at least 3500 (52.5% deuterium incorporation at each designated deuterium atom), at least 4000 (60% deuterium incorporation), at least 4500 (67.5% deuterium incorporation), at least 5000 (75% deuterium incorporation), at least 5500 (82.5% deuterium incorporation), at least 6000 (90% deuterium incorporation), at least 6333.3 (95% deuterium incorporation), at least 6466.7 (97% deuterium incorporation), at least 6600 (99% deuterium incorporation), or at least 6633.3 (99.5% deuterium incorporation).
- Pharmaceutically acceptable solvates in accordance with the disclosure include those wherein the solvent of crystallization may be isotopically substituted, e.g., D 2 O, d 6 -acetone, d 6 - DMSO.
- Compounds of the disclosure e.g., compounds of formulae (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), and (ID-ii) that contain groups capable of acting as donors and/or acceptors for hydrogen bonds may be capable of forming co- crystals with suitable co-crystal formers.
- co-crystals may be prepared from compounds of formulae (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), and (ID-ii) by known co-crystal forming procedures.
- Such procedures include grinding, heating, co-subliming, co-melting, or contacting in solution compounds of formulae (I'), (I"), (I), (I- i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), and (ID-ii) with the co-crystal former under crystallization conditions and isolating co-crystals thereby formed.
- Suitable co-crystal formers include those described in WO 2004/078163.
- each asymmetric center is present in at least 10 % enantiomeric excess, at least 20 % enantiomeric excess, at least 30 % enantiomeric excess, at least 40 % enantiomeric excess, at least 50 % enantiomeric excess, at least 60 % enantiomeric excess, at least 70 % enantiomeric excess, at least 80 % enantiomeric excess, at least 90 % enantiomeric excess, at least 95 % enantiomeric excess, or at least 99 % enantiomeric excess.
- each asymmetric center is present in at least 50 % enantiomeric excess, at least 60 % enantiomeric excess, at least 70 % enantiomeric excess, at least 80 % enantiomeric excess, at least 90 % enantiomeric excess, at least 95 % enantiomeric excess, or at least 99 % enantiomeric excess.
- compounds of the disclosure can be present in a racemic mixture or in enantiomerically enriched form or in an enantiopure form or as a mixture of diastereoisomers.
- the term on a C-sp 3 indicates the absolute stereochemistry, either (R) or (S).
- the term on a C-sp 3 indicates the absolute stereochemistry, either (R) or (S).
- the term on a C-sp 3 represents a covalent bond wherein the stereochemistry of the bond is not defined. This means that the term " on a C-sp 3 comprises an (S) configuration or an (R) configuration of the respective chiral centre or a mixture thereof.
- mixtures of stereoisomers e.g., mixtures of enantiomers, such as racemates, and/or mixtures of diastereoisomers are encompassed by the present disclosure.
- a compound of the disclosure can be in the form of one of the possible stereoisomers, rotamers, atropisomers, tautomers or mixtures thereof, for example, as substantially pure geometric (cis or trans) stereoisomers, diastereomers, optical isomers, racemates or mixtures thereof.
- Any resulting mixtures of stereoisomers can be separated on the basis of the physicochemical differences of the constituents, into the pure or substantially pure geometric or optical isomers, diastereomers, racemates, for example, by chromatography and/or fractional crystallization.
- Any resulting racemates of compounds of the disclosure or of intermediates can be resolved into the optical isomers (enantiomers) by known methods, e.g., by separation of the diastereomeric salts thereof, obtained with an optically active acid or base, and liberating the optically active acidic or basic compound.
- a basic moiety may thus be employed to resolve the compounds of the disclosure into their optical antipodes, e.g., by fractional crystallization of a salt formed with an optically active acid, e.g., tartaric acid, dibenzoyl tartaric acid, diacetyl tartaric acid, di-O,O'-p-toluoyl tartaric acid, mandelic acid, malic acid or camphor- 10-sulfonic acid.
- Racemic compounds of the disclosure or racemic intermediates can also be resolved by chiral chromatography, e.g., high pressure liquid chromatography (HPLC) using a chiral adsorbent.
- the compounds of the disclosure can also be obtained in the form of their hydrates, or include other solvents used for their crystallization.
- the compounds of the disclosure may inherently or by design form solvates with pharmaceutically acceptable solvents (including water); therefore, it is intended that the disclosure embrace both solvated and unsolvated forms.
- solvate refers to a molecular complex of a compound of the disclosure (including pharmaceutically acceptable salts thereof) with one or more solvent molecules.
- solvent molecules are those commonly used in the pharmaceutical art, which are known to be innocuous to the recipient, e.g., water, ethanol, and the like.
- hydrate refers to the complex where the solvent molecule is water.
- solvates can be identified by a person of skill in the art with tools such as NMR.
- the compounds of the disclosure, including salts, hydrates and solvates thereof, may inherently or by design form polymorphs.
- the stereocenter at the 3-position of the glutarimide moiety (marked with a *) may be prone to epimerization under basic conditions. Separation of the diastereoisomers (or enantiomers as the case may be) at this position can be achieved according to known chiral separation techniques in the art, e.g., by chrial SFC. For example, separation may be carried out according to Example 65.
- the absolute configuration at the glutarimide stereocentre (marked with a * above) is S. In another embodiment of the compounds of the present disclosure, the absolute configuration at the glutarimide stereocentre (marked with a * above) is R. In one embodiment, there is provided a compound as described in any one of the Examples or according to any of Embodiments 1 to 42, wherein the absolute configuration at the glutarimide stereocentre (marked with a * above) is S. In another embodiment, there is provided a compound as described in any one of the Examples or according to any of Embodiments 1 to 42, wherein the absolute configuration at the glutarimide stereocentre (marked with a * above) is R.
- the compounds of the disclosure can be prepared in a number of ways well known to those skilled in the art of organic synthesis.
- compounds of the present disclosure can be synthesized using the methods described below, together with synthetic methods known in the art of synthetic organic chemistry, or variations thereon as appreciated by those skilled in the art.
- the compounds of formula (I'), (I"), or (I) can be prepared according to the Schemes provided infra.
- General scheme 1 The starting materials for the above reaction scheme are commercially available or can be prepared according to methods known to one skilled in the art or by methods disclosed herein.
- a metallaphotoredox reaction such as an iridium (Ir)-catalysed photoredox coupling of INT-1 with an alcohol partner of formula INT-1A in the presence of a polar solvent, such as acetonitrile (ACN) can provide the cross-coupled ether product (I)-2 in Step 1.
- a metallaphotoredox reaction such as an iridium (Ir)-catalysed photoredox coupling of INT-1 with an alcohol partner of formula INT-1A in the presence of a polar solvent, such as acetonitrile (ACN) can provide the cross-coupled ether product (I)-2 in Step 1.
- Step 2 Removal of the protecting group (e.g., Boc) under acidic conditions can provide the free amine (I)-3 (Step 2), which can then be converted to (I)-4 via an alkylation reaction (Step 3-i) with an appropriate alkyl bromide or alkyl mesylate in the presence of an amine base and polar solvent, such as diisopropylethylamine (DIPEA) and acetonitrile (ACN) or dimethylformamide (DMF), or a reductive amination (Step 3-ii) with an appropriate aldehyde in the presence of a borohydride reagent, such as sodium borohydride acetate.
- DIPEA diisopropylethylamine
- ACN acetonitrile
- DMF dimethylformamide
- Step 3-ii a reductive amination
- R 1 , R 2 , m and n are as defined herein, in particular according to any one of enumerated Em
- the starting materials for the above reaction scheme are commercially available or can be prepared according to methods known to one skilled in the art or by methods disclosed herein.
- the compounds of the disclosure especially compounds comprising non-linear R 1 and/or R 2 groups are prepared in the above reaction Scheme 2 as follows:
- the compound of (I)- 3 can be converted into (I)-5 via an alkylation reaction (Step 3-iii) with an appropriate non-linear alkyl iodide or mesylate in the presence of a base, such as K 2 CO 3 , and a polar solvent, such as dimethylacetamide (DMA), or (I)-6 via a reductive amination (Step 3-iv) with an appropriate ketone in the presence of a borohydride reagent, such as sodium borohydride acetate.
- a borohydride reagent such as sodium borohydride acetate.
- a metallaphotoredox reaction such as an iridium (Ir)-catalysed photoredox coupling, of (INT-3) with an alcohol partner of formula (INT-1B) in the presence of a polar solvent, such as acetonitrile (ACN) can provide the cross-coupled ether product (I)-7 in Step 1.
- Step 2 Removal of the protecting group (e.g., Boc) under acidic conditions, can provide the free amine (I)-8 (Step 2), which can then be converted to (I)-9 via reductive amination (Step 3-i) with an appropriate aldehyde in the presence of a borohydride reagent, such as sodium borohydride acetate.
- (I)-8 may be converted into (I)-9 via an alkylation reaction (Step 3-ii) with an appropriate alkyl mesylate or halide (e.g., iodide) in the presence of an amine base and polar solvent, such as diisopropylethylamine (DIPEA) and dimethylformamide (DMF) as described in general schemes 1 and 2.
- DIPEA diisopropylethylamine
- DMF dimethylformamide
- Base mediated hydrogen–deuterium exchange in a deuterated sovlent, such as CDCl 3 yields the final deuterated compounds of Formula (I), Formula (I') or Formula (I ), i.e. (I)-12-iii, wherein R 1 2 " , R , m and n are as defined according to any one of enumerated Embodiments 1 to 45.
- the disclosure provides a compound of formula (I)-12-i, (I)-12-ii or (I)-12-iii, wherein R 1 , R 2 , m and n are as defined according to any one of enumerated Embodiments 1 to 45.
- a compound of formula (X') or a salt thereof wherein: 1 each R is independently selected from hydrogen, C 1 -C 6 alkyl, hydroxyl, halo, C 1 - C 6 haloalkyl, C 1 -C 6 haloalkoxyl, and C 1 -C 6 alkoxyl; or 2 R 1 on the same carbon atom together with the same carbon atom to which they are attached form a C 3 -C 8 cycloalkyl; or 2 R 1 on adjacent carbon atoms together with the adjacent carbon atoms to which they are attached form a C 3 - C 8 cycloalkyl; or 2 R 1 on non-adjacent carbon atoms together with the non-adjacent carbon atoms to which they are attached form a bridging ring; R 2’ is selected from a nitrogen protecting group, e.g., Boc, hydrogen, C 3 -C 11 cycloalkyl, 4- to 11-membered heterocycly
- each R 1 is independently selected from hydrogen, C 1 -C 6 alkyl, hydroxyl, halo, and C 1 - C 6 alkoxyl; or 2 R 1 on the same carbon atom together with the same carbon atom to which they are attached form a C 3 -C 8 cycloalkyl; or 2 R 1 on adjacent carbon atoms together with the adjacent carbon atoms to which they are attached form a C 3 -C 8 cycloalkyl; or 2 R 1 on non- adjacent carbon atoms together with the non-adjacent carbon atoms to which they are attached form a bridging ring; R 2’ is selected from a nitrogen protecting group, e.g., Boc, hydrogen, C 3 -C 11 cycloalkyl, 4- to 11-membered heterocyclyl comprising 1-2 heteroatoms independently selected from N, O, and S, C 1 -C 6 haloalkyl,
- the compond of Formula (X') or Formula (X) is of Formula (X)-i wherein R 1 , R 2’ , m and n are defined according to Formula (X') or Formula (X) above.
- the compond of Formula (X') or Formula (X) is of Formula (X)-ii wherein R 1 , R 2’ , m and n are defined according to Formula (X') or Formula (X) above.
- R 2’ is selected from a nitrogen protecting group, e.g., Boc, hydrogen, and unsubstituted C 1 -C 10 alkyl.
- a compound of Fomula (Y) wherein R 1 , m and n are as defined according to Formula (X') or Formula (X) above; and each of PG 1 and PG 2 is independently a nitrogen protecting group as defined herein.
- PG 2 is a base labile protecting group and PG 1 is an acid labile protecting group.
- PG 2 is the SEM protecting group (trimethylsilylethoxymethyl) and PG 1 is the BOC protecting group (tert-butyloxycarbonyl).
- the compound of Formula (Y) is of Fomula (Y)-i wherein R 1 , m, n, PG 1 and PG 2 are defined according to Formula (Y) above.
- the compound of Formula (Y) is of Fomula (Y)-ii wherein R 1 , m, n, PG 1 and PG 2 are defined according to Formula (Y) above.
- the disclosure provides to a process for the preparation of a compound of formula (I'), (I"), or (I), in free form or in pharmaceutically acceptable salt form, comprising the step of: 1) coupling an aryl bromide of formula (INT-1) or formula (INT-3) with an alcohol of formula (INT-1A) or (INT-1B) under photo redox coupling conditions, to give a compound of formula (I)-2 or formula (I)-7 as defined herein.
- the disclosure provides a process for the preparation of a compound of formula (I'), (I") or (I), in free form or in pharmaceutically acceptable salt form, comprising the steps of: 1) coupling an aryl bromide of formula (INT-3) with an alcohol of formula (INT-1B) under photo redox coupling conditions, to give a compound of formula (I)-7 as defined herein; 2) deprotecting a compound of formula (I)-7 to give a compound of formula (I)-8 as defined herein; 3-i) reacting a compound of formula (I)-8 under reductive amination conditions to give a compound of formula (I)-9 as defined herein; or 3-ii) reacting a compound of formula (I)-8 under alkylation conditions to give a compound of formula (I)-9 as defined herein; 4) chlorinating a compound of formula (I)-9 with a nucleophilic chlorinating reagent, such as SOCl 2 , to give a compound of formula (I)-10 as defined herein
- the disclosure provides a process for the preparation of a compound of formula (I'), (I"), or (I), in free form or in pharmaceutically acceptable salt form, comprising the steps of: 1) coupling an aryl bromide of formula (INT-1) with an alcohol of formula (INT-1A) under photo redox coupling conditions, to give a compound of formula (I)-2 as defined herein; 2) deprotecting a compound of formula (I)-2 to give a compound of formula (I)-3; 3-i) reacting a compound of formula (I)-3 under reductive amination conditions to give a compound of formula (I) as defined herein; or 3-ii) reacting a compound of formula (I)-3 under alkylation conditions to give a compound of formula (I'), (I") or (I) as defined herein; 4) optionally purifying the compound of formula (I'), (I") or (I) as defined herein; and 5) optionally separating the resultant stereoisomers, e.g., by
- Photo redox coupling reaction conditions for any of the aforementioned process steps or hereinafter involve the use of an Ir(III) catalyst, such as [Ir ⁇ dF(CF 3 )ppy ⁇ 2 ⁇ dtbbpy ⁇ ]PF 6 , a Ni(II) complex, such as [NiCl 2 ⁇ dtbbpy], base, such as TMP, a suitable solvent, such as acetonitrile, a light source, such as a 34 W blue LED, the reaction conducted at room temperature (r.t.) for a suitable amount of time, for example 12 hours.
- Ir(III) catalyst such as [Ir ⁇ dF(CF 3 )ppy ⁇ 2 ⁇ dtbbpy ⁇ ]PF 6
- Ni(II) complex such as [NiCl 2 ⁇ dtbbpy]
- base such as TMP
- a suitable solvent such as acetonitrile
- a light source such as a 34 W blue LED
- Reductive amination conditions for any of the aforementioned process steps or hereinafter involve the use of a corresponding aldehyde or ketone, a suitable hydride reagent, such as NaBH(OAc) 3 , a suitable solvent, such as DMF, the reaction conducted at room temperature (r.t.).
- Alkylation reaction conditions for any of the aforementioned process steps or hereinafter involve the use of a corresponding sulfonate ester, such as a corresponding mesylate, a suitable base, such as DIPEA, a suitable solvent, such as DMF, the reaction conducted at a suitable temperature, such as 100 o C, under microwave.
- the disclosure relates to a compound of formula (X'), (X), (X)-i, (X)-ii, (Y), (Y)-i, or (Y)-ii, or salts thereof.
- the disclosure relates to the use of a compound of formula (X'), (X), (X)-i, (X)-ii, (Y), (Y)-i, or (Y)-ii, or salts thereof in the manufacture of a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii).
- compositions in another aspect, the disclosure provides a pharmaceutical composition comprising one or more compounds of described herein or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, and one or more pharmaceutically acceptable carriers.
- pharmaceutical composition refers to a compound of the disclosure, or a pharmaceutically acceptable salt thereof, together with at least one pharmaceutically acceptable carrier, in a form suitable for oral or parenteral administration.
- the term "pharmaceutically acceptable carrier” refers to a substance useful in the preparation or use of a pharmaceutical composition and includes, for example, suitable diluents, solvents, dispersion media, surfactants, antioxidants, preservatives, isotonic agents, buffering agents, emulsifiers, absorption delaying agents, salts, drug stabilizers, binders, excipients, disintegration agents, lubricants, wetting agents, sweetening agents, flavoring agents, dyes, and combinations thereof, as would be known to those skilled in the art (see, for example, Remington The Science and Practice of Pharmacy, 22 nd Ed. Pharmaceutical Press, 2013, pp. 1049-1070).
- a pharmaceutical composition comprising an agent which is effective in reducing WIZ protein expression levels and/or inducing fetal hemoglobin (HbF) expression.
- Such compositions include, but are not limited to, small molecule compounds (e.g., small molecule compounds that can target WIZ protein for degradation, e.g., through E3 ubiquitin pathway, e.g. a compound as described herein).
- the disclosure provides a pharmaceutical composition comprising a compound of the disclosure, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.
- the composition comprises at least two pharmaceutically acceptable carriers, such as those described herein.
- solvates and hydrates are generally considered compositions.
- pharmaceutically acceptable carriers are sterile.
- the pharmaceutical composition can be formulated for particular routes of administration such as oral administration, parenteral administration, and rectal administration, etc.
- the pharmaceutical compositions of the disclosure can be made up in a solid form (including without limitation capsules, tablets, pills, granules, powders or suppositories), or in a liquid form (including without limitation solutions, suspensions or emulsions).
- compositions can be subjected to conventional pharmaceutical operations such as sterilization and/or can contain conventional inert diluents, lubricating agents, or buffering agents, as well as adjuvants, such as preservatives, stabilizers, wetting agents, emulsifiers and buffers, etc.
- the pharmaceutical compositions are tablets or gelatin capsules comprising the active ingredient together with one or more of: a) diluents, e.g., lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and/or glycine; b) lubricants, e.g., silica, talcum, stearic acid, its magnesium or calcium salt and/or polyethyleneglycol; c) binders, e.g., magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose and/or polyvinylpyrrolidone; d) disintegrants, e.g., starches, agar, alginic acid or its sodium salt, or effervescent mixtures; and e) absorbents, colorants, flavors and sweeteners.
- diluents e.g., lactose, dextrose, sucrose, mann
- the pharmaceutical compositions are capsules comprising the active ingredient only. Tablets may be either film coated or enteric coated according to methods known in the art.
- suitable compositions for oral administration include an effective amount of a compound of the disclosure in the form of tablets, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsion, hard or soft capsules, or syrups or elixirs, solutions or solid dispersion.
- Compositions intended for oral use are prepared according to any method known in the art for the manufacture of pharmaceutical compositions and such compositions can contain one or more agents selected from the group consisting of sweetening agents, flavoring agents, coloring agents and preserving agents in order to provide pharmaceutically elegant and palatable preparations.
- Tablets may contain the active ingredient in admixture with nontoxic pharmaceutically acceptable excipients, which are suitable for the manufacture of tablets.
- excipients are, for example, inert diluents, such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, corn starch, or alginic acid; binding agents, for example, starch, gelatin or acacia; and lubricating agents, for example magnesium stearate, stearic acid or talc.
- the tablets are uncoated or coated by known techniques to delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period.
- a time delay material such as glyceryl monostearate or glyceryl distearate can be employed.
- Formulations for oral use can be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium, for example, peanut oil, liquid paraffin or olive oil.
- Certain injectable compositions are aqueous isotonic solutions or suspensions, and suppositories are advantageously prepared from fatty emulsions or suspensions.
- compositions may be sterilized and/or contain adjuvants, such as preserving, stabilizing, wetting or emulsifying agents, solution promoters, salts for regulating the osmotic pressure and/or buffers. In addition, they may also contain other therapeutically valuable substances.
- Said compositions are prepared according to conventional mixing, granulating or coating methods, respectively, and contain about 0.1-75%, or contain about 1-50%, of the active ingredient.
- Suitable compositions for transdermal application include an effective amount of a compound of the disclosure with a suitable carrier.
- Carriers suitable for transdermal delivery include absorbable pharmacologically acceptable solvents to assist passage through the skin of the host.
- transdermal devices are in the form of a bandage comprising a backing member, a reservoir containing the compound optionally with carriers, optionally a rate controlling barrier to deliver the compound of the skin of the host at a controlled and predetermined rate over a prolonged period of time, and means to secure the device to the skin.
- Suitable compositions for topical application e.g., to the skin and eyes, include aqueous solutions, suspensions, ointments, creams, gels or sprayable formulations, e.g., for delivery by aerosol or the like.
- topical delivery systems will in particular be appropriate for dermal application, e.g., for the treatment of skin cancer, e.g., for prophylactic use in sun creams, lotions, sprays and the like. They are thus particularly suited for use in topical, including cosmetic, formulations well-known in the art. Such may contain solubilizers, stabilizers, tonicity enhancing agents, buffers and preservatives. As used herein a topical application may also pertain to an inhalation or to an intranasal application.
- a dry powder either alone, as a mixture, for example a dry blend with lactose, or a mixed component particle, for example with phospholipids
- a dry powder inhaler or an aerosol spray presentation from a pressurised container, pump, spray, atomizer or nebuliser, with or without the use of a suitable propellant.
- WIZ modulating properties or WIZ degrading properties or Hbf inducing properties e.g., as indicated in the in vitro tests as provided in the examples, and are therefore indicated for therapy or for use as research chemicals, e.g., as tool compounds.
- Additional properties of the disclosed compounds include having good potency in the biological assays described herein, favorable safety profile, and possess favorable pharmacokinetic properties.
- Diseases and Disorders The compounds of the disclosure can be used to treat one or more of the diseases or disorders described herein below.
- the disease or disorder is affected by the reduction of WIZ protein expression levels and/or induction of fetal hemoglobin protein expression levels.
- the disease or disorder is a hemoglobinopathy, e.g., beta hemoglobinopathy, including sickle cell disease (SCD) and beta-thalassemia.
- a method of reducing WIZ protein expression levels and/or inducing fetal hemoglobin (HbF) expression comprising administering to a subject a therapeutically effective amount of an agent, e.g., a small molecule (e.g., a small molecule compound that can target WIZ protein for degradation, e.g., through E3 ubiquitin pathway, e.g. a compound as described herein).
- an agent e.g., a small molecule (e.g., a small molecule compound that can target WIZ protein for degradation, e.g., through E3 ubiquitin pathway, e.g. a compound as described herein).
- the method of reducing WIZ protein expression levels and/or inducing fetal hemoglobin (HbF) expression is for the treatment of a hemoglobinopathy, e.g., beta hemoglobinopathy, including sickle cell disease (SCD) and beta-thalassemia.
- a hemoglobinopathy e.g., beta hemoglobinopathy, including sickle cell disease (SCD) and beta-thalassemia.
- SCD sickle cell disease
- beta-thalassemia beta-thalassemia
- a therapeutic agent e.g., a small molecule (e.g., small molecule compounds that can target WIZ protein for degradation, e.g., through E3 ubiquitin pathway, e.g., a compound as described herein), for use in a method of reducing WIZ protein expression levels and/or inducing fetal hemoglobin (HbF) expression;
- a therapeutic agent e.g., a small molecule (e.g., small molecule compounds that can target WIZ protein for degradation, e.g., through E3 ubiquitin pathway, e.g., a compound as described herein), for use in the treatment of the aforementioned diseases or disorders according to the present disclosure;
- Use of an agent e.g., a small molecule (e.g.
- a pharmaceutical composition comprising an agent, e.g., a small molecule (e.g., small molecule compounds that can target WIZ protein for degradation, e.g., through E3 ubiquitin pathway, e.g., a compound as described herein), for use in the treatment of the aforementioned diseases or disorders according to the present disclosure.
- a small molecule e.g., small molecule compounds that can target WIZ protein for degradation, e.g., through E3 ubiquitin pathway, e.g., a compound as described herein
- compounds of formulae (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), and (ID-ii), in free or pharmaceutically acceptable salt form are useful in the treatment of conditions which may be treated by modulation of WIZ protein expression levels, reduction of WIZ protein expression levels, or induction of fetal hemoglobin (HbF), such as in a blood disorder, for example an inherited blood disorder, e.g., sickle cell disease, or beta-thalassemia.
- HbF fetal hemoglobin
- the disclosure provides a method of treating or preventing a disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB- iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- the disclosure provides a method of treating or preventing a disorder that is affected by the reduction of WIZ protein levels, in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- the disclosure provides a method of inhibiting WIZ protein expression in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- the disclosure provides a method of degrading WIZ protein in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB- iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- the disclosure provides a method of inhibiting, reducing, or eliminating the activity of WIZ protein or WIZ protein expression, the method comprising administering to the subject a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- the disclosure provides a method of inducing or promoting fetal hemoglobin in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA- iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- the disclosure provides a method of reactivating fetal hemoglobin production or expression in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- the disclosure provides a method of increasing fetal hemoglobin expression in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA- iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- the disclosure provides a method of treating a hemoglobinopathy, e.g., a beta-hemoglobinopathy, in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I'), (I"), (I), (I-i), (IA), (IA- i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- a hemoglobinopathy e.g., a beta-hemoglobinopathy
- the disclosure provides a method of treating a sickle cell disease in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- the disclosure provides a method of treating beta-thalassemia in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
- the beta-thalassemia major or intermedia is the result of homozygous null or compound heterozygous mutations resulting with beta-globin deficiency and the phenotypic complications of beta-thalassemia, whether transfusion-dependent or not.
- the disclosure provides a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof for use in a method of treating or preventing a disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IB), (IB-ii), (IB-iii), (IC), (IC-i-i), (IC), (IC-i-i
- the disclosure provides a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof for use in a method of treating or preventing a disorder that is affected by the reduction of WIZ protein levels, in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IB), (IB-i), (IB-ii), (IB-
- the disclosure provides a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof for use in a method of inhibiting WIZ protein expression in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IB), (IB-ii), (IB-iii), (IC), (IC-i), (IC), (IC-i), (IC
- the disclosure provides a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof for use in a method of degrading WIZ protein in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IB), (IB-ii), (IB-iii), (IC), (IC-i), (IC), (IC-i), (IC
- the disclosure provides a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof for use in a method of inhibiting, reducing, or eliminating the activity of WIZ protein or WIZ protein expression, the method comprising administering to the subject a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IB), (IB-ii), (IB-iii), (IC), (IC-i), (IC-i), (IC-i), (IC-i), (IC-i),
- the disclosure provides a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof for use in a method of inducing or promoting fetal hemoglobin in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-ii), (IB-iii), (IC), (
- the disclosure provides a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof for use in a method of reactivating fetal hemoglobin production or expression in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IB), (IB-ii), (IB-iii), (IC),
- the disclosure provides a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof for use in a method of increasing fetal hemoglobin expression in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IB), (IB-ii), (IB-iii), (IC), (IC-i),
- the disclosure provides a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof for use in a method of treating a hemoglobinopathy, e.g., a beta-hemoglobinopathy, in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB
- the disclosure provides a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof for use in a method of treating a sickle cell disease in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IB), (IB-ii), (IB-iii), (IC), (IC-i), (
- the disclosure provides a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof for use in a method of treating beta-thalassemia in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IB), (IB-ii), (IB-iii), (IC), (IC-i), (
- the beta-thalassemia major or intermedia is the result of homozygous null or compound heterozygous mutations resulting with beta-globin deficiency and the phenotypic complications of beta-thalassemia, whether transfusion-dependent or not.
- Dosage The pharmaceutical composition or combination of the disclosure can be in unit dosage of about 1-1000 mg of active ingredient(s) for a subject of about 50-70 kg, or about 1-500 mg or about 1-250 mg or about 1-150 mg or about 0.5-100 mg, or about 1-50 mg of active ingredients.
- the therapeutically effective dosage of a compound, the pharmaceutical composition, or the combinations thereof is dependent on the species of the subject, the body weight, age and individual condition, the disorder or disease or the severity thereof being treated.
- the above-cited dosage properties are demonstrable in vitro and in vivo tests using advantageously mammals, e.g., mice, rats, dogs, monkeys or isolated organs, tissues and preparations thereof.
- the compounds of the disclosure can be applied in vitro in the form of solutions, e.g., aqueous solutions, and in vivo either enterally, parenterally, advantageously intravenously, e.g., as a suspension or in aqueous solution.
- the dosage in vitro may range between about 10 -3 molar and 10 -9 molar concentrations.
- a therapeutically effective amount in vivo may range depending on the route of administration, between about 0.1-500 mg/kg, or between about 1-100 mg/kg.
- the disclosure provides a pharmaceutical combination comprising a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC- i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, and one or more additional therapeutic agent(s) for simultaneous, separate or sequential use in therapy.
- a pharmaceutically acceptable salt hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, and one or more additional therapeutic agent(s) for simultaneous, separate or sequential use in therapy.
- the additional therapeutic agent is a myelosuppressive agent, such as hydroxyurea.
- Combination therapy includes the administration of the subject compounds in further combination with other biologically active ingredients (such as, but not limited to, a second and different antineoplastic agent or a therapeutic agent that targets Hbf or another cancer target) and non-drug therapies (such as, but not limited to, surgery or radiation treatment).
- the compounds of the application can be used in combination with other pharmaceutically active compounds, preferably compounds that are able to enhance the effect of the compounds of the application.
- the compound of the disclosure may be administered either simultaneously with, or before or after, one or more other therapeutic agent.
- the compound of the disclosure may be administered separately, by the same or different route of administration, or together in the same pharmaceutical composition as the other agents.
- a therapeutic agent is, for example, a chemical compound, peptide, antibody, antibody fragment or nucleic acid, which is therapeutically active or enhances the therapeutic activity when administered to a patient in combination with a compound of the disclosure.
- the disclosure provides a combination comprising a therapeutically effective amount of a compound of formula (I'), (I"), (I), (I-i), (IA), (IA- i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), or a pharmaceutically acceptable salt thereof and one or more additional therapeutically active agents.
- the disclosure provides a product comprising a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), and at least one other therapeutic agent as a combined preparation for simultaneous, separate or sequential use in therapy.
- the therapy is the treatment of a disease or condition modulated by WIZ.
- Products provided as a combined preparation include a composition comprising the compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii), and the other therapeutic agent(s) together in the same pharmaceutical composition, or the compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IB), (IB-i), (IB-iii), (IC), (IC-i), (IC-i), (ID), (ID-i), or (ID-ii), and the other therapeutic agent(s) together in the same pharmaceutical composition, or the compound of formula (I'), (I"), (I), (I-i), (IA), (IA
- the disclosure provides a pharmaceutical composition
- a pharmaceutical composition comprising a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC- i), (IC-ii), (ID), (ID-i), or (ID-ii), and another therapeutic agent(s).
- the pharmaceutical composition may comprise a pharmaceutically acceptable carrier, as described above.
- the disclosure provides a kit comprising two or more separate pharmaceutical compositions, at least one of which contains a compound of formula (I'), (I"), (I), (I-i), (IA), (IA-i), (IA-ii), (IA-iii), (IB), (IB-i), (IB-ii), (IB-iii), (IC), (IC-i), (IC-ii), (ID), (ID-i), or (ID-ii).
- the kit comprises means for separately retaining said compositions, such as a container, divided bottle, or divided foil packet.
- An example of such a kit is a blister pack, as typically used for the packaging of tablets, capsules and the like.
- the kit of the disclosure may be used for administering different dosage forms, for example, oral and parenteral, for administering the separate compositions at different dosage intervals, or for titrating the separate compositions against one another.
- the kit of the disclosure typically comprises directions for administration.
- the compound of the disclosure and the other therapeutic agent may be manufactured and/or formulated by the same or different manufacturers.
- the compound of the disclosure and the other therapeutic may be brought together into a combination therapy: (i) prior to release of the combination product to physicians (e.g., in the case of a kit comprising the compound of the disclosure and the other therapeutic agent); (ii) by the physician themselves (or under the guidance of the physician) shortly before administration; (iii) in the patient themselves, e.g., during sequential administration of the compound of the disclosure and the other therapeutic agent.
- physicians e.g., in the case of a kit comprising the compound of the disclosure and the other therapeutic agent
- physician e.g., in the case of a kit comprising the compound of the disclosure and the other therapeutic agent
- by the physician themselves or under the guidance of the physician
- in the patient themselves e.g., during sequential administration of the compound of the disclosure and the other therapeutic agent.
- Such functional groups include hydroxy, phenol, amino and carboxylic acid.
- Suitable protecting groups for hydroxy or phenol include trialkylsilyl or diarylalkylsilyl (e.g., t- butyldimethylsilyl, t-butyldiphenylsilyl or trimethylsilyl), tetrahydropyranyl, benzyl, substituted benzyl, methyl, and the like.
- Suitable protecting groups for amino, amidino and guanidino include t-butoxycarbonyl, benzyloxycarbonyl, and the like.
- Suitable protecting groups for carboxylic acid include alkyl, aryl or arylalkyl esters.
- Protecting groups may be added or removed in accordance with standard techniques, which are well-known to those skilled in the art and as described herein. The use of protecting groups is described in detail in J. F. W. McOmie, “Protective Groups in Organic Chemistry", Plenum Press, London and New York 1973; T. W. Greene and P. G. M. Wuts, “Greene's Protective Groups in Organic Synthesis", Fourth Edition, Wiley, New York 2007; P. J.
- the protecting group may also be a polymer resin, such as a Wang resin or a 2-chlorotrityl- chloride resin.
- starting components and reagents may be obtained from sources such as Sigma Aldrich, Lancaster Synthesis, Inc., Maybridge, Matrix Scientific, TCI, and Fluorochem USA, Strem, other commercial vendors, or synthesized according to sources known to those skilled in the art, or prepared as described in this disclosure.
- Analytical Methods, Materials, and Instrumentation Unless otherwise noted, reagents and solvents were used as received from commercial suppliers.
- Proton nuclear magnetic resonance (NMR) spectra were obtained on either Bruker Avance spectrometer or Varian Oxford 400 MHz spectrometer unless otherwise noted. Spectra are given in ppm ( ⁇ ) and coupling constants, J, are reported in Hertz.
- Tetramethylsilane was used as an internal standard. Chemical shifts are reported in ppm relative to dimethyl sulfoxide ( ⁇ 2.50), methanol ( ⁇ 3.31), chloroform ( ⁇ 7.26) or other solvent as indicated in NMR spectral data. A small amount of the dry sample (2-5 mg) is dissolved in an appropriate deuterated solvent (1 mL). The chemical names were generated using ChemBioDraw Ultra v12 from CambridgeSoft. Mass spectra (ESI-MS) were collected using a Waters System (Acquity UPLC and a Micromass ZQ mass spectrometer) or Agilent-1260 Infinity (6120 Quadrupole); all masses reported are the m/z of the protonated parent ions unless recorded otherwise.
- ESI-MS Mass spectra
- the sample was dissolved in a suitable solvent such as MeCN, DMSO, or MeOH and was injected directly into the column using an automated sample handler.
- a suitable solvent such as MeCN, DMSO, or MeOH
- the analysis is performed on Waters Acquity UPLC system (Column: Waters Acquity UPLC BEH C181.7 ⁇ m, 2.1 x 30mm; Flow rate: 1 mL/min; 55°C (column temperature); Solvent A: 0.05% formic acid in water, Solvent B: 0.04% formic acid in MeOH; gradient 95% Solvent A from 0 to 0.10 min; 95% Solvent A to 20% Solvent A from 0.10 to 0.50 min; 20% Solvent A to 5% Solvent A from 0.50 to 0.60 min; hold at 5% Solvent A from 0.6 min to 0.8 min; 5% Solvent A to 95% Solvent A from 0.80 to 0.90 min; and hold 95% Solvent A from 0.90 to 1.15 min.
- the compounds of formula (I) have at least two asymmetric carbon atoms as illustrated below wherein the asymmetric carbon atoms are identified by a *:
- compounds drawn whereby the bond from the N atom of the oxoisoindolinyl moiety to the C atom of the glutarimide moiety is depicted as flat shall be taken to mean a compound mixture which comprises both the (R) and (S) stereoisomers in relation to this stereocenter.
- Example 29 (named as 3-(5-(((R)-1-(3,3-difluorocyclobutyl)piperidin-3-yl)oxy)-1- oxoisoindolin-2-yl)piperidine-2,6-dione) thus exists as a diastereomeric mixture of both the (R)- 3-(5-(((R)-1-(3,3-difluorocyclobutyl)piperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione and (S)-3-(5-(((R)-1-(3,3-difluorocyclobutyl)piperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine- 2,6-dione.
- the stereochemical configuration of the diastereomer which is designated as (R*,S*) indicates the relative stereochemistry is known (as depicted by the wedged bonds) but not the absolute stereochemistry. Accordingly, any reference to a compound designated as (R*,S*) shall be taken to mean as either having the absolute (R,S) configuration or the (S,R) confirguration. This also applies to compounds which have been synthesised from an intermediate compound whereby the relative stereochemistry is known but the abslute stereochemistry has not been determined.
- Example 55 which is named as 3-(5-(((3S*,4S*)-1-ethyl-4-fluoropiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione and whereby the groups atached to the 3- and 4-position of the piperidinyl moiety are represented by the wedged bonds to indicate the relative stereochemistry is known.
- the compound is either 3-(5-(((3S,4S)-1-ethyl-4- fluoropiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione or 3-(5-(((3R,4R)-1-ethyl-4- fluoropiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (taking into account the flat bond to the glutarimide moiety as explained above). The same interpretation is to be applied throughout the following section for the synthesis of all compounds.
- Step 2.3-(5-bromo-1-oxoisoindolin-2-yl)piperidine-2,6-dione (INT-XX)
- 3-aminopiperidine-2,6-dione hydrochloride 1-1c (596.3 g, 3.623 mol) and i-Pr 2 NEt (2.50 L, 14.3 mol) in DMF (5.0 L) was added 1-1b (1000 g, 3.623 mmol) and the resulting reaction mixture was stirred at 85-90 °C for 24 h.
- the reaction mixture was then allowed to cool to room temperature, water (20 L) was added, and the resulting mixture was stirred for 12 h.
- Step 2 3-(1-oxo-5-(((R)-piperidin-3-yl)oxy)isoindolin-2-yl)piperidine-2,6-dione (INT-2)
- INT-2 3-(1-oxo-5-(((R)-piperidin-3-yl)oxy)isoindolin-2-yl)piperidine-2,6-dione
- the reaction was cooled to 0 °C and triethylamine (16.0 mL, 115 mmol) followed by N1,N2- dimethylethane-1,2-diamine (1.41 mL, 13.1 mmol) were added.
- the reaction stirred at r.t. for 2 hrs.
- the reaction was quenched with 50% saturated aqueous sodium bicarbonate and extracted three times with 4:1 DCM:iPrOH. The organic layers were combined, passed through a phase separator and concentrated.
- Step 2 (R)-5-((6-azaspiro[2.5]octan-4-yl)oxy)isobenzofuran-1(3H)-one (INT-20) Tert-butyl (R)-4-((1-oxo-1,3-dihydroisobenzofuran-5-yl)oxy)-6-azaspiro[2.5]octane-6- carboxylate 19 (228 mg, 0.63 mmol) was dissolved in dioxane (3.2 mL) and trifluoroethane (0.5 mL).4M HCl in dioxane (0.95 mL, 3.8 mmol) was added and the reaction stirred at r.t. for 18 hrs.
- Step 1 Tert-butyl 7-((1-oxo-1,3-dihydroisobenzofuran-5-yl)oxy)-5-azaspiro[2.5]octane-5- carboxylate (31)
- Compound 31 was made according to General Method I starting from 5- bromoisobenzofuran-1(3H)-one (0.2 g, 0.939 mmol) and tert-butyl 7-hydroxy-5- azaspiro[2.5]octane-5-carboxylate (CAS# 2167476-06-2) (235 mg, 1.03 mmol).
- Step 2 5-((5-azaspiro[2.5]octan-7-yl)oxy)isobenzofuran-1(3H)-one (32) Tert-butyl 7-((1-oxo-1,3-dihydroisobenzofuran-5-yl)oxy)-5-azaspiro[2.5]octane-5- carboxylate 31 (271 mg, 0.754 mmol) was suspended in dioxane (7.54 mL).4M HCl in dioxane (1.13 mL, 4.52 mmol) was added and the reaction stirred at r.t. for 18 hrs.
- Step 3 Enantiomers of 5-((5-ethyl-5-azaspiro[2.5]octan-7-yl)oxy)isobenzofuran-1(3H)-one (INT-33)
- Compound INT-33 was made according to General Method X starting from 5-((5- azaspiro[2.5]octan-7-yl)oxy)isobenzofuran-1(3H)-one 32 (196 mg, 0.754 mmol) and acetaldehyde (63.9 ⁇ L, 1.13 mmol).
- Step 2 rac-5-(((1R,5R,6S)-3-Azabicyclo[4.1.0]heptan-5-yl)oxy)isobenzofuran-1(3H)-one (39)
- Compound 39 was made according to General Method II starting from rac-tert-butyl (1R,5R,6S)-5-((1-oxo-1,3-dihydroisobenzofuran-5-yl)oxy)-3-azabicyclo[4.1.0]heptane-3- carboxylate 38 (224 mg, 0.65 mmol).
- Step 3 5-(((1S,5S,6R)-3-ethyl-3-azabicyclo[4.1.0]heptan-5-yl)oxy)isobenzofuran-1(3H)-one and 5-(((1R,5R,6S)-3-ethyl-3-azabicyclo[4.1.0]heptan-5-yl)oxy)isobenzofuran-1(3H)-one
- Compound INT-40 was made according to General Method X starting from rac-5- (((1R,5R,6S)-3-azabicyclo[4.1.0]heptan-5-yl)oxy)isobenzofuran-1(3H)-one 39 (159 mg, 0.65 mmol) and acetaldehyde (55 ⁇ L, 0.974 mmol).
- Step 2 rac-5-(((1R,5S,6S)-3-Azabicyclo[4.1.0]heptan-5-yl)oxy)isobenzofuran-1(3H)-one (46)
- Compound 46 was made according to General Method II starting from rac-tert-butyl (1R,5S,6S)-5-((1-oxo-1,3-dihydroisobenzofuran-5-yl)oxy)-3-azabicyclo[4.1.0]heptane-3- carboxylate 45 (302 mg, 0.87 mmol).
- Step 3 5-(((1S,5R,6R)-3-ethyl-3-azabicyclo[4.1.0]heptan-5-yl)oxy)isobenzofuran-1(3H)-one and 5-(((1R,5S,6S)-3-ethyl-3-azabicyclo[4.1.0]heptan-5-yl)oxy)isobenzofuran-1(3H)-one
- Compound INT-47 was made according to General Method X starting from rac-5- (((1R,5S,6S)-3-azabicyclo[4.1.0]heptan-5-yl)oxy)isobenzofuran-1(3H)-one 46 (214 mg, 0.87 mmol) and acetaldehyde (74 ⁇ L, 1.31 mmol).
- Step 2 ((1r,3r)-3-methoxycyclobutyl)methyl methanesulfonate (INT-58)
- Compound INT-58 was made according to General Method VIII starting from ((1r,3r)-3- methoxycyclobutyl)methanol 57 (156 mg, 1.345 mmol) to afford ((1r,3r)-3- methoxycyclobutyl)methyl methanesulfonate INT-58 as a light yellow oil.
- reaction mixture stirred at r.t. for 12 hrs.
- the reaction mixture was diluted with DCM (20 mL) and washed with saturated aqueous Na 2 S 2 O 3 (2 x 80 mL).
- the organic layers were combined, washed with saturated aqueous NaHCO 3 (2 x 80 mL), brine (80 mL), dried over anhydrous Na 2 SO 4 , filtered, and concentrated to afford rac-benzyl (1R,6S)-7-oxa-3-azabicyclo[4.1.0]heptane-3-carboxylate 145 as yellow oil. Material was used in the next step without purification.
- the reaction mixture was warmed to r.t. and stirred for 3 hrs.
- the mixture was diluted with EtOAc (200 mL) and washed with brine (3 x 50 mL), dried over Na 2 SO 4 , filtered, and concentrated.
- the crude material was purified by silica gel chromatography (0-40% EtOAc in petroleum ether) and the fractions containing product were concentrated. Then resulting material was further purified by reverse phase HPLC (60-80% ACN in water with 0.05% ammonia hydroxide as modifier).
- reaction was evacuated and backfilled with nitrogen three times. ACN (2.5 mL) was added followed by 2,2,6,6-tetramethylpiperidine (0.09 mL, 0.5 mmol). The reaction was placed in PennOC m1450nm Photoreactor under blue LED light at r.t. for 18 hrs.
- Step 2 3-(1-oxo-5-(((S)-piperidin-3-yl)oxy)isoindolin-2-yl)piperidine-2,6-dione (5)
- Compound 5 was made according to General Method VII starting from tert-butyl (3S)-3- ((2-(2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin-3-yl)-1-oxoisoindolin-5- yl)oxy)piperidine-1-carboxylate 4 (315.6 mg, 0.550 mmol). The reaction was quenched with 50% saturated aqueous sodium bicarbonate and extracted three times with 4:1 DCM:iPrOH.
- Step 3 3-(5-(((S)-1-ethylpiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (I-6)
- 3-(1-oxo-5-(((S)-piperidin-3-yl)oxy)isoindolin-2- yl)piperidine-2,6-dione 5 56.9 mg, 0.166 mmol
- bromoethane (22.3 mg, 0.205 mmol) were dissolved in ACN (1.0 mL).
- DIPEA (0.10 mL, 0.573 mmol) was added and the reaction stirred at 60 °C for 24 hrs.
- Example 3 3-(5-(((R)-1-isobutylpiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6- dione (I-7)
- Compound I-7 was made according to General Method X starting from 3-(1-oxo-5-(((R)- piperidin-3-yl)oxy)isoindolin-2-yl)piperidine-2,6-dione INT-2 (61 mg, 0.18 mmol) and isobutanal (0.024 mL, 0.27 mmol).
- Example 4 3-(5-(((R)-1-(oxetan-3-ylmethyl)piperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-8)
- Compound I-8 was made according to General Method III starting from 3-(1-oxo-5-(((R)- piperidin-3-yl)oxy)isoindolin-2-yl)piperidine-2,6-dione INT-2 (72 mg, 0.21 mmol) and oxetane-3- carbaldehyde (27 mg, 0.32 mmol).
- Example 5 3-(5-(((R)-1-((4,4-difluorocyclohexyl)methyl)piperidin-3-yl)oxy)-1- oxoisoindolin-2-yl)piperidine-2,6-dione (I-9)
- Compound I-9 was made according to General Method III starting from 1- (hydroxymethyl)-3-(1-oxo-5-(((R)-piperidin-3-yl)oxy)isoindolin-2-yl)piperidine-2,6-dione INT-2 (60 mg, 0.18 mmol) and 4,4-difluorocyclohexane-1-carbaldehyde (39 mg, 0.26 mmol).
- Example 6 3-(5-(((R)-1-(cyclohexylmethyl)piperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-10)
- Compound I-10 was made according to General Method III starting from 1- (hydroxymethyl)-3-(1-oxo-5-(((R)-piperidin-3-yl)oxy)isoindolin-2-yl)piperidine-2,6-dione INT-2 (60 mg, 0.18 mmol) and cyclohexanecarboxaldehyde (0.032 mL, 0.26 mmol).
- Example 7 3-(5-(((R)-1-(cyclobutylmethyl)piperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-11)
- Compound I-9 was made according to General Method III starting from 1- (hydroxymethyl)-3-(1-oxo-5-(((R)-piperidin-3-yl)oxy)isoindolin-2-yl)piperidine-2,6-dione INT-2 (68 mg, 0.20 mmol) and cyclobutanecarbaldehyde (25 mg, 0.30 mmol).
- Example 8 3-(1-oxo-5-(((R)-1-propylpiperidin-3-yl)oxy)isoindolin-2-yl)piperidine-2,6-dione (I-12)
- Compound I-12 was made according to General Method III starting from 1- (hydroxymethyl)-3-(1-oxo-5-(((R)-piperidin-3-yl)oxy)isoindolin-2-yl)piperidine-2,6-dione INT-2 (68 mg, 0.20 mmol) and propanal (0.021 mL, 0.30 mmol).
- Example 9 3-(5-(((R)-1-isopropylpiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6- dione (I-13) 3-(1-oxo-5-(((R)-piperidin-3-yl)oxy)isoindolin-2-yl)piperidine-2,6-dione INT-2 (60 mg, 0.18 mmol) was suspended in DMA (1.75 mL). K 2 CO 3 (36 mg, 0.26 mmol) was added and the reaction was evacuated and backfilled with nitrogen three times.
- Example 10 3-(1-oxo-5-(((R)-1-(tetrahydro-2H-pyran-4-yl)piperidin-3-yl)oxy)isoindolin-2- yl)piperidine-2,6-dione (I-14) 3-(1-oxo-5-(((R)-piperidin-3-yl)oxy)isoindolin-2-yl)piperidine-2,6-dione INT-2 (60 mg, 0.18 mmol) and 4-iodotetrahydro-2H-pyran (0.105 mL, 0.874 mmol) were suspended in DMA (1.75 mL).
- Example 11 3-(5-(((R)-1-(2-oxaspiro[3.3]heptan-6-yl)piperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-15) 3-(1-oxo-5-(((R)-piperidin-3-yl)oxy)isoindolin-2-yl)piperidine-2,6-dione INT-2 (60 mg, 0.18 mmol) and 6-iodo-2-oxaspiro[3.3]heptane (196 mg, 0.87 mmol) were suspended in DMA (1.75 mL).
- Example 12 3-(5-(((R)-1-(oxetan-3-yl)piperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine- 2,6-dione (I-16) 3-(1-oxo-5-(((R)-piperidin-3-yl)oxy)isoindolin-2-yl)piperidine-2,6-dione INT-2 (60 mg, 0.18 mmol) and 3-iodooxetane (0.077 mL, 0.87 mmol) were suspended in DMA (1.75 mL). K 2 CO 3 (36 mg, 0.26 mmol) was added and the reaction was evacuated and backfilled with nitrogen 3 times.
- the reaction stirred at 100 °C for a total of 6 hrs under microwave radiation.
- the reaction was quenched with 50% saturated aqueous sodium bicarbonate and extracted three times with 4:1 DCM:iPrOH.
- the organic layers were combined, passed through a phase separator, and concentrated onto CELITE®.
- Example 13 3-(5-(((R)-1-(cyclopropylmethyl)piperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-17)
- sodium triacetoxyborohydride 123 mg, 0.58 mmol
- cyclopropanecarbaldehyde 0.031 mg, 0.44 mmol
- Example 14 3-(5-(((R)-1-((1-ethyl-1H-pyrazol-4-yl)methyl)piperidin-3-yl)oxy)-1- oxoisoindolin-2-yl)piperidine-2,6-dione (I-18)
- sodium triacetoxyborohydride 123 mg, 0.58 mmol
- 1-ethyl-1H-pyrazole-4-carbaldehyde 54.2 mg, 0.44 mmol
- Step 2 Ethyl (R)-2-(chloromethyl)-4-((6-ethyl-6-azaspiro[2.5]octan-4-yl)oxy)benzoate (22) To a solution of (R)-5-((6-ethyl-6-azaspiro[2.5]octan-4-yl)oxy)isobenzofuran-1(3H)-one 21 (163 mg, 0.57 mmol) in dichloroethane (2.8 mL) and ethanol (2.8 mL) in a 25 mL 2 neck round bottom flask stirred at 70 °C was added thionyl chloride (0.50 mL, 6.8 mmol) dropwise.
- Step 3 3-(5-(((R)-6-ethyl-6-azaspiro[2.5]octan-4-yl)oxy)-1-oxoisoindolin-2-yl)piperidine- 2,6-dione (I-23).
- 3-aminopiperidine-2,6-dione hydrochloride (77 mg, 0.47 mmol) was dissolved in DMF (0.94 mL).
- DIPEA (0.21 mL, 1.2 mmol) was added and the reaction was evacuated and backfilled with nitrogen three times. The reaction stirred at r.t. for 15 minutes.
- Example 16 3-(5-(((R)-6-isobutyl-6-azaspiro[2.5]octan-4-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-26)
- Step 1 (R)-5-((6-isobutyl-6-azaspiro[2.5]octan-4-yl)oxy)isobenzofuran-1(3H)-one
- Compound 24 was made according to General Method III starting from (R)-5-((6- azaspiro[2.5]octan-4-yl)oxy)isobenzofuran-1(3H)-one INT-20 (90 mg, 0.35 mmol) and isobutanal (48 ⁇ L, 0.52 mmol).
- Step 2 Ethyl (R)-2-(chloromethyl)-4-((6-isobutyl-6-azaspiro[2.5]octan-4-yl)oxy)benzoate (25)
- Compound 25 was made according to General Method IV starting from (R)-5-((6-ethyl-6- azaspiro[2.5]octan-4-yl)oxy)isobenzofuran-1(3H)-one 24 (114 mg, 0.36 mmol).
- Step 3 3-(5-(((R)-6-isobutyl-6-azaspiro[2.5]octan-4-yl)oxy)-1-oxoisoindolin-2-yl)piperidine- 2,6-dione (I-26)
- Compound I-26 was made according to General Method V starting from ethyl (R)-2- (chloromethyl)-4-((6-isobutyl-6-azaspiro[2.5]octan-4-yl)oxy)benzoate 25 (57.5 mg, 0.15 mmol).
- Example 17 3-(5-(((R)-6-((S)-sec-butyl)-6-azaspiro[2.5]octan-4-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione
- Step 1 5-(((R)-6-((S)-sec-butyl)-6-azaspiro[2.5]octan-4-yl)oxy)isobenzofuran-1(3H)-one
- Compound 28 was made according to General Method IX starting from (R)-5-((6- azaspiro[2.5]octan-4-yl)oxy)isobenzofuran-1(3H)-one INT-20 (218 mg, 0.84 mmol) and (R)-sec- butyl methanesulfonate INT-27 (192 mg, 1.26 mmol).
- Step 2 Ethyl 4-(((R)-6-((S)-sec-butyl)-6-azaspiro[2.5]octan-4-yl)oxy)-2- (chloromethyl)benzoate (29)
- Compound 29 was made according to General Method IV starting from 5-(((R)-6-((S)- sec-butyl)-6-azaspiro[2.5]octan-4-yl)oxy)isobenzofuran-1(3H)-one 28 (98.8 mg, 0.31 mmol).
- Step 3 3-(5-(((R)-6-((S)-sec-butyl)-6-azaspiro[2.5]octan-4-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-30)
- Compound I-30 was made according to General Method V starting from ethyl 4-(((R)-6- ((S)-sec-butyl)-6-azaspiro[2.5]octan-4-yl)oxy)-2-(chloromethyl)benzoate 29 (88.3 mg, 0.23 mmol).
- Example 18 Diastereomers 3-(5-((5-ethyl-5-azaspiro[2.5]octan-7-yl)oxy)-1-oxoisoindolin- 2-yl)piperidine-2,6-dione (I-35)
- Step 1 Single Enantiomer of Ethyl 2-(chloromethyl)-4-((5-ethyl-5-azaspiro[2.5]octan-7- yl)oxy)benzoate (34)
- Compound 34 was made according to General Method IV starting from 5-((5-ethyl-5- azaspiro[2.5]octan-7-yl)oxy)isobenzofuran-1(3H)-one INT-33 peak 1 (20.88 mg, 0.073 mmol).
- Step 2 Diastereomers 3-(5-((5-ethyl-5-azaspiro[2.5]octan-7-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-35)
- Compound I-35 was made according to General Method V starting from single enantiomer of ethyl 2-(chloromethyl)-4-((5-ethyl-5-azaspiro[2.5]octan-7-yl)oxy)benzoate 34 (25.7 mg, 0.073 mmol). The reaction was concentrated and purified by reverse phase HPLC (15-40% ACN in water with 5 mM NH 4 OH as modifier).
- Test tubes contained 3 drops of formic acid prior to sample collection. Fractions containing desired product were lyophilized to afford formate salt of diastereomers 3-(5-((5-ethyl-5-azaspiro[2.5]octan-7-yl)oxy)-1-oxoisoindolin-2-yl)piperidine- 2,6-dione I-35 as a blueish solid.
- LCMS [M+H] + 398.4.
- Example 19 Diastereomers 3-(5-((5-ethyl-5-azaspiro[2.5]octan-7-yl)oxy)-1-oxoisoindolin- 2-yl)piperidine-2,6-dione (I-37)
- Step 1 Single Enantiomer of Ethyl 2-(chloromethyl)-4-((5-ethyl-5-azaspiro[2.5]octan-7- yl)oxy)benzoate (36)
- Compound 36 was made according to General Method IV starting from 5-((5-ethyl-5- azaspiro[2.5]octan-7-yl)oxy)isobenzofuran-1(3H)-one INT-33 peak 2 (18.93 mg, 0.066 mmol) to afford single enantiomer of ethyl 2-(chloromethyl)-4-((5-ethyl-5-azaspiro[2.5]octan-7- yl)oxy)benz
- Step 2 Diastereomers 3-(5-((5-ethyl-5-azaspiro[2.5]octan-7-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-37)
- I-37 was made according to General Method V starting from single enantiomer of ethyl 2-(chloromethyl)-4-((5-ethyl-5-azaspiro[2.5]octan-7-yl)oxy)benzoate 36 (23.2 mg, 0.066 mmol).
- Example 20 3-(5-(((1S*,5S*,6R*)-3-ethyl-3-azabicyclo[4.1.0]heptan-5-yl)oxy)-1- oxoisoindolin-2-yl)piperidine-2,6-dione (I-42)
- Step 1 Ethyl 2-(chloromethyl)-4-(((1S*,5S*,6R*)-3-ethyl-3-azabicyclo[4.1.0]heptan-5- yl)oxy)benzoate (41)
- Compound 41 was made according to General Method IV starting from 5- (((1S*,5S*,6R*)-3-ethyl-3-azabicyclo[4.1.0]heptan-5-yl)oxy)isobenzofuran-1(3H)-one INT-40 Peak 1 (86.4 mg, 0.32 mmol) to afford ethyl 2-(chloromethyl)-4-(((1S*,5S*,6R
- Step 2 3-(5-(((1S*,5S*,6R*)-3-ethyl-3-azabicyclo[4.1.0]heptan-5-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-42)
- Compound I-42 was made according to General Method V starting from ethyl 2- (chloromethyl)-4-(((1S*,5S*,6R*)-3-ethyl-3-azabicyclo[4.1.0]heptan-5-yl)oxy)benzoate 41 (107 mg, 0.32 mmol).
- Example 21 3-(5-(((1R*,5R*,6S*)-3-ethyl-3-azabicyclo[4.1.0]heptan-5-yl)oxy)-1- oxoisoindolin-2-yl)piperidine-2,6-dione (I-44)
- Step 1 Ethyl 2-(chloromethyl)-4-(((1R*,5R*,6S*)-3-ethyl-3-azabicyclo[4.1.0]heptan-5- yl)oxy)benzoate (43)
- Compound 43 was made according to General Method IV starting from 5- (((1R*,5R*,6S*)-3-ethyl-3-azabicyclo[4.1.0]heptan-5-yl)oxy)isobenzofuran-1(3H)-one INT-40 Peak 2 (50.7 mg, 0.19 mmol) to afford ethyl 2-(chloromethyl)-4-(((1R*,5R*,6S
- Step 2 3-(5-(((1R*,5R*,6S*)-3-ethyl-3-azabicyclo[4.1.0]heptan-5-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-44)
- Compound I-26 was made according to General Method V starting from ethyl 2- (chloromethyl)-4-(((1R*,5R*,6S*)-3-ethyl-3-azabicyclo[4.1.0]heptan-5-yl)oxy)benzoate 43 (62.5 mg, 0.19 mmol).
- Step 2 3-(5-(((1S*,5R*,6R*)-3-ethyl-3-azabicyclo[4.1.0]heptan-5-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-49)
- Compound I-49 was made according to General Method V starting from ethyl 2- (chloromethyl)-4-(((1S*,5R*,6R*)-3-ethyl-3-azabicyclo[4.1.0]heptan-5-yl)oxy)benzoate 48 (58.4 mg, 0.17 mmol).
- Example 23 3-(5-(((3R,6R)-1-ethyl-6-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-52)
- Step 1 Tert-butyl (2R,5R)-5-((2-(2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin-3- yl)-1-oxoisoindolin-5-yl)oxy)-2-methylpiperidine-1-carboxylate (50)
- Compound 50 was made according to General Method VI starting from 3-(5-bromo-1- oxoisoindolin-2-yl)-1-((2-(trimethylsilyl)ethoxy)methyl)piperidine-2,6-dione INT-1 (500 mg, 1.10 mmol) and tert-butyl (2R,5R)-5-hydroxy-2-methylpiperidine
- Step 2 3-(5-(((3R,6R)-6-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (51)
- Compound 51 was made according to General Method VII starting from tert-butyl (2R,5R)-5-((2-(2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin-3-yl)-1-oxoisoindolin-5- yl)oxy)-2-methylpiperidine-1-carboxylate 50 (251 mg, 0.43 mmol).
- the reaction mixture was diluted with saturated aqueous sodium bicarbonate and extracted with 4:1 DCM:TFE three times.
- Step 3 3-(5-(((3R,6R)-1-ethyl-6-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine- 2,6-dione (I-52)
- To a solution of 3-(5-(((3R,6R)-6-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione 51 (62 mg, 0.17 mmol) and sodium triacetoxyborohydride (55.1 mg, 0.26 mmol) in EtOH (1 mL) was added acetaldehyde (0.015 mL, 0.260 mmol) at 0 °C.
- Example 24 3-(5-(((R)-1-(but-2-yn-1-yl)piperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine- 2,6-dione (I-53)
- DIPEA 51 uL, 0.291 mmol
- 1-bromo-2-butyne 17. uL, 0.189 mmol
- the reaction stirred at 120 °C for 2 hrs under microwave radiation.
- the reaction was diluted with acetone and concentrated onto ISOLUTE® (HM-N Part No. 9800-5000).
- the product was lyophilized to afford 3-(5-(((R)-1-(but-2-yn-1-yl)piperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione I-53.
- Example 25 3-(5-(((R)-1-(3-cyclopropylprop-2-yn-1-yl)piperidin-3-yl)oxy)-1-oxoisoindolin- 2-yl)piperidine-2,6-dione (I-54) 3-(1-oxo-5-(((R)-piperidin-3-yl)oxy)isoindolin-2-yl)piperidine-2,6-dione INT-2 (73 mg, 0.21 mmol) was added to a 5 mL microwave vial, followed by the addition of (3-bromoprop-1-yn-1- yl)cyclopropane (44 mg, 0.28 mmol) in ACN (2.1 mL) and DIPEA (74 uL, 0.425 mmol).
- Example 26 3-(5-(((R)-1-((1s,3S)-3-ethoxycyclobutyl)piperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-56)
- a 5 mL microwave vial was charged with 3-(1-oxo-5-(((R)-piperidin-3-yl)oxy)isoindolin-2- yl)piperidine-2,6-dione INT-2 (60 mg, 0.18 mmol), (1r,3r)-3-ethoxycyclobutyl methanesulfonate INT-55 (80 mg, 0.35 mmol), DIPEA (0.06 mL, 0.35 mmol) and ACN (0.5 mL).
- Example 27 3-(5-(((R)-1-(((1r,3R)-3-methoxycyclobutyl)methyl)piperidin-3-yl)oxy)-1- oxoisoindolin-2-yl)piperidine-2,6-dione (I-59)
- Compound I-59 was made according to General Method IX starting from 3-(1-oxo-5- (((R)-piperidin-3-yl)oxy)isoindolin-2-yl)piperidine-2,6-dione INT-2 (60 mg, 0.18 mmol) and ((1r,3r)-3-methoxycyclobutyl)methyl methanesulfonate INT-58 (51 mg, 0.26 mmol).
- Example 28 3-(5-(((R)-1-(7-oxaspiro[3.5]nonan-2-yl)piperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-61)
- Compound I-61 was made according to General Method IX starting from 3-(1-oxo-5- (((R)-piperidin-3-yl)oxy)isoindolin-2-yl)piperidine-2,6-dione INT-2 (70 mg, 0.20 mmol) and 7- oxaspiro[3.5]nonan-2-yl methanesulfonate INT-60 (79 mg, 0.36 mmol).
- Example 29 3-(5-(((R)-1-(3,3-difluorocyclobutyl)piperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-63) 3-(1-oxo-5-(((R)-piperidin-3-yl)oxy)isoindolin-2-yl)piperidine-2,6-dione INT-2 (50 mg, 0.15 mmol) and 3,3-difluorocyclobutyl methanesulfonate INT-62 (54 mg, 0.29 mmol) were added to a 2 mL microwave vial and suspended in ACN (0.73 mL).
- Example 30 3-(5-(((R)-1-(((1r,4R)-4-methoxycyclohexyl)methyl)piperidin-3-yl)oxy)-1- oxoisoindolin-2-yl)piperidine-2,6-dione (I-65)
- Compound I-65 was made according to General Method IX starting from 3-(1-oxo-5- (((R)-piperidin-3-yl)oxy)isoindolin-2-yl)piperidine-2,6-dione INT-2 (60 mg, 0.18 mmol) and ((1r,4r)-4-methoxycyclohexyl)methyl methanesulfonate INT-64 (58 mg, 0.26 mmol).
- Example 31 3-(5-(((R)-1-(but-3-en-1-yl)piperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine- 2,6-dione (I-67) 3-(1-oxo-5-(((R)-piperidin-3-yl)oxy)isoindolin-2-yl)piperidine-2,6-dione INT-2 (100 mg, 0.29 mmol) and cyclobutyl methanesulfonate INT-66 (66 mg, 0.44 mmol) were added to a 2 mL microwave vial and suspended in ACN (1.5 mL).
- Example 32 3-(5-(((R)-1-((R)-sec-butyl)piperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine- 2,6-dione (I-69)
- Compound I-69 was made according to General Method IX starting from 1- (hydroxymethyl)-3-(1-oxo-5-(((R)-piperidin-3-yl)oxy)isoindolin-2-yl)piperidine-2,6-dione INT-2 (100 mg, 0.29 mmol) and (S)-sec-butyl methanesulfonate INT-68 (66 mg, 0.44 mmol).
- Example 33 3-(5-(((R)-1-((S)-sec-butyl)piperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine- 2,6-dione (I-70)
- Compound I-70 was made according to General Method IX starting from 1- (hydroxymethyl)-3-(1-oxo-5-(((R)-piperidin-3-yl)oxy)isoindolin-2-yl)piperidine-2,6-dione INT-2 (100 mg, 0.29 mmol) and (R)-sec-butyl methanesulfonate INT-27 (66 mg, 0.44 mmol).
- Example 34 rac-3-(5-(((3R,5R)-1-Ethyl-5-hydroxypiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-73)
- Step 1 rac-Tert-butyl (3R,5R)-3-((2-(2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin- 3-yl)-1-oxoisoindolin-5-yl)oxy)-5-hydroxypiperidine-1-carboxylate (71) 71 was made according to General Method VI starting from 3-(5-bromo-1-oxoisoindolin- 2-yl)-1-((2-(trimethylsilyl)ethoxy)methyl)piperidine-2,6-dione INT-1 (850 mg, 1.88 mmol) rac-tert- butyl (3R,5R)-3,5-dihydroxy
- Step 2 rac-3-(5-(((3R,5R)-5-hydroxypiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6- dione (72) 72 was made according to General Method VII starting from 71 (453 mg, 0.77 mmol). The reaction was quenched with saturated aqueous NaHCO 3 and extracted with 4:1 DCM:EtOH three times. The organic layers were combined and concentrated to afford rac-3-(5-(((3R,5R)-5- hydroxypiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione 72 (276 mg, 0.768 mmol).
- Step 3 rac-3-(5-(((3R,5R)-1-ethyl-5-hydroxypiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-73)
- rac-3-(5-(((3R,5R)-5-hydroxypiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione 72 (276 mg, 0.77 mmol) and sodium triacetoxyborohydride (1.30 g, 6.14 mmol) in EtOH (5.0 mL) was added acetaldehyde (0.34 mL, 6.14 mmol) at 0 °C.
- Example 34a tert-butyl (3R,5R)-3-((2-(2,6-dioxo-1-((2- (trimethylsilyl)ethoxy)methyl)piperidin-3-yl)-1-oxoisoindolin-5-yl)oxy)-5- hydroxypiperidine-1-carboxylate (71a)
- Example 34a was synthesized by analogy to the previous Example 34 starting with tert- butyl (3R,5R)-3,5-dihydroxypiperidine-1-carboxylate.
- Example 35 rac-3-(5-(((3R,4S)-1-ethyl-4-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-76); (R)-3-(5-(((3R,4S)-1-ethyl-4-methylpiperidin-3-yl)oxy)-1- oxoisoindolin-2-yl)piperidine-2,6-dione, (S)-3-(5-(((3R,4S)-1-ethyl-4-methylpiperidin-3- yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione, (R)-3-(5-(((3S,4R)-1-ethyl-4- methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-d
- Step 1 rac-tert-butyl (3R,4S)-3-((2-(2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin- 3-yl)-1-oxoisoindolin-5-yl)oxy)-4-methylpiperidine-1-carboxylate (74) 74 was made according to General Method VI starting from 3-(5-bromo-1-oxoisoindolin- 2-yl)-1-((2-(trimethylsilyl)ethoxy)methyl)piperidine-2,6-dione INT-1 (1.85 g, 4.08 mmol) and rac- tert-butyl (3R,4S)-3-hydroxy-4-methylpiperidine-1-carboxylate (966 mg, 4.49 mmol).
- Step 3 rac-3-(5-(((3R,4S)-1-ethyl-4-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-76), (R)-3-(5-(((3R,4S)-1-ethyl-4-methylpiperidin-3-yl)oxy)-1- oxoisoindolin-2-yl)piperidine-2,6-dione, (S)-3-(5-(((3R,4S)-1-ethyl-4-methylpiperidin-3- yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione, (R)-3-(5-(((3S,4R)-1-ethyl-4- methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-d
- Example 36 3-(5-(((R)-1-ethylazepan-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (I- 79)
- Step 1 Tert-butyl (3R)-3-((2-(2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin-3-yl)-1- oxoisoindolin-5-yl)oxy)azepane-1-carboxylate (77)
- Compound 77 was made according to General Method VI starting from 3-(5-bromo-1- oxoisoindolin-2-yl)-1-((2-(trimethylsilyl)ethoxy)methyl)piperidine-2,6-dione INT-1 (200 mg, 0.44 mmol) and tert-butyl (3R)-3-hydroxyazepane-1-carboxylate (104 mg, 0.49 mmol).
- Step 2 3-(5-(((R)-azepan-3-yl)oxy)-1-oxoisoindolin-2-yl)-1-(hydroxymethyl)piperidine-2,6- dione (78)
- To tert-butyl (3R)-3-((2-(2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin-3-yl)-1- oxoisoindolin-5-yl)oxy)azepane-1-carboxylate 77 (44.4 mg, 0.076 mmol) dissolved in ACN (1.0 mL) was added methanesulfonic acid (0.1 mL, 1.54 mmol). The reaction stirred at r.t.
- Step 1 Tert-butyl (S)-3-((1-oxo-1,3-dihydroisobenzofuran-5-yl)oxy)azepane-1-carboxylate (80) To a 40 mL vial, 5-bromoisobenzofuranone (100 mg, 0.47 mmol), (S)-3-hydroxy-1-N- Boc-azepane (101 mg, 0.47 mmol), dtbbpy (12.6 mg, 0.047 mmol), NiCl 2 (glyme) (10.3 mg, 0.047 mmol), and Ir[dF(CF 3 )ppy) 2 dtbbpy]PF 6 (13.1 mg, 0.012 mmol) were added.
- Step 5 3-(5-(((S)-1-ethylazepan-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (I-84)
- Compound I-84 was made according to General Method V starting from ethyl (S)-2- (chloromethyl)-4-((1-ethylazepan-3-yl)oxy)benzoate 83 (20 mg, 0.059 mmol). The reaction was concentrated and purified by basic reverse phase HPLC (15-40% ACN in water with 5 mM NH 4 OH as modifer). Test tubes contained 3 drops of formic acid prior to sample collection. Fractions containing desired product were combined and concentrated to afford product as an indigo-coloured solid.
- Step 1 Tert-butyl (R)-3-((1-oxo-1,3-dihydroisobenzofuran-5-yl)oxy)azepane-1-carboxylate (85)
- Compound 85 was made according to General Method I starting from 5- bromoisobenzofuran-1(3H)-one (250 mg, 1.17 mmol) and tert-butyl (3R)-3-hydroxyazepane-1- carboxylate (278 mg, 1.29 mmol).
- Step 2 (R)-5-(azepan-3-yloxy)isobenzofuran-1(3H)-one (86)
- Tert-butyl (R)-3-((1-oxo-1,3-dihydroisobenzofuran-5-yl)oxy)azepane-1-carboxylate 85 (305 mg, 0.88 mmol) was suspended in dioxane (4.4 mL).4M HCl in dioxane (1.3 mL, 5.3 mmol) was added and the reaction stirred at r.t. for 72 hrs. The reaction was concentrated to afford (R)-5-(azepan-3-yloxy)isobenzofuran-1(3H)-one 86 as a clear oil.
- Step 4 Ethyl (R)-2-(chloromethyl)-4-((1-isobutylazepan-3-yl)oxy)benzoate (88)
- Compound 88 was made according to General Method IV starting from (R)-5-((1- isobutylazepan-3-yl)oxy)isobenzofuran-1(3H)-one 87 (30.3 mg, 0.10 mmol) to afford ethyl (R)-2- (chloromethyl)-4-((1-isobutylazepan-3-yl)oxy)benzoate 88 as a brown oil. Material was taken through to the next step without purification. LCMS [M+H] + : 368.5.
- Step 5 3-(5-(((R)-1-isobutylazepan-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (I- 89)
- Compound I-89 was made according to General Method V starting from ethyl (R)-2- (chloromethyl)-4-((1-isobutylazepan-3-yl)oxy)benzoate 88 (36.8 mg, 0.10 mmol). The reaction was concentrated onto CELITE®. The dry loading tube was first filled with 1/2 inch of activated charcoal, then a filter pad, the CELITE® residue, and a second filter pad.
- Example 39 3-(5-(((R)-1-ethylpyrrolidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (I-94)
- Step 1 Tert-butyl (R)-3-((1-oxo-1,3-dihydroisobenzofuran-5-yl)oxy)pyrrolidine-1- carboxylate (90)
- Compound 90 was made according to General Method I starting from 5- bromoisobenzofuran-1(3H)-one (100 mg, 0.47 mmol) and (R)-1-N-Boc-3-hydroxy-pyrrolidine (97 mg, 0.52 mmol).
- Step 2 (R)-5-(pyrrolidin-3-yloxy)isobenzofuran-1(3H)-one (91)
- Tert-butyl (R)-3-((1-oxo-1,3-dihydroisobenzofuran-5-yl)oxy)pyrrolidine-1-carboxylate 90 (98 mg, 0.31 mmol) was suspended in dioxane (3.1 mL).
- 4M HCl in dioxane (0.46 mL, 1.84 mmol) was added and the reaction stirred at r.t. for 2 hrs.
- Trifluoroethanol (1 mL) was added followed by additional 4M HCl in dioxane (0.46 mL, 1.84 mmol).
- Step 3 (R)-5-((1-ethylpyrrolidin-3-yl)oxy)isobenzofuran-1(3H)-one (92)
- Compound 92 was made according to General Method X starting from (R)-5-(pyrrolidin- 3-yloxy)isobenzofuran-1(3H)-one 91 (67.3 mg, 0.31 mmol) and acetaldehyde (26 ⁇ L, 0.46 mmol).
- Step 4 Ethyl (R)-2-(chloromethyl)-4-((1-ethylpyrrolidin-3-yl)oxy)benzoate (93)
- Compound 93 was made according to General Method IV starting from (R)-5-((1- ethylpyrrolidin-3-yl)oxy)isobenzofuran-1(3H)-one 92 (17.5 mg, 0.071 mmol) to afford ethyl (R)-2- (chloromethyl)-4-((1-ethylpyrrolidin-3-yl)oxy)benzoate 93 as a brown oil. Material was taken through to the next step without purification. LCMS [M+H] + : 312.3.
- Step 5 3-(5-(((R)-1-ethylpyrrolidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (I-94)
- Compound I-94 was made according to General Method V starting from ethyl (R)-2- (chloromethyl)-4-((1-ethylpyrrolidin-3-yl)oxy)benzoate 93 (22 mg, 0.071 mmol). The reaction was concentrated and purified by reverse phase HPLC (10-30% ACN in water with 5 mM NH 4 OH as modifier). Test tubes contained 3 drops of formic acid prior to sample collections.
- Example 40 3-(5-(((S)-1-ethylpyrrolidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (I-99)
- Compound I-99 was made according to the previous Example 39, except that step 1 employed (S)-1-N-boc-3-hydroxy-pyrrolidine.
- Example 41 3-(5-(((3R,6S)-1-ethyl-6-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-102)
- Step 1 Tert-butyl (2S,5R)-5-((2-(2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin-3- yl)-1-oxoisoindolin-5-yl)oxy)-2-methylpiperidine-1-carboxylate (100)
- 3-(5-bromo-1-oxoisoindolin-2-yl)-1-((2- (trimethylsilyl)ethoxy)methyl)piperidine-2,6-dione INT-1 (527 mg, 1.16 mmol), dtbbpy (16 mg, 0.058 mmol), NiCl 2 (glyme) (13 mg
- Step 2 3-(5-(((3R,6S)-6-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (101)
- Compound 101 was made according to General Method VII starting from tert-butyl (2S,5R)-5-((2-(2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin-3-yl)-1-oxoisoindolin-5- yl)oxy)-2-methylpiperidine-1-carboxylate 100 (525 mg, 0.89 mmol).
- Step 3 3-(5-(((3R,6S)-1-ethyl-6-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine- 2,6-dione (I-102)
- Example 42 3-(5-(((R)-1-cyclopentylpiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine- 2,6-dione (I-103)
- the reaction was stirred at r.t. for 1 hr.
- the reaction was diluted with 4:1 DCM:iPrOH and washed with saturated aqueous sodium bicarbonate.
- the organic layer was passed through a phase separator and concentrated onto CELITE®.
- Example 43 3-(5-(((R)-1-cyclohexylpiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6- dione (I-104)
- Compound I-104 was prepared in an analogous manner to previous Example 42 (I-103).
- Example 44 rac-3-(5-(((2R,3R)-1-ethyl-2-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-107)
- Step 1 rac-Tert-butyl (2R,3R)-3-((2-(2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin- 3-yl)-1-oxoisoindolin-5-yl)oxy)-2-methylpiperidine-1-carboxylate (105)
- Step 2 rac-3-(5-(((2R,3R)-2-Methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6- dione (106)
- Compound 106 was made according to General Method VII starting from rac-tert-butyl (2R,3R)-3-((2-(2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin-3-yl)-1-oxoisoindolin-5- yl)oxy)-2-methylpiperidine-1-carboxylate 105 (588 mg, 1.0 mmol).
- Step 3 rac-3-(5-(((2R,3R)-1-Ethyl-2-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-107)
- a vial containing rac-3-(5-(((2R,3R)-2-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione 106 (177 mg, 0.50 mmol) and ACN (4.0 mL) was added sodium triacetoxyborohydride (315 mg, 1.5 mmol) followed by acetaldehyde (60 uL, 0.99 mmol).
- reaction stirred at r.t. for 1 hr.
- Material was diluted with 1:3 ACN:water, lyophilized and further purified by basic reverse phase HPLC (15-40% ACN in water with 5 mM NH4OH as modifier). Test tubes contained 3 drops formic acid prior to sample collection.
- Example 45 rac-3-(5-(((3R,5S)-1-ethyl-5-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-111); (R)-3-(5-(((3R,5S)-1-ethyl-5-methylpiperidin-3-yl)oxy)-1- oxoisoindolin-2-yl)piperidine-2,6-dione, (S)-3-(5-(((3R,5S)-1-ethyl-5-methylpiperidin-3- yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione, (R)-3-(5-(((3S,5R)-1-ethyl-5- methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-d
- Step 1 rac-Tert-butyl (3R,5S)-3-((2-(2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin- 3-yl)-1-oxoisoindolin-5-yl)oxy)-5-methylpiperidine-1-carboxylate (109)
- Compound 109 was made according to General Method VI starting from 3-(5-bromo-1- oxoisoindolin-2-yl)-1-((2-(trimethylsilyl)ethoxy)methyl)piperidine-2,6-dione INT-1 (750 mg, 1.65 mmol) and rac-tert-butyl (3R,5S)-3-hydroxy-5-methylpiperidine-1-carboxylate (356 mg, 1.65 mmol).
- Step 2 rac-3-(5-(((3R,5S)-5-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6- dione (110)
- Compound 110 was made according to General Method VII starting from rac-tert-butyl (3R,5S)-3-((2-(2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin-3-yl)-1-oxoisoindolin-5- yl)oxy)-5-methylpiperidine-1-carboxylate 109 (970 mg, 1.65 mmol).
- Step 3 rac-3-(5-(((3R,5S)-1-ethyl-5-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-111); (R)-3-(5-(((3R,5S)-1-ethyl-5-methylpiperidin-3-yl)oxy)-1- oxoisoindolin-2-yl)piperidine-2,6-dione, (S)-3-(5-(((3R,5S)-1-ethyl-5-methylpiperidin-3- yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione, (R)-3-(5-(((3S,5R)-1-ethyl-5- methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-d
- Example 46 rac-3-(5-(((3R,4R)-1-ethyl-4-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-114); (R)-3-(5-(((3R,4S)-1-ethyl-4-methylpiperidin-3-yl)oxy)-1- oxoisoindolin-2-yl)piperidine-2,6-dione, (S)-3-(5-(((3R,4S)-1-ethyl-4-methylpiperidin-3- yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione, (R)-3-(5-(((3S,4R)-1-ethyl-4- methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-d
- Step 3 rac-3-(5-(((3R,4R)-1-ethyl-4-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-114); (R)-3-(5-(((3R,4S)-1-ethyl-4-methylpiperidin-3-yl)oxy)-1- oxoisoindolin-2-yl)piperidine-2,6-dione, (S)-3-(5-(((3R,4S)-1-ethyl-4-methylpiperidin-3- yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione, (R)-3-(5-(((3S,4R)-1-ethyl-4- methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-d
- Example 47 rac-3-(5-(((3R,5S)-1-ethyl-5-hydroxypiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-117)
- Step 1 rac-Tert-butyl (3R,5S)-3-((2-(2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin- 3-yl)-1-oxoisoindolin-5-yl)oxy)-5-hydroxypiperidine-1-carboxylate (115)
- Step 2 rac-3-(5-(((3R,5S)-5-hydroxypiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6- dione (116)
- Compound 116 was made according to General Method VII starting from rac-tert-butyl (3R,5S)-3-((2-(2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin-3-yl)-1-oxoisoindolin-5- yl)oxy)-5-hydroxypiperidine-1-carboxylate 115 (550 mg, 0.93 mmol).
- Step 3 rac-3-(5-(((3R,5S)-1-ethyl-5-hydroxypiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-117)
- a vial containing rac-3-(5-(((3R,5S)-5-hydroxypiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione 116 34 mg, 0.095 mmol
- ACN 2.0 mL
- sodium triacetoxyborohydride 60 mg, 0.28 mmol
- acetaldehyde 11 uL, 0.19 mmol
- the reaction stirred at r.t. for 1 hr.
- the material was further purified by basic reverse phase HPLC (10-30% ACN in water with 5 mM NH 4 OH as modifier).
- Test tubes contained 3 drops formic acid prior to sample collection.
- Example 48 3-(5-((1-ethyl-4,4-dimethylpiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine- 2,6-dione (I-123)
- Step 1 5-((1-ethyl-4,4-dimethylpiperidin-3-yl)oxy)isobenzofuran-1(3H)-one (121)
- Compound 121 was made according to General Method X starting from single enantiomer 5-((4,4-dimethylpiperidin-3-yl)oxy)isobenzofuran-1(3H)-one INT-119 (0.1 g, 0.336 mmol) and acetaldehyde (0.028 mL, 0.504 mmol).
- Step 2 Ethyl 2-(chloromethyl)-4-((1-ethyl-4,4-dimethylpiperidin-3-yl)oxy)benzoate (122)
- 5-((1-ethyl-4,4-dimethylpiperidin-3-yl)oxy)isobenzofuran-1(3H)-one 121 (0.033 g, 0.114 mmol) in dichloroethane (1.0 mL) and ethanol (1.0 mL) in a 25 mL 2 neck round bottom flask stirred at 70 °C was added thionyl chloride (0.10 mL, 1.368 mmol) dropwise. The reaction stirred at 70 °C overnight.
- Step 3 3-(5-((1-ethyl-4,4-dimethylpiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6- dione (I-123)
- Compound I-123 was made according to General Method V starting from ethyl 2- (chloromethyl)-4-((1-ethyl-4,4-dimethylpiperidin-3-yl)oxy)benzoate 122 (22.9 mg, 0.065 mmol). The reaction was concentrated and purified by silica gel chromatography pushing the crude material through a plug of charcoal before reaching the silica column (0-100% 3:1 ethyl acetate:ethanol with 1% triethylamine in heptane).
- Example 49 3-(5-((1-ethyl-4,4-dimethylpiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine- 2,6-dione (I-126)
- Example 49 (I-126) was synthesized by analogy to the previous Example 48 starting with single enantiomer INT-120. Absolute stereochmistry at 3-position of the piperidine ring of I-126 was not determined.
- Step 1 5-((1-ethyl-4,4-dimethylpiperidin-3-yl)oxy)isobenzofuran-1(3H)-one (124) LCMS [M+H] + : 290.1.
- Step 2 5-((1-ethyl-4,4-dimethylpiperidin-3-yl)oxy)isobenzofuran-1(3H)-one (125) Material was used directly in the next reaction without purification. LCMS [M+H] + : 354.3.
- the reaction was concentrated and purified by silica gel chromatography pushing the crude material through a plug of charcoal before reaching the silica column (0-100% 3:1 ethyl acetate:ethanol with 1% triethylamine in heptane). Fractions containing desired product were combined and concentrated. The material was further purified by basic reverse phase HPLC (25-50% ACN in water with 5 mM NH 4 OH as modifier). Test tubes contained 3 drops of formic acid prior to sample collection.
- Example 50 3-(5-((1-((S)-sec-butyl)-4,4-dimethylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-129)
- Step 1 5-((1-((S)-sec-butyl)-4,4-dimethylpiperidin-3-yl)oxy)isobenzofuran-1(3H)-one (127)
- Compound 127 was made according to General Method IX starting from single enantiomer 5-((4,4-dimethylpiperidin-3-yl)oxy)isobenzofuran-1(3H)-one INT-119 (0.1 g, 0.383 mmol) and (R)-sec-butyl methanesulfonate INT-27 (0.2 g, 1.314 mmol).
- Step 2 Ethyl 4-((1-((S)-sec-butyl)-4,4-dimethylpiperidin-3-yl)oxy)-2- (chloromethyl)benzoate (128)
- Compound 128 was made according to General Method IV starting from 5-((1-((S)-sec- butyl)-4,4-dimethylpiperidin-3-yl)oxy)isobenzofuran-1(3H)-one 127 (0.0408 g, 0.129 mmol).
- Step 3 3-(5-((1-((S)-sec-butyl)-4,4-dimethylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-129)
- Compound I-129 was made according to General Method V starting from ethyl 4-((1-((S)-sec- butyl)-4,4-dimethylpiperidin-3-yl)oxy)-2-(chloromethyl)benzoate 128 (49.3 mg, 0.129 mmol).
- reaction was concentrated and purified by silica gel chromatography pushing the crude material through a plug of charcoal before reaching the silica column (0-100% 3:1 ethyl acetate:ethanol with 1% triethylamine in heptane). Fractions containing desired product were combined and concentrated. The material was further purified by basic reverse phase HPLC (35-60% ACN in water with 5 mM NH 4 OH as modifier). Test tubes contained 3 drops formic acid prior to sample collection.
- Example 51 3-(5-((1-((S)-sec-butyl)-4,4-dimethylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-132)
- Example 51 (I-132) was synthesized by analogy to the previous Example 50 starting with single enentiomer INT-120. Absolute stereochmistry at 3-position of the piperidine ring of I-132 was not determined.
- Step 1 5-((1-((S)-sec-butyl)-4,4-dimethylpiperidin-3-yl)oxy)isobenzofuran-1(3H)-one (130) LCMS [M+H] + : 318.4.
- Step 2 Ethyl 4-((1-((S)-sec-butyl)-4,4-dimethylpiperidin-3-yl)oxy)-2- (chloromethyl)benzoate (131) Material was used directly in the next reaction. LCMS [M+H] + : 382.3. In the final step 3, the material was further purified by basic reverse phase HPLC (35- 60% ACN in water with 5 mM NH 4 OH as modifier). Test tubes contained 3 drops formic acid prior to sample collection.
- Example 52 rac-3-(5-(((3R,5R)-1-Ethyl-5-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-136)
- Step 1 rac-Tert-butyl (3R,5R)-3-((2-(2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin- 3-yl)-1-oxoisoindolin-5-yl)oxy)-5-methylpiperidine-1-carboxylate (134)
- 3-(5-bromo-1-oxoisoindolin-2-yl)-1-((2- (trimethylsilyl)ethoxy)methyl)piperidine-2,6-dione INT-1 (988 mg, 2.2 mmol), dtbbpy (29.2 mg, 0.11 mmol), NiC
- Step 2 rac-3-(5-(((3R,5R)-5-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6- dione (135)
- Compound 135 was made according to General Method VII starting from rac-tert-butyl (3R,5R)-3-((2-(2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin-3-yl)-1-oxoisoindolin-5- yl)oxy)-5-methylpiperidine-1-carboxylate 134 (1.11 g, 1.89 mmol).
- Step 3 rac-3-(5-(((3R,5R)-1-ethyl-5-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-136)
- a vial containing rac-3-(5-(((3R,5R)-5-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione 135 (629 mg, 1.76 mmol) and ACN (10.0 mL) was added sodium triacetoxyborohydride (1.12 g, 5.28 mmol) followed by acetaldehyde (200 uL, 3.5 mmol).
- Step 1 Ethyl 2-(chloromethyl)-4-(((1R*,5S*,6S*)-3-ethyl-3-azabicyclo[4.1.0]heptan-5- yl)oxy)benzoate (137)
- Compound 137 was made according to General Method IV starting from 5- (((1R*,5S*,6S*)-3-ethyl-3-azabicyclo[4.1.0]heptan-5-yl)oxy)isobenzofuran-1(3H)-one INT-47 Peak 2 (77.8 mg, 0.29 mmol).
- Step 2 3-(5-(((1R*,5S*,6S*)-3-ethyl-3-azabicyclo[4.1.0]heptan-5-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-138)
- Compound I-138 was made according to General Method V starting from ethyl 2- (chloromethyl)-4-(((1R*,5S*,6S*)-3-ethyl-3-azabicyclo[4.1.0]heptan-5-yl)oxy)benzoate 137 (70 mg, 0.21 mmol).
- Step 1 rac-Tert-butyl 5-((1-oxo-1,3-dihydroisobenzofuran-5-yl)oxy)-7- azaspiro[3.5]nonane-7-carboxylate (140)
- 5-bromoisobenzofuran-1(3H)-one 45 mg, 0.21 mmol
- rac-tert- butyl 5-hydroxy-7-azaspiro[3.5]nonane-7-carboxylate 52 mg, 0.22 mmol
- dtbbpy 5.7 mg, 0.021 mmol
- NiCl 2 (glyme) 4.6 mg, 0.021 mmol
- Ir[(dF(CF 3 )ppy) 2 dtbbpy]PF 6 4.7 mg, 4.2 ⁇ mol
- Step 2 rac-5-((7-azaspiro[3.5]nonan-5-yl)oxy)isobenzofuran-1(3H)-one (141)
- Compound 141 was made according to General Method II starting from rac-tert-butyl 5- ((1-oxo-1,3-dihydroisobenzofuran-5-yl)oxy)-7-azaspiro[3.5]nonane-7-carboxylate 140 (23 mg, 0.062 mmol).
- Step 3 rac-5-((7-ethyl-7-azaspiro[3.5]nonan-5-yl)oxy)isobenzofuran-1(3H)-one (142)
- Compound 142 was made according to General Method X starting from rac-5-((7- azaspiro[3.5]nonan-5-yl)oxy)isobenzofuran-1(3H)-one 141 (17 mg, 0.062 mmol) and acetaldehyde (5.3 ⁇ L, 0.093 mmol).
- Step 4 rac-Ethyl 2-(chloromethyl)-4-((7-ethyl-7-azaspiro[3.5]nonan-5-yl)oxy)benzoate (143)
- Compound 143 was made according to General Method IV starting from rac-5-((7-ethyl- 7-azaspiro[3.5]nonan-5-yl)oxy)isobenzofuran-1(3H)-one 142 (12.5 mg, 0.041 mmol) to afford rac-ethyl 2-(chloromethyl)-4-((7-ethyl-7-azaspiro[3.5]nonan-5-yl)oxy)benzoate 143 as a brown orange oil. Material was taken through to the next step without purification.
- Test tubes contained 3 drops formic acid prior to sample collection. Pure fractions were combined and lyophilized to afford formate salt of rac-3-(5-((7- ethyl-7-azaspiro[3.5]nonan-5-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione I-144 as a light blue solid.
- LCMS [M+H] + 412.2.
- Step 1 Tert-butyl (3S*,4S*)-4-fluoro-3-hydroxypiperidine-1-carboxylate (147)
- benzyl (3S*,4S*)-4-fluoro-3-hydroxypiperidine-1-carboxylate INT-146 Peak 1 (absolute stereochemistry unknown) (230 mg, 0.91 mmol) in MeOH (2 mL) was added Boc 2 O (218 mg, 0.23 mL, 1.0 mmol) and 10% Pd/C (50 mg, 0.047 mmol). The mixture stirred under an atmosphere of hydrogen gas at r.t. for 16 hrs.
- Step 2 Tert-butyl (3S*,4S*)-3-((2-(2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin-3- yl)-1-oxoisoindolin-5-yl)oxy)-4-fluoropiperidine-1-carboxylate (148) A mixture of 3-(5-bromo-1-oxoisoindolin-2-yl)-1-((2-(trimethylsilyl)ethoxy)methyl)piperidine- 2,6-dione INT-1 (100 mg, 0.22 mmol), tert-butyl (3S*,4S*)-4-fluoro-3-hydroxypiperidine-1- carboxylate (97 mg, 0.44 mmol), Ir[dF(CF 3 )ppy] 2 (dtbpy)(PF 6 ) (3 mg, 0.002 mmol) and NiCl 2 •dtbbpy (4 mg, 0.011 mmol),
- reaction vial was sealed with parafilm, placed 2 cm away from a blue LED, and irradiated at r.t. for 16 hrs.
- the reaction mixture was filtered and the filter cake was washed with ACN (3 x 5 mL). The combined filtrates were concentrated.
- Step 3 3-(5-(((3S*,4S*)-4-fluoropiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6- dione (149)
- Step 4 3-(5-(((3S*,4S*)-1-ethyl-4-fluoropiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine- 2,6-dione (I-150)
- Step 2 Tert-butyl (3R*,4R*)-3-((2-(2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin-3- yl)-1-oxoisoindolin-5-yl)oxy)-4-fluoropiperidine-1-carboxylate (152)
- tert-butyl (3R*,4R*)-4-fluoro-3-hydroxypiperidine-1- carboxylate 151 (73 mg, 0.33 mmol)
- Ir[dF(CF 3 )ppy] 2 (dtbpy)(PF 6 ) (3 mg, 0.002 mmol)
- NiCl 2 •dtbbpy 4 mg,
- reaction vial was sealed with parafilm, placed 2 cm away from one blue LED, and irradiated at r.t. for 16 hrs.
- the reaction mixture was filtered and the filter cake was washed with ACN (3 x 5 mL) and the combined filtrates were concentrated.
- Step 3 3-(5-(((3R*,4R*)-4-fluoropiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6- dione (153).
- MsOH 57 mg, 0.04 mL, 0.59 mmol
- tert-butyl (3R*,4R*)-3-((2- (2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin-3-yl)-1-oxoisoindolin-5-yl)oxy)-4- fluoropiperidine-1-carboxylate 152 (30 mg, 0.059 mmol) in ACN (0.5 mL).
- Step 4 3-(5-(((3R*,4R*)-1-ethyl-4-fluoropiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine- 2,6-dione (I-154) 2M ZnCl 2 in THF (0.2 mL, 0.42 mmol) was added to a mixture of 3-(5-(((3R*,4R*)-4- fluoropiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione 153 (50 mg, 0.12 mmol) and acetaldehyde (64 mg, 0.6 mmol, 40%) in THF:EtOH (1:1, 0.5 mL) at r.t.
- Step 1 Tert-butyl (3S*,4R*)-4-fluoro-3-hydroxypiperidine-1-carboxylate (156) Boc 2 O (371 mg, 0.39 mL, 1.7 mmol) and 10% Pd/C (100 mg, 0.094 mmol) were added to a solution of benzyl (3S,4R)-4-fluoro-3-hydroxypiperidine-1-carboxylate INT-155 Peak 1 (absolute stereochemistry undetermined) (430 mg, 1.7 mmol) in MeOH (5.0 mL) at r.t. and stirred under an atmosphere of hydrogen gas for 16 hrs.
- reaction vial was sealed with parafilm, placed 2 cm away from one blue LED, and irradiated at r.t. for 16 hrs.
- the reaction mixture was filtered and the filter cake was washed with ACN (3 x 5 mL). The filtrates were combined and concentrated.
- Step 3 3-(5-(((3S*,4R*)-4-fluoropiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6- dione (158) MsOH (406 mg, 0.27 mL, 4.22 mmol) was added to a solution of tert-butyl (3S*,4R*)-3-((2- (2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin-3-yl)-1-oxoisoindolin-5-yl)oxy)-4- fluoropiperidine-1-carboxylate 157 (250 mg, 0.42 mmol) in ACN (3.0 mL) and stirred at 40 °C for 2 hrs.
- Step 4 3-(5-(((3S*,4R*)-1-ethyl-4-fluoropiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine- 2,6-dione (I-159) 2M ZnCl 2 in THF (0.37 mL, 0.74 mmol) was added to a solution of 3-(5-(((3S*,4R*)-4- fluoropiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione 158 (100 mg, 0.25 mmol) and acetaldehyde (270 mg, 2.45 mmol, 40%) in THF:EtOH (1:1, 1 mL) at r.t.
- Step 1 Tert-butyl (3R*,4S*)-4-fluoro-3-hydroxypiperidine-1-carboxylate (160) Boc 2 O (389 mg, 0.41 mL, 1.78 mmol) and 10% Pd/C (100 mg, 0.094 mmol) were added to a solution of benzyl (3R,4S)-4-fluoro-3-hydroxypiperidine-1-carboxylate INT-155 Peak 2 (absolute stereochemistry undetermined) (430 mg, 1.7 mmol) in MeOH (5.0 mL) at 25 °C and stirred under an atmosphere of hydrogen gas for 16 hrs.
- Step 2 Tert-butyl (3R*,4S*)-3-((2-(2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin-3- yl)-1-oxoisoindolin-5-yl)oxy)-4-fluoropiperidine-1-carboxylate (161) A mixture of 3-(5-bromo-1-oxoisoindolin-2-yl)-1-((2-(trimethylsilyl)ethoxy)methyl)piperidine- 2,6-dione INT-1 (260 mg, 0.57 mmol), tert-butyl (3R*,4S*)-4-fluoro-3-hydroxypiperidine-1- carboxylate 160 (250 mg, 1.15 mmol), Ir[dF(CF 3 )ppy] 2 (dtbpy)(PF 6 ) (7 mg, 0.006 mmol), NiCl 2 •dtbbpy (1 mg, 0.003 mmol), qui
- reaction vial was sealed with parafilm, placed 2 cm away from one blue LED, and irradiated at r.t. for 16 hrs.
- the reaction mixture was filtered and the filter cake was washed with ACN (3 x 5 mL). The filtrates were combined and concentrated.
- Step 3 3-(5-(((3R*,4S*)-4-fluoropiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6- dione (162) MsOH (422 mg, 0.29 mL, 4.4 mmol) was added to a solution of tert-butyl (3R*,4S*)-3-((2- (2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin-3-yl)-1-oxoisoindolin-5-yl)oxy)-4- fluoropiperidine-1-carboxylate 161 (260 mg, 0.44 mmol) in ACN (3.0 mL) and stirred at 40 °C for 2 hrs.
- Step 1 Tert-butyl (3S,5R)-3-fluoro-5-hydroxypiperidine-1-carboxylate (166) Boc 2 O (1.2 g, 5.5 mmol) and 10% Pd(OH) 2 /C (300 mg, 0.21 mmol) were added to a solution of (3R,5S)-1-benzyl-3-(benzyloxy)-5-fluoropiperidine INT-164 (1.4 g, 4.5 mmol) in MeOH (20.0 mL) at r.t. The reaction mixture stirred at 60°C for 16 hrs under hydrogen gas (50 psi).
- Step 2 Tert-butyl (3R,5S)-3-((2-(2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin-3- yl)-1-oxoisoindolin-5-yl)oxy)-5-fluoropiperidine-1-carboxylate (167) A mixture of (3S,5R)-3-fluoro-5-hydroxypiperidine-1-carboxylate 166 (387 mg, 1.8 mmol), 3- (5-bromo-1-oxoisoindolin-2-yl)-1-((2-(trimethylsilyl)ethoxy)methyl)piperidine-2,6-dione INT-1 (400 mg, 0.88 mmol), Ir[dF(CF 3 )ppy] 2 (dtbpy)(PF 6 ) (10 mg, 0.009 mmol) and NiCl 2 •dtbbpy (18 mg, 0.044 mmol), quinuclidine (10 mg,
- the reaction vial was sealed with parafilm, placed 2 cm away from a blue LED, and irradiated at r.t. for 16 hr.
- the reaction mixture was filtered, the filter cake was washed with EtOAc (3 x 10 mL) and the combined filtrates were concentrated.
- Step 3 3-(5-(((3R,5S)-5-fluoropiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (168) MsOH (568 mg, 0.38 mL, 5.9 mmol) was added to a solution of tert-butyl (3R,5S)-3-((2-(2,6- dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin-3-yl)-1-oxoisoindolin-5-yl)oxy)-5- fluoropiperidine-1-carboxylate 167 (350 mg, 0.59 mmol) in ACN (2.1 mL) and stirred at 40 °C for 2 hrs.
- reaction mixture was cooled to 0 °C, Et 3 N (777 mg, 1.1 mL, 7.7 mmol) was added drop wise followed by DMEDA (104 mg, 0.13 mL, 1.2 mmol). The reaction mixture stirred at r.t. for 14 hrs. The reaction mixture was concentrated and the crude material was purified by reverse phase HPLC (2-32% ACN in water with 10 mM NH 4 HCO 3 as modifier).
- Step 4 3-(5-(((3R,5S)-1-ethyl-5-fluoropiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine- 2,6-dione (I-169)
- Step 1 Tert-butyl (3R,5R)-3-fluoro-5-hydroxypiperidine-1-carboxylate (170) Boc 2 O (1.3 g, 6.0 mmol) and 10% Pd(OH) 2 /C (300 mg, 0.21 mmol) were added to a solution of (3R,5R)-1-benzyl-3-(benzyloxy)-5-fluoropiperidine INT-165 (1.5 g, 5.0 mmol) in MeOH (30.0 mL) at r.t. The reaction mixture stirred at 60 °C for 16 hrs under H 2 (50 psi). The suspension was filtered through a pad of CELITE® and the pad was washed with MeOH (3 x 20 mL).
- Step 2 tert-butyl (3R,5R)-3-((2-(2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin-3- yl)-1-oxoisoindolin-5-yl)oxy)-5-fluoropiperidine-1-carboxylate (171)
- a mixture of tert-butyl (3R,5R)-3-fluoro-5-hydroxypiperidine-1-carboxylate 170 (289 mg, 1.32 mmol)
- Ir[dF(CF 3 )ppy] 2 (dtbpy)(PF 6 ) (7 mg, 0.006 mmol) and NiCl 2 •dtbbpy (13 mg, 0.0
- reaction vial was sealed with parafilm, placed 2 cm away from a blue LED, and irradiated at r.t. for 16 hrs.
- the reaction mixture was filtered, the filter cake was washed with EtOAc (3 x 5 mL) and the filtrate was concentrated.
- Step 3 3-(5-(((3R,5R)-5-fluoropiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (172)
- MsOH (487 mg, 0.33 mL, 5.1 mmol) was added to a solution of tert-butyl (3R,5R)-3-((2-(2,6- dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin-3-yl)-1-oxoisoindolin-5-yl)oxy)-5- fluoropiperidine-1-carboxylate 171 (300 mg, 0.51 mmol) in ACN (3.0 mL).
- reaction stirred at 40 °C for 2 hrs.
- the reaction mixture was cooled to 0 °C, Et 3 N (667 mg, 0.92 mL, 6.6 mmol) was added dropwise followed by DMEDA (89 mg, 0.11 mL, 1.0 mmol).
- DMEDA 89 mg, 0.11 mL, 1.0 mmol.
- the reaction mixture stirred at r.t. for 14 hrs.
- the reaction mixture was concentrated and the crude material was purified by reverse phase HPLC (10-40% ACN in water with 10 mM NH 4 HCO 3 as modifier).
- Step 1 rac-Tert-butyl 6-((2-(2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin-3-yl)-1- oxoisoindolin-5-yl)oxy)-2-azabicyclo[2.2.1]heptane-2-carboxylate (175)
- Example 62 rac-3-(5-((2-ethyl-2-azabicyclo[2.2.1]heptan-6-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione
- the reaction stirred at r.t. for 1 hr.
- the reaction was poured into saturated aqueous sodium bicarbonate and extracted with 4:1 DCM/iPrOH three times.
- the organics layers were combined, passed through a phase separator, and concentrated.
- the crude material was purified by basic reverse phase HPLC (15-40% ACN in water with 5 mM NH 4 OH as modifier). Test tubes contained 3 drops formic acid prior to sample collection.
- Example 63 3-(5-(((3R,5R)-5-ethoxy-1-ethylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-181)
- Step 1 tert-butyl (3R,5R)-3-((2-(2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin-3- yl)-1-oxoisoindolin-5-yl)oxy)-5-ethoxypiperidine-1-carboxylate (179)
- N 1 ,N 1 ,N 8 ,N 8 -tetramethylnaphthalene-1,8-diamine 155 mg, 0.725 mmol
- Step 3 3-(5-(((3R,5R)-5-ethoxy-1-ethylpiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine- 2,6-dione (I-181)
- the reaction was stirred at r.t. for 5 days.
- the reaction was poured into saturated aqueous sodium bicarbonate and extracted with 4:1 DCM/iPrOH three times. The organic layers were combined, passed through a phase separator, and concentrated onto CELITE®.
- Example 64 3-(5-(((3R,5R)-1-ethyl-5-methoxypiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-184)
- Step 1 tert-butyl (3R,5R)-3-((2-(2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin-3- yl)-1-oxoisoindolin-5-yl)oxy)-5-methoxypiperidine-1-carboxylate (182)
- N 1 ,N 1 ,N 8 ,N 8 -tetramethylnaphthalene-1,8-diamine 155 mg, 0.725 mmol
- Step 3 3-(5-(((3R,5R)-1-ethyl-5-methoxypiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine- 2,6-dione (I-184)
- Example 64 can be synthesised according to the scheme below, whereby the synthesis of Example 64.
- Example 64 The remaining steps outlined in Example 64 can then be employed to afford 3-(5-(((3R,5R)-1-ethyl-5- methoxypiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione.
- Example 65-1 and 65-2 3-(5-(((3R,5R)-1-ethyl-5-methoxypiperidin-3-yl)oxy)-1- oxoisoindolin-2-yl)piperidine-2,6-dione, Peak 1 and Peak 2
- the diastereomeric mixture of I-184 (0.22 g, 0.53 mmol) was separated via chiral SFC [Column 21 x 250 mm: (S,S) Whelk-O1; CO 2 Co-solvent 35%
- Example 65-1 Peak 1: Diastereomer 1 of 3-(5-(((3R,5R)-1-ethyl-5-methoxypiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione as a white solid. Chiral SFC Rt 3.77 mins.
- Example 65-2 Peak 2: Diastereomer 2 of 3-(5-(((3R,5R)-1-ethyl-5-methoxypiperidin-3-yl)oxy)- 1-oxoisoindolin-2-yl)piperidine-2,6-dione as a white solid.
- Example 66 3-(5-(((3R,5R)-1-ethyl-5-hydroxypiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-185)
- Example 66 (I-185) was synthesized by analogy to Example 34 starting with Example 34a (71a) Step 1: 3-(5-(((3R,5R)-5-hydroxypiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6- dione (186) LCMS [M+H] + : 360.2.
- Step 2 3-(5-(((3R,5R)-1-ethyl-5-hydroxypiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine- 2,6-dione (I-185)
- 3-(5-(((3R,5R)-5-hydroxypiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione 186 200 mg, 0.56 mmol
- sodium triacetoxyborohydride (354 mg, 1.67 mmol) in EtOH (2 mL) and MeCN (1 mL) was added acetaldehyde (0.063 mL, 1.1 mmol).
- Example 67 3-(5-(((3R,5R)-5-hydroxy-1-isopropylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-187)
- acetone 15 mL
- DMF 5 mL
- sodium triacetoxyborohydride (2.84 g, 13.4 mmol
- Example 68 (3R,5R)-3-((2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)oxy)-5-ethoxy-N- methylpiperidine-1-carboxamide (I-188)
- Example 69 ethyl (3R,5R)-3-((2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)oxy)-5- ethoxypiperidine-1-carboxylate (I-189)
- Example 70 3-(5-(((3R,5R)-1-acetyl-5-ethoxypiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-190)
- Example 71 3-(5-(((3R,5R)-5-ethoxy-1-(methylsulfonyl)piperidin-3-yl)oxy)-1-oxoisoindolin- 2-yl)piperidine-2,6-dione (I-191)
- reaction was stirred at r.t. for 1 hr.
- the reaction was poured into a saturated aqueous sodium bicarbonate solution and extracted with 4:1 DCM/iPrOH three times. The organic layers were combined, passed through a phase separator, and concentrated.
- the reaction was purified by reverse phase HPLC (5-95% ACN in water with 0.1% formic acid as modifier, 30x100 cyano column). Fractions containing desired product were combined and lyophilized to afford 3-(5-(((3R,5R)-5-ethoxy-1- (methylsulfonyl)piperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione I-191.
- Example 72 3-(5-(((3R,5R)-5-ethoxy-1-isobutylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-192)
- Example 73 3-(5-(((3R,5R)-1-cyclobutyl-5-ethoxypiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-193)
- MgSO4 (95.5 mg, 0.774 mmol)
- DMF 2.0 mL
- sodium triacetoxyborohydride 123 mg, 0.581 mmol
- cyclobutanone 290 uL, 3.87 mmol
- the reaction was stirred at r.t. for 1 hr.
- the reaction was poured into saturated aqueous sodium bicarbonate and extracted with 4:1 DCM/TFE three times.
- the organic layers were combined, passed through a phase separator, and concentrated.
- Example 74 3-(5-(((3R,5R)-5-ethoxy-1-isopropylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-194)
- MgSO4 (95.5 mg, 0.774 mmol)
- DMF 2.0 mL
- sodium triacetoxyborohydride 123 mg, 0.581 mmol
- acetone 284 uL, 3.87 mmol
- Example 75-1 and 75-2 3-(5-(((3R,5R)-1-ethyl-5-methylpiperidin-3-yl)oxy)-1-oxoisoindolin- 2-yl)piperidine-2,6-dione (I-202) and 3-(5-(((3R,5R)-1,5-dimethylpiperidin-3-yl)oxy)-1- oxoisoindolin-2-yl)piperidine-2,6-dione (I-203)
- Step 1 tert-butyl (3R,5S)-3-methyl-5-((methylsulfonyl)oxy)piperidine-1-carboxylate (196): To a solution of tert-butyl (3S,5R)-3-hydroxy-5-methylpiperidine-1-carboxylate (195) (4.03 g, 1 Eq, 18.7 mmol) in DCM (50 mL) at 0 o C were added triethylamine (2.84 g, 3.91 mL, 1.5 Eq, 28.1 mmol) and methanesulfonyl chloride (3.00 g, 2.03 mL, 1.4 Eq, 26.2 mmol). The reaction was stirred at 0 o C for 1 hr.
- reaction mixture was poured into 150 ml of saturated aqueuous sodium bicarbonate.
- the products were extracted 3x with DCM.
- the organic layers were passed through an isolute phase separator, and then the combined filtrate was concentrated to provide product tert-butyl (3R,5S)-3-methyl-5-((methylsulfonyl)oxy)piperidine-1- carboxylate 196 that was used directly into the next step without further purification.
- Step 2 tert-butyl (3R,5R)-3-(formyloxy)-5-methylpiperidine-1-carboxylate (197): To a solution of tert-butyl (3R,5S)-3-methyl-5-((methylsulfonyl)oxy)piperidine-1- carboxylate (196) (5.5 g, 1 Eq, 19 mmol) in Toluene (50 mL) were added potassium formate (3.2 g, 2 Eq, 37 mmol) and 1,4,7,10,13,16-hexaoxacyclooctadecane (9.9 g, 2 Eq, 37 mmol). The reaction was cooled to 23 o C, then diluted with water.
- Step 3 tert-butyl (3R,5R)-3-(hydroxy)-5-methylpiperidine-1-carboxylate (198): To a solution of tert-butyl (3R,5R)-3-(formyloxy)-5-methylpiperidine-1-carboxylate (197) (1.8 g, 1 Eq, 7.4 mmol) in MeOH (15 mL) at 23 °C was added Sodium methoxide (0.48 g, 18 mL, 0.5 molar in MeOH, 1.2 Eq, 8.9 mmol). The reaction mixture was poured into a flask containing water. The products were extracted 2x with DCM.
- Step 4 tert-butyl (3R,5R)-3-((2-(2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin-3- yl)-1-oxoisoindolin-5-yl)oxy)-5-methylpiperidine-1-carboxylate (199) tert-Butyl (3R,5R)-3-((2-(2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin-3-yl)-1- oxoisoindolin-5-yl)oxy)-5-methylpiperidine-1-carboxylate (199) was synthesized by analogy to Example 52, Step 1, starting with tert-butyl (3R,5R)-3-hydroxy-5-methylpiperidine-1-carboxylate (198).
- Step 5 3-(5-(((3R,5R)-5-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (200) and 1-(hydroxymethyl)-3-(5-(((3R,5R)-5-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (201) To a solution of tert-butyl (3R,5R)-3-((2-(2,6-dioxo-1-((2- (trimethylsilyl)ethoxy)methyl)piperidin-3-yl)-1-oxoisoindolin-5-yl)oxy)-5-methylpiperidine-1- carboxylate (199) (12.0 g, 1 Eq, 20.3 mmol) in MeCN (60mL) was added methanesulfonic acid (9.78 g, 6.61 mL, 5 Eq,
- the reaction was cooled to 0 °C and a stream of nitrogen gas was blown into the reaction flask while adding triethylamine (20.6 g, 28.4 mL, 10 Eq, 204 mmol) at 0 °C.
- N 1 ,N 2 -dimethylethane-1,2-diamine (DMEDA) (2.87 g, 3.49 mL, 1.6 Eq, 32.6 mmol
- DMEDA N 1 ,N 2 -dimethylethane-1,2-diamine
- the reaction was stirred for 1.5 hr at 0 o C.
- the reaction mixture was poured into saturated aqueous bicarbonate solution (400 ml) and was extracted with DCM (2x 200 mL).
- Step 6 3-(5-(((3R,5R)-1-ethyl-5-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine- 2,6-dione (I-202) and 3-(5-(((3R,5R)-1,5-dimethylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-203) To a vial containing a mixture of 3-(5-(((3R,5R)-5-methylpiperidin-3-yl)oxy)-1- oxoisoindolin-2-yl)piperidine-2,6-dione (200) and 1-(hydroxymethyl)-3-(5-(((3R,5R)-5- methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (201) (6.0
- Test tubes containing product were collected and poured into a separatory flask containing saturated aqueous sodium bicarbonate solution, extracted with 4:1 DCM/TFE and passed through an isolute phase separator and the solvents were concentrated.
- the crude oil was rediluted in 2:1 water/MeCN and lyophilized to afford 3-(5-(((3R,5R)-1,5-dimethylpiperidin- 3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione I-203 (0.19 g, 0.51 mmol) as a white solid.
- Example 75-1 3-(5-(((3R,5R)-1-ethyl-5-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-202); LCMS [M+H] + : 386.2.
- Example 75-2 3-(5-(((3R,5R)-1,5-dimethylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-203); LCMS [M + H] + : 372.4.
- Example 76-1 and 76-2 3-(5-(((3R,5R)-1-ethyl-5-methylpiperidin-3-yl)oxy)-1-oxoisoindolin- 2-yl)piperidine-2,6-dione, Peak 1 and Peak 2
- the diastereomeric mixture of 3-(5-(((3R,5R)-1-ethyl-5-methylpiperidin-3-yl)oxy)-1- oxoisoindolin-2-yl)piperidine-2,6-dione (I-202) (Example 75-1) was separated via chiral SFC [Column 21 x 250 mm Whelk-O1; CO 2 Co-solvent 35% IPA:ACN with 0.1% TEA; at 80 g/min at 125 bar at 25 o C] to afford the single diastereomers:
- Example 76-1 Peak 2: Diastereomer 2 of 3-(5-(((3R,5R)-1-ethyl-5-methylpiperidin-3- yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione as a white solid.
- Example 77 3-(5-(((3R,5R)-1-isopropyl-5-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione formate salt (I-204) To a vial containing (200) (0.14 g, 0.38 mmol) and DMF (2 mL) was added sodium triacetoxyborohydride (0.12 g, 0.58 mmol) and MgSO 4 (95 mg, 0.77 mmol) followed by acetone (0.28 mL, 3.9 mmol).
- Example 78 3-(5-(((3R,5R)-1-cyclobutyl-5-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione formate salt (I-205)
- To a vial containing 3-(5-(((3R,5R)-5-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (200) (0.1 g, 0.3 mmol) and DMF (1 mL) was added sodium triacetoxyborohydride (97 mg, 0.46 mmol) and MgSO4 (75 mg, 0.61 mmol) followed by cyclobutanone (228 uL, 3.05 mmol).
- Example 79 3-(5-(((3R,5R)-1-isobutyl-5-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione formate salt (I-206)
- To a vial containing 3-(5-(((3R,5R)-5-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (200) (179 mg, 0.5 mmol) and EtOH (2 ml) and DMF (1 mL) was added sodium triacetoxyborohydride (212 mg, 1 mmol) followed by isobutyraldehyde (68 uL, 0.75 mmol).
- Example 80 3-(5-(((3R,5R)-5-methyl-1-(methylsulfonyl)piperidin-3-yl)oxy)-1-oxoisoindolin- 2-yl)piperidine-2,6-dione (I-207)
- To a vial containing 3-(5-(((3R,5R)-5-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (200) 200 mg, 0.56 mmol
- DMAP 137 mg, 1.12 mmol
- Example 81 3-(5-(((3R,6S)-1-isopropyl-6-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-208)
- the reaction was stirred at r.t. for 9 days.
- the reaction was diluted with 4:1 DCM:iPrOH and washed with saturated aqueous sodium bicarbonate.
- the organic layer was passed through a phase separator and concentrated onto Celite ® .
- Example 82 3-(5-(((3R,6S)-1-cyclobutyl-6-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione hydrochloride salt (I-209)
- the reaction was stirred at r.t. for 9 days.
- the reaction was diluted with 4:1 DCM:iPrOH and washed with saturated aqueous sodium bicarbonate.
- the organic layer was passed through a phase separator and concentrated onto Celite ® .
- Example 83 ethyl (2S,5R)-5-((2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)oxy)-2- methylpiperidine-1-carboxylate (I-210)
- To a vial containing 3-(5-(((3R,6S)-6-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione 101 (Example 41, Step 2) 130 mg, 0.36 mmol
- DIPEA 130 ul, 0.74 mmol
- the reaction was stirred at r.t. for 1 hr.
- the reaction was quenched with 50% saturated aqueous sodium bicarbonate and extracted with 4:1 DCM/iPrOH three times.
- the combined organic phases were dried over anhydrous Na 2 SO 4 , filtered and concentrated under reduced pressure.
- the crude material was purified by reverse phase HPLC (5-95% ACN in water with 0.1% formic acid as modifier, cyano 30x100 column).
- Example 84 (2S,5R)-5-((2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)oxy)-N,2- dimethylpiperidine-1-carboxamide (I-211)
- To a vial containing 3-(5-(((3R,6S)-6-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione 101 (Example 41, Step 2) 75 mg, 0.21 mmol
- DBU 59 ul, 0.39 mmol
- DMSO 1.0 mL
- Example 85 3-(5-(((3R,6S)-6-methyl-1-(methylsulfonyl)piperidin-3-yl)oxy)-1-oxoisoindolin- 2-yl)piperidine-2,6-dione (I-212)
- reaction was stirred at 0-5 °C for 30 min and at r.t. for 30 min.
- the reaction was poured into a saturated aqueous sodium bicarbonate solution and extracted with 4:1 DCM/iPrOH three times. The combined organic phases were dried over anhydrous Na 2 SO 4 , filtered and concentrated under reduced pressure.
- the reaction was purified by reverse phase HPLC (5-95% ACN in water with 0.1% formic acid as modifier, 30x100 cyano column).
- Example 86 3-(5-(((3R,6S)-1-acetyl-6-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-213)
- reaction was stirred at r.t. for 4 hr.
- the reaction was poured into a saturated aqueous sodium bicarbonate solution and extracted with 4:1 DCM/iPrOH three times.
- the combined organic phases were dried over anhydrous Na 2 SO 4 , filtered and concentrated under reduced pressure.
- the reaction was purified by reverse phase HPLC (5-95% ACN in water with 0.1% formic acid as modifier). Fractions containing desired product were combined and lyophilized to afford 3-(5-(((3R,6S)-1-acetyl-6-methylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione I-213 as a white solid.
- Example 87-1 and 87-2 3-(1-oxo-5-(((3R,6S)-6-propylpiperidin-3-yl)oxy)isoindolin-2- yl)piperidine-2,6-dione (I-221) and 3-(5-(((3R,6S)-1-ethyl-6-propylpiperidin-3-yl)oxy)-1- oxoisoindolin-2-yl)piperidine-2,6-dione (I-222)
- Step 1 tert-butyl (S)-(1-(2,2-dimethyl-4,6-dioxo-1,3-dioxan-5-yl)-1-oxopentan-2- yl)carbamate
- CDI 15 g, 92 mmol
- acetonitrile 75 mL
- S -2-((tert- butoxycarbonyl)amino)pentanoic acid (214) (20 g, 92 mmol) portion-wise over 15 minutes at 15 °C.
- Step 2 tert-butyl (S)-(1-(2,2-dimethyl-4,6-dioxo-1,3-dioxan-5-yl)pentan-2-yl)carbamate (215)
- Step 3 tert-butyl (S)-2-oxo-5-propylpyrrolidine-1-carboxylate (216) tert-Butyl (S)-(1-(2,2-dimethyl-4,6-dioxo-1,3-dioxan-5-yl)pentan-2-yl)carbamate (215) (14.7 g, 44.6 mmol) was stirred in toluene at reflux for 3 hours. Reaction mixture was concentrated in vacuo to afford tert-butyl (S)-2-oxo-5-propylpyrrolidine-1-carboxylate 216 (10.4 g) as a yellow oil.
- Step 4 tert-butyl (S)-(8-(dimethyl(oxo)-l6-sulfaneylidene)-7-oxooctan-4-yl)carbamate (217) 2-Methylpropan-2-olate pottasium (4.21 g, 37.5 mmol) was added as a solid charge to a suspension of trimethyl(oxo)sulfonium iodide (9.35 g, 42.5 mmol) in DMSO (50 mL).
- Step 5 tert-butyl (S)-5-oxo-2-propylpiperidine-1-carboxylate (218)
- Step 6 tert-butyl (2S,5R)-5-hydroxy-2-propylpiperidine-1-carboxylate (219)
- tert-butyl (S)-5-oxo-2-propylpiperidine-1-carboxylate (218) 400 mg, 1.66 mmol
- EtOH 10 mL
- sodium borohydride 94.1 mg, 2.49 mmol
- the reaction mixture was concentrated in vacuo and saturated aqueous NH 4 Cl (30 mL) was added.
- the aqueous phase was extracted with DCM (4x). The combined organic fractions were dried over Na 2 SO 4 , filtered and concentrated in vacuo.
- Step 7 tert-butyl (2S,5R)-5-((2-(2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin-3- yl)-1-oxoisoindolin-5-yl)oxy)-2-propylpiperidine-1-carboxylate (220)
- Compound 220 was made according to General Method VI starting from 3-(5-bromo-1- oxoisoindolin-2-yl)-1-((2-(trimethylsilyl)ethoxy)methyl)piperidine-2,6-dione INT-1 (0.37 g, 0.81 mmol) and tert-butyl (2S,5R)-5-hydroxy-2-propylpiperidine-1-carboxylate (219) (0.18 g, 0.74 mmol).
- Step 8 3-(1-oxo-5-(((3R,6S)-6-propylpiperidin-3-yl)oxy)isoindolin-2-yl)piperidine-2,6-dione (I-221) (Example 87-1)
- Compound I-221 was made according to General Method VII starting from tert-Butyl (2S,5R)-5-((2-(2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin-3-yl)-1-oxoisoindolin-5- yl)oxy)-2-propylpiperidine-1-carboxylate 220 (0.38 g, 0.61 mmol). The reaction mixture was concentrated in vacuo.
- Step 9 3-(5-(((3R,6S)-1-ethyl-6-propylpiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine- 2,6-dione (I-222) (Example 87-2)
- To a solution of 3-(1-oxo-5-(((3R,6S)-6-propylpiperidin-3-yl)oxy)isoindolin-2-yl)piperidine- 2,6-dione I-221 (0.11 g, 0.27 mmol) and sodium triacetoxyborohydride (0.16 g, 0.74 mmol) in EtOH (2 mL) was added acetaldehyde (0.030 mL, 0.54 mmol) at 0 °C.
- Example 88-1 and 88-2 3-(5-((6,6-dimethylpiperidin-3-yl)oxy)-1-oxoisoindolin-2- yl)piperidine-2,6-dione (I-224) and 3-(5-((1-ethyl-6,6-dimethylpiperidin-3-yl)oxy)-1- oxoisoindolin-2-yl)piperidine-2,6-dione (I-225)
- Step 1 tert-butyl 5-((2-(2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin-3-yl)-1- oxoisoindolin-5-yl)oxy)-2,2-dimethylpiperidine-1-carboxylate (223)
- Compound 223 was made according to General Method VI starting from 3-(5-bromo-1- oxoisoindolin-2-yl)-1-((2-(trimethylsily
- Step 2 3-(5-((6,6-dimethylpiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (I- 224) (Example 88-1)
- Compound I-224 was made according to General Method VII starting from tert-butyl 5- ((2-(2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin-3-yl)-1-oxoisoindolin-5-yl)oxy)-2,2- dimethylpiperidine-1-carboxylate 223 (1.43 g, 2.38 mmol).
- Step 3 3-(5-((1-ethyl-6,6-dimethylpiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6- dione (I-225) (Example 88-2)
- To a solution of 3-(5-((6,6-dimethylpiperidin-3-yl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6- dione I-224 (479 mg, 1.29 mmol) and sodium triacetoxyborohydride (683 mg, 3.22 mmol) in EtOH (20 mL) was added acetaldehyde (0.14 mL, 2.5 mmol) at 0 °C.
- the HiBit tag was derived from a split Nanoluciferase and has the following protein sequence: VSGWRLFKKIS (SEQ ID NO: 1).
- the complementary fragment of Nanoluciferase (known as LgBit, from Promega), was added to the HiBit tag to form an active Nanoluciferase enzyme whose activity can be precisely measured.
- LgBit the complementary fragment of Nanoluciferase
- LgBit from Promega
- Lentiviral vectors based on the InvitrogenTM pLenti6.2/V5 DEST backbone were constructed that places the HiBit tag upstream of WIZ and expressed the fusion protein from an HSVTK promotor.
- HiBit-WIZ fusion protein To ensure moderate and consistent expression of the HiBit-WIZ fusion protein across all cells in the population, stable cell lines were constructed from cells harboring a single copy of the construct. Lentivirus packaged with the constructs were made using the ViraPowerTMkit from InvitrogenTM.293T cells from ATCC (Catalog number: CRL-3216), were infected with the virus at low multiplicity of infection and selected by 5 ⁇ g/mL blasticidin in culture media for 2 weeks. The levels of HiBit-WIZ tagged fusion proteins in compound-treated cell lines were measured as follows: On day 1, cells were diluted to 1.0 x 10 6 cells/ml in normal growth medium. 20 ⁇ L of cell suspension were plated in each well of a solid white 384-well plate.
- WIZ Amax reflects the DMSO-normalized, curve-fitted percentage of WIZ- HiBit remaining at 25 uM. It was calculated by normalizing DMSO controls to 100%, parametric curve fitting of the dose response data (10-point, 5-fold), followed by calculation of response at 25 uM using the fitted equation.
- Example 91 Quantification of SALL4 protein levels in HiBiT Tag Fusion Protein Assay
- the HiBiT system from Promega was used to develop high-throughput and quantitative assays to measure changes in SALL4 protein levels in response to compounds.
- the HiBiT tag was derived from a split Nanoluciferase and has the following protein sequence: VSGWRLFKKIS (SEQ ID No: 1).
- the complementary fragment of Nanoluciferase (known as LgBiT, from Promega), was added to the HiBiT tag to form an active Nanoluciferase enzyme whose activity can be precisely measured. In this way, the levels of a fusion protein with the HiBiT tag can be quantified in cell lysates.
- DNA constructs based on the Invitrogen pLenti6.2/V5 DEST backbone, were constructed with the HiBiT tag upstream of SALL4 and expressed the fusion protein from a CMV promotor. To ensure moderate and consistent expression of the HiBiT-SALL4 fusion protein across all cells in the population, stable cell lines were derived from clones. GripTite 293 MSR cells (293GT) from ThermoFisher Scientific (Catalog number: CRL-R79507), were stably transfected with prepared constructs via electroporation. Following recovery, cells were selected by 10 ug/mL blasticidin in culture media.
- HiBiT-SALL4 tagged fusion proteins in compound-treated cell lines were measured as follows: On day 1, cells were diluted to 1.0 x 10 6 cells/ml in normal growth medium.20 ⁇ L of cell suspension were plated in each well of a solid white 384-well plate. Plates were incubated overnight in a 37°C and 5% CO 2 humidified tissue culture incubator. On day 2, serial dilutions of compounds were made in 384-well plates.
- HiBiT substrate Na-Glo® HiBit Lytic Detection System, Promega Catalogue number: N3050
- SALL4 degradation activity of comparative compounds Table 3 shows comparative data demonstrating SALL4 degradation activity of compounds of the disclosure in the SALL4 HiBiT assay in 293T cells.
- SALL4 Amax reflects the DMSO-normalized, curve-fitted percentage of SALL4-HiBiT remaining at 50 uM.
- Example 92 Small Molecule HbF Induction Assay Cryopreserved primary human CD34 + hematopoietic stem and progenitor cells were obtained from AllCells, LLC. The CD34 + cells were isolated from the peripheral blood of healthy donors after mobilization by administration of granulocyte colony-stimulating factor. Cells were differentiated ex vivo toward the erythroid lineage using a 2-phase culture method.
- SFEM StemSpanTM Serum-Free Expansion Media
- rhSCF 50 ng/mL, Peprotech®, Inc.
- rhIL-6 50 ng/mL, Peprotech®, Inc.
- rhIL-3 50 ng/mL, Peprotech®, Inc.
- rhFlt3L 50 ng/mL, Peprotech®, Inc.
- 1X antibiotic-antimycotic Life Technologies, Thermo Fisher Scientific
- Erythroid Differentiation Media is comprised of IMDM (Life Technologies) supplemented with insulin (10 ⁇ g/mL, Sigma Aldrich), heparin (2 U/mL Sigma Aldrich), holo-transferrin (330 ⁇ g/mL, Sigma Aldrich), human serum AB (5%, Sigma Aldrich), hydrocortisone (1 ⁇ M, STEMCELL Technologies), rhSCF (100 ng/mL, Peprotech®, Inc.), rhIL-3 (5 ng/mL, Peprotech®, Inc.), rhEPO (3 U/mL, Peprotech®, Inc.), and 1X antibiotic- antimycotic.
- HbF-specific antibody 1:10-1:25, InvitrogenTM, MHFH04-4.
- Stained cells were washed with phosphate-buffered saline before analysis on the FACSCantoTM II flow cytometer or LSRFortessaTM (BD Biosciences). Data analysis was performed with FlowJoTM Software (BD Biosciences).
- HbF induction activity of compounds Table 4
- mPB CD34+ cells were expanded for 6 days, then erythroid differentiated in the presence of compound for 7 days. Cells were fixed, stained and analyzed by flow cytometry.
- HbF Amax the highest percentage of cells staining positive for HbF (%HbF+ cells) in the fitted dose-response curve.
- the baseline %HbF+ cells for DMSO-treated cells is approximately 30-40%.
- Example 93 Cell culture for shRNA and CRISPR assays HEK293T cells were maintained in DMEM high glucose complete media with sodium pyruvate, non-essential amino acids, 10% FBS, 2 mM L-glutamine, 100 U/mL pen/strep, 25 mM HEPES. Unless stated otherwise, all reagents for culturing HEK293T cells were obtained from InvitrogenTM.
- mPB CD34+ cells (AllCells, LLC) were maintained in StemSpanTM serum-free expansion media (SFEM) ( STEMCELL Technologies Inc.) supplemented with 50 ng/mL each of rhTPO, rhIL-6, rhFLT3L, rhSCF for 2-3 days prior to shRNA transduction or targeted ribonucleoprotein (RNP) electroporation targeting WIZ. All cytokines were obtained from Peprotech®, Inc. Cell cultures were maintained at 37°C and 5%CO 2 in a humidified tissue culture incubator.
- SFEM StemSpanTM serum-free expansion media
- Annealed double-stranded DNA oligonucleotides were ligated into pHAGE lentiviral backbone digested with PmeI/AscI using T4 DNA ligase kit (New England Biolabs). Ligation reactions were transformed into chemically competent Stbl3 cells (InvitrogenTM) according to the manufacturer’s protocol. Positive clones were verified using the sequencing primer (5’-ctacattttacatgatagg-3’; SEQ ID NO: 2) and plasmids were purified by Alta Biotech LLC.
- Lentivirus particles for the respective shRNA constructs were generated by co-transfection of HEK293T cells with pCMV-dR8.91 and pCMV-VSV-G expressing envelope plasmid using Lipofectamine 3000 reagent in 150mm tissue culture dish format as per manufacturer’s instructions (InvitrogenTM). Lentivirus supernatant was harvested 48 hours after co-transfection, filtered through a 0.45 ⁇ m filter (Millipore) and concentrated using Amicon Ultra 15 with Ultracel- 100 membrane (Millipore). Infectious units of each of the lentivirus particle was determined by flow cytometry using eGFP expression as marker of transduction after serial dilution and infection of HEK293T cells.
- shRNA sequences are as follows: shWIZ_#15’-AGCCCACAATGCCACGGAAAT-3’ (SEQ ID NO: 3); shWIZ_#25’-GCAACATCTACACCCTCAAAT-3’ (SEQ ID NO: 4); shWIZ_#45’-TGACCGAGTGGTACGTCAATG-3’ (SEQ ID NO: 5); shWIZ_#55’-AGCGGCAGAACATCAACAAAT-3’ (SEQ ID NO: 6). Lentiviral shRNA transduction and FACS of mPB CD34+ cells mPB CD34+ transduction was performed on retronectin coated non-tissue culture treated 96 well-flat bottom plates (Corning, Inc.).
- RetroNectin® (1 ⁇ g/mL) (TAKARABIO, Inc.), sealed and incubated at 4°C overnight. RetroNectin®was then removed and plates were incubated with BSA (bovine serum albumin) (1%) in PBS for 30 minutes at room temperature. Subsequently, BSA (bovine serum albumin) was aspirated and replaced with 100 ⁇ L of lentiviral concentrate and centrifuged at 2000xg for 2 hours at room temperature. Next, residual supernatant was gently pipetted out and ready for transductions of mPB CD34+ cells.
- BSA bovine serum albumin
- Sorted eGFP-positive cells were used for the erythroid differentiation assay.
- Targeting CRISPR knockout of WIZ Alt-R CRISPR-Cas9 crRNA and tracrRNA (5’- AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUC GGUGCUUU -3’; SEQ ID NO: 7) were purchased from Integrated DNA Technologies, Inc..
- Equimolar tracrRNA was annealed with WIZ targeting crRNA (Table 3) in Tris buffer (10 mM, pH 7.5) by heating at 95°C for 5 minutes using a polymerase chain reaction (PCR) machine (Bio- Rad) followed by cooling to room temperature on the benchtop.
- PCR polymerase chain reaction
- a ribonucleoprotein (RNP) complex was generated by mixing annealed tracrRNA:crRNA with 6 ug of Cas9 at 37°C for 5 minutes in 1x buffer containing HEPES (100 mM), KCl (50 mM), MgCl 2 (2.5 mM), glycerol (0.03%), DTT (1 mM) and Tris pH 7.5 (2 mM). Electroporation of the RNP complex was performed on a 4D-NucleofectorTM (Lonza) as per manufacturer’s recommendation.
- Table 5 Erythroid differentiation of shRNA transduced or RNP electroporated mPB CD34+ cells Erythroid differentiation was initiated by plating 8,000 RNP-electroporated or FACS sorted eGFP+ mPB CD34+ cells per well in 96-well tissue culture plate.
- Base differentiation media consists of IMDM (Iscove's Modified Dulbecco's Medium), human AB serum (5%), transferrin (330 ⁇ g/mL), Insulin (10 ⁇ g/mL) and Heparin (2 IU/mL).
- rhSCF 100 ng/mL
- rhIL-3 10 ng/mL
- rhEPO 2.5 U/mL
- hydrocortisone 1 ⁇ M
- rhSCF 100 ng/mL
- rhIL-3 10 ng/mL
- rhEPO 2.5 U/mL
- hydrocortisone 1 ⁇ M
- RNA-seq Two independent, targeted CRISPR/Cas9 knockout (KO) of WIZ were done using WIZ_6 and WIZ_18 gRNAs or a non-targeting scrambled gRNA negative control in mPB CD34+ HSCs.
- RNA sequencing libraries were prepared using the Illumina TruSeq Stranded mRNA Sample Prep protocol and sequenced using the Illumina NovaSeq6000 platform (Illumina). Samples were sequenced to a length of 2x76 base-pairs. For each sample, salmon version 0.8.2 (Patro et al.
- HbF intracellular staining One hundred thousand cells were aliquoted into U-bottom 96-well plate and stained for 20 min in the dark with diluted LIVE/DEAD fixable violet viability dye as per manufacturer’s recommendation (Invitrogen). Cells were washed with FACS staining buffer and subsequently stained with anti-CD71-BV711 (BD Biosciences) and anti-CD235a-APC (BD Biosciences) for 20 mins in the dark.
- WIZ KO upregulates HBG1/2 expression upon erythroid differentiation
- Targeted KO of WIZ using two independent gRNAs demonstrated upregulation of fetal hemoglobin genes (HBG1/2), as presented in Figure 1A.
- Loss of WIZ induces fetal hemoglobin expression in mPB CD34 + derived erythroid cells
- shRNA and CRISPR-Cas9-mediated knockdown and knockout functional genetics approaches were employed.
- mPB CD34 + cells were treated with shRNA or CRISPR-Cas9 reagents and erythroid differentiated for 7 days prior to flow cytometry analysis.
- WIZ is a regulator of fetal hemoglobin expression and represents a novel target for the treatment of sickle cell disease and beta-thalassemia.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Medicinal Chemistry (AREA)
- Epidemiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Diabetes (AREA)
- Hematology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Plural Heterocyclic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Priority Applications (14)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| MX2023014327A MX2023014327A (es) | 2021-06-03 | 2022-06-01 | Derivados de 3-(1-oxoisoindolin-2-il)piperidina-2,6-diona y sus usos medicos. |
| CA3215410A CA3215410A1 (en) | 2021-06-03 | 2022-06-01 | 3-(1-oxoisoindolin-2-yl)piperidine-2,6-dione derivatives and medical uses thereof |
| EP22731823.5A EP4347580A1 (en) | 2021-06-03 | 2022-06-01 | 3-(1-oxoisoindolin-2-yl)piperidine-2,6-dione derivatives and medical uses thereof |
| KR1020237045016A KR20240013812A (ko) | 2021-06-03 | 2022-06-01 | 3-(1-옥소이소인돌린-2-일)피페리딘-2,6-디온 유도체 및 이의 의학적 용도 |
| CN202280022964.9A CN117062811A (zh) | 2021-06-03 | 2022-06-01 | 3-(1-氧代异吲哚啉-2-基)哌啶-2,6-二酮衍生物及其医疗用途 |
| JP2023574412A JP2024520654A (ja) | 2021-06-03 | 2022-06-01 | 3-(1-オキソイソインドリン-2-イル)ピペリジン-2,6-ジオン誘導体及びその医療用使用 |
| IL308094A IL308094A (en) | 2021-06-03 | 2022-06-01 | 3-(1-OXOISOINDOLIN-2-YL)PIPERIDINE-2,6-DIONE DERIVATIVES AND THEIR MEDICAL USES |
| AU2022284366A AU2022284366A1 (en) | 2021-06-03 | 2022-06-01 | 3-(1-oxoisoindolin-2-yl)piperidine-2,6-dione derivatives and medical uses thereof |
| BR112023024905A BR112023024905A2 (pt) | 2021-06-03 | 2022-06-01 | Derivados de 3-(5-oxoisoindolin-2-il)piperidina-2,6-diona e seus usos |
| PE2023003180A PE20240657A1 (es) | 2021-06-03 | 2022-06-01 | Derivados de 3-(1-oxoisoindolin-2-il)piperidina-2,6-diona y sus usos medicos |
| CR20230614A CR20230614A (es) | 2021-06-03 | 2022-06-01 | Derivados de 3-(1-oxoisoindolin-2-il)piperidina-2,6-diona y sus usos médicos |
| DO2023000261A DOP2023000261A (es) | 2021-06-03 | 2023-11-29 | Derivados de 3(1oxoisoindolin2il)piperidina2,6diona y sus usos médicos |
| JOJO/P/2023/0308A JOP20230308A1 (ar) | 2021-06-03 | 2023-11-29 | 3-(1-أوكسويزويندولين-2-ييل)بيبيريدين-2,6-مشتقات ديون واستخداماتها الطبية |
| CONC2024/0000013A CO2024000013A2 (es) | 2021-06-03 | 2024-01-02 | Derivados de 3–(1–oxoisoindolin–2–il)piperidina–2,6–diona y sus usos médicos |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202163196422P | 2021-06-03 | 2021-06-03 | |
| US63/196,422 | 2021-06-03 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2022254362A1 true WO2022254362A1 (en) | 2022-12-08 |
Family
ID=82115547
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IB2022/055131 Ceased WO2022254362A1 (en) | 2021-06-03 | 2022-06-01 | 3-(1-oxoisoindolin-2-yl)piperidine-2,6-dione derivatives and medical uses thereof |
Country Status (22)
| Country | Link |
|---|---|
| US (2) | US12103919B2 (https=) |
| EP (1) | EP4347580A1 (https=) |
| JP (1) | JP2024520654A (https=) |
| KR (1) | KR20240013812A (https=) |
| CN (1) | CN117062811A (https=) |
| AR (1) | AR126052A1 (https=) |
| AU (1) | AU2022284366A1 (https=) |
| BR (1) | BR112023024905A2 (https=) |
| CA (1) | CA3215410A1 (https=) |
| CL (1) | CL2023003561A1 (https=) |
| CO (1) | CO2024000013A2 (https=) |
| CR (1) | CR20230614A (https=) |
| DO (1) | DOP2023000261A (https=) |
| EC (1) | ECSP24000004A (https=) |
| IL (1) | IL308094A (https=) |
| JO (1) | JOP20230308A1 (https=) |
| MX (1) | MX2023014327A (https=) |
| PE (1) | PE20240657A1 (https=) |
| PY (1) | PY2243958A (https=) |
| TW (1) | TW202306570A (https=) |
| UY (1) | UY39796A (https=) |
| WO (1) | WO2022254362A1 (https=) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11897862B2 (en) | 2022-03-17 | 2024-02-13 | Gilead Sciences, Inc. | IKAROS zinc finger family degraders and uses thereof |
| US12122764B2 (en) | 2021-12-22 | 2024-10-22 | Gilead Sciences, Inc. | IKAROS zinc finger family degraders and uses thereof |
| US12441711B2 (en) | 2022-11-04 | 2025-10-14 | Bristol-Myers Squibb Company | Compounds and their use for treatment of hemoglobinopathies |
| WO2025230875A1 (en) * | 2024-04-29 | 2025-11-06 | Bristol-Myers Squibb Company | Compounds and their use for treatment of hemoglobinopathies |
| US12617774B2 (en) | 2025-05-30 | 2026-05-05 | Novartis Ag | Substituted indole compounds and methods of use thereof |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN118598797A (zh) * | 2024-05-17 | 2024-09-06 | 诚达药业股份有限公司 | 一种手性3-羟基-4-氟哌啶衍生物的合成方法及拆分方法 |
| WO2026002044A1 (zh) * | 2024-06-25 | 2026-01-02 | 标新生物医药科技(上海)有限公司 | 含有硫/氧取代戊二酰亚胺基异吲哚啉酮骨架的双功能蛋白降解剂及它们的应用 |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004078163A2 (en) | 2003-02-28 | 2004-09-16 | Transform Pharmaceuticals, Inc. | Pharmaceutical co-crystal compositions of drugs such as carbamazepine, celecoxib, olanzapine, itraconazole, topiramate, modafinil, 5-fluorouracil, hydrochlorothiazide, acetaminophen, aspirin, flurbiprofen, phenytoin and ibuprofen |
| WO2012068512A1 (en) | 2010-11-18 | 2012-05-24 | Deuteria Pharmaceuticals Llc | 3-deutero-pomalidomide |
| WO2012079022A1 (en) | 2010-12-10 | 2012-06-14 | Concert Pharmaceuticals, Inc. | Substituted dioxopiperidinyl phthalimide derivatives |
| WO2018102725A1 (en) * | 2016-12-01 | 2018-06-07 | Arvinas, Inc. | Tetrahydronaphthalene and tetrahydroisoquinoline derivatives as estrogen receptor degraders |
| WO2020012334A1 (en) * | 2018-07-10 | 2020-01-16 | Novartis Ag | 3-(5-hydroxy-1-oxoisoindolin-2-yl)piperidine-2,6-dione derivatives and their use in the treatment of ikaros family zinc finger 2 (ikzf2)-dependent diseases |
| WO2020117759A1 (en) * | 2018-12-03 | 2020-06-11 | Dana-Farber Cancer Institute, Inc. | Small molecule degraders of helios and methods of use |
| WO2021124172A1 (en) * | 2019-12-18 | 2021-06-24 | Novartis Ag | 3-(5-methoxy-1-oxoisoindolin-2-yl)piperidine-2,6-dione derivatives and uses thereof |
Family Cites Families (23)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| PL3202460T3 (pl) | 2010-02-11 | 2019-12-31 | Celgene Corporation | Pochodne arylometoksyizoindoliny i zawierające je kompozycje oraz sposoby ich zastosowania |
| US9133161B2 (en) | 2012-07-27 | 2015-09-15 | Celgene Corporation | Processes for preparing isoindoline-1,3-dione compounds |
| WO2017024019A1 (en) | 2015-08-04 | 2017-02-09 | Celgene Corporation | Methods for treating chronic lymphocytic leukemia and the use of biomarkers as a predictor of clinical sensitivity to immunomodulatory therapies |
| EP3445765A4 (en) | 2016-04-22 | 2019-09-18 | Dana Farber Cancer Institute, Inc. | DECREASE OF CYCLINE-DEPENDENT KINASE 4/6 (CDK4 / 6) BY CONJUGATION OF CDK4 / 6 INHIBITORS WITH E3-LIGASE LIGANDS AND METHODS OF USE |
| CN110506039A (zh) | 2016-10-11 | 2019-11-26 | 阿尔维纳斯股份有限公司 | 用于雄激素受体靶向降解的化合物和方法 |
| MX2019005007A (es) | 2016-11-01 | 2019-07-18 | Arvinas Inc | Protac dirigidos a la proteína tau y métodos asociados de uso. |
| JP2020505327A (ja) | 2016-12-23 | 2020-02-20 | アルビナス・オペレーションズ・インコーポレイテッドArvinas Operations, Inc. | Egfrタンパク質分解標的化キメラ分子およびその関連する使用方法 |
| KR20250117470A (ko) | 2016-12-23 | 2025-08-04 | 아비나스 오퍼레이션스, 인코포레이티드 | 급속 진행성 섬유육종 폴리펩티드의 표적화 분해를 위한 화합물 및 방법 |
| US10806737B2 (en) | 2016-12-23 | 2020-10-20 | Arvinas Operations, Inc. | Compounds and methods for the targeted degradation of fetal liver kinase polypeptides |
| US11191741B2 (en) | 2016-12-24 | 2021-12-07 | Arvinas Operations, Inc. | Compounds and methods for the targeted degradation of enhancer of zeste homolog 2 polypeptide |
| BR112019015312A2 (pt) | 2017-01-26 | 2020-03-10 | Arvinas Operations, Inc. | Moduladores da proteólise pelo receptor de estrogênio e métodos de uso associados |
| AU2018351050B2 (en) | 2017-10-18 | 2025-09-18 | Novartis Ag | Compositions and methods for selective protein degradation |
| WO2019079701A1 (en) | 2017-10-20 | 2019-04-25 | Dana-Farber Cancer Institute, Inc. | HETEROBIFUNCTIONAL COMPOUNDS HAVING IMPROVED SPECIFICITY FOR BRD4 BROMODOMAINE |
| EP3710443A1 (en) | 2017-11-17 | 2020-09-23 | Arvinas Operations, Inc. | Compounds and methods for the targeted degradation of interleukin-1 receptor-associated kinase 4 polypeptides |
| IL315310A (en) | 2017-12-26 | 2024-10-01 | Kymera Therapeutics Inc | Irak degraders and uses thereof |
| EP3765026A4 (en) | 2018-03-10 | 2021-12-22 | Yale University | BTK PROTEOLYSIS MODULATORS AND METHODS FOR USE |
| WO2019195609A2 (en) | 2018-04-04 | 2019-10-10 | Arvinas Operations, Inc. | Modulators of proteolysis and associated methods of use |
| AU2019294835B2 (en) | 2018-06-29 | 2025-04-17 | Dana-Farber Cancer Institute, Inc. | Ligands to cereblon (CRBN) |
| US12030892B2 (en) | 2018-06-29 | 2024-07-09 | Dana-Farber Cancer Institute, Inc. | CRBN modulators |
| EP3814330A4 (en) | 2018-06-29 | 2022-07-20 | Dana-Farber Cancer Institute, Inc. | Immunomodulatory compounds |
| US12060366B2 (en) | 2018-06-29 | 2024-08-13 | Dana-Farber Cancer Institute, Inc. | Bispecific degraders |
| WO2021053555A1 (en) | 2019-09-16 | 2021-03-25 | Novartis Ag | Glue degraders and methods of use thereof |
| CA3154386A1 (en) * | 2019-10-17 | 2021-04-22 | Michael Berlin | Bifunctional molecules containing an e3 ubiquitine ligase binding moiety linked to a bcl6 targeting moiety |
-
2022
- 2022-06-01 WO PCT/IB2022/055131 patent/WO2022254362A1/en not_active Ceased
- 2022-06-01 CN CN202280022964.9A patent/CN117062811A/zh active Pending
- 2022-06-01 BR BR112023024905A patent/BR112023024905A2/pt not_active Application Discontinuation
- 2022-06-01 UY UY0001039796A patent/UY39796A/es unknown
- 2022-06-01 TW TW111120484A patent/TW202306570A/zh unknown
- 2022-06-01 KR KR1020237045016A patent/KR20240013812A/ko not_active Ceased
- 2022-06-01 EP EP22731823.5A patent/EP4347580A1/en active Pending
- 2022-06-01 IL IL308094A patent/IL308094A/en unknown
- 2022-06-01 MX MX2023014327A patent/MX2023014327A/es unknown
- 2022-06-01 AU AU2022284366A patent/AU2022284366A1/en not_active Abandoned
- 2022-06-01 CA CA3215410A patent/CA3215410A1/en active Pending
- 2022-06-01 PY PY202202243958A patent/PY2243958A/es unknown
- 2022-06-01 CR CR20230614A patent/CR20230614A/es unknown
- 2022-06-01 PE PE2023003180A patent/PE20240657A1/es unknown
- 2022-06-01 AR ARP220101454A patent/AR126052A1/es not_active Application Discontinuation
- 2022-06-01 JP JP2023574412A patent/JP2024520654A/ja active Pending
- 2022-06-01 US US17/829,933 patent/US12103919B2/en active Active
-
2023
- 2023-11-29 CL CL2023003561A patent/CL2023003561A1/es unknown
- 2023-11-29 DO DO2023000261A patent/DOP2023000261A/es unknown
- 2023-11-29 JO JOJO/P/2023/0308A patent/JOP20230308A1/ar unknown
-
2024
- 2024-01-02 CO CONC2024/0000013A patent/CO2024000013A2/es unknown
- 2024-01-02 EC ECSENADI20244A patent/ECSP24000004A/es unknown
- 2024-09-03 US US18/823,254 patent/US20250026736A1/en active Pending
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004078163A2 (en) | 2003-02-28 | 2004-09-16 | Transform Pharmaceuticals, Inc. | Pharmaceutical co-crystal compositions of drugs such as carbamazepine, celecoxib, olanzapine, itraconazole, topiramate, modafinil, 5-fluorouracil, hydrochlorothiazide, acetaminophen, aspirin, flurbiprofen, phenytoin and ibuprofen |
| WO2012068512A1 (en) | 2010-11-18 | 2012-05-24 | Deuteria Pharmaceuticals Llc | 3-deutero-pomalidomide |
| WO2012079022A1 (en) | 2010-12-10 | 2012-06-14 | Concert Pharmaceuticals, Inc. | Substituted dioxopiperidinyl phthalimide derivatives |
| WO2018102725A1 (en) * | 2016-12-01 | 2018-06-07 | Arvinas, Inc. | Tetrahydronaphthalene and tetrahydroisoquinoline derivatives as estrogen receptor degraders |
| WO2020012334A1 (en) * | 2018-07-10 | 2020-01-16 | Novartis Ag | 3-(5-hydroxy-1-oxoisoindolin-2-yl)piperidine-2,6-dione derivatives and their use in the treatment of ikaros family zinc finger 2 (ikzf2)-dependent diseases |
| WO2020117759A1 (en) * | 2018-12-03 | 2020-06-11 | Dana-Farber Cancer Institute, Inc. | Small molecule degraders of helios and methods of use |
| WO2021124172A1 (en) * | 2019-12-18 | 2021-06-24 | Novartis Ag | 3-(5-methoxy-1-oxoisoindolin-2-yl)piperidine-2,6-dione derivatives and uses thereof |
Non-Patent Citations (18)
| Title |
|---|
| "Remington The Science and Practice of Pharmacy", 2013, PHARMACEUTICAL PRESS, pages: 1049 - 1070 |
| "The Peptides", vol. 3, 1981, ACADEMIC PRESS |
| BIAN, CHEN ET AL., ELIFE, vol. 4, 2015, pages e05606 |
| DONOVAN, K.A. ET AL.: "Thalidomide promotes degradation of SALL4, a transcription factor implicated in Duane Radial Ray syndrome", ELITE, vol. 7, 2018, pages e38430, XP055862607, DOI: 10.7554/eLife.38430 |
| GREVET, SCIENCE, vol. 361, no. 6399, 2018, pages 285 - 290 |
| HOUBEN WEYL: "Methoden der organischen Chemie", vol. 15, 1974, GEORG THIEME VERLAG, article "Methods of Organic Chemistry" |
| J. F. W. MCOMIE: "Protective Groups in Organic Chemistry", 1973, PLENUM PRESS |
| MATYSKIELA, M.E.COUTO, S.ZHENG, X.: "SALL4 mediates teratogenicity as a thalidomide-dependent cerebion substrate", NAT CHEM BIOL, vol. 14, 2018, pages 981 - 987, XP036592858, DOI: 10.1038/s41589-018-0129-x |
| MCARTHUR ET AL., HAEMATOLOGICA, 2019 |
| MEILER, S. E. ET AL., BLOOD, vol. 118, no. 4, 2011, pages 1109 - 1112 |
| MOUTOUH-DE PARSEVAL, L. A. ET AL., THE JOURNAL OF CLINICAL INVESTIGATION, vol. 118, no. 1, 2008, pages 248 - 258 |
| P. J. KOCIENSKI: "Protecting Groups", 2005, GEORG THIEME VERLAG |
| RENNEVILLE ET AL., BLOOD, vol. 126, no. 16, 2015, pages 1930 - 1939 |
| RIVERS ET AL., EXPERIMENTAL HEMATOLOGY, vol. 67, 2018, pages 60 - 64 |
| SHEARSTONE ET AL., PLOS ONE, vol. 11, no. 4, 2016, pages e0153767 |
| T. W. GREENEP. G. M. WUTS: "Greene's Protective Groups in Organic Synthesis", 2007, WILEY |
| VINJAMUR, D. S., THE BRITISH JOURNAL OF HAEMATOLOGY, vol. 180, no. 5, 2018, pages 630 - 643 |
| WICKHAM H: "ggplot2: Elegant Graphics for Data Analysis", 2016, SPRINGER-VERLAG |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12122764B2 (en) | 2021-12-22 | 2024-10-22 | Gilead Sciences, Inc. | IKAROS zinc finger family degraders and uses thereof |
| US11897862B2 (en) | 2022-03-17 | 2024-02-13 | Gilead Sciences, Inc. | IKAROS zinc finger family degraders and uses thereof |
| US12358887B2 (en) | 2022-03-17 | 2025-07-15 | Gilead Sciences, Inc. | IKAROS Zinc Finger Family degraders and uses thereof |
| US12441711B2 (en) | 2022-11-04 | 2025-10-14 | Bristol-Myers Squibb Company | Compounds and their use for treatment of hemoglobinopathies |
| WO2025230875A1 (en) * | 2024-04-29 | 2025-11-06 | Bristol-Myers Squibb Company | Compounds and their use for treatment of hemoglobinopathies |
| US12617774B2 (en) | 2025-05-30 | 2026-05-05 | Novartis Ag | Substituted indole compounds and methods of use thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| US20230019617A1 (en) | 2023-01-19 |
| BR112023024905A2 (pt) | 2024-02-20 |
| US12103919B2 (en) | 2024-10-01 |
| IL308094A (en) | 2023-12-01 |
| JOP20230308A1 (ar) | 2023-11-29 |
| ECSP24000004A (es) | 2024-02-29 |
| CA3215410A1 (en) | 2022-12-08 |
| CO2024000013A2 (es) | 2024-01-25 |
| PE20240657A1 (es) | 2024-04-04 |
| AR126052A1 (es) | 2023-09-06 |
| JP2024520654A (ja) | 2024-05-24 |
| CN117062811A (zh) | 2023-11-14 |
| EP4347580A1 (en) | 2024-04-10 |
| AU2022284366A1 (en) | 2023-10-26 |
| CR20230614A (es) | 2024-02-01 |
| DOP2023000261A (es) | 2023-12-29 |
| MX2023014327A (es) | 2023-12-13 |
| UY39796A (es) | 2023-07-31 |
| PY2243958A (es) | 2023-01-20 |
| US20250026736A1 (en) | 2025-01-23 |
| TW202306570A (zh) | 2023-02-16 |
| KR20240013812A (ko) | 2024-01-30 |
| CL2023003561A1 (es) | 2024-06-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP4076650B1 (en) | 3-(5-methoxy-1-oxoisoindolin-2-yl)piperidine-2,6-dione derivatives and uses thereof | |
| US12103919B2 (en) | 3-(5-oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione derivatives and uses thereof | |
| KR102902295B1 (ko) | 피라졸로피리딘 유도체 및 이의 용도 | |
| US20250276964A1 (en) | Benzisoxazole Derivatives and Uses thereof | |
| CN116802182A (zh) | 吡唑并吡啶衍生物及其用途 | |
| CN116940571A (zh) | 苯并异噁唑衍生物及其用途 | |
| BR112023018542B1 (pt) | Derivados de pirazolopiridina, e composição e combinação farmacêuticas | |
| BR122025004894A2 (pt) | Derivados de pirazolopiridina, seus usos, composição e combinação farmacêuticas, e kit | |
| EA051403B1 (ru) | Производные пиразолопиридина и пути их применения |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 22731823 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202280022964.9 Country of ref document: CN |
|
| ENP | Entry into the national phase |
Ref document number: 3215410 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: AU2022284366 Country of ref document: AU Ref document number: 2022284366 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12023552913 Country of ref document: PH |
|
| ENP | Entry into the national phase |
Ref document number: 2022284366 Country of ref document: AU Date of ref document: 20220601 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 308094 Country of ref document: IL |
|
| WWE | Wipo information: entry into national phase |
Ref document number: P6003095/2023 Country of ref document: AE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2301007823 Country of ref document: TH |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 003180-2023 Country of ref document: PE Ref document number: MX/A/2023/014327 Country of ref document: MX |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2023574412 Country of ref document: JP |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112023024905 Country of ref document: BR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202317087297 Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 806899 Country of ref document: NZ |
|
| ENP | Entry into the national phase |
Ref document number: 20237045016 Country of ref document: KR Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1020237045016 Country of ref document: KR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202393538 Country of ref document: EA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 11202307343T Country of ref document: SG |
|
| WWE | Wipo information: entry into national phase |
Ref document number: NC2024/0000013 Country of ref document: CO |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2022731823 Country of ref document: EP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2022731823 Country of ref document: EP Effective date: 20240103 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2023135650 Country of ref document: RU |
|
| WWP | Wipo information: published in national office |
Ref document number: NC2024/0000013 Country of ref document: CO |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 523451765 Country of ref document: SA |
|
| ENP | Entry into the national phase |
Ref document number: 112023024905 Country of ref document: BR Kind code of ref document: A2 Effective date: 20231128 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 523451765 Country of ref document: SA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 523451765 Country of ref document: SA |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 202393538 Country of ref document: EA |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 308094 Country of ref document: IL |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 2023135650 Country of ref document: RU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 523451765 Country of ref document: SA |