WO2022211604A1 - Fe-fviii 변이 유전자로 교정된 줄기세포, 이로부터 분화된 내피 세포 및 이를 포함하는 혈우병 예방 또는 치료용 약제학적 조성물 - Google Patents

Fe-fviii 변이 유전자로 교정된 줄기세포, 이로부터 분화된 내피 세포 및 이를 포함하는 혈우병 예방 또는 치료용 약제학적 조성물 Download PDF

Info

Publication number
WO2022211604A1
WO2022211604A1 PCT/KR2022/004816 KR2022004816W WO2022211604A1 WO 2022211604 A1 WO2022211604 A1 WO 2022211604A1 KR 2022004816 W KR2022004816 W KR 2022004816W WO 2022211604 A1 WO2022211604 A1 WO 2022211604A1
Authority
WO
WIPO (PCT)
Prior art keywords
fviii
cells
composition
pluripotent stem
coagulation factor
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2022/004816
Other languages
English (en)
French (fr)
Inventor
김동욱
박철용
최상휘
김도훈
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Industry Academic Cooperation Foundation of Yonsei University
Original Assignee
Industry Academic Cooperation Foundation of Yonsei University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Industry Academic Cooperation Foundation of Yonsei University filed Critical Industry Academic Cooperation Foundation of Yonsei University
Publication of WO2022211604A1 publication Critical patent/WO2022211604A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/44Vessels; Vascular smooth muscle cells; Endothelial cells; Endothelial progenitor cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/04Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/745Blood coagulation or fibrinolysis factors
    • C07K14/755Factors VIII, e.g. factor VIII C (AHF), factor VIII Ag (VWF)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102Mutagenizing nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0696Artificially induced pluripotent stem cells, e.g. iPS
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10Growth factors
    • C12N2501/115Basic fibroblast growth factor (bFGF, FGF-2)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10Growth factors
    • C12N2501/155Bone morphogenic proteins [BMP]; Osteogenins; Osteogenic factor; Bone inducing factor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10Growth factors
    • C12N2501/165Vascular endothelial growth factor [VEGF]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/45Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from artificially induced pluripotent stem cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00Genetically modified cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2533/00Supports or coatings for cell culture, characterised by material
    • C12N2533/50Proteins
    • C12N2533/54Collagen; Gelatin

Definitions

  • the present invention relates to stem cells corrected with FE-FVIII mutant gene, endothelial cells differentiated therefrom, and a pharmaceutical composition for preventing or treating hemophilia comprising the same.
  • Hemophilia A is caused by various mutations in the blood coagulation factor FVIII (F8) (hereafter referred to as blood coagulation factor VIII, coagulation factor VIII, factor VIII, or factor 8) gene on the X chromosome. It is one of the most common genetic disorders.
  • FVIII is a cofactor of FIX. Active FVIII binds to active FIX and together form a tenase complex to activate FX.
  • FVIII is an essential protein in the coagulation pathway because the tenase complex initiates the positive feedback loop of coagulation. To date, there is no radical treatment for HA.
  • AAV vectors can only be applied to adults, and depending on the vector dose and the strength of the enhancer-promoter, carcinoma may develop.
  • iPSCs Patient-derived pluripotent stem cells
  • Pluripotent stem cells have pluripotency and self-renewal ability, so they are a good source of cell therapy to replace cells or tissues that do not function normally.
  • FVIII protein can be expressed normally when gene-edited iPSCs differentiate into endothelial cells (ECs) after correcting the reverse FVIII gene of patient-derived iPSCs using a programmable nuclease.
  • ECs endothelial cells
  • more than half of HA patients have other genetic variations, including large deletions, insertions, duplications, or point mutations. Therefore, there is a need for a universal strategy applicable to all types of genetic mutations occurring in HA patients.
  • DSB site-specific DNA double stranded-break
  • HDR homology-direct repair
  • NHEJ non-homologous end joining
  • the present inventors made intensive research efforts to develop a cell therapy agent capable of treating hemophilia by using gene editing in iPSCs.
  • the present inventors used CRISPR/Cas9 nickase-mediated knock-in (Knock-In, KI) to place the coagulation factor FVIII (F8) at the adeno-associated virus site 1 (AAVS1) locus of iPSCs derived from HA patients. ) (blood coagulation factor VIII, coagulation factor VIII, factor VIII, or factor 8) gene and a functionally enhanced FVIII gene were inserted to establish a universal gene editing strategy.
  • CRISPR/Cas9 nickase-mediated knock-in Knock-In, KI
  • AAVS1 adeno-associated virus site 1
  • the activity level of the F309S mutant FVIII gene (1.4-fold), the FVIII half-life of the E1984V mutant FVIII gene (1.35-fold), the activity level and half-life of FVIII in the F309S/E1984V- mutant FVIII gene (FE-FVIII) were confirmed. (1.56 fold and 1.55 fold, respectively).
  • FVIII and FE-FVIII expression cassettes were inserted into patient-derived iPSCs (WT-KI and FE-KI iPSCs), FVIII mRNA was expressed in iPSCs and differentiated endothelial cells (ECs), and FVIII protein was also secreted.
  • the FE-FVIII protein secreted from ECs derived from FE-KI iPSCs showed more improved activity level and stability of FVIII protein than FVIII protein analyzed by FVIII activity and decay assays of FVIII.
  • the present inventors confirmed that higher FVIII activity was shown in HA mice transplanted with ECs derived from FE-KI iPSCs than those derived from WT-KI iPSCs.
  • both WT-KI and FE-KI EC transplanted mice survived within 48 hours by tail clip challenge (17.6% and 22.2%, respectively), demonstrating the potential of cell-based hemophilia therapy. Therefore, the present invention was completed by identifying that FE-KI iPSCs can be usefully used as a cell therapy for HA treatment by differentiating them into ECs.
  • Another object of the present invention is to provide an induced pluripotent stem cell expressing a FVIII mutant gene comprising mutations at the F309 position and the E1984 position, an endothelial cell differentiated therefrom, and a method for producing the same.
  • Another object of the present invention is to provide a pharmaceutical composition for preventing or treating hemophilia A comprising the composition, induced pluripotent stem cells, or endothelial cells as an active ingredient.
  • the present invention comprises a polynucleotide encoding a mutant FVIII protein comprising mutations at positions F309 and E1984 of blood coagulation factor VIII (blood coagulation factor VIII).
  • a composition for factor FVIII knock-in is provided.
  • the blood coagulation factor FVIII may include full-length blood coagulation factor VIII (flFVIII), or a fragment thereof.
  • the fragment of the full-length blood coagulation factor FVIII may be B domain-deleted blood coagulation factor VIII (BDD-VIII) lacking the B domain, but is not limited thereto. .
  • the F309 position mutation may be a F309S mutation.
  • the E1984 position mutation may be an E1984V mutation.
  • the FVIII mutant protein may be F309S and E1984V mutant proteins.
  • the FVIII protein without the F309 position mutation and the E1984 position mutation may include the amino acid sequence of SEQ ID NO: 46.
  • the FVIII mutant protein having the F309 position mutation and the E1984 position mutation may include the amino acid sequence of SEQ ID NO: 48.
  • the composition further comprises a guide RNA targeting the AAVS1 locus or a polynucleotide encoding the same.
  • the guide RNA targets intron 1 of the PPP1R12C gene, but is not limited thereto.
  • the guide RNA has a length of about 15 nt to 30 nt, 15 nt to 25 nt, 15 nt to 24 nt, 15 nt to 23 nt, 15 nt to 22 nt, 15 nt to 21 nt, 15 nt to 20 nt, 16 nt to 30 nt, 16 nt to 25 nt, 16 nt to 24 nt, 16 nt to 23 nt, 16 nt to 22 nt, 16 nt to 21 nt, 16 nt to 20 nt, 17 nt to 30 nt, 17 nt to 25 nt, 17 nt to 24 nt, 17 nt to 23 nt, 17 nt to 22 nt, 17 nt to 21 nt, 17 nt to 20 nt, 18 nt to 30 nt, 18 nt to 25 nt, 18 nt to 24 nt to 24 nt
  • the guide RNA is to include a protospacer adjacent motif (Protospacer adjacent motif, PAM) sequence.
  • PAM protospacer adjacent motif
  • the polynucleotide encoding the guide RNA may be RNA, DNA, or PNA, and may be chemically modified.
  • the guide RNA may be a single chain guide RNA (sgRNA).
  • sgRNA single chain guide RNA
  • the chemical modification may include non-natural nucleotide linkages.
  • the chemical modification may include a phosphate in which a nonnatural inter-nucleotide bridging phosphate residue is modified.
  • the modified phosphates are methyl phosphonates, methyl phosphorothioates, phosphoromorpholidates, phosphoropiperazidates or phosphoroamidates. ) may be selected from
  • the composition further comprises an RNA-guided nuclease, or a polynucleotide encoding the same.
  • the RNA-guided nuclease may be a Cas polypeptide.
  • the Cas polypeptide is one of the protein components of the CRISPR/Cas system, and may be an activated endonuclease or a nick forming enzyme.
  • the Cas polypeptide may form a complex with crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA) to exhibit its activity.
  • the Cas polypeptide may be, for example, from the genus Streptococcus (eg, Streptococcus pyogens), from the genus Neisseria (eg, Neisseria meningitidis), from the genus Pasteurella (eg, Pasteurella multocida), from the genus Francisella (eg, Francisella novicida), or It may be a polypeptide derived from a bacterium of the genus Campylobacter (eg, Campylobacter jejuni).
  • the Cas polypeptide may be a Cas9 polypeptide or a Cas12a (Cpf1) polypeptide.
  • the PAM sequence may be 5'-NGG-3', but is not limited thereto.
  • the N means any base.
  • the polynucleotide encoding the FVIII mutant protein and/or the polynucleotide encoding an RNA-guided nuclease may be included in the vector.
  • the vector may be a plasmid.
  • the composition is for correction in vitro, ex vivo, or in vivo.
  • the present invention provides an induced pluripotent stem cell derived from isolated somatic cells of a patient with Hemophilia A (HA) transformed to express the blood coagulation factor FVIII mutant protein. cell, iPSC).
  • HA Hemophilia A
  • the blood coagulation factor FVIII mutant protein contains mutations at the F309 position and the E1984 position of the blood coagulation factor FVIII (BDD-VIII).
  • the blood coagulation factor FVIII may include full-length blood coagulation factor VIII (flFVIII), or a fragment thereof.
  • the fragment of the full-length blood coagulation factor FVIII may be B domain-deleted blood coagulation factor VIII (BDD-VIII) lacking the B domain, but is not limited thereto. .
  • the F309 position mutation may be a F309S mutation.
  • the E1984 position mutation may be an E1984V mutation.
  • the FVIII mutant protein may be F309S and E1984V mutant proteins.
  • the isolated somatic cells of the hemophilia A patient refer to cells selected from the group consisting of muscle cells, nerve cells, epithelial cells, blood cells, mast cells, bone cells, and stem cells.
  • the somatic cells may be, for example, adipocytes, fibroblasts, epithelial cells, blood cells, or hematopoietic stem cells.
  • the fibroblasts may be skin-derived fibroblasts.
  • the epithelial cell may be a urinary tract-derived urinary epithelial cell.
  • the stem cell may be an adipose tissue-derived mesenchymal stem cell (MSC), but is not limited thereto.
  • induced pluripotent stem cell refers to a cell induced to have pluripotency through artificial dedifferentiation from differentiated cells.
  • the induced pluripotent stem cells are similar to embryonic stem cells in cell appearance, gene, or protein expression pattern, have pluripotency in vitro and in vivo, form teratoma, and germline transmission of genes is possible
  • the induced pluripotent stem cells may include iPS cells derived from all mammals such as human, cow, horse, pig, dog, sheep, goat or cat.
  • the induced pluripotent stem cells may be human-derived induced pluripotent stem cells.
  • the induced pluripotent stem cells may be induced pluripotent stem cells derived from a patient with hemophilia A.
  • the transformation can be performed using any known gene delivery system used for transformation of cells.
  • the gene delivery system of the present invention can be constructed in various forms, including (i) a naked recombinant DNA molecule, (ii) a plasmid, (iii) a viral vector, and (iv) the naked recombinant DNA molecule or It can be prepared in the form of liposomes containing plasmids, polymer nanoparticles, lipid nanoparticles, and the like.
  • the contacting step is carried out according to a viral infection method known in the art. Infection of host cells with viral vectors is described in the references cited above.
  • the gene delivery agent when the gene delivery agent is a naked recombinant DNA molecule or plasmid, the microinjection method (Capecchi, M.R., Cell, 22:479 (1980); and Harland and Weintraub, J. Cell Biol. 101:1094- 1099 (1985)), calcium phosphate precipitation (Graham, F.L. et al., Virology, 52:456 (1973); and Chen and Okayama, Mol. Cell. Biol. 7:2745-2752 (1987)), electroporation method (Neumann, E. et al., EMBO J., 1:841 (1982); and Tur-Kaspa et al., Mol.
  • the microinjection method Capecchi, M.R., Cell, 22:479 (1980); and Harland and Weintraub, J. Cell Biol. 101:1094- 1099 (1985)
  • calcium phosphate precipitation Graham, F.L. et al., Virology
  • the present invention provides an endothelial cell, which is differentiated from the induced pluripotent stem cell, and expresses the blood coagulation factor FVIII mutant protein.
  • the present invention provides a composition for the above-described blood coagulation factor FVIII knock-in, an induced pluripotent stem cell transformed to express a blood coagulation factor FVIII mutant protein, or the above It provides a pharmaceutical composition for preventing or treating hemophilia A, comprising endothelial cells expressing a blood coagulation factor FVIII mutant protein as an active ingredient.
  • the pharmaceutical composition may include a pharmaceutically acceptable carrier.
  • the carrier is used in the sense of including excipients, diluents or adjuvants.
  • the carrier may be, for example, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, polyvinyl pi It may be selected from the group consisting of rolidone, water, physiological saline, buffers such as PBS, methylhydroxy benzoate, propylhydroxy benzoate, talc, magnesium stearate, and mineral oil.
  • the composition may include a filler, an anti-agglomeration agent, a lubricant, a wetting agent, a flavoring agent, an emulsifying agent, a preservative, or a combination thereof.
  • the pharmaceutical composition may be prepared in any formulation according to a conventional method.
  • the composition may be formulated, for example, as an oral dosage form (eg, a powder, tablet, capsule, syrup, pill, or granule), or a parenteral dosage form (eg, an injection).
  • an oral dosage form eg, a powder, tablet, capsule, syrup, pill, or granule
  • a parenteral dosage form eg, an injection.
  • composition may be prepared as a systemic formulation or a topical formulation.
  • the pharmaceutical composition may be administered orally, intravenously, intramuscularly, orally, transdermally, mucosally, intranasal, intratracheal, subcutaneously, or a combination thereof.
  • the composition may be administered by a subcutaneous route, and more specifically, it may be administered to subcutaneous fat.
  • the present invention provides a method for producing induced pluripotent stem cells expressing FVIII mutant protein in induced pluripotent stem cells derived from isolated somatic cells of a patient with hemophilia A (HA). .
  • the blood coagulation factor FVIII mutant protein in the method for producing pluripotent stem cells expressing the FVIII mutant protein, is prepared by treating the above-described composition for a blood clotting factor FVIII knock-in. transforming to express it.
  • the present invention provides a method for producing an endothelial cell expressing a blood coagulation factor FVIII mutant protein comprising the steps of:
  • iPSC induced pluripotent stem cell
  • the blood coagulation factor FVIII may include full-length blood coagulation factor VIII (flFVIII), or a fragment thereof.
  • the fragment of the full-length blood coagulation factor FVIII may be B domain-deleted blood coagulation factor VIII (BDD-VIII) lacking the B domain, but is not limited thereto. .
  • step (a) will include (a1) culturing the transformed induced pluripotent stem cells in a medium containing Y-27632 for 1 to 2 days.
  • the Y-27632 is about 1-20 ⁇ M, 1-18 ⁇ M, 1-15 ⁇ M, 1-14 ⁇ M, 1-13 ⁇ M, 1-12 ⁇ M, 1- 11 ⁇ M, 1-10 ⁇ M, 5-20 ⁇ M, 5-18 ⁇ M, 5-15 ⁇ M, 5-14 ⁇ M, 5-13 ⁇ M, 5-12 ⁇ M, 5-11 ⁇ M, 5-10 ⁇ M, 8- 20 ⁇ M, 8-18 ⁇ M, 8-15 ⁇ M, 8-14 ⁇ M, 8-13 ⁇ M, 8-12 ⁇ M, 8-11 ⁇ M, 8-10 ⁇ M, 5 ⁇ M, 6 ⁇ M, 7 ⁇ M, 8 ⁇ M, 9 ⁇ M, 10 ⁇ M, 11 ⁇ M, 12 ⁇ M, 13 ⁇ M
  • step (a) will further include (a2) culturing the transformed induced pluripotent stem cells in a medium containing CHIR99021 for 1 to 3 days.
  • the CHIR99021 is about 1 to 15 ⁇ M, 1 to 12 ⁇ M, 1 to 10 ⁇ M, 1 to 9 ⁇ M, 1 to 8 ⁇ M, 1 to 7 ⁇ M, 1 to 6 ⁇ M in the medium.
  • step (a3) the transformed induced pluripotent stem cells are cultured in a medium containing BMP4, bFGF, VEGF-A, or a combination thereof for 1 to 3 days. It will additionally include the step of
  • the BMP4 is 10-50 ng/mL, 10-40 ng/mL, 10-35 ng/mL, 10-30 ng/mL, 10-25 ng/mL, 15 in the medium. to 50 ng/mL, 15 to 40 ng/mL, 15 to 35 ng/mL, 15 to 30 ng/mL, 15 to 25 ng/mL, 20 to 50 ng/mL, 20 to 40 ng/mL, 20 to 35 ng/mL, 20-30 ng/mL, 20-25 ng/mL, 15 ng/mL, 16 ng/mL, 17 ng/mL, 18 ng/mL, 19 ng/mL, 20 ng/mL, 21 ng/mL, 22 ng/mL, 23 ng/mL, 24 ng/mL, or 25 ng/mL.
  • the bFGF is 1 to 25 ng/mL, 1 to 20 ng/mL, 1 to 15 ng/mL, 1 to 10 ng/mL, 3 to 25 ng/mL, 3 in the medium.
  • the VEGF-A is 20 to 100 ng/mL, 20 to 80 ng/mL, 20 to 70 ng/mL, 20 to 60 ng/mL, 20 to 50 ng/mL in the medium.
  • mL 30-100 ng/mL, 30-80 ng/mL, 30-70 ng/mL, 30-60 ng/mL, 30-50 ng/mL, 35-100 ng/mL, 35-80 ng/mL , 35-70 ng/mL, 35-60 ng/mL, 35-50 ng/mL, 40-100 ng/mL, 40-80 ng/mL, 40-70 ng/mL, 40-60 ng/mL, 40-50 ng/mL, 45-100 ng/mL, 45-80 ng/mL, 45-70 ng/mL, 45-60 ng/mL, 45-50 ng/mL, 45 ng/mL, 46 ng/mL mL, 47 ng/mL, 48 ng/mL, 49 ng/mL, 50 ng/mL, 51 ng/mL, 52 ng/mL, 53 ng/mL, 54 ng/mL, or 55 ng/mL.
  • step (a) may include steps (a1) to (a3) sequentially.
  • the culture in step (a) may be made in a culture vessel coated with a gel containing an extracellular matrix.
  • the gel containing the extracellular matrix is Matrigel TM , but is not limited thereto.
  • the steps (a1) to (a3) are to induce differentiation of the mesodermal lineage.
  • step (b) comprises isolating cells expressing a cell surface protein of CD31, CD34, VE-Cad, or a combination thereof from the population of endothelial progenitors.
  • step (b) comprises isolating cells expressing a cell surface protein of CD31, VE-Cad, or a combination thereof from the population of endothelial progenitors. More specifically, the method comprises isolating cells expressing the cell surface protein of CD31 from among the population of endothelial progenitors.
  • the step (c) will further include culturing the transformed induced pluripotent stem cells in a medium containing VEGF-A for 2 to 8 days.
  • the VEGF-A is 20 to 100 ng/mL, 20 to 80 ng/mL, 20 to 70 ng/mL, 20 to 60 ng/mL, 20 to 50 ng/mL in the medium.
  • mL 30-100 ng/mL, 30-80 ng/mL, 30-70 ng/mL, 30-60 ng/mL, 30-50 ng/mL, 35-100 ng/mL, 35-80 ng/mL , 35-70 ng/mL, 35-60 ng/mL, 35-50 ng/mL, 40-100 ng/mL, 40-80 ng/mL, 40-70 ng/mL, 40-60 ng/mL, 40-50 ng/mL, 45-100 ng/mL, 45-80 ng/mL, 45-70 ng/mL, 45-60 ng/mL, 45-50 ng/mL, 45 ng/mL, 46 ng/mL mL, 47 ng/mL, 48 ng/mL, 49 ng/mL, 50 ng/mL, 51 ng/mL, 52 ng/mL, 53 ng/mL, 54 ng/mL, or 55 ng/mL.
  • the present invention provides a composition for blood clotting factor FVIII knock-in.
  • the present invention provides an induced pluripotent stem cell expressing a FVIII mutant protein containing mutations at the F309 position and the E1984 position, an endothelial cell differentiated therefrom, and a method for producing the same.
  • the present invention provides a pharmaceutical composition for preventing or treating hemophilia A comprising the composition, induced pluripotent stem cells, or endothelial cells as an active ingredient.
  • composition of the present invention induced pluripotent stem cells, and endothelial cells differentiated therefrom have excellent efficacy in restoring the function of FVIII, and thus can be usefully used as a therapeutic agent for hemophilia.
  • FVIII activity of FVIII variants Activity was determined after supernatant obtained from transfected HEK293T cells.
  • B Disintegration analysis of FVIII variants. Each activity was measured after incubating the FVIII protein harvested from the transfected HEK293T cells at 37° C. for 0, 8, 16, and 24 hours.
  • C Decay rate and relative half-life of FVIII variants. Data are the mean ⁇ SEM of three independent experiments. The SD for the ratio decay value is estimated based on least squares curve fitting and is within about 10% of the mean value. *, p ⁇ 0.05 compared to BDD-FVIII transfected cells.
  • WT WT BDD-FVIII; F, F309S mutant BDD-FVIII; E, E1984V mutant BDD-FVIII; FE, F309S/E1984V mutant BDD-FVIII
  • FIG. 2 is a diagram showing the results of the primary PCR screening of the corrected iPSC cell line.
  • A The sgRNA target sequence at the AAVS1 locus located in intron 1 of the PPP1R12C gene located on chromosome 19.
  • B PCR-based genotyping to confirm targeted insertion of donor DNA in knock-in iPSC cell lines. Each primer set represents a 5' knock-in junction (F1/R1), a 3' knock-in junction (F2/R2) and the AAVS1 locus (F1/R2). ⁇ -actin was used as an internal reference.
  • C The partial sequence of the knock-in junction in the integrated iPSC cell line containing the template donor DNA. Both cancer sequences are shown in green. The donor plasmid sequences starting from pEF1 ⁇ and ending with the puromycin resistance gene are shown in blue and cyan, respectively. The original genome sequence is shown in black.
  • FIG. 3 is a schematic diagram illustrating the target insertion of the FVIII gene into the human AAVS1 locus of iPSCs derived from HA patients.
  • A Schematic of PCR target sites for primary PCR screening after knock-in at the AAVS1 locus of HA-derived iPSCs. Primers used for PCR-based genotyping are indicated by arrows.
  • B PCR-based genotyping to identify removal of the puromycin resistance cassette in corrected iPSC cell lines. F1/R1 and F2/R2 primer sets were used to detect 5' and 3' junctions of corrected iPSCs, respectively. The F3/R2 primer set was used to detect excision of the puromycin resistance cassette.
  • C Shows the sequence around the loxP site of a corrected iPSC cell line after generation of DNA amplicons using the F3/R2 primer set and excision of the resistance cassette.
  • FIG. 4 is a diagram showing the expression of pluripotency markers in corrected iPSC cell lines.
  • A Quantitative real-time PCR analysis of pluripotency markers (OCT4, SOX2, NANOG and LIN28) in parental patients and corrected iPSC lines. GAPDH was used to normalize gene expression. Data are the mean ⁇ SEM of three independent experiments.
  • B Immunofluorescence staining shows the expression of pluripotency marker proteins (OCT4 and SSEA4) of the corrected iPSC cell line. Nuclei were marked with 4',6-diamidino-2-phenylindole (DAPI) (Scale bar, 100 ⁇ m).
  • DAPI 4',6-diamidino-2-phenylindole
  • C Immunofluorescence staining shows expression of marker proteins representing ectoderm (NESTIN), mesoderm ( ⁇ -smooth muscle actin, ⁇ -SMA) and endoderm (hepatocyte nuclear factor-3 ⁇ , HNF-3 ⁇ ) of the corrected iPSC cell line. Nuclei were labeled with DAPI (scale bar, 100 ⁇ m).
  • DAPI scale bar, 100 ⁇ m.
  • Karyotyping was performed on corrected iPSC cell lines.
  • FIG. 5 is a view showing off-target analysis in iPSC cell lines corrected through target-deep sequencing.
  • A Four potential off-target sites different from the target site by up to 4 nucleotides were investigated in the corrected clones by target-deep sequencing. Mismatched nucleotide and PAM sequences (5'-NGG-3') are shown in blue and red, respectively.
  • B Total number of leads.
  • FIG. 6 is a diagram showing the phenotypic rescue (rescue) of FVIII gene expression in the corrected iPSC cell line.
  • A To confirm that the mutated sequence was translated in the FE-KI iPSC cell line, Sanger sequencing was performed on the mRNA of the FVIII gene in the corrected iPSC cell line. 309 Phe and 1984 Glu were successfully mutated to 309 Ser and 1984 Val in FE-KI iPSCs.
  • B qPCR analysis results showing FVIII expression levels in patient and knock-in iPSC cell lines. GAPDH was used to normalize gene expression. Data are the mean ⁇ SEM of three independent experiments.
  • FIG. 7 is a diagram showing the functional recovery of FVIII deficiency in the corrected iPSC cell line and the differentiated EC.
  • A qPCR analysis results showing EC marker expression (CD31, VWF, VE-cadherin) and FVIII expression levels in patient and knock-in iPSC cell lines. GAPDH was used to normalize gene expression. Data are the mean ⁇ SEM of three independent experiments.
  • B Immunofluorescence staining shows the expression of endothelial marker proteins (CD31 and VWF) of a knock-in iPSC cell line. Nuclei were labeled with DAPI (scale bar, 100 ⁇ m).
  • FIG. 8 is a diagram showing the functional recovery of FVIII in transplanted HA mice.
  • A RT-PCR analysis to detect expression of HA and human FVIII in transplanted mice. Human ACTIN was used to identify transplanted ECs. Mouse Gapdh was used as a control.
  • B FVIII activity was measured in HA and plasma collected from transplanted mice. Data represent detected activity per 1 ⁇ 10 6 EC.
  • FIG. 9 is a diagram showing a schematic diagram for the differentiation of corrected iPSCs and cell separation using MACS.
  • FIG. 10 and 11 are diagrams showing yields of corrected iPSCs for each cell surface marker. (FIG. 10, WT-BDD vs. FE-BDD; FIG. 11, Total)
  • FIG. 12 is a diagram showing a schematic diagram of the corrected iPSC differentiation, cell separation, and gene expression analysis.
  • 13 to 15 show EC-specific genes (CD31, FVIII, VE-Cad, vWF) for each experimental group (WT-BDD, FE-BDD, Total) and cell surface markers (CD31, VEGFR2, CD34, VE-Cad) It is a diagram showing the expression level.
  • 16 to 18 show cells that were isolated or unsorted with each cell surface marker (CD31+, VEGFR2+, CD34+, VE-Cad+) on day 4 of differentiating iPSCs into ECs, and microscopically on days 8-10 of differentiation ( 16) and CD31, vWF, and VE-Cad immunostaining (FIGS. 17 and 18) is a diagram showing the observed results.
  • FIG. 19 shows the differentiation of EC progenitor cells separated by each cell surface marker (CD31+, VEGFR2+, CD34+, VE-Cad+) on the 4th day of differentiating iPSCs into ECs by experimental group (WT-BDD, FE-BDD). It is a diagram showing the activity of FVIII contained in the culture medium of EC cells on days 8 to 10.
  • % used to indicate the concentration of a specific substance is (weight/weight) % for solid/solid, (weight/volume) % for solid/liquid, and Liquid/liquid is (volume/volume) %.
  • the present inventors used pcDNA4/BDD-FVIII plasmid (Addgene, #41035) as a backbone to construct a donor plasmid.
  • 5'-homology arm (5'-homology arm, left arm, LA) and 3'-homology arm (3'-homology arm, right arm, RA) were designed at the MunI/MluI and PacI/MauBI sites, respectively, and inserted.
  • the human EF1 ⁇ promoter sequence was cloned between the left arm and the FVIII open reading frame using the MluI/RruI site.
  • Streptococcus pyogenes (SpCas9)(D10A) nickase and 5'-GX 19 sgRNA (5'-GGGCCACTAG GGACAGGAT-3', SEQ ID NO: 1) expression plasmids were purchased from ToolGen (Seoul, Korea).
  • Cas9 nickase (D10A) plasmids, BDD-FVIII and FE-FVIII knock-in donor DNAs were electroporated into iPSCs of hemophilia A patients. Specifically, iPSCs from hemophilia A patients were washed once with DPBS and dissociated into single cells using ReLeSRTM (STEMCELL Technologies, Vancouver, Canada). 5x10 5 iPSCs were electroporated with 1 ⁇ g Cas9 nickase, 2 ⁇ g sgRNA expression vector and 2 ⁇ g each donor plasmid using the Neon transfection system (Invitrogen, Carlsbad, CA, USA).
  • cells were cultured in STEMMACS medium containing 10 ⁇ M Y-27632 (Sigma-Aldrich, St. Louis, MO, USA) for 2 days. Four days after transfection, cells were selected using 0.5 ⁇ g/mL puromycin.
  • a web-based in silico tool (www.rgenome.net) was used to search for 4 potential off-target sites that differed from the target site by up to 3 nucleotides.
  • Genomic DNA was isolated from patient and corrected iPSC cell lines using DNeasy Blood & Tissue Kits (QIAGEN) for target-deep sequencing, and off-target using the MiSeq system (Illumina, San Diego, CA, USA) in ToolGen. Sites were amplified and analyzed.
  • iPSCs were dissociated with ReleSRTM and transferred to Matrigel-coated culture dishes in STEMMACS medium containing 10 ⁇ M Y-27632 for 1 day. Then, the culture medium was replaced with STEMdiffTM APELTM2 medium (STEMCELL Technologies) containing 6 ⁇ M CHIR99021 (Tocris Bioscience, Bristol, UK) for 2 days to induce mesodermal lineages. On day 2, cells contained 25 ng/mL bone morphogenetic protein 4 (BMP4; Prospec, East Brunswick, NJ, USA), 10 ng/mL bFGF and 50 ng/mL vascular endothelial growth factor (VEGF)-A (PeproTech). Vascular lineages were induced by culturing in STEMdiffTM APELTM2 medium for 2 days.
  • BMP4 bone morphogenetic protein 4
  • VEGF vascular endothelial growth factor
  • FVIII activity was measured using the Coamatic ® Factor VIII chromogenic assay kit (Instrumentation Laboratory, Bedford, MA, USA) according to the manufacturer's instructions.
  • FVIII activity measurements were performed in 96-well microplates and absorbance at 405 nm was determined by endpoint readout used by a microplate reader (Molecular devices, San Jose, CA, USA). The standard curve was measured with HemosIL ® Calibration Plasma (Instrumentation Laboratory).
  • hemophilia A mice For transplantation into hemophilia A mice, 3-month-old hemophilia A mice (Jackson Laboratory, strain: B6;129S4-F8 tm1Kaz /J) were used, and patient-derived or corrected iPSCs were injected into each mouse 1x10 6 via tail vein injection. EC was injected. Cyclosporine A (210 mg/L; in negative water) was administered 3 days prior to transplantation and replaced once every 3 days. After 3, 5, 7, 10 and 14 days, blood samples were taken from each of the transplanted mouse tail veins to measure the expression and activity of FVIII, respectively.
  • HA and implanted mice were anesthetized and tail-clip analysis was performed. Briefly, a 2 mm diameter tail end was cut and bleeding was allowed for 5 min. After the tail was pressed firmly for 1 min, survival time was monitored in each mouse until 2 days after clipping.
  • A is the residual FVIII activity
  • a 0 is the initial activity
  • k is the apparent rate constant
  • t is the incubation time (hours) at 37°C.
  • HEK 293T cells Human embryonic kidney (HEK) 293T cells (ATCC, Manassas, VA, USA) contained 10% (vol/vol) fetal bovine serum (FBS; Hyclone, Logan, UT, USA) and 1% (vol/vol) P/S (Gibco) was maintained in Dulbecco's Modified Eagle's Medium (DMEM; Gibco, Grand Island, NY, USA).
  • Intron 22 inverted patient-derived iPSCs, BDD-FVIII and F309S/E1984V mutant FVIII (FE-FVIII) gene-inserted iPSCs were cultured in Matrigel (Corning, Corning, NY, USA)-coated culture dishes. Feeder-free culture was performed using STEMMACSTM iPSC-brew XF (STEMMACSTM iPSC-brew XF) culture medium (Miltenyi Biotec, Bergisch Gladbach, Germany).
  • Genomic DNA was isolated from cells using the DNeasy Blood & Tissue kit (QIAGEN, Hilden, Germany) according to the manufacturer's instructions. To confirm the knock-in of the donor DNA into the AAVS1 locus, the DNA fragments of each junction were amplified using EmeraldAmp ® GT PCR Master Mix. The nucleotide sequence of each DNA amplicon was verified through Sanger sequencing at Cosmogenetech.
  • iPSC colonies were dissected to generate embryonic bodies (EBs), followed by EB culture medium [4 ng/mL basic fibroblast growth factor (bFGF; PeproTech, Rocky Hill, JN, USA), 20% knockout).
  • EB culture medium [4 ng/mL basic fibroblast growth factor (bFGF; PeproTech, Rocky Hill, JN, USA), 20% knockout.
  • DMEM/F12 medium Gibco
  • serum substitute Invitrogen
  • 1% non-essential amino acids Invitrogen
  • 2-mercaptoethanol Sigma-Aldrich
  • mouse anti-SSEA4 (1:200, Millipore, Billerica, MA, USA), rabbit anti-OCT4 (1:200, Santa Cruz Biotechnology, Dallas, TX, USA), rabbit anti-NESTIN (1:1000, Millipore), goat anti-HNF3 ⁇ (1:200, Santa Cruz Biotechnology), mouse anti- ⁇ -SMA (1:400, Sigma-Aldrich), mouse anti-CD31 (1:200, BD Biosciences, San Jose, CA, USA), and rabbit anti-VWF (1:500, Millipore).
  • target site Target Seq. (5' to 3') Forward primer Sequence.
  • Reverse primer Seq. (5' to 3') Off-target t 1 (OT1) , Chr.19) GGGCCCTTATGGACAGGAT GGG (SEQ ID NO: 33) GTGCCCGTATCCCAGAGT GAT (SEQ ID NO: 34) AGGTGGATGACAAGGTC AGG (SEQ ID NO: 35) Off-target 2 (OT2, Chr.19) GGGGCACTGGGGACAGGC TTGG (SEQ ID NO: 36) AGGAGGTCAGTCTGGGA GGT (SEQ ID NO: 37) GAGAGGGGCACAAACA GAAG (SEQ ID NO: 38) Off-target 3 (OT3, Chr.15) GGACCACTGGGCACAGGGAT CGG (SEQ ID NO: 39) ATGTTGGAAGAGGACGT TGG (SEQ ID NO: 40) TCACATGTCCTCCACCT GT
  • Antibodies used in this study Antibody Company Cat # OCT4 Santa Cruz SC9081 SSEA-4 Millipore MAB4304 NESTIN Millipore MAB5326 ⁇ -SMA Sigma A5228 HNF-3 ⁇ Santa Cruz SC6554 CD31 BD Bioscience 555444 vWF Millipore AB7356
  • FVIII mutants were transfected into HEK 293T cells and incubated at 37° C. for 24 hours, after which the supernatant was harvested and analyzed.
  • FVIII activity levels were increased in FVIII variants containing the F309S mutated-FVIII gene (1.40 fold in F, 1.56 fold in FE) compared to BDD-FVIII.
  • the E1984V mutated-FVIII gene reduced the level of FVIII activity compared to BDD-FVIII.
  • the E mutant FVIII gene reduces FVIII activity compared to WT, the increased FVIII activity in the FE mutant FVIII gene than the F mutant FVIII gene represents a synergistic effect.
  • the stability of the FVIII mutant was estimated through decay analysis (Fig. 1, B). After incubating the supernatant secreted from each cell line at 37° C. for 0-24 hours, each sample was checked by activity assay to determine the rate of decay compared to the initial stage. In the decay analysis, the F mutant FVIII gene was not significantly different from that of BDD-FVIII, but the stability and half-life were increased in the E1984V mutant FVIII gene (E, FE), which are factors related to stability ( FIGS. 1 and 1C ). Based on the above results, it was determined that the FE mutant FVIII gene is involved in both secretion and stability.
  • Example 2 Targeted knock-in of BDD-FVIII and FE-FVIII gene into the AAVS1 locus of HA patient-derived iPSCs )
  • sgRNA targeting intron 1 of the PPP1R12C gene was used ( FIG. 2A ).
  • Each donor plasmid with sgRNA and Cas9 nickase (D10A) vector was electroporated into iPSCs derived from HA patients ( FIG. 3A ).
  • genomic DNA was extracted from the emerging drug-resistant iPS colonies, and then knock-in colonies were identified by PCR analysis as previously described. To screen the corrected colonies, the 5' junction and the 3' junction of the knock-in site were amplified using a specific primer set (F1/R1, F2/R2).
  • WT-K1 and FE-K1 iPSCs were selected to excise the puromycin resistance cassette from the knock-in iPSC cell line.
  • transient Cre recombinase expression by electroporation we screened each iPSC cell line based on the PCR product generated by the F3/R2 primers. 3 of 8 colonies (37.5%, WT-K1 excision) and 4 of 8 colonies (50%, FE-K1 excision) were screened from each iPSC lineage.
  • the present inventors also confirmed the expression of pluripotent marker proteins (SSEA4, OCT4) in the corrected iPSC cell line (Fig. 4, B).
  • SSEA4, OCT4 pluripotent marker proteins
  • Fig. 4, B In vitro tripoderm analysis confirmed successful differentiation of ectoderm (NESTIN), mesoderm (alpha smooth muscle actin, ⁇ -SMA) and endoderm (hepatocyte nuclear factor-3beta, HNF-3 ⁇ ) (Fig. 4.C).
  • all corrected iPSC cell lines showed a normal 46,XY karyotype by G-banding (Fig. 4, D).
  • the present inventors confirmed whether the off-target mutation was induced in the iPSC lineage corrected by Cas9 nickase.
  • a web-based in silico tool was used to obtain a list of off-target sites that differed from the target site by up to 3 nucleotides, and identified 4 potential off-target sites for target-deep sequencing in 4 corrected iPSC cell lines and parental iPSCs. selected. It was confirmed that no significant mutations were found in the off-target site of the corrected iPSC cell line (FIG. 5).
  • EC is known to be the main source of FVIII production.
  • EC markers appeared on day 8 of differentiation and were confirmed by qRT-PCR analysis and immunocytochemistry.
  • qRT-PCR analysis showed that EC markers (CD31, VWF, VE-cadherin) were expressed in differentiated ECs compared to patient iPSCs (Fig. 7, A).
  • EC markers CD31, VWF, VE-cadherin
  • the present inventors further conducted FVIII activity assay to investigate whether the FVIII protein secreted from ECs differentiated from the corrected cell line.
  • the level of FVIII activity of FE-KI ECs (41.50 ⁇ 3.59 in FE-K1e1, 38.79 ⁇ 4.09 in FE-K1e2) was significantly higher than that of WT-KI ECs (19.17 ⁇ 5.15 in WT-K1e1, 20.88 ⁇ 2.14 in WT-K1e1). increased (Fig. 7, C).
  • a FVIII decay assay was then performed to determine the stability of the FVIII protein in each corrected EC cell line.
  • the supernatant obtained from each EC cell line was also incubated for 0-24 hours at 37°C as tested in 293T cells, and then each sample was analyzed by FVIII activity assay to investigate the rate of decay (FIG. 7, D).
  • FVIII activity assay to investigate the rate of decay (FIG. 7, D).
  • FVIII activity assay also showed no significant differences between HA mice and patient cell transplanted mice.
  • mice transplanted with WT-K1e1 and FE-K1e1 cells showed restoration of FVIII activity in HA mice.
  • the FVIII activity of mice transplanted with FE-K1e1 cells was more than 2-fold higher than that of mice transplanted with WT-K1e1 cells for 7 days after transplantation (7.00 ⁇ 1.23 in WT-K1e1, and 7.00 ⁇ 1.23 in FE-K1e1). 14.84 ⁇ 0.89). (Fig. 8, B).
  • the FE-KI cell line can increase the level of FVIII activity and the stability of FVIII protein in differentiated EC than the WT-KI cell line, and that FVIII activity can be restored in ECs transplanted into HA mice after 7 days. did.
  • cell surface markers CD31, VEGFR2, CD34, or VE-Cad
  • FIG. 9 A schematic diagram explaining the differentiation and separation process is shown in FIG. 9, and the yields for each cell surface marker are shown in Tables 4 and 10, and Tables 5 and 11.
  • the yield obtained by separating each cell surface marker was about 2% higher in the FE-BDD gene insertion group than in the WT-BDD gene insertion group in the case of CD31+ cell line.
  • VEGFR2+, CD34+, and VE-Cad+ cell lines showed that the WT-BDD gene insertion group was slightly higher than the FE-BDD gene insertion group, but the overall yield was significantly higher between the WT-BDD and FE-BDD gene insertion groups. There was no difference.
  • Example 8 Comparison of EC marker gene expression characteristics of each cell line after EC cell isolation using corrected iPSC cell surface markers
  • Example 7 the present inventors separated by each cell surface marker on the 4th day of EC differentiation (CD31+, VEGFR2+, CD34+, VE-Cad+), or after differentiating unsorted cell lines, differentiation 8 to 10 On day 1, expression levels of EC marker genes were compared using qPCR. A schematic diagram of cell differentiation, separation, and experimentation is shown in FIG. 12, and gene expression levels for each experimental group and cell line are shown in FIGS. 13 to 15.
  • the expression level of CD31 and VE-Cad genes which are endothelial cell-specific markers, was higher in the population of CD31-positive cells among the cell surface markers CD31, VEGFR2, CD34 and VE-Cad than in the unsorted cell population. was found to be significantly higher.
  • FIGS. 13 and 14 in the case of the cell line isolated with CD31 in the FE-BDD insertion group, it can be seen that the relative expression level of FVIII is increased compared to the cell line isolated by CD31 in the WT-BDD insertion group. there was.
  • Example 8 the present inventors separated by each cell surface marker on the 4th day of EC differentiation (CD31+, VEGFR2+, CD34+, VE-Cad+), or after differentiating unsorted cell lines, differentiation 8 to 10 On the first day, microscopy and immunostaining were performed with CD31, vWF, and VE-Cad and observed. The results are shown in FIGS. 16 to 18 .
  • EC progenitor cells were isolated by MACS on the 4th day, and then immunostained with EC markers CD31, vWF, and VE-Cad on the 10th day of final differentiation to observe the results. It was confirmed that the CD31+, CD34+, and VE-Cad+ cells were the cells uniformly expressing CD31 and vWF as a whole. In contrast, in the case of Unsorted and VEGFR2+ cells, it was confirmed that a large number of CD31-/vWF- cells were mixed (scale bar 200 ⁇ m).
  • CD31, CD34 and/or VE-Cad markers are used to isolate EC progenitor cells that are positive for the corresponding EC marker, it was found that cells differentiated into vascular endothelial cells can be separated with higher uniformity.
  • Example 10 Comparison of FVIII activity after EC cell isolation using cell surface markers of corrected iPSCs
  • Example 8 the present inventors differentiated cell lines separated by each cell surface marker (CD31+, VEGFR2+, CD34+, VE-Cad+) into EC cells on the 4th day of EC differentiation, and then differentiated WT- The activity of FVIII contained in the culture medium of BDD and FE-BDD cell lines was compared. The results are shown in Table 6 and FIG. 19 .

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Veterinary Medicine (AREA)
  • Plant Pathology (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Hematology (AREA)
  • Epidemiology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Virology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Vascular Medicine (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Diabetes (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Transplantation (AREA)

Abstract

본 발명은 FE-FVIII 변이 유전자로 교정된 줄기세포와 이로부터 분화된 내피 세포 및 이를 포함하는 혈우병 예방 또는 치료용 약제학적 조성물에 관한 것이다. 본 발명의 상기 조성물과, 유도만능 줄기세포, 이로부터 분화된 내피세포는 FVIII의 기능을 회복하는 효능이 우수하므로, 혈우병의 치료제로서 유용하게 사용될 수 있다.

Description

FE-FVIII 변이 유전자로 교정된 줄기세포, 이로부터 분화된 내피 세포 및 이를 포함하는 혈우병 예방 또는 치료용 약제학적 조성물
본 특허출원은 대한민국 특허출원 제10-2021-0043662호(2021년 4월 2일 출원)에 대하여 우선권을 주장하며, 상기 특허출원의 개시 사항은 본 명세서에 참조로서 삽입된다.
본 발명은 FE-FVIII 변이 유전자로 교정된 줄기세포와 이로부터 분화된 내피 세포 및 이를 포함하는 혈우병 예방 또는 치료용 약제학적 조성물에 관한 것이다.
A형 혈우병(Hemophilia A, HA)은 X 염색체에 있는 혈액응고 인자 FVIII (F8) (이하 blood coagulation factor VIII, coagulation factor VIII, factor VIII, 또는 factor 8로 표현됨) 유전자의 다양한 돌연변이에 의해 유발되며 출혈 장애 중 가장 흔한 유전 질환이다. 응고 경로에서 FVIII는 FIX의 보조인자(cofactor)이다. 활성 FVIII는 활성 FIX와 결합하고 함께 테나제 복합체(tenase complex)를 형성하여 FX를 활성화한다. 테나제 복합체는 응고의 양성 피드백 루프를 시작하기 때문에 FVIII는 응고 경로에서 필수 단백질이다. 현재까지 HA에 대한 근본적인 치료법은 없다. 중증 유형의 HA 환자(FVIII의 1% 미만 활성)는 관절 및 근육과 같은 기관에서 내부 출혈이 일어나기 쉽고 만성 근골격 질환이 발생할 가능성이 더 높다. 따라서 중증형 환자는 2~3일에 한 번 높은 비용으로 재조합 FVIII 단백질로 평생 치료해야 한다.
HA에 대한 치료 옵션을 개선하기 위해 다양한 전략이 조사되었다. FVIII가 혈액 순환에 남아 있는 시간을 연장하기 위한 향상된 반감기(enhanced half-life, EHL)를 가진 FVIII 단백질의 개발은 HA 치료를 위한 가장 오래된 전략 중 하나이며 여전히 진행 중이다. 최근에는 AAV(adeno-associated virus) 벡터를 이용한 유전자 치료가 등장하고 있다. 그러나 AAV 벡터는 성인에게만 적용될 수 있으며 벡터 용량 및 인핸서-프로모터의 강도에 따라 암종이 발생할 수 있다.
환자 유래 만능 줄기 세포(induced pluripotent stem cell, iPSC)는 HA 치료를 위한 유망한 도구가 될 수 있다. iPSC는 재프로그래밍 인자(OCT4, SOX2, KLF4 및 c-MYC)로 유도된 체세포에서 직접 생성될 수 있다. 만능줄기세포(pluripotent stem cell, PSC)는 만능성과 자가재생 능력이 있어 정상적으로 기능하지 못하는 세포나 조직을 대체하는 세포치료제의 좋은 원천이다. 최근에는 유전자 편집된 iPSC가 프로그램 가능한 뉴클레아제를 사용하여 환자 유래 iPSC의 역 FVIII 유전자를 교정한 후 내피 세포(EC)로 분화될 때 FVIII 단백질이 정상적으로 발현될 수 있음이 확인되었다. 그러나 HA 환자의 절반 이상이 큰 결실, 삽입, 복제 또는 점 돌연변이를 포함한 다른 유전적 변이를 가지고 있다. 따라서, HA 환자에서 발생하는 모든 유형의 유전적 돌연변이에 적용할 수 있는 보편적인 전략이 필요한 실정이다.
프로그래밍 가능한 뉴클레아제를 이용한 유전체 편집이 등장하면서 표적 DNA가 쉽게 변형될 수 있게 되었다. ZFN(zinc finger nucleases, 징크 핑거 뉴클레아제), TALEN(transcription activator-like effector nucleases, 전사 활성인자-유사 이펙터 뉴클레아제) 및 clusters of regularly interspaced palindromic repeats (CRISPR)/Cas9 을 포함한 프로그램 가능한 뉴클레아제는 부위 특이적 DNA 이중 가닥 절단(double stranded-break, DSB)을 생성한다. DSB는 내인성 메커니즘(endogenous mechanisms)을 통해 상동성 직접 복구(homology-direct repair, HDR) 또는 비-상동 말단 접합(non-homologous end joining, NHEJ)에 의해 복구되어 표적 돌연변이 유발 및 염색체 재배열이 발생한다. iPSC와 프로그래밍된 뉴클레아제를 이용한 유전체 편집을 결합하면 유전 질환을 치료하는 세포 요법의 가능성을 고려해볼 수 있을 것이다.
본 발명자들은 iPSC에 유전자 편집을 이용하여 혈우병을 치료할 수 있는 세포치료제를 개발하고자 예의 연구 노력하였다. 본 발명자들은 CRISPR/Cas9 nickase 매개 넉-인(Knock-In, KI)을 사용하여 HA 환자 유래 iPSC의 아데노-관련 바이러스 부위 1(deno-associated virus site 1, AAVS1) 유전자좌에 혈액응고인자 FVIII (F8) (blood coagulation factor VIII, coagulation factor VIII, factor VIII, 또는 factor 8) 유전자와, 기능적으로 강화된 FVIII 유전자를 삽입함으로써 보편적인 유전자 교정 전략을 수립하였다. 구체적으로, F309S 돌연변이 FVIII 유전자의 활성 수준(1.4배), E1984V 돌연변이 FVIII 유전자의 FVIII 반감기(1.35배), F309S/E1984V- 돌연변이 FVIII 유전자 (FE-FVIII)에서 FVIII의 활성 수준 및 반감기의 개선을 확인하였다 (각각 1.56배, 1.55배). FVIII 및 FE-FVIII 발현 카세트를 환자 유래 iPSC에 삽입 (WT-KI 및 FE-KI iPSC)하면 FVIII mRNA가 iPSC 및 분화된 EC (endothelial cell)에서 발현되고 FVIII 단백질도 분비되었다. 중요하게는, FE-KI iPSC로부터 유래된 EC로부터 분비된 FE-FVIII 단백질은 FVIII의 활성 및 FVIII의 붕괴 분석에 의해 분석된 FVIII 단백질보다 FVIII 단백질의 활성 수준 및 안정성이 더 개선되었다. 또한, 본 발명자들은 WT-KI iPSC에서 파생된 EC보다 FE-KI iPSC에서 파생된 EC를 이식한 HA 마우스에서 더 높은 FVIII 활성이 나타남을 확인하였다. 구체적으로는 WT-KI 및 FE-KI EC 이식 마우스 모두 테일 클립 챌린지(각각 17.6%, 22.2%)에 의해 48시간 내에 생존하여 세포 기반 혈우병 요법의 가능성을 입증하였다. 따라서, FE-KI iPSC를 EC로 분화시키면 HA 치료용 세포치료제로서 유용하게 사용할 수 있음을 규명함으로써, 본 발명을 완성하게 되었다.
따라서, 본 발명의 목적은 혈액응고인자 FVIII 넉-인(knock-in) 용 조성물을 제공하는 것이다.
본 발명의 다른 목적은 F309 위치 및 E1984 위치에 돌연변이를 포함하는 FVIII 변이 유전자를 발현하는 유도만능 줄기세포, 이로부터 분화된 내피 세포, 및 이들의 제조방법을 제공하는 것이다.
본 발명의 다른 목적은 상기 조성물, 유도만능 줄기세포, 또는 내피 세포를 유효성분으로 포함하는 A형 혈우병의 예방 또는 치료용 약제학적 조성물을 제공하는 것이다.
본 발명의 일 양태에 따르면, 본 발명은 혈액응고인자 FVIII (F8) (blood coagulation factor VIII)의 F309 위치 및 E1984 위치에 돌연변이를 포함하는, FVIII 변이 단백질을 인코딩하는 폴리뉴클레오타이드를 포함하는, 혈액응고인자 FVIII 넉-인(knock-in) 용 조성물을 제공한다.
본 발명의 일 구현예에 있어서, 상기 혈액응고인자 FVIII은 전장 혈액응고인자 FVIII (full-length blood coagulation factor VIII, flFVIII), 또는 이의 단편을 포함하는 것일 수 있다.
본 발명의 구체적인 구현예에 있어서, 상기 전장 혈액응고인자 FVIII의 단편은 B 도메인이 결여된 혈액응고인자 FVIII (B domain-deleted blood coagulation factor VIII, BDD-VIII)일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에 있어서, 상기 F309 위치 돌연변이는 F309S 돌연변이일 수 있다.
본 발명의 일 구현예에 있어서, 상기 E1984 위치 돌연변이는 E1984V 돌연변이일 수 있다.
본 발명의 일 구현예에 있어서, 상기 FVIII 변이 단백질은 F309S 및 E1984V 변이 단백질일 수 있다.
본 발명의 일 구현예에 있어서, 상기 F309 위치 돌연변이, 및 E1984 위치 돌연변이를 포함하지 않는 FVIII 단백질은 서열번호 46의 아미노산 서열을 포함할 수 있다.
본 발명의 일 구현예에 있어서, 상기 F309 위치 돌연변이, 및 E1984 위치 돌연변이를 가진 FVIII 변이 단백질은 서열번호 48의 아미노산 서열을 포함할 수 있다.
본 발명의 일 구현예에 있어서, 상기 조성물은 AAVS1 유전자 좌위(locus)를 표적화하는 가이드 RNA 또는 이를 인코딩하는 폴리뉴클레오타이드를 추가적으로 포함한다.
본 발명의 일 구현예에 있어서, 상기 가이드 RNA는 PPP1R12C 유전자의 인트론 1을 표적으로 하는 것이나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에 있어서, 상기 가이드 RNA는 길이가 약 15 nt 내지 30 nt, 15 nt 내지 25 nt, 15 nt 내지 24 nt, 15 nt 내지 23 nt, 15 nt 내지 22 nt, 15 nt 내지 21 nt, 15 nt 내지 20 nt, 16 nt 내지 30 nt, 16 nt 내지 25 nt, 16 nt 내지 24 nt, 16 nt 내지 23 nt, 16 nt 내지 22 nt, 16 nt 내지 21 nt, 16 nt 내지 20 nt, 17 nt 내지 30 nt, 17 nt 내지 25 nt, 17 nt 내지 24 nt, 17 nt 내지 23 nt, 17 nt 내지 22 nt, 17 nt 내지 21 nt, 17 nt 내지 20 nt, 18 nt 내지 30 nt, 18 nt 내지 25 nt, 18 nt 내지 24 nt, 18 nt 내지 23 nt, 18 nt 내지 22 nt, 18 nt 내지 21 nt, 또는 18 nt 내지 20 nt일 수 있으나 이에 한정되는 것은 아니다.
본 발명의 일 구현예에 있어서, 상기 가이드 RNA는 프로토스페이서 인접 모티프 (Protospacer adjacent motif, PAM) 서열을 포함하는 것이다.
본 발명의 일 구현예에 있어서, 상기 가이드 RNA를 인코딩하는 폴리뉴클레오타이드는 RNA, DNA, 또는 PNA일 수 있고, 화학적으로 변형된 것일 수 있다.
본 발명의 일 구현예에 있어서, 상기 가이드 RNA는 sgRNA (single chain guide RNA)일 수 있다.
상기 화학적 변형은 비-자연적 뉴클레오타이드 연결을 포함하는 것일 수 있다.
상기 화학적 변형은 비-자연적 뉴클레오타이드 연결 포스페이트 잔기(nonnatural inter-nucleotide bridging phosphate residue)가 변형된 포스페이트를 포함할 수 있다.
상기 변형된 포스페이트는 메틸 포스포네이트(methyl phosphonates), 메틸 포스포로싸이오에 이트(methyl phosphorothioates), 포스포로모폴리데이트(phosphoromorpholidates), 포스포로피페라지데이트 (phosphoropiperazidates) 또는 포스포로아미데이트(phosphoroamidates)로부터 선택되는 것일 수 있다.
본 발명의 일 구현예에 있어서, 상기 조성물은 RNA-가이드 뉴클레아제(RNA-guided nuclease), 또는 이를 인코딩하는 폴리뉴클레오타이드를 추가적으로 포함한다.
본 발명의 일 구현예에 있어서, 상기 RNA-가이드 뉴클레아제는 Cas 폴리펩타이드일 수 있다.
상기 Cas 폴리펩타이드는 CRISPR/Cas 시스템의 단백질 구성 요소 중 하나로서, 활성화된 엔도뉴클레아제 또는 닉(nick) 형성 효소일 수 있다. 상기 Cas 폴리펩타이드는 crRNA(CRISPR RNA) 및 tracrRNA(trans-activating crRNA)와 복합체를 형성하여 그의 활성을 나타낼 수 있다. 상기 Cas 폴리펩티드는 예를 들어 스트렙토코커스 속 (예, Streptococcus pyogens), 네이세리아 속(예, Neisseria meningitidis), 파스테우렐라 속(예, Pasteurella multocida), 프란시셀라 속(예, Francisella novicida), 또는 캄필로박터 속(예, Campylobacter jejuni)의 세균으로부터 유래된 폴리펩티드일 수 있다. 상기 Cas 폴리펩타이드는 Cas9 폴리펩타이드 또는 Cas12a (Cpf1) 폴리펩타이드일 수 있다.
본 발명의 일 구현예에 있어서, 상기 PAM 서열은 5'-NGG-3'일 수 있으나, 이에 한정되는 것은 아니다. 상기 N은 임의의 염기를 의미한다.
본 발명의 일 구현예에 있어서, 상기 FVIII 변이 단백질을 인코딩하는 폴리뉴클레오타이드, 및/또는 RNA-가이드 뉴클레아제(RNA-guided nuclease)를 인코딩하는 폴리뉴클레오타이드는 벡터에 포함될 수 있다. 상기 벡터는 플라스미드일 수 있다.
본 발명의 일 구현예에 있어서, 상기 조성물은 시험관 내(in vitro), 생체 외(ex vivo), 또는 생체 내(in vivo) 교정용이다.
본 발명의 다른 일 양태에 따르면, 본 발명은 혈액응고인자 FVIII 변이 단백질을 발현하도록 형질전환된, A형 혈우병(Hemophilia A, HA) 환자의 분리된 체세포로부터 유래한 유도만능 줄기세포(induced pluripotent stem cell, iPSC)를 제공한다.
본 발명의 일 구현예에 있어서, 상기 혈액응고인자 FVIII 변이 단백질은 혈액응고인자 FVIII (blood coagulation factor VIII, BDD-VIII)의 F309 위치 및 E1984 위치에 돌연변이를 포함하는 것이다.
본 발명의 일 구현예에 있어서, 상기 혈액응고인자 FVIII은 전장 혈액응고인자 FVIII (full-length blood coagulation factor VIII, flFVIII), 또는 이의 단편을 포함하는 것일 수 있다.
본 발명의 구체적인 구현예에 있어서, 상기 전장 혈액응고인자 FVIII의 단편은 B 도메인이 결여된 혈액응고인자 FVIII (B domain-deleted blood coagulation factor VIII, BDD-VIII)일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에 있어서, 상기 F309 위치 돌연변이는 F309S 돌연변이일 수 있다.
본 발명의 일 구현예에 있어서, 상기 E1984 위치 돌연변이는 E1984V 돌연변이일 수 있다.
본 발명의 일 구현예에 있어서, 상기 FVIII 변이 단백질은 F309S 및 E1984V 변이 단백질일 수 있다.
본 발명의 일 구현예에 있어서, 상기 A혈 혈우병 환자의 분리된 체세포는, 근육세포, 신경세포, 상피세포, 혈액 세포, 비만 세포, 골 세포, 및 줄기 세포로 이루어진 군으로부터 선택된 세포를 말한다. 상기 체세포는 예를 들어, 지방 세포, 섬유아세포, 상피 세포, 혈액 세포, 또는 조혈모줄기세포일 수 있다. 상기 섬유아세포는 피부 유래 섬유아세포일 수 있다. 상기 상피 세포는 뇨관 유래 뇨(uninary) 상피 세포일 수 있다. 상기 줄기세포는 지방조직 유래 중간엽 줄기세포(mesenchymal stem cell, MSC)일 수 있으나 이에 한정되는 것은 아니다.
본 명세서에서 용어, "유도만능 줄기세포(induced pluripotent stem cell, iPSC)"는 분화된 세포들로부터 인위적인 역분화 과정을 통해 전분화능(pluripotency)을 가지도록 유도된 세포를 말한다. 상기 유도만능 줄기세포는 배아줄기세포와 세포 외형, 유전자, 또는 단백질 발현 패턴이 유사하고, 시험관 내 및 생체 내에서 전분화능을 가지며, 테라토마(teratoma)를 형성하고, 유전자의 생식선 전이(germline transmission)가 가능하다. 상기 유도만능 줄기세포는 인간, 소, 말, 돼지, 개, 양, 염소 또는 고양이 등의 모든 포유류 유래의 역분화 유도만능 줄기세포를 포함할 수 있다. 상기 유도만능 줄기세포는 인간 유래의 유도만능 줄기세포일 수 있다. 상기 유도만능 줄기세포는 A형 혈우병 환자로부터 유래한 유도만능 줄기세포일 수 있다.
본 발명의 일 구현예에 있어서, 상기 형질전환은 세포의 형질전환에 이용되는 알려진 모든 유전자 전달 시스템을 이용하여 수행될 수 있다.
본 발명의 유전자 전달 시스템은 다양한 형태로 제작할 수 있는 데, 이는 (i) 내이키드(naked) 재조합 DNA 분자, (ii) 플라스미드, (iii) 바이러스 벡터, 및 (iv) 상기 네이키드 재조합 DNA 분자 또는 플라스미드를 내포하는 리포좀, 고분자 나노입자, 지질 나노입자 등의 형태로 제작할 수 있다.
본 발명에서, 유전자 전달체가 바이러스 벡터에 기초하여 제작된 경우에는, 상기 접촉시키는 단계는 당업계에 공지된 바이러스 감염 방법에 따라 실시된다. 바이러스 벡터를 이용한 숙주 세포의 감염은 상술한 인용문헌에 기재되어 있다.
본 발명에서 유전자 전달체가 내이키드(naked) 재조합 DNA 분자 또는 플라스미드인 경우에는, 미세 주입법 (Capecchi, M.R., Cell, 22:479(1980); 및 Harland와 Weintraub, J. Cell Biol. 101:1094-1099(1985)), 칼슘 포스페이트 침전법 (Graham, F.L. et al., Virology, 52:456(1973); 및 Chen과 Okayama, Mol. Cell. Biol. 7:2745-2752(1987)), 전기 천공법(Neumann, E. et al., EMBO J., 1:841(1982); 및 Tur-Kaspa et al., Mol. Cell Biol., 6:716-718(1986)), 리포좀-매개 형질감염법(Wong, T.K. et al., Gene, 10:87(1980); Nicolau 및 Sene, Biochim. Biophys. Acta, 721:185-190(1982); 및 Nicolau et al., Methods Enzymol., 149:157- 176(1987)), DEAE-덱스트란 처리법(Gopal, Mol. Cell Biol., 5:1188-1190(1985)) 및 유전자 밤바드먼트(Yang et al., Proc. Natl. Acad. Sci., 87:9568-9572(1990)) 방법에 의해 유전자를 세포내로 도입시킬 수 있으며, 가장 구체적으로는 전기 천공법을 이용할 수 있다.
본 발명의 다른 일 양태에 따르면, 본 발명은 상기 유도만능 줄기세포로부터 분화된, 혈액응고인자 FVIII 변이 단백질을 발현하는 내피 세포를 제공한다.
본 발명의 또 다른 일 양태에 따르면, 본 발명은 상술한 혈액응고인자 FVIII 넉-인(knock-in) 용 조성물, 혈액응고인자 FVIII 변이 단백질을 발현하도록 형질전환된, 유도만능 줄기세포, 또는 상기 혈액응고인자 FVIII 변이 단백질을 발현하는 내피 세포를 유효성분으로 포함하는, A형 혈우병의 예방 또는 치료용 약제학적 조성물을 제공한다.
상기 약학적 조성물은 약학적으로 허용가능한 담체를 포함할 수 있다. 상기 담체는 부형제, 희석제 또는 보조제를 포함하는 의미로 사용된다. 상기 담체는 예를 들면, 락토스, 덱스트로스, 수크로스, 소르비톨, 만니톨, 자일리톨, 에리트리톨, 말티톨, 전분, 아카시아 고무, 알기네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로스, 메틸 셀룰로스, 폴리비닐 피롤리돈, 물, 생리식염수, PBS와 같은 완충액, 메틸히드록시 벤조에이트, 프로필히드록시 벤조에이트, 탈크, 마그네슘 스테아레이트, 및 미네랄 오일로 이루어진 군으로부터 선택된 것일수 있다. 상기 조성물은 충진제, 항응집제, 윤활제, 습윤제, 풍미제, 유화제, 보존제, 또는 이들의 조합을 포함할 수 있다.
상기 약학적 조성물은 통상의 방법에 따라 임의의 제형으로 준비될 수 있다. 상기 조성물은 예를 들면, 경구 투여 제형(예, 분말, 정제, 캡슐, 시럽, 알약, 또는 과립), 또는 비경구 제형(예, 주사제)으로 제형화될 수 있다.
또한, 상기 조성물은 전신 제형 또는 국부 제형으로 제조될 수 있다. 상기 약학적 조성물은 경구, 정맥내, 근육 내, 경구, 경피(transdermal), 점막, 코안(intranasal), 기관내(intratracheal), 피하, 또는 이들의 조합으로 투여될 수 있다.
본 발명의 구체적인 구현예에 있어서, 상기 조성물은 피하 경로로 투여될 수 있으며, 보다 구체적으로는 피하 지방에 투여될 수 있다.
본 발명의 다른 일 양태에 따르면, 본 발명은 A형 혈우병(Hemophilia A, HA) 환자의 분리된 체세포로부터 유래한 유도만능 줄기세포에 FVIII 변이 단백질을 발현하는 유도만능 줄기세포의 제조방법을 제공한다.
본 발명의 일 구현예에 있어서, 상기 FVIII 변이 단백질을 발현하는 유도만능 줄기세포의 제조방법은 상술한 혈액응고인자 FVIII 넉-인(knock-in) 용 조성물을 처리하여 혈액응고인자 FVIII 변이 단백질을 발현하도록 형질전환하는 단계를 포함한다.
본 발명의 또 다른 일 양태에 따르면, 본 발명은 다음 단계를 포함하는 혈액응고인자 FVIII 변이 단백질을 발현하는 내피 세포의 제조 방법을 제공한다:
(a) 혈액응고인자 FVIII (blood coagulation factor VIII)의 F309 위치 및 E1984 위치에 돌연변이를 포함하는 FVIII 변이 단백질을 발현하도록 형질 전환된, A형 혈우병(Hemophilia A, HA) 환자의 분리된 체세포로부터 유래한 유도만능 줄기세포(induced pluripotent stem cell, iPSC)를 내피 전구세포(endothelial progenitor cell) 집단으로 분화시키는 단계;
(b) 상기 내피 전구세포의 집단 중 CD31, VEGFR2, CD34, VE-Cad, 또는 이들의 조합의 세포 표면 단백질을 발현하는 세포를 분리하는 단계; 및
(c) 상기 분리된 세포를 내피 세포로 분화시키는 단계.
본 발명의 일 구현예에 있어서, 상기 혈액응고인자 FVIII은 전장 혈액응고인자 FVIII (full-length blood coagulation factor VIII, flFVIII), 또는 이의 단편을 포함하는 것일 수 있다.
본 발명의 구체적인 구현예에 있어서, 상기 전장 혈액응고인자 FVIII의 단편은 B 도메인이 결여된 혈액응고인자 FVIII (B domain-deleted blood coagulation factor VIII, BDD-VIII)일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에 있어서, 상기 (a) 단계는 (a1) 상기 형질전환된 유도만능 줄기세포를 Y-27632를 포함하는 배지에서 1 내지 2일간 배양하는 단계를 포함하는 것이다. 본 발명의 구체적인 구현예에 있어서, 상기 Y-27632는 상기 배지에 약 1-20 μM, 1-18 μM, 1-15 μM, 1-14 μM, 1-13 μM, 1-12 μM, 1-11 μM, 1-10 μM, 5-20 μM, 5-18 μM, 5-15 μM, 5-14 μM, 5-13 μM, 5-12 μM, 5-11 μM, 5-10 μM, 8-20 μM, 8-18 μM, 8-15 μM, 8-14 μM, 8-13 μM, 8-12 μM, 8-11 μM, 8-10 μM, 5 μM, 6 μM, 7 μM, 8 μM, 9 μM, 10 μM, 11 μM, 12 μM, 13 μM, 14 μM, 또는 15 μM의 농도로 포함되는 것이나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에 있어서, 상기 (a) 단계는 (a2) 상기 형질전환된 유도만능 줄기세포를 CHIR99021를 포함하는 배지에서 1 내지 3일 동안 배양하는 단계를 추가적으로 포함하는 것이다.
본 발명의 구체적인 구현예에 있어서, 상기 CHIR99021는 상기 배지에 약 1 내지 15 μM, 1 내지 12 μM, 1 내지 10 μM, 1 내지 9 μM, 1 내지 8 μM, 1 내지 7 μM, 1 내지 6 μM, 3 내지 15 μM, 3 내지 12 μM, 3 내지 10 μM, 3 내지 9 μM, 3 내지 8 μM, 3 내지 7 μM, 3 내지 6 μM, 5 내지 15 μM, 5 내지 12 μM, 5 내지 10 μM, 5 내지 9 μM, 5 내지 8 μM, 5 내지 7 μM, 5 내지 6 μM, 3 μM, 4 μM, 5 μM, 6 μM, 7 μM, 8μM, 9 μM, 또는 10 μM의 농도로 포함되는 것이나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에 있어서, 상기 (a) 단계는 (a3) 상기 형질전환된 유도만능 줄기세포를 BMP4, bFGF, VEGF-A, 또는 이들의 조합을 포함하는 배지에서 1 내지 3일 동안 배양하는 단계를 추가적으로 포함하는 것이다.
본 발명의 구체적인 구현예에 있어서, 상기 BMP4는 배지에 10 내지 50 ng/mL, 10 내지 40 ng/mL, 10 내지 35 ng/mL, 10 내지 30 ng/mL, 10 내지 25 ng/mL, 15 내지 50 ng/mL, 15 내지 40 ng/mL, 15 내지 35 ng/mL, 15 내지 30 ng/mL, 15 내지 25 ng/mL, 20 내지 50 ng/mL, 20 내지 40 ng/mL, 20 내지 35 ng/mL, 20 내지 30 ng/mL, 20 내지 25 ng/mL, 15 ng/mL, 16 ng/mL, 17 ng/mL, 18 ng/mL, 19 ng/mL, 20 ng/mL, 21 ng/mL, 22 ng/mL, 23 ng/mL, 24 ng/mL, 또는 25 ng/mL의 농도로 포함되는 것이나 이에 한정되는 것은 아니다.
본 발명의 구체적인 구현예에 있어서, 상기 bFGF는 배지에 1 내지 25 ng/mL, 1 내지 20 ng/mL, 1 내지 15 ng/mL, 1 내지 10 ng/mL, 3 내지 25 ng/mL, 3 내지 20 ng/mL, 3 내지 15 ng/mL, 3 내지 10 ng/mL, 5 내지 25 ng/mL, 5 내지 20 ng/mL, 5 내지 15 ng/mL, 5 내지 10 ng/mL, 6 내지 25 ng/mL, 6 내지 20 ng/mL, 6 내지 15 ng/mL, 6 내지 10 ng/mL, 8 내지 25 ng/mL, 8 내지 20 ng/mL, 8 내지 15 ng/mL, 8 내지 10 ng/mL, 10 내지 25 ng/mL, 10 내지 20 ng/mL, 10 내지 15 ng/mL, 7 ng/mL, 8 ng/mL, 9 ng/mL, 10 ng/mL, 11 ng/mL, 12 ng/mL, 13 ng/mL, 14 ng/mL, 또는 15 ng/mL의 농도로 포함되는 것이나, 이에 한정되는 것은 아니다.
본 발명의 구체적인 구현예에 있어서, 상기 VEGF-A는 상기 배지에 20 내지 100 ng/mL, 20 내지 80 ng/mL, 20 내지 70 ng/mL, 20 내지 60 ng/mL, 20 내지 50 ng/mL, 30 내지 100 ng/mL, 30 내지 80 ng/mL, 30 내지 70 ng/mL, 30 내지 60 ng/mL, 30 내지 50 ng/mL, 35 내지 100 ng/mL, 35 내지 80 ng/mL, 35 내지 70 ng/mL, 35 내지 60 ng/mL, 35 내지 50 ng/mL, 40 내지 100 ng/mL, 40 내지 80 ng/mL, 40 내지 70 ng/mL, 40 내지 60 ng/mL, 40 내지 50 ng/mL, 45 내지 100 ng/mL, 45 내지 80 ng/mL, 45 내지 70 ng/mL, 45 내지 60 ng/mL, 45 내지 50 ng/mL, 45 ng/mL, 46 ng/mL, 47 ng/mL, 48 ng/mL, 49 ng/mL, 50 ng/mL, 51 ng/mL, 52 ng/mL, 53 ng/mL, 54 ng/mL, 또는 55 ng/mL의 농도로 포함되는 것이나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에 있어서, 상기 (a) 단계는 상기 (a1) 내지 (a3)의 단계를 순차적으로 포함할 수 있다.
본 발명의 일 구현예에 있어서, 상기 (a) 단계의 배양은 세포외기질을 포함하는 겔로 코팅된 배양용기에서 이루어지는 것일 수 있다. 상기 세포외기질을 포함하는 겔은 마트리겔(MatrigelTM)이나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에 있어서, 상기 (a1) 내지 (a3)의 단계는 중배엽 계통의 분화를 유도하는 것이다.
본 발명의 일 구현예에 있어서, 상기 단계 (b)는 내피 전구세포의 집단 중 CD31, CD34, VE-Cad, 또는 이들의 조합의 세포 표면 단백질을 발현하는 세포를 분리하는 단계를 포함한다.
본 발명의 구체적인 구현예에 있어서, 상기 단계 (b)는 내피 전구세포의 집단 중 CD31, VE-Cad, 또는 이들의 조합의 세포 표면 단백질을 발현하는 세포를 분리하는 단계를 포함한다. 보다 구체적으로는 내피 전구세포의 집단 중 CD31의 세포 표면 단백질을 발현하는 세포를 분리하는 단계를 포함한다.
본 발명의 일 구현예에 있어서, 상기 (c) 단계는 상기 형질전환된 유도만능 줄기세포를 VEGF-A를 포함하는 배지에서 2 내지 8일 동안 배양하는 단계를 추가적으로 포함하는 것이다.
본 발명의 구체적인 구현예에 있어서, 상기 VEGF-A는 상기 배지에 20 내지 100 ng/mL, 20 내지 80 ng/mL, 20 내지 70 ng/mL, 20 내지 60 ng/mL, 20 내지 50 ng/mL, 30 내지 100 ng/mL, 30 내지 80 ng/mL, 30 내지 70 ng/mL, 30 내지 60 ng/mL, 30 내지 50 ng/mL, 35 내지 100 ng/mL, 35 내지 80 ng/mL, 35 내지 70 ng/mL, 35 내지 60 ng/mL, 35 내지 50 ng/mL, 40 내지 100 ng/mL, 40 내지 80 ng/mL, 40 내지 70 ng/mL, 40 내지 60 ng/mL, 40 내지 50 ng/mL, 45 내지 100 ng/mL, 45 내지 80 ng/mL, 45 내지 70 ng/mL, 45 내지 60 ng/mL, 45 내지 50 ng/mL, 45 ng/mL, 46 ng/mL, 47 ng/mL, 48 ng/mL, 49 ng/mL, 50 ng/mL, 51 ng/mL, 52 ng/mL, 53 ng/mL, 54 ng/mL, 또는 55 ng/mL의 농도로 포함되는 것이나, 이에 한정되는 것은 아니다.
본 발명의 특징 및 이점을 요약하면 다음과 같다:
(a) 본 발명은 혈액응고인자 FVIII 넉-인(knock-in) 용 조성물을 제공한다.
(b) 본 발명은 F309 위치 및 E1984 위치에 돌연변이를 포함하는 FVIII 변이 단백질을 발현하는 유도만능 줄기세포, 이로부터 분화된 내피 세포, 및 이들의 제조방법을 제공한다.
(c) 본 발명은 상기 조성물, 유도만능 줄기세포, 또는 내피 세포를 유효성분으로 포함하는 A형 혈우병의 예방 또는 치료용 약제학적 조성물을 제공한다.
(d) 본 발명의 상기 조성물과, 유도만능 줄기세포, 이로부터 분화된 내피세포는 FVIII의 기능을 회복하는 효능이 우수하므로, 혈우병의 치료제로서 유용하게 사용될 수 있다.
도 1은 FVIII 변이체의 FVIII 활성 수준 및 안정성을 분석한 결과이다. (A) FVIII 변이체의 FVIII 활성. 활성은 형질감염(transfection) 된 HEK293T 세포로부터 얻은 상청액 후에 결정되었다. (B) FVIII 변이체의 붕괴 분석. 각 활성은 형질감염된 HEK293T 세포로부터 수확된 FVIII 단백질을 37℃에서 0, 8, 16, 24시간 동안 배양한 후 측정하였다. (C) FVIII 변이체의 붕괴율 및 상대 반감기. 데이터는 3개의 독립적인 실험의 평균 ± SEM이다. 비율 감쇠 값에 대한 SD는 최소 제곱 곡선 피팅을 기반으로 추정되며 평균 값의 약 10% 이내이다. *, BDD-FVIII 형질감염된 세포와 비교하여 p < 0.05. (WT, WT BDD-FVIII; F, F309S 돌연변이 BDD-FVIII; E, E1984V 돌연변이 BDD-FVIII; FE, F309S/E1984V 돌연변이 BDD-FVIII)
도 2는 교정된 iPSC 세포주의 1차 PCR 스크리닝 결과를 나타낸 도이다. (A) 염색체 19에 위치한 PPP1R12C 유전자의 인트론 1에 위치하는 AAVS1 유전자좌에서 sgRNA 표적 서열. (B) 넉-인 iPSC 세포주에서 공여자 DNA의 표적 삽입을 확인하기 위한 PCR 기반 유전자형 분석. 각 프라이머 세트는 5' 녹-인 junction (F1/R1), 3' 녹-인 junction (F2/R2) 및 AAVS1 유전자좌(F1/R2)를 나타낸다. β-액틴은 내부 참조로 사용되었다. (C) 템플릿 공여자 DNA를 포함하는 통합된 iPSC 세포주에서 녹-인 junction의 부분 서열. 두개의 암 시퀀스는 모두 녹색으로 표시되었다. pEF1α에서 시작하여 puromycin 내성 유전자로 끝나는 공여자 플라스미드 서열은 각각 파란색과 청록색으로 표시되었다. 원래의 게놈 시퀀스는 검은색으로 표시되었다.
도 3은 HA 환자 유래 iPSC의 인간 AAVS1 유전자좌에 FVIII 유전자의 표적 삽입을 모식도로 나타낸 것이다. (A) HA 유래 iPSC의 AAVS1 유전자좌에 넉-인 후 1차 PCR 스크리닝을 위한 PCR 표적 부위의 개략도. PCR 기반 유전자형 분석에 사용되는 프라이머는 화살표로 표시되었다. (B) 교정된 iPSC 세포주에서 퓨로마이신 내성 카세트의 제거를 식별하기 위한 PCR 기반 유전자형 분석. F1/R1 및 F2/R2 프라이머 세트는 각각 교정된 iPSC의 5' 접합(junction) 및 3' 접합(junction)을 검출하는 데 사용되었다. F3/R2 프라이머 세트는 퓨로마이신 내성 카세트의 절제(excision)를 검출하는 데 사용되었다. (C) F3/R2 프라이머 세트를 사용하여 DNA 앰플리콘을 생성하고 저항 카세트의 절제 후 교정된 iPSC 세포주의 loxP 부위 주변의 서열을 보여준다.
도 4는 교정된 iPSC 세포주의 다능성 마커 발현을 나타낸 도이다. (A) 모 환자(parental patient) 및 교정된 iPSC 세포주(corrected iPSC line)에서 다능성 마커(OCT4, SOX2, NANOG 및 LIN28)의 정량적 실시간 PCR 분석. GAPDH는 유전자 발현을 정규화하는 데 사용됨. 데이터는 3개의 독립적인 실험의 평균 ± SEM이다. (B) 면역형광 염색은 교정된 iPSC 세포주의 다능성 마커 단백질(OCT4 및 SSEA4)의 발현을 보여준다. 핵은 4', 6-diamidino-2-phenylindole (DAPI)로 표시되었다(Scale bar, 100μm). (C) 면역형광 염색은 교정된 iPSC 세포주의 외배엽(NESTIN), 중배엽(α-평활근 액틴, α-SMA) 및 내배엽(간세포 핵 인자-3β, HNF-3β)을 나타내는 마커 단백질의 발현을 보여준다. 핵은 DAPI(스케일 바, 100μm)로 표지되었다. (D) 교정된 iPSC 세포주에서 핵형 분석을 수행하였다.
도 5는 타겟-딥 시퀀싱을 통해 교정된 iPSC 세포주에서 오프-타겟 분석을 나타낸 도이다. (A) 표적 부위와 최대 4개의 뉴클레오티드가 다른 4개의 잠재적인 오프-타겟 사이트를 타겟-딥 시퀀싱에 의해 교정된 클론에서 조사하였다. 일치하지 않는 뉴클레오티드 및 PAM 서열(5'-NGG-3')은 각각 파란색과 빨간색으로 표시되었다. (B) 총 리드의 수.
도 6은 교정된 iPSC 세포주에서 FVIII 유전자 발현의 표현형 구조(rescue)를 나타낸 도이다. (A) 돌연변이된 서열이 FE-KI iPSC 세포주에서 번역되었는지 확인하기 위해 교정된 iPSC 세포주에서 FVIII 유전자의 mRNA에서 Sanger 시퀀싱을 수행했다. 309 Phe 및 1984 Glu는 FE-KI iPSC에서 309 Ser 및 1984 Val로 성공적으로 돌연변이되었다. (B) 환자 및 넉-인 iPSC 세포주에서 FVIII 발현 수준을 보여주는 qPCR 분석 결과. GAPDH는 유전자 발현을 정규화하는 데 사용되었다. 데이터는 3개의 독립적인 실험의 평균 ± SEM이다. (C) FVIII 활성은 환자 또는 넉-인 iPSC 세포주에서 수확된 상등액에서 30배 농축 후 측정되었다. 데이터는 1x105 iPSC당 감지된 활성을 나타낸다. 데이터는 3개의 독립적인 실험의 평균 ± SEM이다. *, p < 0.05 및 **, p < 0.01은 환자 iPSC 대비. *, p < 0.05는 WT-KI iPSC 세포주 대비(스튜던트 t 테스트).
도 7은 교정된 iPSC 세포주와 분화된 EC에서 FVIII 결핍의 기능적 회복을 나타낸 도이다. (A) 환자 및 넉-인 iPSC 세포주에서 EC 마커 발현(CD31, VWF, VE-cadherin) 및 FVIII 발현 수준을 보여주는 qPCR 분석 결과. GAPDH는 유전자 발현을 정규화하는 데 사용되었다. 데이터는 3개의 독립적인 실험의 평균 ± SEM 이다. (B) 면역형광 염색은 넉-인 iPSC 세포주의 내피 마커 단백질(CD31 및 VWF)의 발현을 보여준다. 핵은 DAPI(스케일 바, 100μm)로 표지되었다. (C) FVIII 활성은 환자 또는 넉-인 iPSC 세포주로부터 분화된 EC로부터 수확된 상청액에서 30배 농축 후에 측정되었다. 데이터는 1Х105 EC당 감지된 활성을 나타낸다. 데이터는 3개의 독립적인 실험의 평균 ± SEM 이다. *, p <0.05 및 ** p < 0.01 환자 EC와 비교. 쪌, WT-KI EC(Student t 검정)와 비교하여 p < 0.05. (D) 붕괴 분석에 대한 각 활성은 EC에서 수확한 FVIII 단백질을 37℃에서 0, 8, 16, 24시간 동안 배양한 후 결정되었습니다. 데이터는 3개의 독립적인 실험의 평균 ± SEM입니다. *, p < 0.01 WT-KI EC(스튜던트 t 테스트)와 비교. (E) EC로부터 수확된 FVIII 단백질의 FVIII 붕괴율 및 상대 반감기. 데이터는 3개의 독립적인 실험의 평균 ± SEM 이다. 비율 감쇠 값에 대한 SD는 최소 제곱 곡선 피팅을 기반으로 추정되며 평균 값의 약 10% 이내이다. *, p < 0.01 WT-KI EC(스튜던트 t 테스트)와 비교.
도 8은 이식된 HA 마우스에서 FVIII의 기능적 회복을 나타낸 도이다. (A) HA 및 이식된 마우스에서 인간 FVIII의 발현을 검출하기 위한 RT-PCR 분석. 인간 ACTIN은 이식된 EC를 식별하는 데 사용되었다. 마우스 Gapdh를 대조군으로 사용하였다. (B) FVIII 활성은 HA 및 이식된 마우스로부터 채취한 혈장을 측정하였다. 데이터는 1Х106 EC당 감지된 활동을 나타낸다. HA(이식되지 않은 혈우병 A 마우스, 매일 n=3), 환자(매일 n=3), WT-K1e1(3d에서 n=6, 기타 n=3), FE-K1e1(n=각각 6, 3, 4, 3, 3). 데이터는 평균 ± SEM을 의미한다. *, p < 0.05, **, p < 0.01 및 ***, 환자 EC 이식 마우스와 비교하여 p < 0.001, 쪌, WT-KI EC와 비교하여 p < 0.05(Student's t test). (C) 테일 클립 분석 후 HA 및 이식된 마우스의 생존 곡선. HA(n=6), 환자(n=6), WT-K1e1(n=17), FE-K1e1(n=18). *, p < 0.001 환자군과 비교(log-rank test).
도 9는 교정된 iPSC의 분화 및 MACS를 이용한 세포 분리에 관한 모식도를 나타낸 도이다.
도 10 및 도 11은 교정된 iPSC의 세포 표면 마커별 수득율을 나타낸 도이다. (도 10, WT-BDD vs. FE-BDD; 도 11, Total)
도 12는 교정된 iPSC의 분화 및 세포 분리, 유전자 발현 분석에 관한 모식도를 나타낸 도이다.
도 13 내지 도 15는 실험군별(WT-BDD, FE-BDD, Total) 및 세포 표면 마커별(CD31, VEGFR2, CD34, VE-Cad) EC 특이적 유전자(CD31, FVIII, VE-Cad, vWF) 발현 수준을 나타낸 도이다.
도 16 내지 18은 iPSC를 EC로 분화시키는 4일차에 각 세포 표면 마커로 분리하거나(CD31+, VEGFR2+, CD34+, VE-Cad+), 분리하지 않은(unsorted) 세포주들을, 분화 8 내지 10일째에 현미경(도 16) 및 CD31, vWF, VE-Cad 로 면역염색(도 17 및 도 18)을 하여 관찰한 결과를 나타낸 도이다.
도 19는 실험군 별(WT-BDD, FE-BDD)로 iPSC를 EC로 분화시키는 4일차에 각 세포 표면 마커 (CD31+, VEGFR2+, CD34+, VE-Cad+)로 분리한 EC 전구 세포들을 분화시켜, 분화 8 내지 10일째의 EC 세포의 배양액에 포함된 FVIII의 활성도를 나타낸 도이다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예
본 명세서 전체에 걸쳐, 특정 물질의 농도를 나타내기 위하여 사용되는 "%"는 별도의 언급이 없는 경우, 고체/고체는 (중량/중량) %, 고체/액체는 (중량/부피) %, 그리고 액체/액체는 (부피/부피) %이다.
실험방법 및 실험재료
SpCas9 니케이즈(nickase)에 대한 공여자 플라스미드 및 가이드 RNA의 준비
본 발명자들은 공여자 플라스미드(donor plasmid)를 구성하기 위해 pcDNA4/BDD-FVIII 플라스미드(Addgene, #41035)를 백본으로 사용하였다. 5'-상동성 암(5'-homology arm, left arm, LA) 및 3'-상동성 암(3'-homology arm, right arm, RA) 을 각각 MunI/MluI 및 PacI/MauBI 부위에 설계하고 삽입하였다. MluI/RruI 부위를 사용하여 인간 EF1α 프로모터 서열을 left arm과 FVIII 오픈 리딩 프레임 사이에 클로닝하였다. Gibson Assembly® Cloning Kit (New England Biolabs, Massachusetts, UK)를 사용하여 FVIII 유전자 카세트와 right arm 사이에 loxP 부위가 측면에 있는 소 성장 호르몬(Bovine growth hormone, bGH) 폴리아데닐화 신호 및 퓨로마이신 내성 카세트를 삽입하였다. F309S, E1984V 및 F309S/E1984V 돌연변이체는 Gibson 어셈블리에 의해 구성되었다. 클로닝된 DNA의 염기서열을 확인하기 위해 Cosmogenetech (Seoul, Korea)에서 Sanger sequencing으로 확인하였다. 재조합 Streptococcus pyogenes (SpCas9)(D10A) nickase 및 5'-GX19 sgRNA (5'-GGGCCACTAG GGACAGGAT-3', SEQ ID NO: 1) 발현 플라스미드는 ToolGen(서울, 한국)에서 구입하였다.
FVIII 유전자 삽입 iPSC의 생성
Cas9 nickase (D10A) 플라스미드, BDD-FVIII 및 FE-FVIII 넉-인 공여자 DNA를 혈우병 A 환자의 iPSC에 전기천공하였다. 구체적으로, 혈우병 A 환자의 iPSC를 DPBS로 한 번 세척하고 ReLeSRTM(STEMCELL Technologies, Vancouver, Canada)을 사용하여 단일 세포로 해리하였다. Neon 형질감염 시스템(Invitrogen, Carlsbad, CA, USA)을 사용하여 5x105 iPSC를 1 μg Cas9 nickase, 2μg sgRNA 발현 벡터 및 2μg 각 공여자 플라스미드로 전기천공하였다. 전압 1000 V에서 30ms 동안 한 번 펄스를 가한 후, 세포를 10μM Y-27632(Sigma-Aldrich, St. Louis, MO, USA)가 포함된 STEMMACS 배지에서 2일 동안 배양하였다. 형질감염 4일 후, 0.5 μg/mL 퓨로마이신을 사용하여 세포를 선택하였다.
교정된 iPSC의 클론 집단을 분리하기 위해 퓨로마이신을 사용한 단일 콜로니 확장을 3회 수행하였다. 교정된 iPSC를 분리한 후 5x105 세포를 1 μg pCAG-Cre:GFP 벡터(Addgene, #13776)로 전기천공하고 10일 후에 형질감염된 각 iPS 집락에 대해 클론 선택을 수행하였다.
오프-타겟 분석을 위한 타겟-딥 시퀀싱(Targeted-deep sequencing for off-target analysis)
웹 기반 in silico 도구(www.rgenome.net)를 사용하여 표적 부위와 최대 3개의 뉴클레오티드가 다른 4개의 잠재적 오프-타겟 사이트를 검색하였다. 타겟-딥 시퀀싱을 위해 DNeasy Blood & Tissue Kits(QIAGEN)를 사용하여 환자 및 교정된 iPSC 세포주에서 게놈 DNA를 분리하고, ToolGen에서 MiSeq 시스템(Illumina, San Diego, CA, USA)을 사용하여 오프-타겟 사이트를 증폭 및 분석하였다.
내피세포로의 분화 (Differentiation into endothelial cells)
iPSC를 ReleSRTM으로 해리하고 1일 동안 10 μM Y-27632가 포함된 STEMMACS 배지에서 Matrigel 코팅된 배양 접시로 옮겼다. 그런 다음 배양 배지를 6 μM CHIR99021(Tocris Bioscience, Bristol, UK)을 포함하는 STEMdiffTM APELTM2 배지(STEMCELL Technologies)로 2일 동안 교체하여 중배엽 계통을 유도하였다. 2일째에 세포는 25 ng/mL 골형성 단백질 4 (BMP4; Prospec, East Brunswick, NJ, USA), 10 ng/mL bFGF 및 50 ng/mL 혈관 내피 성장 인자(VEGF)-A(PeproTech)가 포함된 STEMdiffTM APELTM2 배지에서 2일 동안 배양하여 혈관 계통을 유도하였다.
4일째에 세포를 TrypLETM select(Gibco)로 분리하고 새로운 배양 접시로 옮기고 4일 동안 50 ng/mL VEGF-A를 포함하는 EC 성장 배지-MV2 (ECGM-MV2; Promocell, Heidelberg, Germany)에서 배양하였다. 내피 전구 세포를 생성하고 배지를 2일마다 교체하였다. 8일째에 CD31, CD34, vWF 및 VE-cadherin과 같은 EC 마커를 면역염색으로 확인한 후 분화된 전체 세포에서 CD31+ 또는 CD34+ 세포를 MACS(Magnetic-activated cell sorting) 또는 Fluorescence-activated cell sorting (FACS)로 분류하였다.
FVIII 활성 측정
FVIII 활성을 측정하기 위해 293T 세포와 iPSC를 페놀 레드가 없는 DMEM/F12 배지(Gibco)에서 37℃에서 24시간 동안 배양하고 EC를 50 ng/mL VEGF-A가 포함된 페놀 레드가 없는 ECGM-MV2 배지에서 37℃에서 48시간 배양하였다. iPSC 및 EC의 상층액을 수집하고 Amicon® Ultra-15 원심분리 필터(Millipore)를 사용하여 30배 농축하였다. 배양 상청액의 FVIII 활성은 제조업체의 지침에 따라 Coamatic® Factor VIII 발색 분석 키트(Instrumentation Laboratory, Bedford, MA, USA)를 사용하여 측정되었다. FVIII 활성 측정은 96-웰 마이크로플레이트에서 수행되었고 405 nm에서의 흡광도는 마이크로플레이트 판독기(Molecular devices, San Jose, CA, USA)에 의해 사용된 종말점 판독에 의해 측정되었다. 표준 곡선은 HemosIL® Calibration Plasma(Instrumentation Laboratory)로 측정되었다.
혈우병 A 마우스에 생체 내 이식 (In vivo transplantation into hemophilia A mice)
혈우병 A 생쥐에 이식하기 위해 생후 3개월 된 혈우병 A 생쥐(Jackson Laboratory, strain: B6;129S4-F8tm1Kaz/J)를 사용하였고, 각 생쥐에서 환자 유래 또는 교정된 iPSC를 꼬리 정맥 주사를 통해 1x106 EC를 주입하였다. Cyclosporine A (210 mg/L; 음수 내)는 이식 3일 전에 투여되었고 3일에 한 번 교체되었다. 3일, 5일, 7일, 10일 및 14일 후에 이식된 마우스 꼬리 정맥 각각에서 혈액 샘플을 채취하여 FVIII의 발현 및 활성을 각각 측정하였다.
테일-클립 분석(Tail-clip assay)
HA 및 이식된 마우스를 마취시키고 테일-클립 분석을 수행하였다. 간단히 말해, 2 mm 직경의 꼬리 말단부를 절단하고 5분 동안 출혈을 허용하였다. 꼬리를 1분 동안 단단히 누른 후 각 마우스에서 클리핑 후 2일까지 생존 시간을 모니터링하였다.
붕괴율 및 반감기 데이터 분석(Decay rate and half-life data analysis)
시간 함수로서의 FVIII 활성은 A=A0 x e-kt 방정식을 사용하여 비선형 최소 자승 회귀(nonlinear least squares regression)에 의해 단일 지수 붕괴 곡선(single exponential decay curve)에 맞춰졌다. 여기서 A는 잔류 FVIII 활성, A0은 초기 활동, k는 겉보기 속도 상수, t는 37℃에서 배양 시간(시간)이다. FVIII의 반감기는 A=1/2A0일 때의 시간으로 계산하고 상대값으로 표현하였다.
세포 배양
인간 배아 신장(HEK) 293T 세포(ATCC, Manassas, VA, USA)는 10%(vol/vol) 소태아 혈청 (FBS; Hyclone, Logan, UT, USA) 및 1%(vol/vol) P/S(Gibco)이 보충된 Dulbecco's Modified Eagle's Medium (DMEM; Gibco, Grand Island, NY, USA)에서 유지되었다. Intron 22 역위 환자 유래 iPSC(Intron 22 inverted patient-derived iPSC), BDD-FVIII 및 F309S/E1984V 돌연변이 FVIII(FE-FVIII) 유전자 삽입 iPSC는 Matrigel(Corning, Corning, NY, USA)이 코팅된 배양 접시에서 STEMMACSTM iPSC-brew XF(STEMMACSTM iPSC-brew XF) 배양 배지(Miltenyi Biotec, Bergisch Gladbach, Germany)를 이용하여 지지세포 없이 배양(feeder-free culture) 되었다.
RNA 분리, 정량적 실시간 PCR(qPCR) 및 RT-PCR 분석
제조사의 지시에 따라 Easy-SpinTM Total RNA Extraction Kit (iNtRON Biotechnology, Seongnam, Korea)를 사용하여 세포에서 총 RNA를 분리하였다. PrimeScriptTM RT Master Mix (Takara Bio, Kusatsu, Japan)를 사용하여 1 μg의 총 RNA에서 cDNA를 합성하였다. mRNA 수준의 정량화를 위해 SYBR® Premix Ex-Taq (Takara Bio) 및 CFX96 Real-Time System (Bio-Rad, Hercules, CA, USA)을 사용하여 qPCR을 수행하였다. 각 유전자에 대한 Ct 값은 GAPDH의 Ct 값으로 정규화되었다. EmeraldAmp® GT PCR Master Mix(Takara Bio)를 사용하여 RT-PCR을 수행하였다.
교정된 iPSC에서 넉-인 접합부의 PCR 분석 및 DNA 시퀀싱
제조사의 지시에 따라 DNeasy Blood & Tissue kit(QIAGEN, Hilden, Germany)를 사용하여 세포에서 게놈 DNA를 분리하였다. AAVS1 유전자좌로의 공여자 DNA의 넉-인을 확인하기 위해 EmeraldAmp® GT PCR Master Mix를 사용하여 각 접합부의 DNA 단편을 증폭하였다. 각 DNA 앰플리콘의 염기서열은 Cosmogenetech에서 Sanger 염기서열분석을 통해 검증되었다.
3개의 배엽층으로 시험관내 분화 (In vitro differentiation into three germ layers)
시험관내 3배엽 형성 분석을 이전에 기재된 바와 같이 수행하였다. 간단히 말해서, iPSC 콜로니를 절개하여 배아체(embryonic body, EB)를 생성한 다음, EB 배양 배지[4ng/mL 염기성 섬유아세포 성장 인자(bFGF; PeproTech, Rocky Hill, JN, USA), 20% 넉아웃 혈청 대체물(Invitrogen), 1% 비필수 아미노산 (Invitrogen) 및 0.1 mM 2-메르캅토에탄올(Sigma-Aldrich)이 포함된 DMEM/F12 배지(Gibco)]를 이용하여 저부착 세포 배양 접시(low attachment cell culture dish)에서 배양하였고, 1주 동안 5% FBS를 포함하였다. 그런 다음 EB를 Matrigel 코팅 접시에 플레이팅하고 자발적 분화를 위해 추가로 2주 동안 배양하였다.
면역세포화학 및 핵형 분석 (Immunocytochemistry and karyotyping)
면역형광 염색을 위해 세포를 실온(RT)에서 15분 동안 4% 파라포름알데히드 용액에 고정하고 DPBS로 3회 세척하고 실온에서 10분 동안 PBS 중 0.1% Triton X-100으로 투과하였다. PBS로 3회 세척한 후, 세포를 실온에서 1시간 동안 블로킹 버퍼(2% 소 혈청 알부민 포함 PBS)에서 인큐베이션하였다. 그 다음, 세포를 1시간 동안 실온에서 블로킹 버퍼 중 1차 항체와 함께 인큐베이션하였다. 다음 항체가 사용되었다:
마우스 항-SSEA4(1:200, Millipore, Billerica, MA, USA), 토끼 항-OCT4(1:200, Santa Cruz Biotechnology, Dallas, TX, USA), 토끼 항-NESTIN(1:1000, Millipore), 염소 항-HNF3β(1:200, Santa Cruz Biotechnology), 마우스 항-α-SMA(1:400, Sigma-Aldrich), 마우스 항-CD31(1:200, BD Biosciences, San Jose, CA, USA), 및 토끼 항-VWF(1:500, Millipore).
PBS로 3번 세척한 후, 형광 태그가 붙은 이차 항체(Alexa Fluor® 488 또는 594, 1:1000, Invitrogen)가 있는 세포를 실온에서 30분 동안 블로킹 버퍼에서 인큐베이션하였다. 그런 다음 세포를 PBS로 3회 세척하고 장착 배지(Vector Laboratories, Burlingame, CA, USA)를 포함하는 4',6-디아미디노-2-페닐인돌 (4', 6-diamidino-2-phenylindole, DAPI)을 사용하여 커버슬립에 장착하였다. 이미지는 형광 현미경(Eclipse Ti-U, Nikon Instruments Inc., Tokyo, Japan)으로 캡처되었다. 핵형 분석을 위해 각 iPSC 계통의 염색체를 G-banding 분석을 위해 Giemsa로 염색하고 EONE 연구소(한국 인천)에서 분석하였다.
본 발명에서 사용된 프라이머 및 항체와 관련된 정보는 하기 표 1 내지 3에 나타내었다.
Primer sequences used for genomic-based PCR screening and Sanger sequencing.
Primers Sequence (5' to 3') Used for SEQ ID NO:
F1 TCGACTTCCCCTCTTCCGATG genotype PCR 2
F2 GGGGATCAATTCTCTAGAGCTCG genotype PCR 3
F3 CCTCATCTCCAGCAGTCAAG genotype PCR 4
R1 CCGTTGCGAAAAAGAACGTTCAC genotype PCR 5
R2 TGACCAACCATCCCTGTTTT genotype PCR 6
F309-F GCCATACATATGTCTGGCAG genotype PCR 7
F309-R GATGGCGTTTCAAGACTGGTGG genotype PCR 8
E1984-F GGCATGACCGCCTTACTGAAG genotype PCR 9
E1984-R CAGCCCAGAACCTCCATCCTC genotype PCR 10
β-Actin-F TCACCCACACTGTGCCCATCTACGA RT-PCR 11
β-Actin-R CAGCGGAACCGCTCATTGCCAATGG RT-PCR 12
GAPDH-F TGCACCACCAACTGCTTAGC qPCR 13
GAPDH-R GGCATGGACTGTGGTCATGAG qPCR 14
OCT4-F CCTCACTTCACTGCACTGTA qPCR 15
OCT4-R CAGGTTTTCTTTCCCTAGCT qPCR 16
SOX2-F TTCACATGTCCCAGCACTACCAGA qPCR 17
SOX2-R TCACATGTGTGAGAGGGGCAGTGT qPCR 18
NANOG-F TGAACCTCAGCTACAAACAG qPCR 19
NANOG-R TGGTGGTAGGAAGAGTAAAG qPCR 20
LIN28-F AGCCATATGGTAGCCTCATGTCCG qPCR 21
LIN28-R TCAATTCTGTGCCTCCGGGAGCAG qPCR 22
CD31-F TGCGAATCGATCAGTGGA qPCR 23
CD31-R ACCGGGGCTATCACCTTC qPCR 24
VWF-F TCGGGCTTCACTTACGTTCT qPCR 25
VWF-R CCTTCACTCGGACACACTCA qPCR 26
VE-caderin-F GGTCCCTGAACGCCCTGGTAA qPCR 27
VE-cadherin-R GGAGTGGAGTATGGAGTTGGAGCA qPCR 28
FVIII-F GGCATGACCGCCTTACTGAAG qPCR and RT-PCR 29
FVIII-R GATGGCGTTTCAAGACTGGTGG qPCR and RT-PCR 30
Mouse Gapdh-F CATCACTGCCACCCAGAAGACTG RT-PCR 31
Mouse Gapdh-R ATGCCAGTGAGCTTCCCGTTCAG RT-PCR 32
Sequences of each target site and primers used in off-target amplification.
Target site Target Seq. (5' to 3') Forward primer Seq. (5' to 3') Reverse primer Seq. (5' to 3')
Off- targe t 1 (OT1
, Chr.19)
GGGCCCTTATGGACAGGAT GGG
(SEQ ID NO: 33)
GTGCCCGTATCCAGAGT GAT
(SEQ ID NO: 34)
AGGTGGATGACAAGGTC AGG
(SEQ ID NO: 35)
Off- targe t 2 (OT2, Chr.19) GGGGCACTGGGGACAGGC TTGG
(SEQ ID NO: 36)
AGGAGGTCAGTCTGGGA GGT
(SEQ ID NO: 37)
GAGAGGGGCACAAACA GAAG
(SEQ ID NO: 38)
Off- targe t 3 (OT3, Chr.15) GGACCACTGGGCACAGGAT CGG(SEQ ID NO: 39) ATGTTGGAAGAGGACGT TGG
(SEQ ID NO: 40)
TCACATGTCCTCCACCT GTG
(SEQ ID NO: 41)
Off- target 4 (OT4, Chr. 17) GGGCCACTAGGGACTGGG GAGG(SEQ ID NO: 42) GGGCTATGGGCTTCTCT GA
(SEQ ID NO: 43)
TGTTTGCTTGCCTCTGAC AC
(SEQ ID NO: 44)
Antibodies used in this study.
Antibody Company Cat #
OCT4 Santa Cruz SC9081
SSEA-4 Millipore MAB4304
NESTIN Millipore MAB5326
α-SMA Sigma A5228
HNF-3β Santa Cruz SC6554
CD31 BD Bioscience 555444
vWF Millipore AB7356
실시예 및 결과
실시예 1: 공여자 플라스미드의 제작 및 선택(Construction and selection of donor plasmids)
먼저, FVIII 유전자 발현을 위한 인간 EF1α (elongation factor-1 alpha) 프로모터의 제어 하에 4개의 공여자 플라스미드를 설계하고 선택을 위해 백본에 퓨로마이신 내성 카세트를 설계하였다. 돌연변이되지 않은 BDD-FVIII(WT), F309S(F), E1984V(E) 및 F309S/E1984V(FE) 돌연변이 된 FVIII 유전자를 각 플라스미드에 삽입하여 FVIII의 활성 수준 및 안정성을 확인하였다. 이 방법으로 F309S 및 E1984V 돌연변이를 생성하였다. 다른 돌연변이 FVIII 유전자(FE)는 기능적 변화를 확인하기 위해 분비 및 안정성에 영향을 미치는 다양한 변이를 융합하여 생성되었다. 각 FVIII 변이체의 분비 수준은 FVIII 활성 분석으로 추정되었다(도 1, A).
FVIII 변이체를 HEK 293T 세포에 형질감염시키고 37℃에서 24시간 동안 인큐베이션한 후, 상청액을 수확하여 분석하였다. FVIII 활성 수준은 BDD-FVIII에 비해 F309S 돌연변이된-FVIII 유전자 (F에서 1.40배, FE에서 1.56배)를 포함하는 FVIII 변이체에서 증가하였다. 반면에, E1984V 돌연변이된-FVIII 유전자는 BDD-FVIII에 비해 FVIII 활성 수준을 감소시켰다. 여기에서 E 돌연변이 FVIII 유전자의 경우 WT보다 FVIII 활성을 감소시키는 점을 고려하면, FE 돌연변이 FVIII 유전자에서 F 돌연변이 FVIII 유전자 보다도 FVIII 활성이 증가된 것은 시너지 효과를 나타내는 것이다.
다음으로, 붕괴 분석을 통해 FVIII 변이체의 안정성을 추정하였다(도 1, B). 각 세포주로부터 분비된 상등액을 37℃에서 0-24시간 동안 배양한 후, 각 샘플을 활성 분석으로 확인하여 초기 단계와 비교하여 붕괴율을 결정하였다. 붕괴 분석에서 F 돌연변이 FVIII 유전자는 BDD-FVIII와 크게 다르지 않았지만 안정성과 관련된 인자인 E1984V 돌연변이 FVIII 유전자(E, FE)에서 안정성과 반감기가 증가하였다(도 1, 1C). 이상의 결과를 바탕으로 FE 돌연변이 FVIII 유전자는 분비와 안정성 모두에 관여하는 것으로 판단되었다.
실시예 2: HA 환자 유래 iPSC의 AAVS1 유전자좌로 BDD-FVIII 및 FE-FVIII 유전자의 표적화된 넉-인 (Targeted knock-in of BDD-FVIII and FE-FVIII gene into the AAVS1 locus of HA patient- derived iPSCs)
BDD-FVIII 및 FE 돌연변이 FVIII(FE-FVIII) 유전자를 AAVS1 유전자좌에 삽입하기 위해 PPP1R12C 유전자의 인트론 1을 표적으로 하는 sgRNA를 사용하였다(도 2, A).
sgRNA 및 Cas9 nickase (D10A) 벡터가 있는 각 공여자 플라스미드를 HA 환자 유래 iPSC에 전기천공하였다 (도 3, A).
퓨로마이신 선택 및 추가 배양 후, 출현한 약물 내성 iPS 콜로니로부터 게놈 DNA를 추출한 다음 앞서 설명한 바와 같이 PCR 분석에 의해 넉-인 콜로니를 식별하였다. 교정된 콜로니를 스크리닝하기 위해 특정 프라이머 세트(F1/R1, F2/R2)를 사용하여 넉-인 부위의 5' 접합부 및 3' 접합부를 증폭하였다.
88개 콜로니 중 4개(4.54%, WT-KI)와 92개 콜로니 중 5개(5.43%, FE-KI)에서 PCR 밴드의 5' junction과 3' junction이 모두 나타났다. 2회의 단일 콜로니 확장을 배양하고 각 교정된 세포주의 2개의 클론을 선택하였다 (BDD-FVIII KI iPSC에서 선택된 WT-K1, WT-K2, FE-FVIII KI iPSC에서 선택된 FE-K1, FE-K2)(도 2, B). 각각의 교정된 콜로니는 PCR 산물을 사용한 Sanger 시퀀싱에 의해 각 FVIII 유전자의 표적화된 삽입을 추가로 확인하였다(도 2, C).
그런 다음 WT-K1 및 FE-K1 iPSC를 선택하여 넉-인 iPSC 세포주에서 퓨로마이신 내성 카세트를 절제하였다. 전기천공법에 의한 일시적인 Cre 재조합효소 발현 후, 본 발명자들은 F3/R2 프라이머에 의해 생성된 PCR 산물을 기반으로 각 iPSC 세포주를 스크리닝하였다. 각 iPSC 계통에서 8개 콜로니 중 3개(37.5%, WT-K1 절제), 8개 콜로니 중 4개(50%, FE-K1 절제)가 스크리닝되었다. Sanger 시퀀싱에 의해 저항 카세트가 완전히 제거된 것을 확인한 후 WT-K1(WT-K1e1, WT-K1e2) 및 FE-K1(FE-K1e1, FE-K1e2)에서 각각 파생된 두 개의 iPSC 세포주를 선택하였다(도 3, B 및 C).
실시예 3: 교정된 iPSC 세포주의 다능성 및 오프-타겟 분석
다음으로, 교정된 iPSC 계통이 부모 환자 유래 iPSC와 비교하여 만능 특성(pluripotent characteristics)을 유지하는지 여부를 조사하였다. 정량적 실시간 PCR (qRT-PCR) 결과는 교정된 iPSC 세포주의 만능 마커 유전자(OCT4, SOX2, NANOG 및 LIN28)가 모 iPSC와 유사한 수준의 mRNA를 발현함을 보여주었다(도 4, A).
본 발명자들은 또한 교정된 iPSC 세포주에서 만능 마커 단백질(SSEA4, OCT4)의 발현도 확인하였다(도 4, B). 시험관 내 3배엽 분석은 외배엽(NESTIN), 중배엽(알파 평활근 액틴, α-SMA) 및 내배엽(간세포 핵 인자-3베타, HNF- 3β)의 성공적인 분화를 확인하였다 (도 4. C). 또한, 교정된 모든 iPSC 세포주는 G-밴딩에 의해 정상적인 46, XY 핵형을 보였다(도 4, D).
그런 다음 본 발명자들은 Cas9 nickase에 의해 교정된 iPSC 계통에서 오프-타겟 돌연변이가 유도되었는지 확인하였다. 웹 기반 in silico 도구를 사용하여 최대 3개의 뉴클레오티드만큼 표적 부위와 다른 오프-타겟 사이트의 목록을 얻었고, 4개의 교정된 iPSC 세포주와 부모 iPSC에서 타겟-딥 시퀀싱을 할 4개의 잠재적 오프-타겟 사이트를 선택하였다. 교정된 iPSC 세포주의 오프-타겟 사이트에서 유의미한 돌연변이가 발견되지 않았음을 확인하였다(도 5).
실시예 4: 교정된 iPSC 세포주에서 FVIII 발현의 회복
AAVS1 유전자좌에 BDD-FVIII 및 FE-FVIII 유전자를 성공적으로 삽입한 후, 우리는 교정된 세포주에서 FVIII 유전자의 번역을 확인하기 위해 각 교정된 세포주에서 FVIII mRNA를 추출하였다. Sanger 시퀀싱 데이터는 FE-FVIII 유전자 삽입(FE-KI) iPSC가 BDD-FVIII 유전자 삽입(WT-KI) iPSC의 번역과 비교하여 발현된 FVIII mRNA에서 309 Phe에서 Ser으로, 1984 Glu에서 Val로 번역되었음을 보여주었다(도 6, A).
다음으로, 우리는 시험관 내에서 교정된 iPSC 세포주에서 발현된 FVIII 유전자의 표현형 복원 여부를 확인하였다. qRT-PCR 분석은 FVIII mRNA의 높은 발현이 교정된 iPSC 세포주에서 측정되었지만 부모 환자의 iPSC에서는 측정되지 않았음을 보여주었다(도 6, B). 또한 WT-KI와 FE-KI iPSC 사이의 FVIII mRNA 발현 수준에는 유의한 차이가 없었다. 그러나, 각 iPSC 계통에서 FVIII 단백질의 FVIII 활성 분석 결과, WT- KI 세포주(WT-K1e1에서 15.22±0.22, WT-K1e2에서 14.66±0.45)에서 보다 FE-KI 계통에서 약 1.5배 더 높은 활성(FE-K1e1에서 23.376±0.78, FE-K1e2에서 22.04±0.26)을 나타내었다 (도 6, C).
실시예 5: 교정된 iPSC 유래 EC에서 FVIII 발현의 회복
EC는 FVIII 생산의 주요 원천으로 알려져 있다. 본 발명자들은 iPSC에서 기능적 EC의 차별화를 위한 프로토콜을 확립하였다. EC 마커는 분화 8일째에 나타났고, qRT-PCR 분석 및 면역세포화학에 의해 확인되었다. qRT-PCR 분석은 EC 마커(CD31, VWF, VE-cadherin)가 환자의 iPSC와 비교하여 차별화된 EC에서 발현되었음을 보여주었다(도 7, A). 교정된 EC 계통과 부모 EC 사이의 EC 마커의 발현에는 유의한 차이가 없었다. 면역세포화학 분석은 또한 EC 마커(CD31, VWF)가 환자의 분화된 EC와 교정된 세포주의 차이 없이 발현됨을 밝혔다(도 7, B).
iPSC 세포주에서 EC로 분화한 후, 본 발명자들은 또한 qRT-PCR 분석에 의해 FVIII의 mRNA 발현 수준을 조사하였다(도 7, A). 환자의 iPSC 및 파생된 EC에서는 신호가 감지되지 않았다. 반면에, FVIII mRNA의 높은 발현은 교정된 세포주로부터 분화된 EC에서 확인되었지만, 각 WT-KI 및 FE-KI 세포주 사이의 FVIII mRNA의 발현 수준에는 유의한 차이가 없었다.
본 발명자들은 추가로 FVIII 활성 분석을 수행하여 EC에서 분비된 FVIII 단백질이 교정된 세포주와 분화되었는지 여부를 조사하였다. FE-KI EC의 FVIII 활성 수준(FE-K1e1에서 41.50±3.59, FE-K1e2에서 38.79±4.09)은 WT-KI EC(WT-K1e1에서 19.17±5.15, WT-K1e1에서 20.88±2.14)보다 유의하게 증가하였다 (도 7, C).
그런 다음 FVIII 붕괴 분석을 수행하여 교정된 각 EC 세포주에서 FVIII 단백질의 안정성을 결정하였다. 각 EC 세포주에서 얻은 상등액도 293T 세포에서 검사한 것처럼 37℃에서 0-24시간 동안 배양한 다음, 각 샘플을 FVIII 활성 분석으로 분석하여 붕괴 속도를 조사하였다(도 7, D). 붕괴 분석의 결과를 계산함으로써, 본 발명자들은 FE-KI EC에서 분비되는 FVIII 단백질의 반감기가 WT-KI EC에서 분비되는 것보다 1.7배 더 높게 증가한다는 것을 확인하였다(도 7, E).
실시예 6: 이식된 HA 마우스에서 FVIII 발현의 회복
본 발명자들은 환자, WT-K1e1 및 FE-K1e1 iPSC와 구별되는 EC를 각 HA 마우스에 이식하고 이식 후 각각 3, 5, 7, 10 및 14일에 혈장을 수확하였다. RT-PCR 분석은 FVIII 유전자가 WT-K1e1 및 FE-K1e1 세포 이식 마우스 둘 다에서 발현되었지만 HA 마우스 및 환자 세포 이식 마우스에서는 발현되지 않음을 보여주었다(도 8, A).
FVIII 활성 분석은 또한 HA 마우스와 환자 세포 이식 마우스 사이에 유의미한 차이가 없음을 보여주었다. 그러나, WT-K1e1 및 FE-K1e1 세포 이식된 마우스는 HA 마우스에서 FVIII 활성의 회복을 보여주었다. 더욱이, FE-K1e1 세포가 이식된 마우스의 FVIII 활성은 이식 후 7일 동안 WT-K1e1 세포가 이식된 마우스에 비해 2배 이상 더 높은 활성을 가졌다(WT-K1e1에서 7.00±1.23, FE-K1e1에서 14.84±0.89). (도 8, B).
본 발명자들은 또한 환자, WT-K1e1 및 FE-K1e1 EC를 각 HA 마우스에 이식하고 이식 7일 후 테일-클립 공격을 받았다. 모든 HA 마우스 및 환자의 EC가 이식된 마우스는 테일 클립 공격 후 생존하지 못했다(도 8, C). 일부 WT-K1e1 및 FE-K1e1 이식 마우스는 테일 클립 공격 후 2일 동안 생존하였다(각각 17.6%, 22.2%). 이러한 결과는 BDD-FVIII 및 FE-FVIII 유전자를 HA 환자 유래 iPSC의 AAVS1 유전자좌에 삽입하면 교정된 iPSC와 분화된 EC 모두에서 기능적 FVIII 단백질을 생성할 수 있음을 나타낸다.
본 발명자들은 또한 FE-KI 세포주가 분화된 EC에서 WT-KI 세포주보다 FVIII 활성 수준 및 FVIII 단백질의 안정성을 증가시킬 수 있고 FVIII 활성이 7일 후 HA 마우스에 이식된 EC에서 회복될 수 있음을 입증하였다.
실시예 7: 교정된 iPSC의 세포 표면마커를 이용한 EC 분리 수득율 비교
본 발명자들은 WT-BDD와 FE-BDD로 각각 형질감염된 iPSC를 EC로 분화시키는 과정에서 분화 4일차에 세포 표면마커 (CD31, VEGFR2, CD34, 또는 VE-Cad)를 이용하여 MACS 기법으로 해당 마커 양성인 EC 전구세포를 분리하고 각 세포 표면마커 별 수득율을 확인하였다. 분화 및 분리과정을 설명하는 모식도는 도 9에 나타내었고, 세포 표면마커별 수득율은 표 4와 도 10, 및 표 5와 도 11에 나타내었다.
Yield (%)
(Mean ± S.D.)
CD31+ VEGFR2+ CD34+ VE-Cad+
WT-BDD 45.16 ± 8.92 68.09 ± 20.35 64.73 ± 4.92 49.59 ± 6.57
FE-BDD 47.49 ± 3.58 62.85 ± 9.71 58.29 ± 10.07 42.88 ± 2.58
Yield (%) CD31+ VEGFR2+ CD34+ VE-Cad+
Mean ± S.D. 46.33 ± 6.416 65.47 ± 15.03 62.91 ± 9.055 48.86 ± 8.795
표 4 내지 5, 및 도 10 내지 도 11에 나타낸 바와 같이, 세포 표면 마커별로 분리한 수득율은 CD31+ 세포주의 경우 FE-BDD 유전자 삽입군이 WT-BDD 유전자 삽입군에 비하여 약 2% 가량 높게 나타났고, VEGFR2+, CD34+, 및 VE-Cad+인 세포주의 경우 WT-BDD 유전자 삽입군이 FE-BDD 유전자 삽입군에 비하여 다소 높게 나타났으나, 전체 수득율에는 WT-BDD, FE-BDD 유전자 삽입군 간에 유의적인 차이는 없었다.
실시예 8: 교정된 iPSC의 세포 표면마커를 이용한 EC 세포 분리 후 각 세포주의 EC 마커 유전자 발현 특성 비교
본 발명자들은 상기 실시예 7과 같이, EC 분화 4일차에 각 세포 표면 마커로 분리하거나(CD31+, VEGFR2+, CD34+, VE-Cad+), 분리하지 않은(unsorted) 세포주들을 분화시킨 후, 분화 8 내지 10일째에 qPCR을 이용하여 EC 마커 유전자들의 발현 수준을 비교하였다. 세포 분화, 분리 및 실험 수행과정의 모식도는 도 12에 나타내었고, 각 실험군별 및 세포주별 유전자 발현 수준은 도 13 내지 15에 나타내었다.
도 13 내지 도 15에 나타낸 바와 같이, 세포 표면마커 CD31, VEGFR2, CD34 및 VE-Cad 중 CD31 양성인 세포의 집단에서 unsorted 세포 집단에 비하여 내피세포 특이적 마커인 CD31 및 VE-Cad 유전자의 발현 수준이 유의미하게 높은 것을 확인할 수 있었다. 또한, 도 13 및 도 14를 비교하여 보면, FE-BDD 삽입군에서 CD31로 분리한 세포주의 경우, WT-BDD 삽입군에서 CD31로 분리한 세포주에 비하여 FVIII의 상대적 발현 수준이 상승된 것을 확인할 수 있었다. 즉, FE-BDD를 삽입한 iPSC에서 CD31+ 세포주를 분리하면 보다 내피세포 특이적으로 세포주들을 분리할 수 있고, FVIII의 발현 또한 WT-BDD를 삽입한 세포주들에 비하여 증가되어 혈우병 치료 효과가 상승효과가 있을 것임을 확인할 수 있다.
실시예 9: 교정된 iPSC의 세포 표면마커를 이용한 EC 세포 분리 후 세포의 형태학적 비교
본 발명자들은 상기 실시예 8과 같이, EC 분화 4일차에 각 세포 표면 마커로 분리하거나(CD31+, VEGFR2+, CD34+, VE-Cad+), 분리하지 않은(unsorted) 세포주들을 분화시킨 후, 분화 8 내지 10일째에 현미경 및 CD31, vWF, VE-Cad 로 면역염색을 하여 관찰하였다. 결과는 도 16 내지 도 18 에 나타내었다.
도 16에 나타낸 바와 같이, 4일차에 MACS로 분리 후 최종 분화 10일 째에 세포 표면 마커별 세포주들을 육안으로 확인한 결과, unsorted와 VEGFR2+ 세포의 경우 세포군의 모양이 일정하지 않음을 알 수 있었다 (흰색 화살표). 이에 반해 CD31+, CD34+, VE-Cad+ 세포주들은 균일한 형태학적 특징을 가지는 세포군을 형성함을 확인할 수 있었다 (scale bar 0.5 mm). 즉, CD31, CD34 및/또는 VE-Cad 마커를 이용하여 해당 마커 양성인 EC 전구 세포를 분리하는 경우 혈관내피세포를 보다 높은 균일성을 가지고 분리할 수 있음을 알 수 있다.
또한, 도 17 및 도 18에 나타낸 바와 같이, 4일차에 MACS로 EC 전구 세포를 분리 후 최종 분화 10일 째에 EC 마커인 CD31, vWF, VE-Cad 로 면역염색을 하여 관찰한 결과. CD31+, CD34+, VE-Cad+ 세포가 전체적으로 균일하게 CD31 과 vWF 를 발현하는 세포임을 확인할 수 있었다. 이에 반해, Unsorted 와 VEGFR2+ 세포의 경우 CD31-/vWF- 세포가 다수 섞여 있는 것을 확인하였다 (scale bar 200 μm). 즉, CD31, CD34 및/또는 VE-Cad 마커를 이용하여 EC 해당 마커 양성인 EC 전구세포를 분리하는 경우 혈관내피세포로 분화되는 세포들을 보다 높은 균일성을 가지고 분리할 수 있음을 알 수 있었다.
실시예 10: 교정된 iPSC의 세포 표면마커를 이용한 EC 세포 분리 후 FVIII 활성도의 비교
본 발명자들은 상기 실시예 8과 같이, EC 분화 4일차에 각 세포 표면 마커 (CD31+, VEGFR2+, CD34+, VE-Cad+)로 분리한 세포주들을 EC 세포로 분화시킨 후, 분화 8 내지 10일째의 WT-BDD, FE-BDD 세포주의 배양액에 포함한 FVIII의 활성도를 비교하였다. 결과는 표 6 및 도 19에 나타내었다.
Mean ± S.D. CD31+ VEGFR2+ CD34+ VE-Cad+
WT-BDD 18.87 ± 3.86 14.09 ± 1.83 17.94 ± 3.61 19.20 ± 2.56
FE-BDD 37.36 ± 4.63 38.51 ± 9.81 37.14 ± 5.11 38.99 ± 9.10
표 6 및 도 19에 나타낸 바와 같이, WT-BDD 삽입 세포주에 비해 FE-BDD 세포주의 FVIII 활성도가 높은 것을 확인할 수 있었다. (n=4) (# p<0.01) 이는 도 1의 결과와 일맥상통하기는 하나, 도 1에서는 HEK 293T 세포에 WT-BDD, FE-BDD 유전자를 발현시켰던 것으로, 본 발명자들은 HA 환자의 iPSC에서 동일 유전자를 과발현시켜 EC로 분화시켰을 때에도 일관적인 결과를 얻을 수 있음을 실험적으로 재확인할 수 있었다.

Claims (20)

  1. 혈액응고인자 FVIII (F8) (blood coagulation factor VIII)의 F309 위치 및 E1984 위치에 돌연변이를 포함하는, FVIII 변이 단백질을 인코딩하는 폴리뉴클레오타이드를 포함하는, 혈액응고인자 FVIII 넉-인(knock-in) 용 조성물.
  2. 제1항에 있어서, 상기 조성물은 AAVS1 유전자 좌위를 표적화하는 가이드 RNA 또는 이를 인코딩하는 폴리뉴클레오타이드를 추가적으로 포함하는, 조성물.
  3. 제2항에 있어서, 상기 가이드 RNA는 PPP1R12C 유전자의 인트론 1을 표적으로 하는 것인, 조성물.
  4. 제2항에 있어서, 상기 가이드 RNA는 프로토스페이서 인접 모티프 (Protospacer adjacent motif, PAM) 서열을 포함하는 것인, 조성물.
  5. 제1항에 있어서, RNA-가이드 뉴클레아제(RNA-guided nuclease), 또는 이를 인코딩하는 폴리뉴클레오타이드를 추가적으로 포함하는, 조성물.
  6. 제5항에 있어서, 상기 RNA-가이드 뉴클레아제는 Cas 폴리펩타이드인, 조성물.
  7. 제6항에 있어서, Cas 폴리펩타이드는 Cas9, 또는 Cas12a (Cpf1)인, 조성물.
  8. 제1항에 있어서, 상기 폴리뉴클레오타이드는 벡터에 포함된 것인, 조성물.
  9. 제1항에 있어서, 상기 조성물은 시험관 내(in vitro), 생체 외(ex vivo), 또는 생체 내(in vivo) 교정용인, 조성물.
  10. 혈액응고인자 FVIII 변이 단백질을 발현하도록 형질전환된, A형 혈우병(Hemophilia A, HA) 환자의 분리된 체세포로부터 유래한 유도만능 줄기세포(induced pluripotent stem cell, iPSC)에 있어서, 상기 혈액응고인자 FVIII 변이 단백질은 혈액응고인자 FVIII (blood coagulation factor VIII)의 F309 위치 및 E1984 위치에 돌연변이를 포함하는, 유도만능 줄기세포.
  11. 제10항의 유도만능 줄기세포로부터 분화된, 혈액응고인자 FVIII 변이 단백질을 발현하는 내피 세포.
  12. 제1항 내지 제9항 중 어느 한 항의 조성물, 제10항의 유도만능 줄기세포, 또는 제11항의 내피 세포를 유효성분으로 포함하는, A형 혈우병의 예방 또는 치료용 약제학적 조성물.
  13. A형 혈우병(Hemophilia A, HA) 환자의 분리된 체세포로부터 유래한 유도만능 줄기세포에 제1항 내지 제9항 중 어느 한 항의 조성물을 처리하여 혈액응고인자 FVIII 변이 단백질을 발현하도록 형질전환하는 단계를 포함하는, FVIII 변이 단백질을 발현하는 유도만능 줄기세포의 제조방법.
  14. 다음 단계를 포함하는 혈액응고인자 FVIII 변이 단백질을 발현하는 내피 세포의 제조 방법:
    (a) 혈액응고인자 FVIII (blood coagulation factor VIII)의 F309 위치 및 E1984 위치에 돌연변이를 포함하는 FVIII 변이 단백질을 발현하도록 형질 전환된, A형 혈우병(Hemophilia A, HA) 환자의 분리된 체세포로부터 유래한 유도만능 줄기세포(induced pluripotent stem cell, iPSC)를 내피 전구세포(endothelial progenitor cell) 집단으로 분화시키는 단계;
    (b) 상기 내피 전구세포의 집단 중 CD31, VEGFR2, CD34, VE-Cad, 또는 이들의 조합의 세포 표면 단백질을 발현하는 세포를 분리하는 단계; 및
    (c) 상기 분리된 세포를 내피 세포로 분화시키는 단계.
  15. 제14항에 있어서, 상기 (a) 단계는 상기 형질전환된 유도만능 줄기세포를 Y-27632를 포함하는 배지에서 1 내지 2일간 배양하는 단계를 포함하는 것인, 내피 세포의 제조방법.
  16. 제14항에 있어서, 상기 (a) 단계는 상기 형질전환된 유도만능 줄기세포를 CHIR99021를 포함하는 배지에서 1 내지 3일 동안 배양하는 단계를 추가적으로 포함하는 것인, 내피 세포의 제조방법.
  17. 제14항에 있어서, 상기 (a) 단계는 상기 형질전환된 유도만능 줄기세포를 BMP4, bFGF, VEGF-A, 또는 이들의 조합을 포함하는 배지에서 1 내지 3일 동안 배양하는 단계를 추가적으로 포함하는 것인, 내피 세포의 제조방법.
  18. 제15항 내지 제17항 중 어느 한 항에 있어서, 상기 배양은 세포외기질을 포함하는 겔로 코팅된 배양용기에서 이루어지는 것인, 내피 세포의 제조방법.
  19. 제14항에 있어서, 상기 단계 (b)는 내피 전구세포의 집단 중 CD31, CD34, VE-Cad, 또는 이들의 조합의 세포 표면 단백질을 발현하는 세포를 분리하는 단계인, 유도만능 줄기세포로부터 내피 세포로의 분화 방법.
  20. 제14항에 있어서, 상기 (c) 단계는 상기 형질전환된 유도만능 줄기세포를 VEGF-A를 포함하는 배지에서 2 내지 8일 동안 배양하는 단계를 추가적으로 포함하는 것인, 내피세포의 제조방법.
PCT/KR2022/004816 2021-04-02 2022-04-04 Fe-fviii 변이 유전자로 교정된 줄기세포, 이로부터 분화된 내피 세포 및 이를 포함하는 혈우병 예방 또는 치료용 약제학적 조성물 Ceased WO2022211604A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2021-0043662 2021-04-02
KR20210043662 2021-04-02

Publications (1)

Publication Number Publication Date
WO2022211604A1 true WO2022211604A1 (ko) 2022-10-06

Family

ID=83456567

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/004816 Ceased WO2022211604A1 (ko) 2021-04-02 2022-04-04 Fe-fviii 변이 유전자로 교정된 줄기세포, 이로부터 분화된 내피 세포 및 이를 포함하는 혈우병 예방 또는 치료용 약제학적 조성물

Country Status (2)

Country Link
KR (1) KR102817222B1 (ko)
WO (1) WO2022211604A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2025254174A1 (ja) * 2024-06-06 2025-12-11 公立大学法人奈良県立医科大学 外来性プロモーターによりf8遺伝子を駆動して第viii因子を分泌させることができる細胞

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180070699A (ko) * 2015-11-13 2018-06-26 박스알타 인코퍼레이티드 A형 혈우병의 유전자 요법을 위한 증가된 발현을 갖는 재조합 fviii 변이체를 인코딩하는 바이러스 벡터
KR20200011817A (ko) * 2018-07-25 2020-02-04 연세대학교 산학협력단 혈액 응고인자 ⅷ의 교정용 조성물 및 이를 이용한 방법
US20200384125A1 (en) * 2019-02-15 2020-12-10 Crispr Therapeutics Ag Gene editing for hemophilia a with improved factor viii expression

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180070699A (ko) * 2015-11-13 2018-06-26 박스알타 인코퍼레이티드 A형 혈우병의 유전자 요법을 위한 증가된 발현을 갖는 재조합 fviii 변이체를 인코딩하는 바이러스 벡터
KR20200011817A (ko) * 2018-07-25 2020-02-04 연세대학교 산학협력단 혈액 응고인자 ⅷ의 교정용 조성물 및 이를 이용한 방법
US20200384125A1 (en) * 2019-02-15 2020-12-10 Crispr Therapeutics Ag Gene editing for hemophilia a with improved factor viii expression

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
FANTACINI DAIANNE MACIELY CARVALHO, FONTES APARECIDA MARIA, DE ABREU NETO MÁRIO SOARES, COVAS DIMAS TADEU, PICANÇO-CASTRO VIRGÍNIA: "The F309S mutation increases factor VIII secretion in human cell line", REVISTA BRASILEIRA DE HEMATOLOGIA E HEMOTERAPIA, SOCIEDADE BRASILEIRA DE HEMATOLOGIA E HEMOTERAPIA ;, vol. 38, no. 2, 20 April 2016 (2016-04-20), pages 135 - 140, XP055971969, ISSN: 1516-8484, DOI: 10.1016/j.bjhh.2016.04.002 *
ORLOVA N. A., KOVNIR S. V., VOROBIEV I. I., GABIBOV A. G., VOROBIEV A. I.: "Blood Clotting Factor VIII: From Evolution to Therapy", ACTA NATURAE, PARK MEDIA, RU, vol. 5, no. 2, 1 January 2013 (2013-01-01), RU , pages 19 - 39, XP055971966, ISSN: 2075-8251, DOI: 10.32607/20758251-2013-5-2-19-39 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2025254174A1 (ja) * 2024-06-06 2025-12-11 公立大学法人奈良県立医科大学 外来性プロモーターによりf8遺伝子を駆動して第viii因子を分泌させることができる細胞

Also Published As

Publication number Publication date
KR20220138346A (ko) 2022-10-12
KR102817222B1 (ko) 2025-06-11

Similar Documents

Publication Publication Date Title
US11197935B2 (en) Talen targeting blood coagulation factor VIII intron 1 inversion gene and composition for treating hemophilia comprising same
WO2016021972A1 (en) Immune-compatible cells created by nuclease-mediated editing of genes encoding hla
KR101923632B1 (ko) Hla g-변형된 세포 및 방법
WO2019050071A1 (ko) 엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 조성물
WO2019231266A1 (ko) Hla 유전자가 제거된 인간 유도만능줄기세포 유래 중간엽줄기세포 및 그의 제조 방법
WO2020117031A2 (en) Composition and method for inhibiting amyloid beta accumulation and/or aggregation
WO2021256668A1 (ko) 형광단백질로 표지된 사이토크롬 p450 으로 형질전환된 인간유도 만능줄기 세포주 및 이를 이용한 ahr 조절제 스크리닝 방법
WO2023282688A1 (ko) 산화스트레스 저항성을 갖는 중간엽 줄기세포, 이의 제조방법 및 용도
EP4004191A1 (en) Precursor cells of induced pluripotent stem cell-derived mesenchymal stem cells and method for preparing the same
WO2023008933A1 (ko) 혈액 적합성을 갖는 중간엽 줄기세포, 이의 제조방법 및 용도
WO2016117816A1 (ko) 인간 중간엽 줄기세포의 줄기세포능을 증가시키는 방법
WO2023219434A1 (ko) 혈액 적합성을 갖는 혈관 내 이식용 세포, 이의 제조방법 및 용도
KR102817222B1 (ko) Fe-fviii 변이 유전자로 교정된 줄기세포, 이로부터 분화된 내피 세포 및 이를 포함하는 혈우병 예방 또는 치료용 약제학적 조성물
WO2016093668A2 (ko) 일체형 유전자 치료 유도만능줄기세포 제작방법
WO2023167575A1 (ko) 저면역원성 줄기세포, 줄기세포로부터 분화되거나 유래된 저면역원성 세포 및 이의 제조방법
WO2021145700A1 (ko) 저산소 환경 하에서 높은 적응력을 가지는 세포 및 이의 용도
KR102089088B1 (ko) 혈액 응고인자 ⅷ의 교정용 조성물 및 이를 이용한 방법
WO2022114815A1 (ko) 트랜스-스플라이싱 아데노-연관 바이러스 벡터를 포함하는 프라임에디팅용 조성물
WO2021107234A1 (ko) Hiv 감염 치료 또는 예방을 위한 ccr5/cxcr4 유전자 동시 넉아웃 환자맞춤형 조혈모세포 및 이의 제조방법
WO2024253421A1 (ko) 혈액 적합성을 갖는 중간엽 줄기세포, 이의 제조방법 및 용도
WO2025225866A1 (ko) 저면역원성의 범용성 유도만능줄기세포
WO2022035287A1 (ko) 체외에서 유전자 교정된 세포 및 이의 용도
WO2020230976A1 (ko) 미분화 만능 줄기세포로부터 유전자 편집된 세포의 선별 방법
WO2021145703A1 (ko) 알츠하이머 예방 또는 치료용 약학적 조성물 및 이의 용도
WO2022010220A1 (ko) 면역원성이 감소된 신규한 이식용 세포

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22781723

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22781723

Country of ref document: EP

Kind code of ref document: A1