WO2021256668A1 - 형광단백질로 표지된 사이토크롬 p450 으로 형질전환된 인간유도 만능줄기 세포주 및 이를 이용한 ahr 조절제 스크리닝 방법 - Google Patents

형광단백질로 표지된 사이토크롬 p450 으로 형질전환된 인간유도 만능줄기 세포주 및 이를 이용한 ahr 조절제 스크리닝 방법 Download PDF

Info

Publication number
WO2021256668A1
WO2021256668A1 PCT/KR2021/003425 KR2021003425W WO2021256668A1 WO 2021256668 A1 WO2021256668 A1 WO 2021256668A1 KR 2021003425 W KR2021003425 W KR 2021003425W WO 2021256668 A1 WO2021256668 A1 WO 2021256668A1
Authority
WO
WIPO (PCT)
Prior art keywords
cell line
pluripotent stem
induced pluripotent
stem cell
human induced
Prior art date
Application number
PCT/KR2021/003425
Other languages
English (en)
French (fr)
Inventor
박한진
김지우
임일균
김혜민
Original Assignee
한국화학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국화학연구원 filed Critical 한국화학연구원
Priority to CN202180050975.3A priority Critical patent/CN116802272A/zh
Priority to US18/010,932 priority patent/US20230235294A1/en
Publication of WO2021256668A1 publication Critical patent/WO2021256668A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/067—Hepatocytes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0696—Artificially induced pluripotent stem cells, e.g. iPS
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y114/00—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
    • C12Y114/14—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (1.14.14)
    • C12Y114/14001—Unspecific monooxygenase (1.14.14.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/119—Other fibroblast growth factors, e.g. FGF-4, FGF-8, FGF-10
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/12—Hepatocyte growth factor [HGF]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/16—Activin; Inhibin; Mullerian inhibiting substance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/20—Cytokines; Chemokines
    • C12N2501/237—Oncostatin M [OSM]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/30—Hormones
    • C12N2501/38—Hormones with nuclear receptors
    • C12N2501/39—Steroid hormones
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2503/00—Use of cells in diagnostics
    • C12N2503/02—Drug screening
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2533/00—Supports or coatings for cell culture, characterised by material
    • C12N2533/90—Substrates of biological origin, e.g. extracellular matrix, decellularised tissue

Definitions

  • the present invention relates to a human induced pluripotent stem cell line transformed with cytochrome P450 labeled with a fluorescent protein and a method for screening an AHR modulator using the same.
  • hiPSC Human induced pluripotent stem cell
  • hPSC lines which refer to both hESC and hiPSC lines, contain targeted reporters or selectable markers, elucidate the underlying mechanisms involved in cell lineage determination, and provide differentiation protocols can be optimized to derive the desired cell type and to isolate pure cell populations for basic and clinical applications.
  • HR homologous recombination pathway
  • CRISPR-Cas9 This limitation can be overcome by the CRISPR-Cas9 system.
  • Targeting of the locus in the CRISPR-Cas9 system is mediated by a 20-base guide RNA that recognizes the target DNA sequence and the Cas9 protein involved in DNA cleavage.
  • the CRISPR-Cas9 system enables targeted introduction of DNA double-strand breaks (DSBs) at positions of interest, promoting homologous recombination (HR) and improving targeting efficiency. Due to its high targeting efficiency and simplicity, the CRISPR-Cas9 system made it possible to rapidly (>8%) generate target reporter lines from hPSCs.
  • the aryl hydrocarbon receptor is a ligand-activated transcription factor that not only functions as a sensor of extracellular signals and environmental ligands, but also mediates numerous toxicological consequences associated with various environmental xenobiotics.
  • a ligand such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD; 2,3,7,8-tetrachlorodibenzo-p-dioxin
  • TCDD 2,3,7,8-tetrachlorodibenzo-p-dioxin
  • AHR Upon binding of a ligand such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD; 2,3,7,8-tetrachlorodibenzo-p-dioxin), activated AHR migrates to the nucleus and AHR It forms heterodimers with nuclear translocator (ARNT), resulting in transcriptional induction of several cytochrome P450 enzyme
  • AHR activation in response to endogenous ligands is involved in various signaling pathways important for normal cellular homeostasis, cellular differentiation and immune responses. Indeed, it is known that the AHR signaling pathway is involved in the development and differentiation of immune cells, including T and B cells as well as antigen-presenting cells such as dendritic cells and macrophages.
  • T and B cells include T and B cells as well as antigen-presenting cells such as dendritic cells and macrophages.
  • AHR signaling pathway is involved in the development and differentiation of immune cells, including T and B cells as well as antigen-presenting cells such as dendritic cells and macrophages.
  • accumulating evidence for the significance of AHR in cancer progression and the therapeutic potential of selective AHR modulators with agonistic or antagonistic activity confirmed the potential of AHR as a novel drug target for cancer therapy (Kolluri, SK, Jin, UH, and Safe, S. (2017) Role of the aryl hydrocarbon receptor in carcinogenesis and potential as an anti-can
  • a cell line capable of screening an AHR regulator and as a prior art related to a cell line capable of screening an AHR regulator, a mouse liver cancer cell line expressing EGFP (Enhanced GFP) under the control of an AHR-responsive promoter has been reported (Nagy, SR, Sanborn, JR, Hammock, BD, and Denison, MS (2002) Development of a green fluorescent protein-based cell bioassay for the rapid and inexpensive detection and characterization of ah receptor agonists Toxicol Sci 65, 200- 210).
  • EGFP Enhanced GFP
  • Korean Patent Application Laid-Open No. 10-2019-0092898 discloses a transformed cell line in which cytochrome P450 is introduced into induced pluripotent stem cells, but it is difficult to obtain accurate data because it is necessary to measure the cytochrome P450 after killing the cells.
  • a screening method capable of selecting an AHR modulator using live human induced pluripotent stem cells introduced by conjugating a fluorescent protein to cytochrome P450.
  • the present inventors fused a fluorescent protein gene to a gene encoding a cytochrome P450 protein to perform AHR (Aryl hydrocarbon receptor) screening through live-cell imaging in a living cell type, so that the cytochrome P450 1A1 protein is the protein.
  • a human induced pluripotent stem cell line hiPSC line
  • the gene is edited to be expressed in a state fused with a fluorescent protein without inhibition of its intrinsic function is prepared, and the cells are alive in the cell line-derived hepatocytes
  • the present invention was completed by confirming that it was possible to screen for AHR modulators.
  • An object of the present invention is to provide a human induced pluripotent stem cell line transformed with cytochrome P450 labeled with a fluorescent protein in order to screen for substances that regulate aryl hydrocarbon receptor (AHR).
  • AHR aryl hydrocarbon receptor
  • Another object of the present invention is to provide a method for screening an AHR modulator using the transformed human induced pluripotent stem cell line.
  • the present invention is a human induced pluripotent stem cell line for screening a substance regulating AHR (aryl hydrocarbon receptor), characterized in that transformed with cytochrome P450 labeled with a fluorescent protein; hiPSC line).
  • AHR aryl hydrocarbon receptor
  • the present invention comprises the steps of 1) contacting a test substance with a human induced pluripotent stem cell line transformed with a cytochrome P450 protein labeled with a fluorescent protein;
  • An AHR modulator screening method comprising the step of selecting a test substance whose signal intensity of the fluorescent protein is changed compared to a control sample.
  • the present invention relates to a human induced pluripotent stem cell line transformed with cytochrome P450 labeled with a fluorescent protein and a method for screening an AHR modulator using the same.
  • a human induced pluripotent stem cell line (hiPSC line) in which the gene was edited to be expressed in a fused state was prepared, and AHR involved in cytotoxicity and cancer development in the cell line-derived hepatocytes in a live state It was confirmed that the modulator can be screened and that the AHR modulator can be screened better than when using the conventional hPH cells or HepG2 cells.
  • Humans transformed with the cytochrome P450 protein labeled with the fluorescent protein of the present invention Induced pluripotent stem cell lines can be usefully used for screening AHR modulating compounds.
  • 1a is a diagram showing a schematic diagram of a vector used to make a CYP1A1-mCherry hiPSC cell line.
  • Figure 1b is a diagram showing the target position of three single-guide RNA (sgRNA) used to knock-in CYP1A1-mCherry.
  • sgRNA single-guide RNA
  • 1c is a diagram showing the results of investigating the efficiency of three types of sgRNA by T7 endonuclease I analysis.
  • 1d is a diagram showing the results of PCR analysis to confirm that the mCherry knock-in vector was transfected into hiPSC cells.
  • 1E is a diagram showing the sequencing results of the junction sites between CYP1A1 and mCherry and between PGKneo and CYP1A1 in the CYP1A1-mCherry hiPSC cell line.
  • Figure 2a is a diagram showing the result of confirming the expression of hiPSC markers such as NANOG, OCT4, SOX2, TRA-1-60 and TRA-1-81 using fluorescence immunostaining.
  • Figure 2b is a diagram showing the result of confirming the mRNA expression of three germline marker proteins after differentiation of hiPSC into various cells corresponding to the embryonic trioderm.
  • 2C is a diagram showing the results of confirming the expression of three germline marker proteins using fluorescence immunostaining after differentiating hiPSCs into various cells corresponding to the embryonic trioderm.
  • FIG. 2D is a diagram showing the results of examination through karyotype analysis to see if an abnormality occurred in the entire chromosome of the cell due to the introduction of mCherry DNA.
  • FIG. 3 is a diagram showing a step-by-step direct differentiation protocol for differentiating the CYP1A1-mCherry hiPSC cell line into hepatocytes.
  • 4A is a diagram showing the results of observing the morphology of hepatocytes differentiated from the CYP1A1-mCherry hiPSC cell line.
  • Figure 4b is a diagram confirming the mRNA expression of hepatocyte-specific marker genes such as ALB, AAT, TDO2, HNF4A, G6Pase, TAT, TTR and AFP in hepatocytes differentiated from the CYP1A1-mCherry hiPSC cell line.
  • hepatocyte-specific marker genes such as ALB, AAT, TDO2, HNF4A, G6Pase, TAT, TTR and AFP in hepatocytes differentiated from the CYP1A1-mCherry hiPSC cell line.
  • FIG. 4C is a diagram confirming the expression of ALB, AAT, AFP and HNF4A, which are hepatocyte-specific proteins, in hepatocytes differentiated from the CYP1A1-mCherry hiPSC cell line by immunocytochemical analysis.
  • 4D is a diagram confirming the ratio of albumin-expressing cells by flow cytometry in hepatocytes differentiated from the CYP1A1-mCherry hiPSC cell line.
  • 4E is a diagram confirming the level of albumin secretion into plasma in hepatocytes differentiated from the CYP1A1-mCherry hiPSC cell line.
  • 4f is a diagram showing the results of low-density lipoprotein (LDL)-uptake analysis in hepatocytes differentiated from the CYP1A1-mCherry hiPSC cell line.
  • LDL low-density lipoprotein
  • 4G is a diagram showing the dose-response curves of Bap and TCDD, which are CYP1A1 inducers, in hepatocytes differentiated from the CYP1A1-mCherry hiPSC cell line.
  • Figure 8a is a diagram showing a schematic diagram of the flow of HCS (High-Content Screening) and CYP1A1-mCherry hiPSC-based screening system.
  • 8B is a diagram showing the screening results with 241 chemical substances from a library commercially available in CYP1A1-mCherry HLC treated for 24 hours or 48 hours.
  • FIG. 10d is a diagram comparing the amount of decrease in CYP1A1 activity between six CYP1A1 down-regulators selected as a result of screening and previously known substances that reduce CYP1A1 expression (CH223191, TMF).
  • FIG. 11 is a diagram showing the results of analysis of hiPSC-HLC, hPH and HepG2 cells by principal component analysis.
  • 13A is a diagram showing the average z-score of genes in the KEGG pathway: hsa00980. BaP treatment increased related gene expression in hiPSC-HLC and hPH, and decreased it equally in HepG2 cells.
  • 13B is a diagram showing a heat map for AHR-responsive gene induction by BaP treatment in HepG2, hiPSCHLC and hPH.
  • BaP treatment increased all AHR-responsive genes in hiPSC-HLC and hPH.
  • the present invention provides a human induced pluripotent stem cell line (hiPSC line) for screening a substance regulating AHR (aryl hydrocarbon receptor) transformed with a cytochrome P450 protein labeled with a fluorescent protein.
  • hiPSC line human induced pluripotent stem cell line
  • induced pluripotent stem cells can be cultured for a long time like embryonic stem cells, can be differentiated into various somatic cells, and among them, nerve cells, hepatocytes, and cardiac cells that are important for drug metabolism and efficacy/toxicity tests cells and the like.
  • the human induced pluripotent stem cell line was deposited with the Korea Research Institute of Bioscience and Biotechnology Biological Resources Center under the accession number KCTC 14186BP.
  • the human induced pluripotent stem cells may be human dermal fibroblast-derived induced pluripotent stem cells.
  • the fluorescent protein may be selected from the group consisting of green fluorescence protein (GFP), blue fluorescence protein (CFP), yellow fluorescence protein (YFP) and red fluorescence protein (DsRed), but is not limited thereto, preferably may be red fluorescent protein (DsRed), more preferably mCherry protein.
  • GFP green fluorescence protein
  • CFP blue fluorescence protein
  • YFP yellow fluorescence protein
  • DsRed red fluorescence protein
  • DsRed red fluorescent protein
  • cytochrome P450 protein (cytochrome P450, CYP) is a member of heme protein that promotes oxidation of foreign substances such as drugs, carcinogens and environmental pollutants and internal substrates such as steroids, fatty acids and vitamins , various subtypes have been found in organs such as the kidneys, intestines and lungs, including the liver.
  • the superfamily CYP enzyme which is responsible for about 80% of drug oxidative metabolism, currently has 11 families known only in the human body. Of these, 1 to 4 families are involved in drug metabolism, and more than 30 isozymes is known There are three CYP isozymes known to be regulated by AHR: CYP1A1, CYP1A2, and CYP1B1.
  • the cytochrome P450 may be selected from the group consisting of CYP1A1, CYP1A2 and CYP1B1, but is not limited thereto, and is preferably CYP1A1.
  • CYP1A2 is generally known to be expressed only in the adult liver of an adult in the body, and it is hardly expressed in cells differentiated from stem cells, so it is not suitable for screening. It is not suitable for efficacy or toxicity tests.
  • the term "transfection” refers to a method of mutating the genetic characteristics of cells by directly introducing DNA into cultured animal cells. Generally, a method of introducing a target gene into a medium such as a plasmid is used. do. The transformation may be carried out according to a conventional method in the art, and preferably, examples thereof include a calcium phosphate co-precipitation method, a DEAE-textran treatment method, an electroporation method, a redistribution method, and the like.
  • the targeting vector can typically be constructed as a vector for cloning or as a vector for expression.
  • the targeting vector may be a conventional one used in the art to express a foreign protein in plants, animals or microorganisms.
  • the targeting vector can be constructed through various methods known in the art.
  • the targeting vector may be prepared by transfection using the pMCDT-A vector, but is not limited thereto.
  • the human induced pluripotent stem cell line may be prepared by transfection with a vector into which a fluorescent protein is inserted with sgRNA targeting the gene represented by SEQ ID NOs: 1 to 3, but is not limited thereto.
  • the present inventors designed a targeting vector to knock-in a fluorescent protein into the cytochrome P450 locus in fibroblast-derived human induced pluripotent stem cells, and three single-guide RNAs (sgRNAs) using A targeting vector was prepared and transfected into a human induced pluripotent stem cell line to establish a clone of a human induced pluripotent stem cell line transformed with a cytochrome P450 protein labeled with a fluorescent protein (see FIG. 1 ).
  • sgRNAs single-guide RNAs
  • the pluripotency markers NANOG, OCT4, SOX2, TRA-1-60 and TRA-1-in human induced pluripotent stem cells As a result of confirming whether the established transgenic human induced pluripotent stem cell line maintains the characteristics of human induced pluripotent stem cells, the pluripotency markers NANOG, OCT4, SOX2, TRA-1-60 and TRA-1-in human induced pluripotent stem cells. It was confirmed that the 81 marker was normally expressed (see FIG. 2a ), and the cell differentiation potential into three germ layers was confirmed through EB formation analysis (see FIGS. 2b and 2c ). In addition, as a result of karyotype analysis of the prepared transgenic human induced pluripotent stem cell line, it was confirmed that the karyotype was normal (see FIG. 2D ).
  • the human induced pluripotent stem cell line transformed with the cytochrome P450 protein labeled with the fluorescent protein prepared in the Example of the present invention maintained the characteristics of the human induced pluripotent stem cell as it is.
  • the present inventors confirmed the function of hepatocytes differentiated from the human induced pluripotent stem cell line transformed with the cytochrome P450 protein labeled with the fluorescent protein prepared in Examples of the present invention.
  • the mRNA expression of the hepatocyte-specific marker gene increased. and increased protein expression (FIGS. 4a to 4c), albumin-positive hepatocytes were 96% or more, and it was confirmed that they were successfully differentiated into hepatocytes through albumin secretion detection and low-density lipoprotein-uptake analysis (Figs. 4d to 4g). ).
  • the present inventors confirmed the expression of the fluorescent protein-labeled cytochrome P450 protein in hepatocytes differentiated from the human induced pluripotent stem cell line transformed with the fluorescent protein-labeled cytochrome P450 protein prepared in Examples of the present invention. It was confirmed that the fluorescent protein and cytochrome P450 were expressed at a similar level and expressed at the same position (see FIG. 5 ).
  • the present inventors confirmed that hepatocytes differentiated from the human induced pluripotent stem cell line transformed with the cytochrome P450 protein labeled with the fluorescent protein were treated with a known AHR agonist. , It was confirmed that the intensity of the fluorescent protein increased in proportion to the activity of cytochrome P450.
  • hepatocytes differentiated from the human induced pluripotent stem cell line transformed with the cytochrome P450 protein labeled with the fluorescent protein of the present invention can be used for screening for AHR modulators.
  • test substance 1) contacting a test substance with a human induced pluripotent stem cell line transformed with a cytochrome P450 protein labeled with a fluorescent protein;
  • An AHR modulator screening method comprising the step of selecting a test substance whose signal intensity of the fluorescent protein is changed compared to a control sample.
  • the control sample in step 3) may be BaP or TCDD, but is not limited thereto.
  • the AHR modulator screening method may be performed in a high content screening system (HCS).
  • HCS high content screening system
  • the present inventors used hepatocytes derived from human induced pluripotent stem cell lines transformed with the prepared fluorescent protein-labeled cytochrome P450 protein for automatic analysis using a High-Content Screening (HCS) device.
  • HCS High-Content Screening
  • the present inventors compared the human induced pluripotent stem cell line-derived hepatocytes transformed with the prepared fluorescent protein-labeled cytochrome P450 protein with the hPH and HepG2 cell lines, and transfected with the prepared fluorescent protein-labeled cytochrome P450 protein. Since the converted human induced pluripotent stem cell line-derived hepatocytes can use live cells, it was confirmed that they are superior to the AHR screening method than hPH and HepG2 cells (see FIGS. 11 to 13 ).
  • AHR reporter cell lines are mainly based on the luciferase reporter system under the control of the CYP1A1 promoter in several malignant cell lines, such as hepatocarcinoma cells HepG2 and colorectal adenocarcinoma HT29 cells.
  • BaP treatment in HepG2 cells causes undesirable gene elevation and pathway activation.
  • hPH human primary hepatocytes cells
  • the cell supply is limited because the cells do not divide any more.
  • the transformed human induced pluripotent stem cell line-derived hepatocytes of the present invention have the advantages of induced pluripotent stem cells themselves, which can supply cells with potential for future cell differentiation and provide various cell types.
  • Luciferase-based AHR reporter human induced pluripotent stem cell lines have also been reported (Smith, BW, Stanford, EA, Sherr, DH, and Murphy, GJ (2016) Genome Editing of the CYP1A1 Locus in iPSCs as a Platform to Map AHR Expression throughout Human Development Stem Cells Int 2016, 2574152), the luciferase reporter system entails the sacrifice of cells to investigate AHR activity, whereas the reporter system of the present invention uses the fluorescence level of CYP1A1-mCherry to detect AHR in living cells. It has the advantage of showing activity. As a result, through this, not only the concentration of the drug but also the reaction kinetics according to the drug treatment time in the same cell can be tracked, which can provide additional information for understanding the mechanism of the drug.
  • hiPSCs Human dermal fibroblast-derived human induced pluripotent stem cells (hiPSCs) were used as knock-in experiments and control human induced pluripotent stem cells (hiPSCs).
  • human dermal fibroblast-derived human induced pluripotent stem cells were maintained in mTeSR-E8 medium containing Vitronectin XFTM (Stem Cell Technologies, Vancouver, Canada) and 0.5 mM EDTA was used in DPBS (Dulbecco's Phosphate-Buffered Saline) for 3 Dissociated every day or every 4 days.
  • DPBS Dulbecco's Phosphate-Buffered Saline
  • hiPSCs were plated on Matrigel® (Corning, Tewksbury, MA, USA) coated dishes and cultured in mTeSRTM-E8TM (Stem Cell Technologies) for 1 day.
  • mTeSRTM-E8TM Stem Cell Technologies
  • endoderm (DE; Definitive endoderm) differentiation hiPSCs were treated with 0.5 mg/ml bovine serum albumin (BSA), 2% B27 (Thermo Fisher Scientific, Waltham, MA, USA), 50 ng/ml activin A (Peprotech, Rocky Hill). , NJ, USA) and 1 mM sodium butyrate (Sigma-Aldrich, St.
  • RPMI-1640 fetal bovine serum
  • HGF hepatocyte growth factor
  • DE cells were differentiated into hepatic endoderm cells by culturing in RPMI-1640 containing Liver maturation was performed in hepatocyte culture medium (HCM; Lonza, Basel) supplemented with 10 ng/ml FGF4, 10 n/ml HGF, 10 ng/ml oncostatin M (Peprotech) and 0.1 ⁇ M dexamethasone (Sigma-Aldrich) for 7 days. , Switzerland) were induced by culturing cells in The culture medium was changed daily.
  • HCM hepatocyte culture medium
  • FGF4 n/ml HGF
  • 10 ng/ml oncostatin M Peprotech
  • 0.1 ⁇ M dexamethasone Sigma-Aldrich
  • CYP1A1-mCherry hiPSCs were dissociated with 0.5 mM EDTA and seeded in AggreWell TM 800 plates (Stem Cell Technologies). The next day, the cell aggregates were transferred to low adhesion plates in mTeSR TM -E8 TM medium and cultured for 7 days. The formed embryoid bodies were incubated in Matrigel®-coated plates for an additional 7 days prior to analysis.
  • HepG2 cells were cultured in Eagle's Minimum Essential Medium (EMEM; Nuaille, Biowest, France) containing 10% fetal bovine serum (FBS; Thermo Fisher Scientific).
  • EMEM Eagle's Minimum Essential Medium
  • FBS fetal bovine serum
  • sgRNA single guide RNA
  • Table 1 The target sequences of three single guide RNAs (sgRNAs) are shown in Table 1 below. The following experiments were performed according to the target sequence cloning protocol of Zhang laboratory.
  • the pMCDT-A vector was used as the backbone of the targeting vector.
  • the human CYP1A1 gene was amplified by polymerase chain reaction (PCR) using genomic DNA extracted from hiPSCs. The 5' and 3' homologous arms targeted 1.2 kb upstream and 0.93 kb downstream of the stop codon in CYP1A1, respectively.
  • mCherry and PGKneo were amplified by PCR from the plasmids containing them. After sequence confirmation, each fragment was ligated using T4 DNA ligase (Promega, Madison, WI, USA).
  • T7 endonuclease I assay was performed according to the manufacturer's protocol.
  • genomic DNA was extracted from hiPSCs transfected with or without sgRNA using the G-spin TM Total Genomic DNA Extraction Kit (Intron Biotechnology, Gyeonggi, Korea). Then, a 500 bp fragment containing the sgRNA binding site was amplified by PCR. After the PCR product was purified using the MEGAquick-spin TMPlus Total Fragment DNA purification kit (Intron Biotechnology), the product was denatured and annealed and then digested with T7 endonuclease I (NEB, Ipswich, MA, USA). The digested DNA fragment was analyzed by agarose gel electrophoresis. Knock-in was confirmed by PCR and DNA sequencing of the targeted integration site.
  • Genomic DNA was isolated from drug-resistant clones using the G-DEX genomic DNA extraction kit (Intron Biotechnology), and 50 ng of EX Taq® polymerase (Takara Bio, Shiga, Japan) was used using the primers listed in Table 2. The isolated DNA was amplified.
  • Primer name Sequence (5' ⁇ 3') SEQ ID NO: CYP1A1 forward AGGCTTTTACATCCCCAAGG 4 CYP1A1 reverse TTGTCGATAGCACCATCAGG 5 mCherry forward GTGAGCACTTCCAAATGCAGC 6 mCherry reverse CCTTGAAGCGCATGAACTCCT 7 PAX6 forward GTGTCCAACGGATGTGTGAG 8 PAX6 reverse CTAGCCAGGTTGCGAAGAAC 9 OTX2 forward TGCAGGGGTTCTTCTGTGAT 10 OTX2 reverse AGGGTCAGAGCAATTGACCA 11 ⁇ -SMA forward TGCTCTGGGTTCGTCAGAGTC 12 ⁇ -SMA reverse CAGGCAAGTCACTGTGTGGC 13 EOMES forward AGGCGCAAATAACAACAACAC 14 EOMES reverse ATTCAAGTCCTCCACGCCATC 15 Brachyury forward GCGGGAAAGAGCCTGCAGTA 16 Brachyury reverse TTCCCCGTTCACGTACTTCC 17 FOXA2 forward
  • CYP1A1-mCherry hiPSC-derived HLCs were dissociated with 0.5 mM EDTA and washed with DPBS containing 10% FBS. Dissociated cells were fixed and permeabilized with Foxp3 fixation/permeabilization solution (eBioscience, San Diego, CA, USA) for 1 hour at room temperature (RT), followed by 1 ⁇ g of mouse anti-ALB primary antibody (R & D Systems). , Minneapolis, MN, USA) were incubated for 1 hour and then labeled with fluorescein-conjugated secondary antibody for 1 hour on ice. Flow cytometry was performed using a FACSCaliburTM flow cytometer (BD Biosciences, San Jose, CA, USA) and data were analyzed using FlowJo® software.
  • ELISA enzyme-linked immunosorbent assay
  • culture supernatant was collected 24 hours after medium change and the amount of secreted albumin was measured using a Human Albumin ELISA Quantification Kit (Bethyl Laboratories, Montgomery, TX, USA) according to the manufacturer's protocol. was used to measure.
  • the amount of secreted albumin was measured using 100 ⁇ l of the culture supernatant from an independent culture dish, calculated according to each standard curve, and then normalized to the protein content. Protein content was determined using the Bio-Rad Protein Assay Kit (Bio-Rad, Hercules, CA, USA).
  • acetylated-low density lipoprotein (Ac-LDL) uptake assays cells were harvested at 10 ⁇ g/ml 1, 1'-dioctadecyl-3, 3, 3', 3'-tetramethylindocarin. Incubated with cyanine-labeled Ac-LDL (Life Technologies, Carlsbad, CA, USA) for 5 hours. Red fluorescence was visualized with a fluorescence microscope.
  • Ac-LDL acetylated-low density lipoprotein
  • CYP1A1 activity cells were cultured for 24 h in serum-free medium before treatment. Cells were treated with 7.5 ⁇ M ethoxyresorufin in the presence or absence of the inhibitor 10 ⁇ M dicumarol in HBSS for 7.5, 15, 30 and 60 min, and 100 ⁇ l of medium was placed in a new microcentrifuge tube. was removed with An equal amount (100 ⁇ l) of ice-cold acetonitrile-methanol was added to the removed medium, followed by brief vortexing and centrifugation at 16,000 ⁇ g at 4° C. for 5 minutes. The supernatant was used for the following analysis.
  • the level of metabolite resorufin was measured by high performance liquid chromatography (HPLC) with a Luna C18 column (4.6 ⁇ 150 mm, 5 ⁇ m; Phenomenex, Seoul, Korea).
  • the mobile phase consisted of 20 mM phosphate buffer-methanol-acetonitrile (52:45:3, v/v/v) and the flow rate was 0.8 ml/min. Fluorescence measurements were performed at a wavelength of 560 nm for excitation and 585 nm for emission. Concentrations were calculated using a standard curve for resorufin normalized by the total cell protein content measured using the BCA Protein Assay Kit (Thermo Fisher Scientific).
  • RT-qPCR was performed with SYBR Green Realtime PCR Master Mix (TOYOBO, Osaka, Japan) on a StepOnePlus Real-Time PCR system (Applied Biosystems, Foster City, CA, USA). Triple PCR amplification was performed for each sample.
  • PCR results were normalized with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and then expressed as relative fold change compared to control cells.
  • ⁇ Ct value of control cells is used as control ⁇ Ct(C ⁇ Ct) value.Relative gene expression level is determined using Formula 2- (S ⁇ Ct-C ⁇ Ct). The primers used are shown in Table 2.
  • differentiated cells were dissociated on day 10, plated in Matrigel®-coated 96-well plates, and cultured for maturation. Twenty-four hours after completion of differentiation, cells were transfected with a SCREEN-WELL® Hepatotoxicity library (Enzo Life Sciences, Farmingdale, NY, USA) and a nuclear receptor ligand (SCREEN-WELL® Nuclear Receptor Ligands Library; Enzo Life Sciences). 241 chemicals and AHR agonists (2,3,7,8-tetrachlorodibenzo-p-dioxine (TCDD) and benzo[a]pyrene (BaP)) as positive controls for 24 hours and 48 hours did DMSO was used as vehicle control.
  • SCREEN-WELL® Hepatotoxicity library Enzo Life Sciences, Farmingdale, NY, USA
  • SCREEN-WELL® Nuclear Receptor Ligands Library Enzo Life Sciences
  • 241 chemicals and AHR agonists (2,3,7,8-tetrachlorodibenzo-
  • TCDD 0.1, 1, 10, and 50 ⁇ M concentrations
  • TCDD 0.1, 1, 10, and 50 ⁇ M concentrations
  • RT-qPCR analysis was performed on CYP1A1 mRNA expression according to the above procedure.
  • a dose-response curve was created using GraphPad Prism 5 (GraphPad, SanDiego, CA, USA) as a least-squares fitting method. Samples with low RNA concentrations ( ⁇ 50 ⁇ g/ml) due to cell death were recovered.
  • the target chemical (10 ⁇ M) was treated for 24 h prior to performing the cell viability assay. Then, 10 ⁇ l of Cell Counting Kit-8 (Dojindo, Kumamoto, Japan) was added to 100 ⁇ l of medium, and incubated for 2 hours. Absorbance was measured at 450 nm using an iMarkTM microplate absorbance reader (Bio-Rad). Cell viability was calculated using the following formula:
  • Viability (%) (A sample -A blank )/(A control -A blank ) ⁇ 100
  • RNA samples of hiPSC-derived hepatocytes and HepG2 and human primary hepatocytes (hPH) with and without 1 ⁇ M BaP treatment were prepared using TRIzol reagent.
  • Microarray analysis was performed using an Agilent Human GE 4 X 44 V2 chip (Agilent, Santa Clara, USA) by a service provider (eBiogen, Seoul, Korea).
  • CYP1A1 which is transcriptionally regulated by AHR.
  • HR-mediated knock-in was induced at the target locus using the CRISPR-Cas9 system as described in ⁇ Experimental Method> 2.
  • a targeting vector was designed to knock-in mCherry into the CYP1A1 locus in pre-established hiPSCs derived from normal fibroblasts (Fig. 1a).
  • mCherry cDNA was inserted at the end of the last exon of CYP1A1 with a deletion of the stop codon.
  • Phospho glycerate kinase (PGK)-neo and diphtheria toxin A (DT-A) were included in targeting vectors for positive and negative selection, respectively.
  • Three single-guide RNAs (sgRNAs) were assigned to target either exon 4 - exon 5 (E4-E5) or exon 6 - exon 7 (E6-E7) introns (Fig. 1b).
  • the efficiency of sgRNA was investigated by T7 endonuclease I assay, and it was confirmed that all sgRNAs effectively induced DNA cleavage to generate more than 50% of indels (Fig. 1c).
  • hiPSCs were transfected with targeting vectors containing Cas9 and individual sgRNAs.
  • transfected hiPSCs were treated with G418 followed by single cell clonal expansion. Modification of the target locus in proliferating cells during clonal expansion was confirmed by PCR with the primer set shown in FIG. 1A ( FIG. 1D ).
  • FIG. 1E the results of sequencing the junction sites between CYP1A1 and mCherry and between PGKneo and CYP1A1 are shown in FIG. 1E ( FIG. 1E ).
  • Lines #1-8 were selected as lines to be used in the experiment to determine whether CYP1A1-mCherry hiPSCs maintain the characteristics of hiPSCs.
  • CRISPR-Cas9-mediated gene editing affects the characteristics of hiPSCs.
  • pluripotency and genome stability characteristics were investigated in CYP1A1-mCherry hiPSCs by the method described in ⁇ Experimental Method> 3.
  • pluripotency markers such as NANOG, OCT4, SOX2, TRA-1-60 and TRA-1-81 were expressed in lines #1-8 ( FIG. 2a ).
  • Cell differentiation potential into three germ layers was confirmed by EB formation assay.
  • EBs expressed all three germline markers at the mRNA (Fig. 2b) and protein (Fig. 2c) levels.
  • Fig. 2b mRNA
  • Fig. 2c protein
  • CYP1A1 and its upstream regulator, Aryl hydrocarbon receptor (AHR), are involved in stage I xenobiotic and drug metabolism in the liver.
  • AHR Aryl hydrocarbon receptor
  • CYP1A1-mCherry hiPSC line could be used for compound and drug screening through hepatocyte differentiation
  • CYP1A1-mCherry hiPSCs were differentiated into hepatocytes by the stepwise direct differentiation protocol shown in FIG. 3 (FIG. 3). Then, the function of the differentiated hepatocytes was confirmed by the methods of ⁇ Experimental Method> 4, 5 and 6.
  • hepatocyte-specific marker genes such as ALB, AAT, TDO2, HNF4A, G6Pase, TAT, TTR and AFP increased with differentiation (Fig. 4b).
  • FIG. 4c As a result of immunocytochemical analysis, as shown in FIG. 4c , the expression of ALB, AAT, AFP and HNF4A, which are hepatocyte-specific proteins, was confirmed in the differentiated hepatocytes ( FIG. 4c ).
  • CYP1A1 and mCherry were confirmed in hepatocytes (CYP1A1-mCherry HLCs) differentiated from CYP1A1-mCherry hiPSCs.
  • mRNAs of CYP1A1 and mCherry were expressed at similar levels (Fig. 5a), and it was confirmed that CYP1A1 and mCherry were co-localized in HLC differentiated from CYP1A1-mCherry hiPSCs on day 17 in the absence of a CYP1A1 inducer (Fig. 5b). ). In addition, it was confirmed that mCherry is expressed in the perinuclear endoplasmic reticulum (ER), which is the position where CYP1A1 is mainly present (FIG. 5c).
  • ER perinuclear endoplasmic reticulum
  • CYP1A1-mCherry hepatocytes were co-treated with BaP and TCDD and the AHR antagonist CH223191.
  • CH223191 significantly inhibited the intensity of mCherry in both BaP- and TCDD-treated groups (Fig. 7a). CYP1A1 and mCherry transcriptional expression levels were decreased by CH223191 treatment (Fig. 7b). Also, when CH223191 and BaP or TCDD were co-treated, CYP1A1 activity was decreased ( FIG. 7c ).
  • FIG. 8a For screening, an automated analysis protocol using a High-Content Screening (HCS) device was established (FIG. 8a). A total of 241 samples, including commercial libraries for hepatotoxic agents (210 compounds) and nuclear receptor modulators (29 compounds), as well as BaP and TCDD as positive controls, in CYP1A1-mCherry HLC treated with this module for 24 or 48 hours Chemicals were selected (Fig. 8b).
  • HCS High-Content Screening
  • mCherry activity was measured by co-treatment with 17 compounds, CYP1A1-modulators and AHR antagonists. It was confirmed that the combined treatment of most CYP1A1-modulators and AHR antagonist CH223191 reduced the mCherry intensity in CYP1A1-mCherry HLC (FIG. 9b).
  • papaverine hydrochloride, nordihydroguaiaretic acid, and glafenine showed significant differences in terms of mCherry intensity by exposure to CH223191. showed The effect of these chemicals was confirmed according to the dose (FIG. 9c).
  • Papaverine hydrochloride and glafenine showed a 6-7 fold increase and maximal induction at the concentrations used for screening. Nordihydroguaiaretic acid was less effective ( ⁇ 2 times) than the other two chemicals.
  • the present inventors selected three new AHR agonists that inhibit expression of AHR by mCherry-based HCS.
  • hiPSC-derived HLCs may represent a problem with the reliability of hepatotoxicity test results. Therefore, we compared hiPSC-HLC with HepG2 cells, most commonly used for hPH and hepatotoxicity tests. To investigate the cellular similarity between them, the transcriptome profiles of hiPSC-derived HLC, hPH and HepG2 cells with and without BaP treatment were analyzed by microarray.
  • PCA principle component analysis
  • AHR-responsive genes (CYP1A1, CYP1A2 and CYP1B1) were enhanced by BaP treatment in hiPSC-HLC and hPH, and CYP1A2 and CYP1B1 were not induced by BaP treatment in HepG2 (Fig. 13b).
  • hiPSC-HLC is much closer to hPH and represents a better cell model for drug metabolism and toxicity tests than HepG2 cells.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Transplantation (AREA)
  • Molecular Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 형광단백질로 표지된 CYP1A1 단백질로 형질전환된 인간유도 만능줄기 세포주 및 이를 이용한 AHR 조절제 스크리닝 방법에 관한 것으로, 구체적으로 사이토크롬 P450 1A1(CYP1A1) 단백질이 그 단백질 고유의 기능에 저해됨이 없이 형광단백질과 융합되어 있는 상태로 발현되도록 유전자를 편집한 인간 유도만능 줄기세포주(hiPSC line; human induced pluripotent stem cell line)를 제작하고, 상기 세포주 유래 간세포에서 세포가 살아있는 상태에서 스크리닝하여 기존의 hPH 세포나 HepG2 세포를 이용하는 경우보다 더 우수하게 AHR 조절제를 스크리닝할 수 있음을 확인하였는 바, 본 발명의 CYP1A1-mCherry hiPSC 세포주는 AHR 조절 화합물을 스크리닝하는데 유용하게 사용될 수 있다.

Description

형광단백질로 표지된 사이토크롬 P450 으로 형질전환된 인간유도 만능줄기 세포주 및 이를 이용한 AHR 조절제 스크리닝 방법
본 발명은 형광단백질로 표지된 사이토크롬 P450 으로 형질전환된 인간유도 만능줄기 세포주 및 이를 이용한 AHR 조절제 스크리닝 방법에 관한 것이다.
인간 유도 만능 줄기 세포 (hiPSC; Human induced pluripotent stem cells) 기술은 새로운 약물 발견 및 재생 의학 분야에서 많은 가능성을 제공한다. 자기 재생(self-renewal) 및 전분화능(pluripotency)과 같은 특성을 지닌 hiPSC의 이점은 hiPSC 기반 임상 적용 및 질병 모델링의 촉진을 가능하게 해주었다. 최근에는 줄기 세포 분화 및 게놈 편집 기술의 발전 및 개선이 질병 모델링뿐만 아니라 효능 및 잠재적 독성에 대한 약물 스크리닝에서도 hiPSC 유래 세포의 사용 가능성이 입증되었다(Grskovic, M., Javaherian, A., Strulovici, B., and Daley, G. Q. (2011) Induced pluripotent stem cells--opportunities for disease modelling and drug discovery. Nat Rev Drug Discov 10, 915-929).
hESC 및 hiPSC 라인을 모두 지칭하는 유전자 변형된 인간 다능성 줄기 세포 (hPSC; human pluripotent stem cell) 라인은 표적화된 리포터 또는 선택 가능한 마커를 포함하며, 세포 계통 결정을 수반하는 기본 메커니즘을 밝히고, 분화 프로토콜을 최적화하여 원하는 세포 유형을 도출하고, 기본 및 임상 적용을 위해 순수한 세포 집단을 분리할 수 있다. 상동 재조합 (HR; homologous recombination) 경로에 기초한 통상적인 유전자 표적화 기술을 채택하는 몇몇 초기 접근법이 hPSC에 성공적으로 사용되었다 (Zwaka, T. P., and Thomson, J. A. (2003) Homologous recombination in human embryonic stem cells. Nat Biotechnol 21, 319-321). 그러나, HR의 낮은 표적화 효율(~ 1 %)은 hPSC에서의 유전자 변형이 광범위하게 적용되는 것을 방해하는 한계가 된다.
이러한 한계는 CRISPR-Cas9 시스템에 의해 극복될 수 있다. CRISPR-Cas9 시스템에서 유전자좌의 표적화는 표적 DNA 서열을 인식하는 20 개 염기로 구성된 가이드 RNA 및 DNA 절단에 관여하는 Cas9 단백질에 의해 매개된다. CRISPR-Cas9 시스템은 관심있는 위치에서 DNA 이중 가닥 절단(DSBs; DNA double-strand breaks)의 표적 도입을 가능하게 하여 상동 재조합 (HR; homologous recombination)을 촉진하고 표적 효율을 향상시킨다. 높은 타겟팅 효율성과 단순성으로 인해 CRISPR-Cas9 시스템은 hPSC에서 대상 리포터 라인을 빠르게(> 8 %) 생성하는 것이 가능하여졌다.
한편, 아릴 탄화수소 수용체 (AHR; aryl hydrocarbon receptor)는 세포 외 신호 및 환경 리간드의 센서로서 기능할 뿐만 아니라 다양한 환경 생체 이물(xenobiotics)과 관련된 수많은 독성학적 결과를 매개하는 리간드 활성화 전사 인자이다. 2,3,7,8- 테트라 클로로 디 벤조-p-디옥신 (TCDD; 2,3,7,8-tetrachlorodibenzo-p-dioxin)과 같은 리간드의 결합에서, 활성화된 AHR은 핵으로 이동하고 AHR nuclear translocator (ARNT)와 이종 이량체를 형성하여 발암 물질의 활성화에 중요한 역할을 하는 여러 사이토크롬 P450 효소의 전사 유도를 초래한다. 생화학 반응에서 AHR 활성화의 중요성은 지난 30년 동안 선택된 생체 이물(xenobiotics)에 의한 독성 효과의 매개 및 악성 종양의 개시에 관한 관심을 끌었다. 그러나 최근의 연구는 환경 생체 이물(xenobiotics)이 없는 경우에도 암 진행뿐만 아니라 생리학적 및 발달 과정에서 AHR에 대한 중요한 조절 역할을 보고하였다(Barouki, R., Coumoul, X., and Fernandez-Salguero, P. M. (2007) The aryl hydrocarbon receptor, more than a xenobiotic-interacting protein. FEBS Lett 581, 3608-3615). AHR- 결핍 마우스를 포함하는 몇몇 독립적인 연구는 내인성 리간드에 대한 반응에서 AHR 활성화가 정상적인 세포 항상성, 세포 분화 및 면역 반응에 중요한 다양한 신호 전달 경로에 관여한다는 것을 밝혀냈다. 실제로, AHR 신호 전달 경로는 T 및 B 세포뿐만 아니라 수지상 세포 및 대식세포와 같은 항원-제시 세포를 포함하는 면역 세포의 발달 및 분화에 관련되어 있다고 알려져 있다. 또한, 암 진행에서 AHR의 의미 및 작용 또는 길항 활성을 갖는 선택적 AHR 조절제의 치료 가능성에 대한 증거가 축적되어, AHR을 암 요법의 신규 약물 표적으로서의 가능성이 확인되었다(Kolluri, S. K., Jin, U. H., and Safe, S. (2017) Role of the aryl hydrocarbon receptor in carcinogenesis and potential as an anti-cancer drug target. Arch Toxicol 91, 2497-2513).
이에, AHR 조절제를 스크리닝할 수 있는 세포주에 대한 필요성이 대두되고 있으며, AHR 조절제를 스크리닝할 수 있는 세포주 관련 종래기술로는 AHR-반응성 프로모터의 제어하에 EGFP(Enhanced GFP)를 발현하는 마우스 간암 세포주가 보고되었다(Nagy, S R, Sanborn, J R, Hammock, B D, and Denison, M S (2002) Development of a green fluorescent protein-based cell bioassay for the rapid and inexpensive detection and characterization of ah receptor agonists Toxicol Sci 65, 200-210).
그러나, 인간의 AHR과 마우스의 AHR은 구조적 차이가 있으며, 열 충격 단백질 90(HSP90) 및 다른 보조 인자와의 상이한 상호 작용을 나타낸다. 이것은 인간 AHR에 비해 TCDD와 함께 마우스 AHR의 10 배 높은 친화성을 초래하고, 인체에의 적용에서 약물 반응의 과대 평가를 초래할 수 있다는 단점이 있다.
대한민국 공개특허 제10-2019-0092898호에서는 사이토크롬 P450을 유도만능줄기세포에 도입한 형질전환 세포주를 개시하고 있으나, 이는 세포를 죽여서 그후 사이토크롬 P450을 측정하여야 하므로 정확한 데이터를 얻기가 힘들었다. 지금까지는 형광단백질을 사이토크롬 P450에 접합하여 도입한 살아있는 인간 유도만능 줄기세포를 이용하여 AHR 조절제를 선별할 수 있는 스크리닝하는 방법에 대해서는 개시된 바가 없다.
이에, 본 발명자들은 살아있는 세포 타입에서 live-cell 이미징을 통한 AHR(Aryl hydrocarbon receptor) 스크리닝을 수행하기 위해, 사이토크롬 P450 단백질을 코딩하는 유전자에 형광단백질 유전자를 융합하여 사이토크롬 P450 1A1 단백질이 그 단백질 고유의 기능에 저해됨이 없이 형광단백질과 융합되어 있는 상태로 발현되도록 유전자를 편집한 인간 유도만능 줄기세포주(hiPSC line; human induced pluripotent stem cell line)를 제작하고, 상기 세포주 유래 간세포에서 세포가 살아있는 상태에서 AHR 조절제를 스크리닝할 수 있음을 확인하여 본발명을 완성하였다.
본 발명의 목적은 AHR(aryl hydrocarbon receptor) 조절하는 물질을 스크리닝하기 위하여 형광단백질로 표지된 사이토크롬 P450 으로 형질전환된 인간유도 만능줄기 세포주를 제공하는 것이다.
본 발명의 또 다른 목적은 상기 형질전환된 인간유도 만능 줄기 세포주를 이용하여 AHR 조절제 스크리닝 방법을 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명은 형광단백질로 표지된 사이토크롬 P450 으로 형질전환된 것을 특징으로 하는 AHR(aryl hydrocarbon receptor) 조절하는 물질 스크리닝용 인간 유도만능 줄기세포주(human induced pluripotent stem cell line; hiPSC line)를 제공한다.
또한, 본 발명은 1) 형광단백질로 표지된 사이토크롬 P450 단백질로 형질전환된 인간 유도만능 줄기세포주에 시험물질을 접촉시키는 단계;
2) 상기 시험물질을 접촉한 형광단백질로 표지된 사이토크롬 P450 단백질로 형질전환된 인간 유도만능 줄기세포주에서 형광단백질의 신호 세기를 측정하는 단계; 및
3) 대조구 시료와 비교하여 상기 형광단백질의 신호 세기가 변화된 시험물질을 선별하는 단계를 포함하는 AHR 조절제 스크리닝 방법을 제공한다.
본 발명은 형광단백질로 표지된 사이토크롬 P450 으로 형질전환된 인간유도 만능줄기세포주 및 이를 이용한 AHR 조절제 스크리닝 방법에 관한 것으로, 구체적으로 사이토크롬 P450 단백질이 그 단백질 고유의 기능에 저해됨이 없이 형광단백질과 융합되어 있는 상태로 발현되도록 유전자를 편집한 인간 유도만능 줄기세포주(hiPSC line; human induced pluripotent stem cell line)를 제작하고, 상기 세포주 유래 간세포에서 세포가 살아있는 상태에서 세포독성과 암발생에 관여하는 AHR 조절제를 스크리닝할 수 있고, 기존의 hPH 세포나 HepG2 세포를 이용하는 경우보다 더 우수하게 AHR 조절제를 스크리닝할 수 있음을 확인하였는 바, 본 발명의 형광단백질로 표지된 사이토크롬 P450 단백질로 형질전환된 인간유도 만능줄기세포주는 AHR 조절 화합물을 스크리닝하는데 유용하게 사용될 수 있다.
도 1a는 CYP1A1-mCherry hiPSC 세포주를 만들기 위해 사용한 벡터 모식도를 나타낸 도이다.
도 1b는 CYP1A1-mCherry를 녹-인하기 위해 사용된 3개의 단일-가이드 RNA(sgRNA)의 표적 위치를 나타낸 도이다.
도 1c는 3가지 sgRNA의 효율을 T7 엔도뉴클레아제 I 분석에 의해 조사한 결과를 나타낸 도이다.
도 1d는 mCherry 녹-인 벡터가 hiPSC 세포에 형질감염되었는지 확인하기 위해 PCR 분석한 결과를 나타낸 도이다.
도 1e는 CYP1A1-mCherry hiPSC 세포주에서 CYP1A1과 mCherry 사이 및 PGKneo와 CYP1A1 사이의 접합 부위를 시퀀싱한 결과를 나타낸 도이다.
도 2a는 형광면역염색법을 이용하여 NANOG, OCT4, SOX2, TRA-1-60 및 TRA-1-81과 같은 hiPSC 표지 인자 발현 확인한 결과를 나타낸 도이다.
도 2b는 hiPSC를 배아 삼배엽에 해당하는 다양한 세포로 분화시킨 후, 3 개의 배엽 마커 단백질의 mRNA 발현을 확인한 결과를 나타낸 도이다.
도 2c는 hiPSC를 배아 삼배엽에 해당하는 다양한 세포로 분화시킨 후, 3 개의 배엽 마커 단백질 발현을 형광면역염색법을 이용하여 확인한 결과를 나타낸 도이다.
도 2d는 mCherry DNA 도입으로 인해 세포의 전체적인 염색체에 이상이 생겼는지 핵형 분석을 통해 검사한 결과를 나타낸 도이다.
도 3은 CYP1A1-mCherry hiPSC 세포주를 간세포로 분화시키기 위한 단계적 직접 분화 프로토콜을 나타낸 도이다.
도 4a는 CYP1A1-mCherry hiPSC 세포주로부터 분화된 간세포의 형태를 관찰한 결과를 나타낸 도이다.
도 4b는 CYP1A1-mCherry hiPSC 세포주로부터 분화된 간세포에서 ALB, AAT, TDO2, HNF4A, G6Pase, TAT, TTR 및 AFP와 같은 간세포 특이적 마커 유전자의 mRNA 발현을 확인한 도이다.
도 4c는 CYP1A1-mCherry hiPSC 세포주로부터 분화된 간세포에서 간세포 특이적 단백질인 ALB, AAT, AFP 및 HNF4A 의 발현을 면역 세포 화학 분석으로 확인한 도이다.
도 4d는 CYP1A1-mCherry hiPSC 세포주로부터 분화된 간세포에서 유세포 분석법으로 알부민-발현 세포의 비율을 확인한 도이다.
도 4e는 CYP1A1-mCherry hiPSC 세포주로부터 분화된 간세포에서 혈장으로의 알부민 분비 수준을 확인한 도이다.
도 4f는 CYP1A1-mCherry hiPSC 세포주로부터 분화된 간세포에서 저밀도 지단백질(LDL)-흡수 분석 결과를 나타낸 도이다.
도 4g는 CYP1A1-mCherry hiPSC 세포주로부터 분화된 간세포에서 CYP1A1 유도제인 Bap 및 TCDD의 선량-반응 곡선을 나타낸 도이다.
도 5a는 CYP1A1-mCherry hiPSC로부터 분화시킨 간세포(CYP1A1-mCherry HLCs)의 0일차 및 17일차에서 CYP1A1 및 mCherry의 mRNA의 발현량을 확인한 도이다(N = 6, *** p <0.001).
도 5b는 CYP1A1 유도제의 부재 하에서 CYP1A1-mCherry hiPSC로부터 분화시킨 17일차 간세포에서 CYP1A1 및 mCherry의 공동-국소화(co-localized)되는 것을 확인한 도이다(스케일바 = 200 μm).
도 5c는 mCherry가 CYP1A1가 주로 존재하는 위치인 핵 주위 소포체(ER)에서 발현되는 것을 확인한 도이다(스케일바 = 20 μm).
도 6a는 CYP1A1-mCherry HLC에 BaP 및 TCDD 처리 후 mCherry 강도의 시간 의존적 증가를 확인한 도이다(N = 4, * p <0.05, *** p <0.001).
도 6b는 CYP1A1-mCherry HLC에 AHR 작용제인 BaP 및 TCDD을 15분 동안 처리에 의한 CYP1A1 활성을 확인한 도이다(N = 4. *** p <0.001).
도 6c는 대조군인 CYP1A1-mCherry를 도입하지 않은 hiPSC로부터 유도된 HLC 에 AHR 작용제인 BaP 및 TCDD을 15분 동안 처리에 의한 CYP1A1 활성을 확인한 도이다(N = 4. *** p <0.001).
도 7a는 CYP1A1-mCherry HLC에 AHR 작용제 (BaP 및 TCDD) 및 길항제 (CH223191)의 공동 처리한 후 mCherry 발현을 HCS 영상화 (왼쪽) 및 강도 정량화 (오른쪽)에 의해 분석한 결과를 나타낸 도이다(N = 4, *** p <0.001, 스케일 바 = 200 μm).
도 7b는 CYP1A1-mCherry HLC에 AHR 작용제 (BaP 및 TCDD) 및 길항제 (CH223191)의 공동 처리한 후 CYP1A1 및 mCherry의 mRNA 발현을 확인한 도이다(N = 3, ** p <0.01, *** p <0.001).
도 7c는 YP1A1-mCherry HLC에 AHR 작용제 (BaP 및 TCDD) 및 길항제 (CH223191)의 공동 처리한 후 CYP1A1의 활성 변화를 확인한 도이다(N = 2).
도 8a는 HCS(High-Content Screening) 및 CYP1A1-mCherry hiPSC 기반 스크리닝 시스템의 흐름의 개략도를 나타낸 도이다.
도 8b는 24 시간 또는 48 시간 처리된 CYP1A1-mCherry HLC에서 시판되는 라이브러리로부터 241 가지 화학 물질로 스크리닝 결과를 나타낸 도이다. 두 개의 수평선은 적중 선택에 대한 컷오프 임계값을 나타낸다(비 처리 대조군과 비교하여30 % 상향 또는 하향 조정, N = 6).
도 9a는 24 시간 또는 48 시간 처리된 CYP1A1-mCherry HLC에서 mCherry 강도가 30 % 이상 상승시키는 선별된 화학 물질 17 개의 mCherry 강도(intencity)를 나타낸 도이다(N = 6).
도 9b는 17개의 화합물과 AHR 길항제(CH223191)와 병용 처리한 후 mCherry 강도를 측정한 결과를 나타낸 도이다(N = 6).
도 9c는 파파베린 하이드로클로라이드(papaverine hydrochloride), 노르디하이드로구아이아레트 산(nordihydroguaiaretic acid) 및 글라페닌(glafenine)에 대한 용량-반응 곡선을 나타낸 도이다(N = 3).
도 10a는 24 시간 또는 48 시간 처리된 CYP1A1-mCherry HLC에서 mCherry 강도가 70 % 이상 하향시키는 선별된 화학 물질 6 종의 mCherry 강도(intencity)를 나타낸 도이다(N = 6, 점선은 처리되지 않은 대조군 수준을 나타냄).
도 10b는 스크리닝 결과 선별된 CYP1A1 하향 조절 물질인 3-D02, 2-C08, 2-E05 및 2-E06으로 처리된 CYP1A1-mCherry HLC의 세포 생존력을 측정한 결과를 나타낸 도이다(N = 3).
도 10c는 CYP1A1-mCherry HLC에 공지된 AHR 길항제(CH223191 및 TMF)로 처리 및 스크리닝 결과 선별된 CYP1A1 하향 조절 물질 6 종을 처리한 결과 mCherry 강도(intencity) 변화를 확인한 도이다(N = 6).
도 10d는 스크리닝 결과 선별된 CYP1A1 하향 조절 물질 6 종과 기존에 알려진 CYP1A1 발현 감소 물질들(CH223191, TMF)과의 CYP1A1 활성도 감소량 비교한 도이다.
도 10e는 CH223191, 2-E05 및 2-E06에 의한 TCDD에 의해 유도된 mCherry의 발현 억제 효과를 확인한 도이다(스케일 바 = 200 μm).
도 11은 hiPSC-HLC, hPH 및 HepG2 세포를 주성분 분석으로 분석한 결과를 나타낸 도이다.
도 12는 유전자 온톨로지 및 KEGG-경로 분석을 통한 hiPSC-HLC(a), hPH(b), HepG2(c)의 상위 25 개의 기능적 주석을 나타낸 도로, 빨간색 별표는 약물 대사 및 BaP 관련 용어를 나타낸다(세로 회색 선은 p 값 = 0.05를 나타냄).
도 13a는 KEGG 경로: hsa00980 에서 유전자의 평균 z-점수를 나타낸 도이다. BaP 처리는 hiPSC-HLC 및 hPH에서 관련 유전자 발현을 증가시켰고, HepG2 세포에서 동일하게 감소시켰다.
도 13b는 HepG2, hiPSCHLC 및 hPH에서 BaP 처리에 의한 AHR-반응성 유전자 유도에 대한 히트 맵을 나타낸 도이다. BaP 처리는 hiPSC-HLC 및 hPH에서 모든 AHR-반응성 유전자를 증가시켰다.
이하, 본 발명을 상세히 설명한다.
본 발명은 형광단백질로 표지된 사이토크롬 P450 단백질로 형질전환된 AHR(aryl hydrocarbon receptor) 조절하는 물질 스크리닝용 인간 유도만능 줄기세포주(human induced pluripotent stem cell line; hiPSC line)를 제공한다.
본 발명에 있어서 "유도만능 줄기세포"는 배아줄기세포처럼 오랜 기간 배양될 수 있고, 다양한 체세포로 분화될 수 있으며, 이 중 약물대사 및 효능·독성 검사에 중요하게 이용되는 신경세포, 간세포, 심장세포 등이 포함된다.
상기 인간 유도만능 줄기세포주는 한국생명공학연구원 생물자원센터에 수탁번호 KCTC 14186BP로 기탁되었다.
상기 인간 유도만능 줄기세포는 인간 피부 섬유 아세포 유래 유도만능 줄기세포일 수 있다.
상기 형광단백질은 녹색형광단백질(green fluorescence protein, GFP), 청색형광단백질(CFP), 황색형광단백질(YFP) 및 적색형광단백질(DsRed)로 구성된 군으로부터 선택될 수 있으나 이에 한정되지 않으며, 바람직하게는 적생형광단백질(DsRed)일 수 있고, 더욱 바람직하게는 mCherry 단백질일 수 있다.
본 발명에 있어서 "사이토크롬 P450 단백질(cytochrome P450, CYP)"는 약물, 발암원 및 환경적 오염원 같은 외래물질과 스테로이드, 지방산 및 비타민과 같은 내부 기질의 산화를 촉진하는 헴(heme)단백질의 일원으로, 간을 포함하여 신장, 장관 및 폐와 같은 기관에서 다양한 아형이 발견되었다. 약물 산화대사의 약 80%를 담당하고 있는 슈퍼패밀리 CYP 효소는 인체에서만 현재 11가지의 패밀리가 알려져 있는데, 이 중 약물대사에는 1~4가지 패밀리가 관여하고 있으며, 30가지 이상의 동효소(isozymes)가 알려져 있다. AHR에 의해 조절되는 것으로 알려진 CYP 동효소는 CYP1A1, CYP1A2 및 CYP1B1 세 가지가 있다.
상기 사이토크롬 P450은 CYP1A1, CYP1A2 및 CYP1B1로 구성된 군으로부터 선택될 수 있으나, 이에 한정되지 않으며, 바람직하게는 CYP1A1이다. CYP1A2는 통상 체내의 성숙한 성인의 간에서만 발현되는 것으로 알려져 있고, 줄기세포에서 분화시킨 세포에서는 발현이 거의 되지 않아 스크리닝용으로 적합하지 않으며, CYP1B1은 간세포보다 혈액세포 등에서 발현량이 높은 것으로 알려져 있어 약물의 효능이나 독성 시험에는 적합하지 아니하다.
본 발명에서 용어, "형질전환(transfection)"은 배양동물세포에 DNA를 직접 도입하여 세포의 유전형질을 변이시키는 방법으로서, 일반적으로 목적으로 하는 유전자를 플라스미드 등의 매개체에 넣어 도입하는 방법을 사용한다. 상기 형질전환은 당 분야의 통상적인 방법에 따라 실시될 수 있으며, 바람직하게는 그 예로 인산칼슘공침법, DEAE-텍스트란처리법, 전기천공법, 재분포법 등이 있다.
상기 표적화 벡터는 전형적으로 클로닝을 위한 벡터 또는 발현을 위한 벡터로서 구축될 수 있다. 상기 표적화 벡터는 당업계에서 식물, 동물 또는 미생물에서 외래의 단백질을 발현하는데 사용되는 통상의 것을 사용할 수 있다. 상기 표적화 벡터는 당업계에 공지된 다양한 방법을 통해 구축될 수 있다. 상기 표적화 벡터는 pMCDT-A 벡터를 이용하여 형질감염하여 제조된 것일 수 있으나, 이에 한정되지 않는다.
상기 인간 유도만능 줄기세포주는 서열번호 1 내지 3으로 표시되는 유전자를 표적으로 하는 sgRNA로 형광단백질을 삽입한 벡터로 형질감염하여 제조된 것일 수 있으나, 이에 한정되지 않는다.
본 발명의 구체적인 실시예에서, 본 발명자들은 섬유 아세포 유래 인간 유도만능 줄기세포에 형광단백질을 사이토크롬 P450 유전자좌에 녹-인되도록 표적화 벡터를 설계하고, 3개의 단일-가이드 RNA(sgRNA)를 사용하여 표적화 벡터를 제조하여 인간 유도만능 줄기세포주에 형질감염시켜 형광단백질로 표지된 사이토크롬 P450 단백질로 형질전환된 인간 유도만능 줄기세포주 클론을 확립하였다(도 1 참조). 상기 확립된 형질전환 인간 유도만능 줄기세포주가 인간 유도만능 줄기세포의 특성을 유지하는지 확인한 결과, 인간 유도만능 줄기세포에서 전분화능 마커들인 NANOG, OCT4, SOX2, TRA-1-60 및 TRA-1-81 마커가 정상적으로 발현되는 것을 확인하였으며(도 2a 참조), EB 형성 분석을 통해 3개의 배엽으로의 세포 분화 가능성을 확인하였다(도 2b 및 도 2c 참조). 또한, 제조된 형질전환 인간 유도만능 줄기세포주의 핵형 분석 결과, 핵형이 정상임을 확인하였다(도 2d 참조).
따라서, 본 발명의 실시예에서 제조된 형광단백질로 표지된 사이토크롬 P450 단백질로 형질전환된 인간 유도만능 줄기세포주가 인간 유도만능 줄기세포의 특성을 그대로 유지하는 것을 확인하였다.
또한, 본 발명자들은 본 발명의 실시예에서 제조된 형광단백질로 표지된 사이토크롬 P450 단백질로 형질전환된 인간 유도만능 줄기세포주로부터 분화된 간세포의 기능을 확인한 결과, 간세포 특이적 마커 유전자의 mRNA 발현 증가 및 단백질 발현 증가를 확인하였으며(도 4a 내지 도 4c), 알부민 양성 간세포가 96% 이상이고, 알부민 분비 검출 및 저밀도 지단백질-흡수 분석을 통해 간세포로 성공적으로 분화하였음을 확인하였다(도 4d 내지 도 4g).
또한, 본 발명자들은 본 발명의 실시예에서 제조된 형광단백질로 표지된 사이토크롬 P450 단백질로 형질전환된 인간 유도만능 줄기세포주로부터 분화된 간세포에서 형광단백질로 표지된 사이토크롬 P450 단백질 발현을 확인한 결과, 형광단백질과 사이토크롬 P450 이 유사한 수준으로 발현되고, 동일한 위치에서 발현됨을 확인하였다(도 5 참조).
본 발명자들은 형광단백질의 신호가 AHR 작용제에 의해 유도될 수 있는지 확인한 결과, 형광단백질로 표지된 사이토크롬 P450 단백질로 형질전환된 인간 유도만능 줄기세포주로부터 분화된 간세포에 공지된 AHR 작용제를 처리한 경우, 형광단백질의 강도는 사이토크롬 P450의 활성에 비례하여 증가하는 것을 확인하였다.
상기와 같은 결과를 통해, 본 발명의 형광단백질로 표지된 사이토크롬 P450 단백질로 형질전환된 인간 유도만능 줄기세포주로부터 분화된 간세포가 AHR 조절제 스크리닝에 이용될 수 있음을 확인할 수 있다.
또한, 본 발명은
1) 형광단백질로 표지된 사이토크롬 P450 단백질로 형질전환된 인간 유도만능 줄기세포주에 시험물질을 접촉시키는 단계;
2) 상기 시험물질을 접촉한 형광단백질로 표지된 사이토크롬 P450 단백질로 형질전환된 인간 유도만능 줄기세포주에서 형광단백질의 신호 세기를 측정하는 단계; 및
3) 대조구 시료와 비교하여 상기 형광단백질의 신호 세기가 변화된 시험물질을 선별하는 단계를 포함하는 AHR 조절제 스크리닝 방법을 제공한다.
상기 단계 3)의 대조구 시료는 BaP 또는 TCDD인 것일 수 있으나, 이에 한정되지 않는다.
상기 AHR 조절제 스크리닝 방법은 대량분석시스템(High Content Screening; HCS)에서 수행할 수 있다.
본 발명의 구체적인 실시예에서, 본 발명자들은 제조된 형광단백질로 표지된 사이토크롬 P450 단백질로 형질전환된 인간 유도만능 줄기세포주로부터 유도한 간세포를 이용하여 HCS (High-Content Screening) 장치를 사용한 자동 분석 프로토콜을 설정한 후 AHR 조절제를 스크리닝한 결과, 형광단백질 발현을 증가시키는 화합물 3 종과 형광 단백질 발현을 감소시키는 화합물 2종을 선별하였다(도 8 내지 도 10 참조).
또한, 본 발명자들은 제조된 형광단백질로 표지된 사이토크롬 P450 단백질로 형질전환된 인간 유도만능 줄기세포주 유래 간세포와 hPH 및 HepG2 세포주의 비교한 결과, 제조된 형광단백질로 표지된 사이토크롬 P450 단백질로 형질전환된 인간 유도만능 줄기세포주 유래 간세포가 살아있는 세포를 이용할 수 있어, hPH 및 HepG2 세포보다 AHR 스크리닝 방법에 더 우수하다는 것을 확인하였다(도 11 내지 도 13 참조).
현재 상업적으로 사용가능한 AHR 리포터 세포주는 주로, 간암 세포인 HepG2 및 결직장 선암종 HT29 세포와 같은 몇몇 악성 세포주에서 CYP1A1 프로모터의 제어 하에 루시퍼라제 리포터 시스템에 기초한다. HepG2 세포에 BaP처리는 바람직하지 않은 유전자의 상승 및 경로 활성화를 야기한다. hPH(human primary hepatocytes cells)는 BaP에 대한 반응 측면에서 우수한 효과를 보여 주나, 세포가 더 이상 분열하지 않아 세포 공급이 한정적이다. 이에 반해, 본 발명의 형질전환된 인간 유도만능 줄기세포주 유래 간세포는 향후 세포 분화 가능성이 있는 세포 공급 및 다양한 세포 유형을 제공할 수 있는 유도만능 줄기세포 자체의 장점을 그대로 갖는다.
루시퍼라제-기반 AHR 리포터 인간 유도만능 줄기세포주(hiPSC)도 보고되었지만 (Smith, B W, Stanford, E A, Sherr, D H, and Murphy, G J (2016) Genome Editing of the CYP1A1 Locus in iPSCs as a Platform to Map AHR Expression throughout Human Development Stem Cells Int 2016, 2574152), 루시퍼라제 리포터 시스템은 AHR 활성을 조사하기 위해 세포의 희생을 수반하는 반면, 본 발명의 리포터 시스템은 CYP1A1-mCherry의 형광 수준을 통해 살아있는 세포에서 AHR 활성을 나타내는 장점이 있다. 결과적으로 이를 통해, 약물의 농도 뿐 만 아니라 동일 세포에서 약물 처리 시간의 경과에 따른 반응 동역학(kinetics)을 추적할 수 있어 약물의 기전을 파악하는 데 추가적인 정보를 제공할 수 있다.
이하, 본 발명을 다음 실시예에 의해 상세히 설명한다.
단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명이 이들에 의해 제한되는 것은 아니다.
<실험방법>
1. 인간유도 만능줄기 세포의 배양 및 간세포로의 분화
인간 피부 섬유 아세포 유래 인간유도 만능줄기 세포(hiPSC)를 녹-인 실험 및 대조군 인간유도 만능줄기 세포(hiPSC)로서 사용하였다.
먼저 인간 피부 섬유 아세포 유래 인간유도 만능줄기 세포를 Vitronectin XF™(Stem Cell Technologies, Vancouver, Canada) 를 함유하는 mTeSR-E8 배지에서 유지시키고 DPBS(Dulbecco's Phosphate-Buffered Saline)에서 0.5 mM EDTA를 사용하여 3일 또는 4일마다 해리시켰다.
상기 배양된 hiPSC를 간세포로 분화시키기 위해 하기와 같은 실험을 수행하였다. 구체적으로, hiPSC를 Matrigel®(Corning, Tewksbury, MA, USA) 코팅 접시에 플레이팅하고 1일 동안 mTeSR ™-E8 ™(Stem Cell Technologies)에서 배양하였다. 내배엽 (DE; Definitive endoderm)분화를 위해, hiPSC를 0.5 mg/ml 소 혈청 알부민(BSA), 2 % B27(Thermo Fisher Scientific, Waltham, MA, USA), 50ng/ml 액티빈 A(Peprotech, Rocky Hill, NJ, USA) 및 1 mM 부티르산 나트륨(Sigma-Aldrich, St. Louis, MO, USA) 을 함유하는 RPMI-1640에서 1일 동안 배양하였고, 그런 다음, 부티르산 나르튬의 농도가 감소된 동일한 배지에서 4일 동안 세포 배양을 계속하였다. 다음으로, 5 일 동안 0.5 mg/ml BSA, 2 % B27, 10 ng/ml 섬유 모세포 성장 인자(FGF4; fibroblast growth factor 4, Peprotech) 및 10 ng/ml 간세포 성장 인자(HGF; hepatocyte growth factor, Peprotech) 를 함유하는 RPMI-1640에서 배양함으로써 DE 세포를 간 내배엽 세포로 분화시켰다. 간 성숙은 7일 동안 10 ng/ml의 FGF4, 10 n /ml HGF, 10 ng/ml 온코스타틴 M(Peprotech) 및 0.1 μM 덱사메타손 (Sigma-Aldrich)이 보충된 간세포 배양 배지(HCM; Lonza, Basel, Switzerland) 에서 세포를 배양함으로써 유도되었다. 배양 배지는 매일 교체하였다.
배상체(EB; embryoid body) 형성을 위해, CYP1A1-mCherry hiPSC를 0.5 mM EDTA와 해리하고, AggreWell ™ 800 플레이트 (Stem Cell Technologies)에 시딩하였다. 다음날, 세포 응집물을 mTeSR ™ -E8 ™ 배지에서 저부착 플레이트로 옮기고 7일 동안 배양하였다. 형성된 배상체를 분석 전에 추가로 7일 동안 Matrigel®-코팅된 플레이트에서 배양하였다.
인간 일차 간세포(Corning, Donor No. 303)를 제조사의 지시에 따라 Gentest™High Viability CryoHepatocyte Recovery kit (Corning)를 사용하여 콜라겐 I- 코팅된 배양 플레이트에 플레이팅하고, 24 시간 후에 실험을 수행하였다. HepG2 세포를 10% 소 태아 혈청 (FBS; Thermo Fisher Scientific)을 함유하는 Eagle 's Minimum Essential Medium (EMEM; 프랑스 Nuaille, Biowest)에서 배양하였다.
2. CRISPR-Cas9 시스템을 이용한 mCherry 녹-인
인간 코돈-최적화된 SpCas9 및 키메라 가이드 RNA 발현 플라스미드(pX330-U6-Chimeric_BB-CBh-hSpCas9; Addgene, Watertown, MA, USA)를 사용하여 벡터 구축을 표적화하는데 사용하였다. 표적 유전자의 인트론 부위에서 온라인 CRISPR 설계 도구 (http://crispr.mit.edu)를 사용하여 단일 가이드 RNA(sgRNA)를 구축하였다. 가장 낮은 표적 외 효과를 사용하여 sgRNA를 선택하였다. 3개의 단일 가이드 RNA(sgRNA)의 표적 서열은 하기 표 1에 나타내었다. Zhang 실험실의 표적 서열 클로닝 프로토콜에 따라 다음의 실험을 수행하였다.
Locus sgRNA Score Target site PCR analysis colony 동결 서열번호
E6-E7 intron Guide #1 78 GCATTGATCCTCCTGTCCAT GGG 6 /13 5 1
E4-E5 intron Guide #4-2 73 TAGGTAGTGGCTCCCTTCAA AGG 12 /29 9 2
Guide #5 Reverse 73 CTGGCACTGACCCCTTTGAA GGG 4 /9 3 3
pMCDT-A 벡터를 표적화 벡터의 골격으로 사용하였다. 인간 CYP1A1 유전자는 hiPSC로부터 추출된 게놈 DNA를 사용하여 중합 효소 연쇄 반응 (PCR)에 의해 증폭되었다. 5 '및 3' homologous arms는 각각 CYP1A1에서 정지 코돈의 1.2kb 상류 및 0.93kb 하류를 표적으로 하였다. mCherry 및 PGKneo는 이들을 함유하는 플라스미드로부터 PCR에 의해 증폭되었다. 서열 확인 후 T4 DNA 리가제(Promega, Madison, WI, USA)를 사용하여 각 단편을 결찰하였다. 5 ' homologous arms, mCherry, PGKneo 및 3' homologous arms을 각각 SmaI, HindIII 및 SalI를 사용하여 결찰시켰다. 생성된 최종 단편을 NotI 및 XhoI를 사용하여 pMCDT-A 벡터에 삽입하였다.형질 감염을 위해, 계대 28에서의 hiPSC를 DPBS에서 0.5 mM EDTA와의 해리시켜 단일 세포(2.5 x 10 7 세포/ml)로서 제조하였다. 4 ㎍의 표적화 벡터 및 1 ㎍의 Cas9 벡터를 세포 현탁액에 첨가하고 NEON®(Invitrogen, Carlsbad, CA, USA) 형질 감염 시스템을 사용하여 1600 V, 20 ms, 1 펄스 조건 하에서 전기 천공시켰다. 전기 천공 후, 세포를 Matrigel®-코팅된 48-웰 플레이트에 웰당 1,000 개의 살아있는 세포로 시딩하였다. 세포를 48 시간 동안 확장시킨 후 2 주 동안 50 μg/ml 게네티신(G418 sulfate, Gibco)으로 선택하였다. 그런 다음, 약물 내성 클론을 수동으로 선택하여 확장 및 추가 실험을 수행하였다. 본 발명의 분석을 위해, 29 내지 40의 계대에서 CYP1A1-mCherry hiPSC를 사용하였다.
3. CYP1A1-mCherry hiPSC 라인의 특성 분석
게놈 표적화 효율을 확인하기 위해, 제조사의 프로토콜에 따라 T7 엔도뉴클레아제 I 분석을 수행하였다.
구체적으로, G-spin ™Total Genomic DNA Extraction Kit (Intron Biotechnology, Gyeonggi, Korea)를 사용하여 sgRNA가 있거나 sgRNA가 없이 형질 감염된 hiPSC로부터 게놈 DNA를 추출하였다. 이어서, sgRNA 결합 부위를 포함하는 500 bp 단편을 PCR에 의해 증폭시켰다. MEGAquick-spin ™Plus Total Fragment DNA 정제 키트 (Intron Biotechnology)를 사용하여 PCR 산물을 정제한 후, 산물을 변성 및 어닐링한 다음 T7 엔도뉴클레아제 I (NEB, Ipswich, MA, USA)로 분해시켰다. 분해된 DNA 단편은 아가로스겔 전기 영동으로 분석하였다. 녹-인(kcock-in)은 표적화 된 통합 부위의 PCR 및 DNA 서열 분석으로 확인하였다. G-DEX 게놈 DNA 추출 키트 (Intron Biotechnology)를 사용하여 약물 내성 클론에서 게놈 DNA를 분리하고, 표 2에 나열된 프라이머를 사용하여 EX Taq®중합 효소(Takara Bio, Shiga, Japan)를 사용하여 50ng의 분리된 DNA를 증폭시켰다.
CYP1A1-mCherry hiPSC의 핵형을 분석하기 위하여, 20개의 단일 클론에 대하여 550의 밴드 분해능으로 G-밴딩 핵형 분석(GenDix, Seoul, Korea)을 수행하였다.
프라이머명 서열(5'→3') 서열번호
CYP1A1 forward AGGCTTTTACATCCCCAAGG 4
CYP1A1 reverse TTGTCGATAGCACCATCAGG 5
mCherry forward GTGAGCACTTCCAAATGCAGC 6
mCherry reverse CCTTGAAGCGCATGAACTCCT 7
PAX6 forward GTGTCCAACGGATGTGTGAG 8
PAX6 reverse CTAGCCAGGTTGCGAAGAAC 9
OTX2 forward TGCAGGGGTTCTTCTGTGAT 10
OTX2 reverse AGGGTCAGAGCAATTGACCA 11
α-SMA forward TGCTCTGGGTTCGTCAGAGTC 12
α-SMA reverse CAGGCAAGTCACTGTGTGGC 13
EOMES forward AGGCGCAAATAACAACAACAC 14
EOMES reverse ATTCAAGTCCTCCACGCCATC 15
Brachyury forward GCGGGAAAGAGCCTGCAGTA 16
Brachyury reverse TTCCCCGTTCACGTACTTCC 17
FOXA2 forward ATGCACTCGGCTTCCAGTAT 18
FOXA2 reverse CACGTACGACGACATGTTCA 19
GATA4 forward TCCAAACCAGAAAACGGAAG 20
GATA4 reverse CTGTGCCCGTAGTGAGATGA 21
SOX17 forward CAGAATCCAGACCTGCACAA 22
SOX17 reverse GCGGCCGGTACTTGTAGTT 23
ALB forward GAGACCAGAGGTTGATGTGATG 24
ALB reverse AGTTCCGGGGCATAAAAGTAAG 25
AAT forward GAAGTCAAGGACACCGAGGA 26
AAT reverse GCTGGCAGACCTTCTGTCTT 27
TDO2 forward CAAATCCTCTGGGAGTTGGA 28
TDO2 reverse GTCCAAGGCTGTCATCGTCT 29
HNF4A forward CGAGCAGATCCAGTTCATCA 30
HNF4A reverse TCACACATCTGTCCGTTGCT 31
G6Pase forward TCAACCTCGTCTTTAAGTGGATTCT 32
G6Pase reverse AGTATACACCTGCTGTGCCC 33
TAT forward GCTTCCTCAAGTCCAATGCT 34
TAT reverse CTGTGATGACCACTCGGATG 35
TTR forward ACCGGTGAATCCAAGTGTCC 36
TTR reverse GGTTTTCCCAGAGGCAAATGG 37
AFP forward AGCTTGGTGGTGGATGAA 38
AFP reverse TCTGCAATGACAGCCTCAAG 39
4. 유세포 분석(Flow cytometry)
CYP1A1-mCherry hiPSC 유래 HLC를 0.5 mM EDTA로 해리시키고, 10 % FBS를 함유하는 DPBS로 세척하였다. 해리된 세포를 고정하고, 실온(RT)에서 1시간 동안 Foxp3 고정/투과 용액 (eBioscience, San Diego, CA, USA)으로 투과시킨 후, 1 μg의 마우스 항-ALB 1차 항체 (R & D Systems, Minneapolis, MN, USA)와 함께 1시간 동안 인큐베이션한 다음 얼음상에서 1시간 동안 플루오레세인이 접합된 이차 항체로 표지하였다. FACSCalibur ™유세포 분석기(BD Biosciences, San Jose, CA, USA)를 사용하여 유세포 분석을 수행하고, FlowJo® 소프트웨어를 사용하여 데이터를 분석하였다.
5. 간 기능 검사(Hepatic functional tests)
효소 결합 면역 흡착 분석(ELISA)의 경우, 배지를 교체하고 24 시간 후 배양 상청액을 수집하고 분비된 알부민의 양을 제조사의 프로토콜에 따라 휴먼 알부민 ELISA 정량 키트 (Bethyl Laboratories, Montgomery, TX, USA)를 사용하여 측정하였다. 분비된 알부민의 양은 독립적인 배양 접시로부터 100 ㎕의 배양 상청액을 사용하여 측정하고, 각 표준 곡선에 따라 계산한 후 단백질 함량으로 정규화하였다. 단백질 함량은 Bio-Rad 단백질 분석 키트(Bio-Rad, Hercules, CA, USA)를 사용하여 결정하였다. 아세틸화된 저밀도 지단백질(Ac-LDL; acetylated-low density lipoprotein) 흡수 분석을 위해, 세포를 10 μg/ml 1, 1'-다이옥타데실-3, 3, 3', 3'-테트라메틸인도카르보시아닌-표지된 Ac-LDL(Life Technologies, Carlsbad, CA, USA)과 함께 5시간 동안 배양하였다. 적색 형광은 형광 현미경으로 시각화하였다.
6. 면역세포화학 분석
세포를 실온에서 30 분 동안 4 % 포름 알데히드 (Sigma-Aldrich)를 사용하여 고정시킨 후, 0.1 % 트윈 20 (PBST)을 함유하는 PBS에서 10 분 동안 3 회 세척하였다. 이어서, 샘플을 0.1 % Triton X-100 (Sigma-Aldrich)을 함유하는 PBS에서 15 분 동안 투과시키고, 4 % 정상 염소 혈청 serum (Jackson ImmunoResearch, West Grove, PA, USA)을 RT에서 1시간 동안 차단시켰다. 세포를 4 % 정상 양 혈청 (SOX17의 경우) 또는 정상 염소 혈청 (기타의 경우)을 함유하는 PBS에 희석한 다음 1 차 항체와 함께 4 ℃에서 밤새 배양하였다 : 토끼 항-CYP1A1 (1:200; Abcam, Cambridge, UK), 마우스 항-mCherry (1:200), 토끼 항-AAT (1:200), 마우스 항 -HNF4A (1:200; Abcam), 토끼 항-ALB (1:50), 토끼 항-AFP (1:200; Dako, Glostrup, Denmark), 토끼 항-OCT4 (1:400), 토끼 항-NANOG (1:400; Cell Signaling Technology, Danvers, MA, USA), 마우스 항-SOX2 (1:50; Santa Cruz Biotechnology, Dallas, TX, USA), 마우스 항-TRA-1-60 (1:100), 마우스 항-TRA-1-81 (1:100), 마우스 항-Nestin (1:200), 토끼 항-Desmin (1:50; Millipore, Burlington, MA, USA), 마우스 항-SMA (1:500; Sigma-Aldrich), 염소 항-SOX17 (1:50; R & D Systems) 및 토끼 항-TUBB3 (1:1000; BioLegend, San Diego, CA, USA). 세포를 각각 10 분 동안 PBST에서 6 회 세척하고, 세포를 다음과 같이 PBST에 희석된 적절한 이차 항체와 함께 실온에서 1 시간 동안 배양하였다 : Alexa Fluor 488, 594 염소 항-마우스 IgG, Alexa Fluor 594 염소 항-토끼 IgG 또는 Alexa Fluor 488 닭 항 염소 IgG (1:200; Thermo Fisher Scientific). 그런 다음, 세포를 PBST로 세척하고 핵의 시각화를 위해 4'-6-디아미디노-2-페닐인돌(DAPI; 4'-6-diamidino-2-phenylindole, Sigma-Aldrich)로 염색했다. 소포체(ER)는 제조사의 프로토콜에 따라 ER Tracker ™Green (Invitrogen)을 사용하여 표시하였다.
* 7. Ethoxyresorufin-O-deetylase (EROD) 분석
CYP1A1 활성을 측정하기 위해, 세포를 처리하기 전에 무 혈청 배지에서 24 시간 동안 배양하였다. 세포를 7.5, 15, 30 및 60 분 동안 HBSS에서 억제제 10 μM 디쿠마롤(dicumarol)의 존재 또는 부재하에 7.5 μM 에톡시레소루핀(ethoxyresorufin)으로 처리하고, 100 μl의 배지를 새로운 미세 원심 분리 튜브로 제거하였다. 제거된 배지에 동량(100 ㎕)의 빙냉 아세토니트릴-메탄올을 첨가한 후, 4 ℃에서 5 분 동안 16,000 Х g에서 짧게 볼텍싱 및 원심분리하였다. 상청액을 하기 분석에 사용하였다. 대사체 레조루핀(resorufin)의 수준을 Luna C18 컬럼 (4.6 Х 150 mm, 5 μm; Phenomenex, Seoul, Korea)을 갖는 고성능 액체 크로마토 그래피(HPLC)로 측정하였다. 이동상은 20 mM 포스페이트 완충제-메탄올-아세토 니트릴 (52:45:3, v/v/v)로 구성되었고, 유속은 0.8 ml/분이었다. 여기에 대해서는 560 nm, 방출에 대해서는 585 nm의 파장에서 형광 측정을 수행하였다. BCA 단백질 분석 키트 (Thermo Fisher Scientific)를 사용하여 측정된 전체 세포 단백질 함량에 의해 정규화된 레조루핀(resorufin)에 대한 표준 곡선을 사용하여 농도를 계산하였다.
8. 정량적 역전사 PCR (RT-qPCR)
NucleoZOL 시약 (Macherey-Nagel, Duren, Germany)을 사용하여 각 샘플로부터 총 RNA를 분리하고 제조사의 프로토콜에 따라 GoScript ™역전사 믹스 (Promega)를 사용하여 역전사하였다. RT-qPCR은 StepOnePlus Real-Time PCR 시스템 (Applied Biosystems, Foster City, CA, USA)에서 SYBR Green Realtime PCR Master Mix (TOYOBO, Osaka, Japan)로 수행되었다. 각 샘플에 대해 3 중 PCR 증폭을 수행 하였다. PCR 결과는 글리세르 알데히드-3-포스페이트 탈수소 효소(GAPDH)로 정규화 한 후 대조군 세포와 비교하여 상대적 배수 변화로 표현하였다.△Ct(S△Ct값은 GAPDH에 대해 얻어진 Ct 값과 표적 유전자의 차이로 계산하였다. 대조군 세포의 △Ct값을 대조군 △Ct(C△Ct)값으로 사용하였다. 상대 유전자 발현 수준은 화학식 2- (S△Ct-C△Ct)를 사용하여 결정되었다. 상기 실험에 사용된 프라이머는 표 2에 나타냈다.
9. 화학물 처리 및 고용량 스크리닝(HCS; High-content screening)
HCS를 수행하기 위하여, 10 일째 분화된 세포를 해리시키고, Matrigel®-코팅된 96-웰 플레이트에 플레이팅하고, 성숙을 위해 배양하였다. 분화가 완료된 다음 24 시간 후, 세포를 간독성 라이브러리 (SCREEN-WELL® Hepatotoxicity library; Enzo Life Sciences, Farmingdale, NY, USA) 및 핵 수용체 리간드(SCREEN-WELL® Nuclear Receptor Ligands Library; Enzo Life Sciences)를 포함하는 241 가지 화학 물질 및 양성 대조군으로서 AHR 작용제 (2,3,7,8- 테트라클로로디벤조-p-디옥신 (TCDD) 및 벤조[a]피렌 (BaP))을 24 시간 및 48시간 동안 처리하였다. 비히클 대조군(vehicle control)으로서 DMSO를 사용하였다. 살아있는 세포 핵의 염색을 위해, 세포를 2 μg/ml Hoechst 33342 (Life Technologies)에서 10 분 동안 배양하였다. 염색된 세포는 ImageXpress Micro XLS Widefield High-Content Analysis System (Molecular Devices, San Jose, CA, USA)을 사용하여 이미지화하였다. 획득된 이미지는 공개된 방법에 따라 MetaXpress High-Content Image Acquisition and Analysis Software (Molecular Devices)를 사용하여 분석하였다. 분석은 먼저 Hoechst 염색을 사용하여 세포를 식별하고 CYP1A1 발현을 측정하기 위해 mCherry 강도를 검출하였다. 스크리닝에 사용된 모든 화학 물질 농도는 TCDD (10 nM), BaP (1 μM) 및 H01 (3- 메틸콜란트렌; 1 μM)을 제외하고 10 μM이었다.
10. 선량-반응 곡선(Dose-response curve)
선량-반응 곡선을 측정하기 위해, 샘플을 TCDD, BaP, 파파베린 하이드로클로라이드, 노르디하이드로구아레트 산 및 글라페닌과 함께 24시간 동안 개별 농도(0.1, 1, 10, 및 50 μM 농도의 TCDD와 0.01, 0.1, 1, 10, 50, 및 100 μM 농도의 다른 화합물)로 배양하였다. RNA 추출을 위해 세포를 준비한 후, 상기 절차에 따라 CYP1A1 mRNA 발현에 대한 RT-qPCR 분석을 수행하였다. 최소-제곱 피팅 방법으로 GraphPad Prism 5 (GraphPad, SanDiego, CA, USA)를 사용하여 선량-반응 곡선을 작성하였다. 세포 사멸로 인한 낮은 RNA 농도 (<50 μg/ml)를 갖는 샘플은 회수하였다.
11. 세포 생존력 분석
세포 생존력을 분석하기 위해, 세포 생존력 분석 수행 전에 표적 화학 물질 (10 μM)을 24 시간 동안 처리하였다. 이어서, 100 ㎕의 배지에 대한 10 ㎕의 세포 계수 키트-8(Dojindo, Kumamoto, Japan)을 첨가하고, 2시간 동안 배양하였다. iMark ™마이크로 플레이트 흡광도 판독기 (Bio-Rad)를 사용하여 450 nm에서 흡광도를 측정하였다. 세포 생존율은 다음 공식을 사용하여 계산하였다:
생존률(%)=(A sample-A blank)/(A control-A blank)×100
12. 마이크로 어레이 분석
마이크로 어레이 분석을 위해, hiPSC- 유래 간세포, 및 1 μM BaP 처리가 있거나 없는 HepG2 및 인간 1 차 간세포(hPH; human primary hepatocytes)의 중복된 총 RNA 샘플을 TRIzol 시약을 사용하여 제조하였다. 마이크로 어레이 분석은 서비스 제공 업체(eBiogen, Seoul, Korea)에 의해 Agilent Human GE 4 X 44 V2 칩 (Agilent, Santa Clara, USA)을 사용하여 수행되었다.
유전자 온톨로지 및 KEGG 경로 분석은 유전자 온톨로지(Biological process, Molecular function, and Cellular components) 및 KEGG 경로의 선택과 함께 DAVID를 사용하여 수행하였다. 주성분 분석(PCA), 평균 Z-점수 계산, R-제곱 및 상관도를 수행하고, R (v.3.6.1)을 사용하여 시각화하였다.
13. 통계 분석 및 시각화
RT-qPCR, CYP1A1 활성 및 mCherry 측정에 관한 그래프 시각화 및 통계 분석은 GraphPad Prism 5 및 Microsoft Excel (Redmond, WA, USA)을 사용하여 수행하였다. 화학 구조는 MarvinSketch (v20.6; ChemAxon, Budapest, Hungary)를 사용하여 그렸다.
<실시예 1> CRISPR-Cas9 시스템을 이용한 mCherry 녹-인 벡터의 제조
hiPSC에서 AHR 활성의 라이브 모니터링 시스템을 확립하기 위해 AHR에 의해 전사적으로 조절되는 CYP1A1을 표적화하였다. 형광 마커 삽입의 표적 외 효과를 최소화하기 위해, <실험방법> 2.에 기재된 방법으로 CRISPR-Cas9 시스템을 사용하여 표적 유전자 좌에서 HR-매개 녹-인을 유도하였다. 정상적인 섬유 아세포에서 유래한 사전 확립된 hiPSC에서 mCherry를 CYP1A1 유전자좌에 녹-인되도록 표적화 벡터를 설계하였다(도 1a). mCherry cDNA를 정지 코돈의 결실과 함께 CYP1A1의 마지막 엑손의 끝에 삽입하였다. 포스포 글리세레이트 키나제 (PGK)-네오 및 디프테리아 독소 A (DT-A)를 각각 양성 및 음성 선택을 위한 표적화 벡터에 포함시켰다. 3개의 단일-가이드 RNA(sgRNA)가 엑손 4 - 엑손 5 (E4-E5) 또는 엑손 6 - 엑손 7 (E6-E7) 인트론을 표적으로 하도록 지정하였다(도 1b). sgRNA의 효율은 T7 엔도뉴클레아제 I 분석에 의해 조사하였고, 모든 sgRNA는 효과적으로 DNA의 절단을 유도하여 50 % 초과의 인델을 생성하였음을 확인하였다(도 1c).
Cas9 및 개별 sgRNA를 함유하는 표적화 벡터로 hiPSC를 형질감염시켰다. 양성 선별을 위해, 형질감염된 hiPSC를 G418로 처리한 후 단일 세포 클론 확장이 이어졌다. 클론 확장 동안 증식 세포에서 표적 유전자좌의 변형은 도 1a에 제시된 프라이머 세트를 갖는 PCR로 확인하였다(도 1d). 지정된 부위에서 카세트의 통합을 확인하기 위해, CYP1A1과 mCherry 사이 및 PGKneo와 CYP1A1 사이의 접합 부위를 시퀀싱한 결과를 도 1e에 나타내었다(도 1 e).
상기와 같은 실험 결과, mCherry-융합 CYP1A1을 발현하는 hiPSC 라인의 6 개의 클론(# 1-2, # 1-7, # 1-8, # 1-9, # 4-13 및 # 5-2)을 확립하였으며, 한국생명공학연구원 생물자원센터에 수탁번호 KCTC 14186BP 로 기탁하였다.
<실험예 1> CYP1A1-mCherry hiPSC이 hiPSC의 특성 유지하는지 여부 확인
CYP1A1-mCherry hiPSC이 hiPSC의 특성 유지하는지 여부 확인을 위한 실험에 사용할 라인으로 #1-8 라인을 선택하였다. CRISPR-Cas9-매개 유전자 편집이 hiPSC의 특성에 영향을 미치는지 여부를 조사하기 위해, <실험방법> 3.에 기재된 방법으로 CYP1A1-mCherry hiPSC에서 전분화능 및 게놈 안정성 특성을 조사하였다.
그 결과 도 2a에 나타난 바와 같이, NANOG, OCT4, SOX2, TRA-1-60 및 TRA-1-81과 같은 전분화능 마커는 # 1-8 라인에서 발현되었다(도 2a). 3 개의 배엽으로의 세포 분화 가능성은 EB 형성 분석을 통해 확인하였다. EB는 mRNA(도 2b) 및 단백질(도 2c) 수준에서 3 개의 배엽 마커를 모두 발현시켰다. 또한, CYP1A1-mCherry hiPSC의 핵형을 확인한 결과, hiPSC의 핵형은 정상임을 확인하였다(도 2d).
상기와 같은 결과를 통해, CRISPR-Cas9 시스템에 의해 유도된 mCherry 녹-인 과정이 CYP1A1-mCherry hiPSC 의 전분화능에 영향을 미치지 않음을 확인하였다.
<실험예 2> CYP1A1-mCherry hiPSC로부터 분화된 간세포의 기능 확인
CYP1A1 및 그것의 상류 조절자(upstream regulator)인 아릴 탄화수소 수용체(AHR; Aryl hydrocarbon receptor)는 간에서 단계 I 생체이물(xenobiotic) 및 약물 대사에 관여한다. CYP1A1-mCherry hiPSC 라인은 간세포 분화를 통한 화합물 및 약물 스크리닝에 사용될 수 있을 것으로 예측하여 도 3에 나타낸 단계적 직접 분화 프로토콜에 의해 CYP1A1-mCherry hiPSC 을 간세포로 분화시켰다(도 3). 그런 다음, <실험방법> 4, 5 및 6의 방법으로 분화된 간세포의 기능을 확인하였다.
먼저, 세포의 형태를 관찰한 결과 도 4a에 나타난 바와 같이, 분화의 각 단계에서 다음과 같이 변경되었다: 5일에 결정적인 내배엽, 10일에 간 전구체 및 17일에 간세포(도 4a).
ALB, AAT, TDO2, HNF4A, G6Pase, TAT, TTR 및 AFP와 같은 간세포 특이적 마커 유전자의 전사 발현은 분화와 함께 증가함을 확인하였다(도 4b).
면역 세포 화학 분석 결과 도 4c에 나타난 바와 같이, 분화된 간세포에서 간세포 특이적 단백질인 ALB, AAT, AFP 및 HNF4A 의 발현을 확인하였다(도 4c).
또한, 알부민-발현 세포의 비율을 <실험방법> 4의 유세포 분석법으로 조사하였고, 17 일째에 세포의 96 % 이상이 알부민 양성 HLC임을 확인하였다(도 4d).
분화된 HLC의 기능은 혈장으로의 알부민 분비의 검출(도 4e) 및 저밀도 지단백질 (LDL)-흡수 분석 (도 4f)에 의해 확인되었다.
알려진 CYP1A1 유도제 (benzo [a] pyrene (BaP) 및 TCDD)의 선량-반응 곡선은 분화된 HLC가 이들 화학 물질에 의해 다른 모델과 유사한 약물 반응을 나타냄을 나타낸 것이다(도 4g).
상기와 같은 결과를 통해, CYP1A1-mCherry hiPSC 라인은 필수 간 마커와 기능을 정상적으로 표현하여 HLC로 성공적으로 분화된 것임을 확인할 수 있다.
<실험예 3> CYP1A1-mCherry hiPSC로부터 분화된 간세포에서의 CYP1A1-mCherry 융합 단백질의 발현 확인
CYP1A1-mCherry hiPSC로부터 분화된 간세포(CYP1A1-mCherry HLCs)에서 CYP1A1과 mCherry의 결합과 발현을 확인했다.
CYP1A1 및 mCherry의 mRNA는 유사한 수준으로 발현되었고 (도 5a), CYP1A1 유도제의 부재 하에 17일차 CYP1A1-mCherry hiPSC로부터 분화된 HLC에서 CYP1A1 및 mCherry가 공동-국소화(co-localized)됨을 확인하였다(도 5b). 또한, mCherry는 CYP1A1가 주로 존재하는 위치인 핵 주위 소포체(ER)에서 발현됨을 확인하였다(도 5c).
다음으로, 본 발명자들은 mCherry 신호가 AHR 작용제에 의해 유도될 수 있는지 확인하기 위해, 분화된 CYP1A1-mCherry HLC를 공지된 AHR 작용제인 BaP 및 TCDD로 처리하였다.
그 결과, CYP1A1-mCherry HLC에서 AHR 작용제로 처리한 경우 mCherry의 강도(intensity)가 증가됨을 확인하였다 (도 6a). 또한, BaP- 및 TCDD- 처리된 CYP1A1-mCherry HLC에서 CYP1A1의 활성 증가를 나타냈으며(도 6b), 이는 대조군 hiPSC- 유도된 HLC와 유사함을 확인하였다(도 6c).
CYP1A1의 유도가 AHR에 의해 매개되는지 여부를 확인하기 위해, CYP1A1-mCherry 간세포에서 BaP 및 TCDD와 AHR 길항제인 CH223191을 병용처리하였다.
그 결과, CH223191은 BaP- 및 TCDD- 처리된 그룹 모두에서 mCherry의 강도를 유의하게 억제 하였다(도 7a). CYP1A1 및 mCherry 전사 발현 수준은 CH223191 처리에 의해 감소되었다(도 7b). 또한 CH223191와 BaP 또는 TCDD를 병용처리하면 CYP1A1 활성이 감소하였다(도 7c).
이 결과는 본 발명의 CYP1A1-mCherry hiPSC 유도 HLCs가 AHR-CYP1A1 축의 약물 검사에 사용될 수 있음을 나타냈다.
<실험예 4> CYP1A1-mCherry 간세포를 이용한 간독성 화학 물질 스크리닝
스크리닝을 위해 HCS (High-Content Screening) 장치를 사용한 자동 분석 프로토콜을 설정하였다(도 8a). 이 모듈을 사용하여 24시간 또는 48시간 처리된 CYP1A1-mCherry HLC에서 양성 대조군으로서 BaP 및 TCDD뿐만 아니라 간독성 제제(210 개 화합물) 및 핵 수용체 조절제(29 개 화합물)용 상용 라이브러리를 포함하여 총 241 가지 화학 물질을 선별하였다(도 8b).
4-1. mCherry 발현을 증가시키는 화합 물질의 선별
mCherry 발현을 증가시키는 화합 물질을 선별한 결과, 먼저 처리되지 않은 대조군보다 mCherry 강도가 30 % 이상 상승시키는 화학 물질 17 종을 선별하였다(도 9a). 그 중에서 10 종의 화합물은 CYP1A1 또는 AHR을 직간접적으로 유도하는 약물로 알려져 있었고, 다른 7 종의 화합물은 현재까지 AHR 또는 CYP1A1의 잠재적 활성화제로서 알려져 있지 않았다.
육안으로 세포의 사멸이 감지되지 않았음에도 불구하고, 검출된 mCherry 신호 강도의 상향 조절은 세포 사멸 또는 다른 이유로 야기된 자가 형광일 수 있다. 따라서, 17 종의 화합물과 CYP1A1-조절제 및 AHR 길항제와 병용 처리하여 mCherry 활성을 측정하였다. 대부분의 CYP1A1-조절제 및 AHR의 길항제인 CH223191의 병용 처리는 CYP1A1-mCherry HLC에서 mCherry 강도를 감소시킴을 확인하였다(도 9b).
확인된 AHR 조절제 후보물질 중에서, 파파베린 하이드로클로라이드(papaverine hydrochloride), 노르디하이드로구아이아레트 산(nordihydroguaiaretic acid) 및 글라페닌(glafenine)은 CH223191 노출에 의한 mCherry 강도의 측면에서 유의한 차이를 나타냈다. 이들 화학 물질의 영향을 선량에 따라 확인하였다(도 9c). 파파베린 하이드로클로라이드(papaverine hydrochloride)와 글라페닌(glafenine)은 스크리닝에 사용된 농도에서 6 ~ 7 배 증가와 최대 유도를 보였다. 노르디하이드로구아이아레트 산(nordihydroguaiaretic acid)은 다른 두 화학 물질보다 낮은 효과(~ 2 배)를 나타냈다.
상기와 같은 결과를 통해, 본 발명자는 mCherry 기반 HCS에 의해 3 종의 새로운 AHR 발현을 억제하는 AHR 작용제를 선별하였다.
4-2. mCherry 발현을 감소시키는 화합 물질의 선별
mCherry 발현을 감소시키는 화합 물질을 선별한 결과, 먼저 처리되지 않은 대조군보다 mCherry 강도가 70 % 이상 하향시키는 화학 물질 6 종을 선별하였다(도 10a). 이들 화학 물질 중 어느 것도 HR 길항제 또는 CYP1A1 억제제로 보고된 바 없었다.
CYP1A1의 감소가 해당 화학 물질의 간독성으로 인한 것인지 여부를 검증하기 위해, 해당 화합물 처리 후 <실험방법> 11.에 기재된 방법으로 세포 생존율을 확인하였다. 그 결과, 이들 화합물 중 어느 것도 작업 농도(working comcentration, 10 μM)로 세포 사멸을 유도하지 않았다(도 10b).
TCDD, 3-D02, 2-E05, 2-E06 및 2-C08에 대한 공지된 AHR 길항제의 억제 효과를 비교한 결과, CH223191 및 TMF와 비교하여 mCherry 강도의 현저한 감소를 나타냈다(도 10c). 특히, 2-E05(yangonin) 및 2-E06(desmethoxyyangonin)은 CYP1A1-mCherry HLC에서 세포 사멸없이 비 처리 대조군 및 CH223191 처리 수준으로 CYP1A1 활성 및 mCherry 발현에 대한 TCDD의 효과를 억제함을 확인하였다(도 10d 및 도 10e).
<실험예 4-1>에서 확인된 17 종의 CYP1A1 발현 증가 물질과 상기 두 가지 화학 물질을 병용 처리한 결과, CYP1A1 발현 수준 감소를 나타냄을 확인하였다(도 10f). 또한, CH223191 및 TMF와의 비교는 스크리닝에 의해 확인된 TCDD 및 다른 상향 조절제의 상향 조절 효과를 억제하는 동등한 능력을 보여주었다.
상기와 같은 결과를 통해, CYP1A1-mCherry hiPSC 라인을 사용하여 CYP1A1 발현을 조절하는 새로운 화학 물질을 선별할 수 있으며, HCS 시스템에서 선별한 화합물의 유용성을 입증하였다.
<실험예 5> CYP1A1-mCherry 간세포와 hPH 및 HepG2 세포주의 비교
라이브 스크리닝의 장점에도 불구하고, hiPSC- 유래 HLC의 미성숙은 간독성 시험 결과의 신뢰성에 대한 문제를 나타낼 수 있다. 따라서, 본 발명자들은 hiPSC-HLC를 hPH 및 간독성 시험에 가장 일반적으로 사용되는 HepG2 세포와 비교하였다. 이들 사이의 세포 유사성을 조사하기 위해, BaP 처리가 있거나 없는 hiPSC 유래 HLC, hPH 및 HepG2 세포의 전사체 프로파일을 마이크로 어레이로 분석하였다.
그 결과 도 11에 나타난 바와 같이, 주성분 분석(PCA; Principle component analysis)에서 세 가지 세포 유형이 전체적으로 뚜렷한 세포 특성을 보였으며, 처리 그룹이 아닌 세포 유형별로 그룹화되었다. 주성분(PC) 1 및 2는 일반적인 세포 과정에 관여하는 유전자를 포함하는 반면, 주성분(PC) 3은 3 가지 세포 유형에서 약물 대사와 관련된 유전자를 포함하였다(도 11).
BaP 처리에 의해 상향 조절된 상위 100 개의 유전자를 포함하는 유전자 온톨로지를 기반 기능 주석 분석 및 KEGG 경로 조사 결과, hiPSC-HLC 및 hPH에서 약물 대사 효소 관련 용어가 풍부해진 반면, HepG2 세포에서는 약물 대사 관련 용어가 증가되지 않는 것으로 나타났다(p < 0.05) (도 12a 내지 도 12c). 사이토크롬 P450 (KEGG- 경로: hsa00980)에 의한 이종 생물학의 대사에 포함된 유전자는 hiPSC-HLC 및 hPH에서 BaP 처리에 고도로 발현되고 반응하였다. 그러나, 이들 유전자는 HepG2 세포에서 BaP 처리 후 감소된 발현을 나타냈다(도 13a). 특히, 모든 AHR-반응성 유전자 (CYP1A1, CYP1A2 및 CYP1B1)는 hiPSC-HLC 및 hPH에서의 BaP 처리에 의해 향상되었으며, CYP1A2 및 CYP1B1은 HepG2에서의 BaP 처리에 의해 유도되지 않았다(도 13b).
상기와 같은 결과는 hiPSC-HLC가 hPH에 훨씬 더 가까우며, HepG2 세포보다 약물 대사 및 독성 시험에 대한 더 우수한 세포 모델을 나타낸다는 것을 의미한다.

Claims (14)

  1. 형광단백질로 표지된 사이토크롬 P450 (cytochrome P450)으로 형질전환된 것을 특징으로 하는 AHR(aryl hydrocarbon receptor) 조절제 스크리닝용 인간 유도만능 줄기세포주(human induced pluripotent stem cell line; hiPSC line).
  2. 제1항에 있어서,
    상기 인간 유도만능 줄기세포주는 수탁번호 KCTC 14186BP로 기탁된 것을 특징으로 하는, 인간 유도만능 줄기세포주.
  3. 제1항에 있어서, 상기 형광단백질은 녹색형광단백질(green fluorescence protein, GFP), 청색형광단백질(CFP), 황색형광단백질(YFP) 및 적색형광단백질(DsRed)로 구성된 군으로부터 선택되는 것을 특징으로 하는, 인간 유도만능 줄기세포주.
  4. 제1항에 있어서,
    상기 형광단백질은 mCherry인 것을 특징으로 하는, 인간 유도만능 줄기세포주.
  5. 제1항에 있어서,
    상기 사이토크롬 P450은 CYP1A1, CYP1A2 및 CYP1B1로 구성된 군으로부터 선택되는 것을 특징으로 하는, 인간 유도만능 줄기 세포주.
  6. 제1항에 있어서,
    상기 인간 유도만능 줄기세포주는 서열번호 1 내지 3으로 표시되는 유전자를 표적으로 하는 sgRNA로 mCherry를 삽입한 벡터로 형질감염하여 제조된 것을 특징으로 하는, 인간 유도만능 줄기세포주.
  7. 제1항에 있어서,
    상기 인간 유도만능 줄기세포주는 표적화 벡터로 pMCDT-A 벡터를 이용하여 형질감염하여 제조된 것을 특징으로 하는, 인간 유도만능 줄기세포주.
  8. 제1항에 있어서,
    상기 인간 유도만능 줄기세포주는 NANOG, OCT4, SOX2, TRA-1-60 및 TRA-1-81 마커가 발현되는 것을 특징으로 하는, 인간 유도만능 줄기세포주.
  9. 제1항에 있어서,
    상기 인간 유도만능 줄기세포주는 삼배엽으로 분화시 Pax6, Otx2, alpha-SMA, EOMES, Brachyury, FOXA2, GATA4 및 Sox17이 발현되는 것을 특징으로 하는, 인간 유도만능 줄기세포주.
  10. 1) 제1항의 형광단백질로 표지된 사이토크롬 P450 단백질(cytochrome P450)로 형질전환된 인간 유도만능 줄기세포주(human induced pluripotent stem cell line; hiPSC line)에 시험물질을 접촉시키는 단계;
    2) 상기 시험물질을 접촉한 형광단백질로 표지된 사이토크롬 P450 단백질로 형질전환된 인간 유도만능 줄기세포주에서 형광단백질의 신호 세기를 측정하는 단계; 및
    3) 대조구 시료와 비교하여 상기 형광단백질의 신호 세기가 변화된 시험물질을 선별하는 단계를 포함하는 AHR 조절제 스크리닝 방법.
  11. 제10항에 있어서,
    단계 3)의 대조구 시료는 BaP 또는 TCDD인 것을 특징으로 하는, AHR 조절제 스크리닝 방법.
  12. 제1항의 형광단백질로 표지된 사이토크롬 P450 단백질로 형질전환된 인간 유도만능 줄기세포주를 이용하여 대량분석시스템(High Content Screening; HCS)에서 수행하는 AHR 조절제 스크리닝 방법.
  13. 제12항에 있어서,
    상기 스크리닝 방법은 세포가 살아있는 상태에서 수행되는 것을 특징으로 하는, AHR 조절제 스크리닝 방법.
  14. 제10항 또는 제12항에 있어서,
    상기 AHR 조절제는 파파베린 하이드로클로라이드(papaverine hydrochloride), 노르디하이드로구아이아레트 산(nordihydroguaiaretic acid), 글라페닌(glafenine), 양오닌(yangonin) 및 데스메톡시양오닌(desmethoxyyangonin)으로 이루어지는 군에서 선택되는 어느 하나 이상인 것을 특징으로 하는, AHR 조절제 스크리닝 방법.
PCT/KR2021/003425 2020-06-19 2021-03-19 형광단백질로 표지된 사이토크롬 p450 으로 형질전환된 인간유도 만능줄기 세포주 및 이를 이용한 ahr 조절제 스크리닝 방법 WO2021256668A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN202180050975.3A CN116802272A (zh) 2020-06-19 2021-03-19 荧光蛋白标记的细胞色素p450转化的人诱导多能干细胞系以及使用其的ahr调节剂的筛选方法
US18/010,932 US20230235294A1 (en) 2020-06-19 2021-03-19 Human induced pluripotent stem cell line transformed with fluorescent protein-labeled cytochrome p450 and ahr modulator screening method using same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020200075214A KR102400211B1 (ko) 2020-06-19 2020-06-19 형광단백질로 표지된 사이토크롬 p450 으로 형질전환된 인간유도 만능줄기 세포주 및 이를 이용한 ahr 조절제 스크리닝 방법
KR10-2020-0075214 2020-06-19

Publications (1)

Publication Number Publication Date
WO2021256668A1 true WO2021256668A1 (ko) 2021-12-23

Family

ID=79178393

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/003425 WO2021256668A1 (ko) 2020-06-19 2021-03-19 형광단백질로 표지된 사이토크롬 p450 으로 형질전환된 인간유도 만능줄기 세포주 및 이를 이용한 ahr 조절제 스크리닝 방법

Country Status (4)

Country Link
US (1) US20230235294A1 (ko)
KR (1) KR102400211B1 (ko)
CN (1) CN116802272A (ko)
WO (1) WO2021256668A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024048820A1 (ko) * 2022-09-01 2024-03-07 서울대학교산학협력단 돼지 줄기세포 만능성 평가 시스템 및 이를 이용한 만능성 평가 방법

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20190092898A (ko) * 2018-01-31 2019-08-08 고려대학교 산학협력단 한국인 호발성 cyp 유전형을 포함하는 유도만능줄기세포주

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20190092898A (ko) * 2018-01-31 2019-08-08 고려대학교 산학협력단 한국인 호발성 cyp 유전형을 포함하는 유도만능줄기세포주

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
ANGELOS MATHEW G; RUH PAIGE N; WEBBER BEAU R; BLUM ROBERT H; RYAN CAITLIN D; BENDZICK LAURA; SHIM SEONHUI; YINGST ASHLEY M; TUFA D: "Aryl hydrocarbon receptor inhibition promotes hematolymphoid development from human pluripotent stem cells", BLOOD, vol. 129, no. 26, 29 June 2017 (2017-06-29), pages 3428 - 3439, XP086677990, ISSN: 0006-4971, DOI: 10.1182/blood-2016-07-730440 *
KIM HYEMIN, KIM JI-WOO, KIM SO-JIN, CHOI YOUNG-JUN, KIM DAE-SUNG, PARK HAN-JIN: "Generation of a PXR reporter human induced pluripotent stem cell line (PXR-mCherry hiPSC) using the CRISPR/Cas9 system", STEM CELL RESEARCH, vol. 26, 1 January 2018 (2018-01-01), pages 72 - 75, XP055881052, ISSN: 1873-5061, DOI: 10.1016/j.scr.2017.12.001 *
KIM JI‐WOO, IM ILKYUN, KIM HYEMIN, JEON JANG SU, KANG EUN‐HYE, JO SEONGYEA, CHUN HANG‐SUK, YOON SEOKJOO, KIM JONG‐HOON, KIM SANG K: "Live-cell screening platform using human-induced pluripotent stem cells expressing fluorescence-tagged cytochrome P450 1A1", THE FASEB JOURNAL, vol. 34, no. 7, 1 July 2020 (2020-07-01), pages 9141 - 9155, XP055881061, ISSN: 0892-6638, DOI: 10.1096/fj.201903110R *
NAGY S. R., SANBORN JAMES R, HAMMOCK BRUCE D, DENISON MICHAEL S: "Development of a Green Fluorescent Protein-Based Cell Bioassay for the Rapid and Inexpensive Detection and Characterization of Ah Receptor Agonists", TOXICOLOGICAL SCIENCES, vol. 65, no. 2, 1 February 2002 (2002-02-01), pages 200 - 210, XP055881046, DOI: 10.1093/toxsci/65.2.200 *
SMITH BRENDEN W., STANFORD ELIZABETH A., SHERR DAVID H., MURPHY GEORGE J.: "Genome Editing of the CYP1A1 Locus in iPSCs as a Platform to Map AHR Expression throughout Human Development", STEM CELLS INTERNATIONAL, vol. 2016, 2574152, 11 April 2016 (2016-04-11), pages 1 - 11, XP055881044, ISSN: 1687-966X, DOI: 10.1155/2016/2574152 *

Also Published As

Publication number Publication date
KR102400211B1 (ko) 2022-05-19
CN116802272A (zh) 2023-09-22
KR20210157208A (ko) 2021-12-28
US20230235294A1 (en) 2023-07-27

Similar Documents

Publication Publication Date Title
JP7379410B2 (ja) Ｈｌａ ｇ改変された細胞および方法
US20180071405A1 (en) Endonuclease targeting blood coagulation factor viii gene and composition for treating hemophilia comprising same
Sommer et al. Excision of reprogramming transgenes improves the differentiation potential of iPS cells generated with a single excisable vector
WO2016021972A1 (en) Immune-compatible cells created by nuclease-mediated editing of genes encoding hla
US20090280096A1 (en) Pancreatic endocrine progenitor cells derived from pluripotent stem cells
JP2015527084A (ja) 誘導肝細胞を作製するための方法及び組成物
WO2018190656A1 (ko) In vitro에서 성숙된 인간 장관 오가노이드의 제조 방법 및 이의 용도
WO2012115454A2 (ko) 뉴클레아제에 의해 유전자 변형된 세포를 농축시키는 방법
WO2021256668A1 (ko) 형광단백질로 표지된 사이토크롬 p450 으로 형질전환된 인간유도 만능줄기 세포주 및 이를 이용한 ahr 조절제 스크리닝 방법
Hu et al. ssODN-mediated in-frame deletion with CRISPR/Cas9 restores FVIII function in hemophilia A-patient-derived iPSCs and ECs
Kagiwada et al. YAP establishes epiblast responsiveness to inductive signals for germ cell fate
Kim et al. Live‐cell screening platform using human‐induced pluripotent stem cells expressing fluorescence‐tagged cytochrome P450 1A1
CN114685685B (zh) 编辑rna的融合蛋白及其应用
WO2022211604A1 (ko) Fe-fviii 변이 유전자로 교정된 줄기세포, 이로부터 분화된 내피 세포 및 이를 포함하는 혈우병 예방 또는 치료용 약제학적 조성물
Guo et al. Generation of an Abcc8 heterozygous mutation human embryonic stem cell line using CRISPR/Cas9
WO2020005011A1 (ko) 돌연변이 마우스 유래 췌장 오거노이드 및 표준화된 약물 효과 확인 방법
Wilken et al. Generation of a human Tropomyosin 1 knockout iPSC line
Yao et al. Generation of Dip2a homozygous knockout murine ES cell line IBMSe001-A-1 via CRISPR/Cas9 technology
Li et al. Generation of PARP1 gene knockout human embryonic stem cell line using CRISPR/Cas9
Zhang et al. Generation of RYBP FLAG-HA knock-in human embryonic stem cell line through CRISPR/Cas9-mediated homologous recombination
Alexeeva et al. A human H1-HBB11-GFP reporter embryonic stem cell line (WAe001-A-2) generated using TALEN-based genome editing
WO2020230976A1 (ko) 미분화 만능 줄기세포로부터 유전자 편집된 세포의 선별 방법
KR20200011817A (ko) 혈액 응고인자 ⅷ의 교정용 조성물 및 이를 이용한 방법
Liu et al. Generation of Rybp homozygous knockout murine ES cell line GIBHe001-A-1 by using CRISPR/Cas9 technology
Engels et al. Generation of a CFTR knock-in reporter cell line (MHHi006-A-1) from a human induced pluripotent stem cell line

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21826420

Country of ref document: EP

Kind code of ref document: A1

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 202180050975.3

Country of ref document: CN

122 Ep: pct application non-entry in european phase

Ref document number: 21826420

Country of ref document: EP

Kind code of ref document: A1