WO2022189363A1 - Antisense oligonucleotides for inhibiting alpha-synuclein expression - Google Patents

Antisense oligonucleotides for inhibiting alpha-synuclein expression Download PDF

Info

Publication number
WO2022189363A1
WO2022189363A1 PCT/EP2022/055770 EP2022055770W WO2022189363A1 WO 2022189363 A1 WO2022189363 A1 WO 2022189363A1 EP 2022055770 W EP2022055770 W EP 2022055770W WO 2022189363 A1 WO2022189363 A1 WO 2022189363A1
Authority
WO
WIPO (PCT)
Prior art keywords
mcds
ads
tds
oligonucleotide
seq
Prior art date
Application number
PCT/EP2022/055770
Other languages
English (en)
French (fr)
Inventor
Hélène TRAN
Benjamin CHANRION
Sofia LOTFI
Guillaume DAS DORES
Thierry Dorval
Raphaël GUIGNARD
Original Assignee
Les Laboratoires Servier
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Les Laboratoires Servier filed Critical Les Laboratoires Servier
Priority to EP22710115.1A priority Critical patent/EP4305168A1/en
Priority to IL305668A priority patent/IL305668A/en
Priority to CN202280033253.1A priority patent/CN117280032A/zh
Priority to CA3212650A priority patent/CA3212650A1/en
Priority to AU2022234522A priority patent/AU2022234522A1/en
Priority to PE2023002509A priority patent/PE20240696A1/es
Priority to MX2023010535A priority patent/MX2023010535A/es
Priority to JP2023554365A priority patent/JP2024508956A/ja
Publication of WO2022189363A1 publication Critical patent/WO2022189363A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/321—2'-O-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/323—Chemical structure of the sugar modified ring structure
    • C12N2310/3231—Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/341—Gapmers, i.e. of the type ===---===
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/346—Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/352—Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3525—MOE, methoxyethoxy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/10—Applications; Uses in screening processes
    • C12N2320/11—Applications; Uses in screening processes for the determination of target sites, i.e. of active nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/50—Methods for regulating/modulating their activity
    • C12N2320/53—Methods for regulating/modulating their activity reducing unwanted side-effects

Definitions

  • Alpha-synuclein is a protein encoded by the SNCA gene that is predominantly expressed in the central nervous system, including the neocortex, hippocampus, substantia nigra, thalamus, and cerebellum. In neurons, the expression of alpha-synuclein is localized at presynaptic terminals, and the protein is thought to be a chaperone involved in the assembly and function of the SNARE complex. At least three different isoforms of alpha-synuclein are known, which result from alternative splicing of the SNCA gene transcript. Alpha-synuclein may be involved in modulating many different neuronal functions and properties, including synaptic transmission, synaptic vesicle density, and neuronal plasticity.
  • alpha-synuclein aggregates and forms insoluble fibrils.
  • Alpha- synuclein aggregates are thought to be involved in the pathology of many different neurological diseases, including Parkinson’s disease, Lewy body dementia, Alzheimer’s disease, and multiple system atrophy.
  • the pathogenic role of alpha-synuclein in the progression of disease has been genetically validated. For example, missense mutations in the SNCA gene lead to rare familial Parkinson’s disease. Duplication or triplication of the wildtype gene can also cause rare cases of Parkinson’s disease, and the overexpression of wildtype alpha-synuclein protein alone has been demonstrated to be sufficient to cause disease.
  • MSA Multiple system atrophy
  • GCIs glial cytoplasmic inclusions
  • the alpha-synuclein protein can be found in tissues in several different forms, including as a monomer, oligomer, or fibrillary complex, and may be phosphorylated. It is currently unknown which of these protein species is causative in synucleinopathies. It is therefore challenging to know which form of the protein to target in order to develop drugs that treat synucleinopathies at the protein level.
  • the present disclosure provides antisense oligonucleotides (ASOs) that reduce the abundance or activity of RNA transcribed from the SNCA gene.
  • ASOs antisense oligonucleotides
  • the compounds of the present disclosure decrease the abundance of alpha-synuclein protein in the cell.
  • the ASOs described herein therefore reduce alpha-synuclein proteins, their accumulation and aggregates which might alleviate the symptoms and/or delay disease progression.
  • the present disclosure provides an oligonucleotide comprising a nucleotide sequence of 15 to 30 (e.g., 16 to 20) contiguous nucleotides, wherein the nucleotide sequence is complementary to a region of the same length found in nucleotides a) 16350-16450, b) 18926-19030, c) 22250-22471, d) 22933-23079, e) 23408-23700, f) 29753-29819, g) 38128-38158, h) 39852-39906, i) 53762-53799, or j) 59754-59865 of SEQ ID NO: 1.
  • the nucleotide sequence comprises no more than 3 mismatches to said region.
  • the nucleotide sequence may comprise 0, 1, or 2 mismatches to said region.
  • the nucleotide sequence is single- stranded.
  • the nucleotide sequence may be selected from, e.g., SEQ ID NOs: 18-40.
  • an oligonucleotide described herein may comprise one or more ribonucleotides, one or more deoxyribonucleotides, or a combination of both.
  • an oligonucleotide described herein may comprise one or more modified nucleotides.
  • modified nucleotides may comprise, e.g., a 2’-0- methoxy ethyl (2’ -MOE) nucleotide, a locked nucleic acid (LNA) nucleotide, a bridged nucleic acid (BNA) nucleotide, or any combination thereof.
  • all cytosines in an oligonucleotide described herein are 5- methyl cytosines.
  • an oligonucleotide described herein may comprise phosphodiester internucleoside linkages and/or phosphorothioate internucleoside linkages.
  • the oligonucleotide may comprise at least 1, 2, 3, 4, or 5 phosphodiester internucleoside linkages.
  • at least 1, 2, 3, 4, or 5, or all intemucleoside linkages in the oligonucleotide are phosphorothioate internucleoside linkages.
  • an oligonucleotide described herein comprises: i) a 5-10-5 MOE gapmer; ii) a 4-10-4 MOE gapmer; iii) a 3-10-3 LNA gapmer; iv) a 3 - 11 -3 LNA gapmer; v) a 3-2-10-2-3 LNA/MOE gapmer; vi) a 2-3-10-3-2 BNA/MOE gapmer; vii) a 3-2-10-2-3 BNA/MOE gapmer; or viii) a 2-3-10-3-2 LNA/MOE gapmer.
  • the oligonucleotide comprises: i) a 3-2-10-2-3 LNA/MOE gapmer; ii) a 2-3-10-3-2 BNA/MOE gapmer; iii) a 3-2-10-2-3 BNA/MOE gapmer; or iv) a 2-3-10-3-2 LNA/MOE gapmer; wherein the intemucleoside linkages between nucleosides v) 2 and 3, 4 and 5, 16 and 17, and 18 and 19; vi) 2 and 3, 4 and 5, and 16 and 17; vii) 2 and 3, 3 and 4, 4 and 5, 16 and 17 and 17 and 18; or viii) 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester intemucleoside linkages; and the remainder of the internucleoside linkages are phosphorothioate intemucleoside linkages.
  • an oligonucleotide described herein comprises the following formula: i) Als Tlo mCls Aeo mCes mCds Tds Tds mCds Ads Ads Ads mCds mCds mCds mCeo Tes Tlo Tls mCl (SEQ ID NO: 34), ii) Abs Tbs mCeo Aeo mCes mCds Tds Tds mCds Ads Ads Ads mCds mCds mCds mCeo Teo Tes Tbs mCb (SEQ ID NO: 20), iii) Als Alo Tls Aeo Ges mCds Ads Tds mCds mCds Tds Tds mCds mCds Ads mCeo Aes mC
  • A is adenine
  • mC is a 5 -methyl cytosine
  • G is guanine
  • T is thymine
  • e is a 2’-MOE modified ribose
  • d is a 2’-deoxyribose
  • b is a BNA
  • 1 is an LNA
  • o is a phosphodiester internucleoside linkage
  • s is a phosphorothioate internucleoside linkage.
  • the present disclosure provides an oligonucleotide comprising the structural formula: [0017] In some embodiments, the present disclosure provides an oligonucleotide comprising the structural formula:
  • the present disclosure provides an oligonucleotide comprising the structural formula:
  • the present disclosure provides an oligonucleotide comprising the structural formula:
  • the present disclosure also provides an oligonucleotide conjugate comprising an oligonucleotide described herein.
  • the present disclosure provides a pharmaceutical composition
  • a pharmaceutical composition comprising an oligonucleotide described herein or an oligonucleotide conjugate as described herein, and a pharmaceutically acceptable excipient.
  • a method of reducing alpha-synuclein expression in a mammalian cell comprising contacting the cell with an oligonucleotide, oligonucleotide conjugate, or pharmaceutical composition described herein, thereby reducing alpha-synuclein expression in the cell.
  • the cell is a central nervous system cell, such as a cell in the human brain.
  • the present disclosure provides a method for treating a synucleinopathy in a subject in need thereof, comprising administering a therapeutically effective amount of an oligonucleotide, oligonucleotide conjugate, or pharmaceutical composition described herein to the subject.
  • the synucleinopathy is Parkinson’s disease, Lewy body dementia, Alzheimer’s disease, or multiple system atrophy.
  • the oligonucleotide may be, e.g., injected intrathecally or intracranially to the subject.
  • the oligonucleotide reduces SNCA mRNA levels by at least 25, 50, 75, or 80% in murine primary cortical neurons engineered to express human alpha-synuclein.
  • any of the oligonucleotides, oligonucleotide conjugates, and pharmaceutical compositions described herein may be used in any method of treatment as described herein, may be for use in any treatment as described herein, and/or may be for use in the manufacture of a medicament for any treatment as described herein.
  • FIG. l is a diagram illustrating the knock-in of the human SNCA gene at the endogenous mouse SNCA locus in an hSNCA mouse model ⁇ hSNCA +!+ ).
  • the level of alpha-synuclein protein was assessed by mass spectrometry and normalized against the level of GADPH protein.
  • the level of alpha-synuclein protein was assessed by mass spectrometry and normalized against the level of GADPH protein.
  • FIG. 3 is a table showing the tolerability scoring system for mice utilized in the in vivo assays described herein.
  • FIG. 4 is a bar graph showing the efficacy and tolerability of the given ASO in mice.
  • the left Y axis and solid bars depict the expression level of SNCA mRNA expressed in mouse neurons in vivo two weeks after treatment with the given ASO relative to PBS treated samples.
  • the right Y axis and black circles depict the functional observational battery (FOB) absolute score observed in mice one hour after treatment with the given ASO.
  • FOB functional observational battery
  • FIG. 5 is a bar graph showing the efficacy and tolerability of the given 3LNA- 2MOE-10DNA-2MOE-3LNA gapmer ASO. Axes are as described in FIG. 4.
  • FIG. 6 is a bar graph showing the efficacy and tolerability of the given 2BNA- 3MOE-10DNA-3MOE-2BNA gapmer ASO. Axes are as described in FIG. 4.
  • FIG. 7 is a bar graph showing the efficacy of SNCA_ASO_1613
  • SNC A_ASO_l 617 and SNCA_ASO_1625 at doses of 1, 5, 10, 30 and 100 nmol.
  • the left Y axis and solid bars depict the expression level of SNCA mRNA expressed in mouse neurons in vivo four weeks after treatment with the given ASO relative to PBS treated samples.
  • FIG. 8 is a bar graph showing the efficacy of SNCA_ASO_1613
  • SNC A_ASO_l 617 and SNCA_ASO_1625 at doses of 1, 5, 10, 30 and 100 nmol.
  • the left Y axis and solid bars depict the expression level of alpha synuclein protein expressed in mouse neurons in vivo four weeks after treatment with the given ASO relative to PBS treated samples.
  • FIG. 9 is a dot graph showing the concentration of SNCA AS0 1613
  • FIG. 10 is a table showing the tolerability scoring system for rats utilized in the in vivo assays described herein.
  • FIG. 11 is a dot graph comparing SNCA_ASO_01617 and SNCA_ASO_01613 at doses of 10 nmol and 50 nmol in the cortex based on SNCA mRNA expression quantified by qRT-PCR.
  • FIG. 12 is a dot graph a dots graph comparing SNCA ASO 01617 and SNCA ASO 01613 at doses of 10 nmol and 50 nmol in the cerebellum based on SNCA mRNA expression quantified by qRT-PCR.
  • FIG. 13 is a dot graph that compares the SNCA ASO 01617 and SNCA_ASO_01613 at doses of 10 nmol and 50 nmol in the striatum based on SNCA mRNA expression quantified by qRT-PCR as described above.
  • FIG. 14 is a diagram illustrating the experimental protocol for the measurement of alpha-synuclein pathology in neuronal culture treated with ASO.
  • FIG. 15 is a bar graph that shows the level of alpha-synuclein pathology (phosphorylated form) in primary neuronal culture treated with SNCA ASO 01613,
  • FIG.16 is a bar graph that shows the level of alpha-synuclein pathology (phosphorylated form) in primary neuronal culture treated with SNCA ASO 01613 before, during and after PFF treatment and measured by using a TR-FRET based immunoassay (mean ⁇ SEM).
  • PFFs human alpha-synuclein preformed fibrils.
  • the present disclosure is based on the discovery that antisense oligonucleotides (ASOs) targeting RNAs transcribed from the SNCA gene can effectively reduce the abundance of target SNCA gene transcripts and/or translation of the alpha-synuclein polypeptide from the transcripts.
  • ASOs of the present disclosure comprise sequences that are complementary to SNCA transcripts and bind to defined nucleotide sequences within the transcripts.
  • the ASO mediates a decrease in the expression and accumulation of the alpha-synuclein protein in the cell, alleviating the severity or progression of neurodegenerative diseases.
  • the ASOs of the present disclosure are expected to be particularly useful in the treatment of synucleinopathies, which are caused by the accumulation or aggregation of the alpha- synuclein protein.
  • This protein can be expressed in cells as, e.g., a monomer or an oligomer, and may be phosphorylated or unphosphorylated.
  • the ASOs of the present disclosure are highly advantageous in that they target alpha-synuclein expression at the SNCA transcript level and thus have the ability to decrease expression of all of the above forms of the alpha-synuclein protein.
  • the ASOs of the present disclosure bind to transcripts of the SNCA gene, which encodes the alpha-synuclein protein also named SNCA protein.
  • the SNCA gene is also known as alpha-synuclein, NACP, nonA-beta component of AD amyloid, PARK1, PARK4 , or PDI gene.
  • an ASO described herein targets a transcript of a mammalian SNCA gene (e.g., a murine or human SNCA gene).
  • the sequence for the human SNCA gene is publicly available under GenBank Accession Number NC_000004.12. The gene is 137,980 bps in length and located at chromosome 4:89700345..89838324 (SEQ ID NO: 2). A portion of the human genomic SNCA sequence is shown in SEQ ID NO: 1, and a partial sequence for the pre-mRNA transcript can be found at GenBank AccessionNumberNG_011851.1 (residues 6001-8400). A mature mRNA transcript is shown in SEQ ID NO: 3.
  • an ASO of the present disclosure binds to an SNCA sequence, or a transcript thereof, selected from Chromosome 4: 89,700,345-89,838,315 (reverse strand) and those under GenBank Accession Numbers NM_000345.3, NT_016354.20 TRUNC 30800000-30919000, JN709863.1, BC013293.2, NM 001146055.1, HQ830269.1, and NC_000004.12 (89724099..89838324, complement).
  • an ASO of the present disclosure binds to an SNCA transcript that encodes an alpha-synuclein protein, e.g., as found under UniProt Accession Number P37840, A8K2A4, Q13701, Q4JHI3, or Q6IAU6.
  • an ASO of the present disclosure comprises a sequence that may be at least 60, 70, 80, 85, 90, or 95%, or 100% complementary to a same-length sequence in the target SNCA transcript.
  • an ASO of the present disclosure can bind to a transcript of a wildtype SNCA gene (e.g., a wildtype human, non-human primate, or murine gene).
  • a wildtype SNCA gene e.g., a wildtype human, non-human primate, or murine gene.
  • an ASO of the present disclosure binds to a variant, such as a known variant, of the wildtype SNCA gene.
  • Known variants include, for example, a version of the human SNCA gene in which a G209A substitution results in an A53T mutation in the alpha- synuclein protein encoded from that gene. Additional known variants have nucleotide mutations giving rise to mutant alpha-synuclein proteins comprising A30P, E46K, H50Q, and G51D amino acid substitutions.
  • an ASO described herein may reduce or inhibit expression of an SNCA transcript encoding an alpha-synuclein protein with one or more mutations selected from A30P, E46K, H50Q, G51D, and A53T.
  • the present ASOs comprise sequences that are complementary to a same-length sequence in a target transcript encoded by the SNCA gene (wherein the genomic SNCA sequence may comprise, e.g., SEQ ID NO: 1).
  • an ASO described herein comprises a sequence that is complementary to a sequence in a hotspot region within the target SNCA nucleic acid.
  • the term “hotspot region” refers to a region of the target nucleotide sequence wherein binding of a sequence within the region by a complementary ASO tends to result in a reduction in the abundance or translational activity of the target RNA transcript.
  • a hotspot region may be entirely within an intron, entirely within an exon, or may span an intron/exon junction; or be located in whole or in part in the 5’ or 3’ untranslated region (UTR) of an RNA transcript.
  • an ASO described herein may comprise a sequence that binds to a target sequence within or overlapping with any of several different hotspot regions of the SNCA gene transcript.
  • Table A lists exemplary hotspots in the human SNCA gene and identifies ASOs of the present disclosure that are designed to be complementary to them.
  • the table also shows the minimum reduction in the SNCA gene transcript observed in vitro when neurons from a humanized SNCA knock-in mouse are treated with the selected ASOs targeting this hotspot (see, e.g., the section titled “Materials and Methods of in vitro Assays” below).
  • compounds are referred to interchangeably as SNCA_ASO_[compound number] and as [compound number].
  • compound number SNCA AS0 01608 and compound number 01608 represent the same antisense oligonucleotide compound.
  • binding of a sequence in a hotspot region by an ASO described herein reduces SNCA RNA levels by at least 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, or 100% in a cell (e.g., in an in vitro assay such as the one described below in the section titled “Materials and Methods of in vitro Assays”).
  • an ASO of the present disclosure may be an ASO listed in Table A, or an ASO with a sequence at least 80%, 85%, 90%, 95%, 96%, 97%,
  • ASO antisense oligonucleotide
  • ASO refers to an oligonucleotide capable of hybridizing to a sequence in a target transcript. It is understood by a person skilled in the art that the ASOs described herein do not occur in nature (i.e., they are “isolated” ASOs).
  • RNA transcript refers to any RNA transcribed from a gene (e.g., an SNCA gene).
  • the gene may be wildtype or may be a mutated or variant (e.g., polymorphic) form.
  • An RNA transcript may be a primary RNA transcript or precursor messenger RNA (pre- mRNA), or a messenger RNA (mRNA), and may include exons, introns, 5’ UTRs and 3’ UTRs. Unless otherwise indicated, the sequences of transcripts and ASOs provided herein denote the nucleotide sequence from 5’ end (left) to 3’ end (right).
  • oligonucleotide refers to a compound comprising a strand of about 5 to 100 nucleosides, e.g., 5 to 50 nucleosides, e.g., 8 to 30 nucleosides, connected via internucleoside linkages.
  • Each nucleoside and internucleoside linkage of an oligonucleotide of the present disclosure may be modified or unmodified from naturally occurring nucleotides and linkages.
  • a modified oligonucleotide may comprise one or more modified sugar moieties, one or more modified nucleobases, and/or one or more modified intemucleoside linkages.
  • An ASO described herein may comprise a sequence that is substantially or fully complementary to a same-length sequence in the target transcript. Full complementarity occurs when a first strand of contiguous nucleotides (modified or unmodified) and a second strand of contiguous nucleotides (modified or unmodified) are completely complementary to each other over the entire length of the shorter strand (or both strands, if they are of the same length).
  • the two strands are considered substantially complementary to each other when they base-pair with each other over 80% or more (e.g., 90% or more) over the length of the shorter strand (or both strands, if they are of the same length), with no more than 20% (e.g., no more than 10%) of mismatching base-pairs (e.g., for a duplex of 20 nucleotides, no more than 4 or no more than 2 mismatched base-pairs).
  • a sequence in an ASO of the present disclosure is 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a target RNA transcript.
  • the present ASO comprises no more than 1, 2, or 3 mismatches to its target sequence.
  • nucleobases refers to identical nucleobases.
  • percent identity in this context refers to the percentage of nucleobases that are the same when the two comparing sequences are aligned (introducing gaps, if necessary) for maximum correspondence, over the length of the shorter comparing sequence (or both sequences, if the comparing sequences are of the same length).
  • reduced, inhibited, or abrogated expression or activity of the target transcript is observed compared to a control sample not treated with the ASO.
  • an ASO of the present disclosure reduces the abundance and/or translational activity of the target SNCA transcript in a treated sample, e.g., by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% compared to a control sample not exposed to the ASO.
  • the ASO reduces the level of the target transcript in vivo by said percentage, and administration of the ASO optionally results in a tolerability score (Functional Observational Battery or FOB score) of less than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1, e.g., 0.
  • the terms “reduce” and “inhibit” do not necessarily mean a total elimination of the entire amount and/or activity of the transcript.
  • ASOs are considered to be active when they reduce the amount or activity of the target RNA by 25% or more in an in vitro assay.
  • the present ASO may cause a detectable or measurable change in the level or activity of the alpha-synuclein protein encoded by the target RNA.
  • ASOs may inhibit expression of alpha-synuclein by recruiting an RNase HI enzyme to the duplex formed between an ASO and the target SNCA transcript.
  • Enzymes of the RNase HI family are endonucleases that typically target RNA:DNA duplexes and catalyze the hydrolytic cleavage of the RNA in the duplex.
  • the ASO has minimal off-target effects, and does not hybridize to any non -SNCA transcript in a way that results in significant reduction in the abundance or activity of the non -SNCA transcript.
  • the present ASOs are between 8 and 30 nucleotides in length (e.g., 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length).
  • an ASO described herein can comprise a sequence, complementary to a same-length SNCA transcript sequence, that is any of a range of nucleotide lengths having an upper limit of 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 and an independently selected lower limit of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20
  • the complementary sequence in the ASO is between 16 and 20 nucleotides in length. In particular embodiments, the complementary sequence in the ASO is 16, 17, 18, or 20 nucleobases in length.
  • the ASOs of the present disclosure may comprise one or more modifications, e.g., to increase binding affinity to the target transcript, increase ASO stability (e.g., increase resistance to degradation, e.g., by nucleases), and/or increase ease of ASO transport into the cell.
  • Modifications may include any modification known in the art, including, for example, end modifications, nucleobase modifications, sugar modifications or replacements, and backbone modifications. End modifications may include, for example, 5’ and/or 3’ end modifications (e.g., phosphorylation, conjugation, DNA nucleotides, and inverted linkages).
  • Base modifications may include, e.g., replacement with stabilizing bases, removal of bases, or conjugated bases.
  • Sugar modifications or replacements may include, e.g., modifications at the T and/or 4’ position of the ribose moiety, or replacement of the ribose moiety.
  • Backbone modifications or internucleoside linkage modifications may include, for example, modification or replacement of phosphodiester linkages, e.g., with one or more phosphorothioates, phosphorodithioates, phosphotriesters, methyl and other alkyl phosphonates, phosphinates, and phosphoramidates.
  • the present ASOs may have one or more modified nucleosides.
  • nucleoside refers to a compound comprising a nucleobase and a sugar moiety.
  • Naturally occurring nucleosides include DNA and RNA nucleosides.
  • a non-naturally occurring nucleoside also referred to as a “modified nucleoside” or a “nucleoside analog”
  • the base and/or the sugar have been modified.
  • the modification of the nucleoside may be “silent,” in which case the modified nucleoside has the same or equivalent function in the context of the oligonucleotide compared to a naturally occurring nucleoside.
  • a modified nucleoside may increase the efficacy of the ASO in decreasing the abundance or activity of a target transcript.
  • efficacy encompasses the target engagement on SNCA mRNA.
  • nucleotide refers to a nucleoside covalently bonded to one or more modified or unmodified internucleoside linkages.
  • exemplary nucleotides include monophosphates, diphosphates, triphosphates, and thiophosphates.
  • nucleotide encompasses unmodified nucleotides (i.e., naturally occurring nucleotides) and modified nucleotides (i.e., nucleotide analogs).
  • nucleoside encompasses unmodified nucleosides (i.e., naturally occurring nucleosides) and modified nucleosides (i.e., nucleoside analogs); and the term “nucleobases” encompasses unmodified nucleobases (i.e., naturally occurring nucleobases) and modified nucleobases (i.e., nucleobase analogs).
  • a modified nucleoside comprises a modified nucleobase.
  • the modified nucleobase is a 5-methyl cytosine (5mC) nucleobase, as shown in the structure (I) below, wherein R represents the sugar moiety.
  • 5mC 5-methyl cytosine
  • a sugar moiety can be a modified or an unmodified sugar moiety.
  • an unmodified sugar moiety refers to a 2’-OH(H) ribosyl moiety as found in naturally occurring RNA, also referred to as an unmodified RNA sugar moiety.
  • a modified sugar moiety may be a 2’-H(H) deoxyribose sugar moiety. This moiety is found naturally in deoxyribonucleic acids, and may be referred to as an unmodified DNA sugar moiety or simply a DNA sugar moiety.
  • a modified sugar moiety may comprise an O-methoxyethyl (MOE) moiety.
  • MOE O-methoxyethyl
  • the O-methoxyethyl moiety is at the T position of the sugar, as shown in the structure below (III).
  • R in the structure below represents a nucleobase.
  • Each of the 5’ -hydroxyl and 3’ -hydroxyl groups of the sugar is optionally involved in internucleoside linkages.
  • a T -MOE modified sugar or T -MOE modified nucleoside, or simply an MOE sugar or nucleoside, is a ribose or nucleoside in which the T hydroxyl group that naturally occurs in the ribose is replaced with a 2OCH 2 CH 2 OCH 3 group.
  • a modified sugar moiety may comprise a bridged nucleic acid (BNA) moiety.
  • a bridged nucleic acid comprises a bicyclic sugar moiety.
  • the sugar moiety comprises a 4’-CH 2 -NH-0-2’ linkage.
  • the nitrogen of the bridged nucleic acid is optionally substituted (e.g., methylated, alkylated, or modified with a phenyl group).
  • the structure of a BNA moiety is shown below (IV), wherein R is a nucleobase, R’ is, for example, an H, Me, or Phenyl group, and each of the 5’ -hydroxyl and 3’ -hydroxyl groups of the sugar is optionally involved in internucleoside linkages. In the present ASOs, R’ is an Me group, unless otherwise specified.
  • a BNA modified nucleoside, or simply a BNA nucleoside is a nucleoside comprising a BNA sugar moiety.
  • a modified sugar moiety may comprise a locked nucleic acid (LNA) moiety.
  • a locked nucleic acid comprises a bicyclic sugar moiety.
  • the sugar moiety comprises a 4’-CH 2 -0-2’ linkage.
  • An LNA moiety, as described herein, may be in the alpha-L configuration or the beta-D configuration.
  • LNA moieties in the ASOs described herein are in the beta-D configuration.
  • the structure of an LNA moiety is shown below (V), wherein R is a nucleobase and each of the 5’ -hydroxyl and 3’ -hydroxyl groups of the sugar is optionally involved in intemucleoside linkages.
  • An LNA modified nucleoside, or simply an LNA nucleoside is a nucleoside comprising an LNA sugar moiety.
  • an ASO described herein may include one or more modified nucleotides known in the art, including, e.g., 2’-0-methyl modified nucleotides, T - fluoro modified nucleotides, 2’-deoxy modified nucleotides, T -O-m ethoxy ethyl modified nucleotides, modified nucleotides allowing for alternative intemucleoside linkages (e.g., nucleotides comprising thiophosphates, phosphorothioates, and phosphotriesters), modified nucleotides terminally linked to a cholesterol derivative or lipophilic moiety, peptide nucleic acids, inverted deoxy or dideoxy modified nucleotides, abasic modifications of nucleotides, T -amino modified nucleotides, phosphoramidate modified nucleotides, modified nucleotides comprising modifications at other sites of the sugar or base of an oligonucle
  • nucleosides in the ASO are modified nucleosides. In other embodiments, less than 100% of the nucleosides in the ASO (e.g., less than 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, or 10%) are modified nucleosides.
  • the ASOs of the present disclosure may comprise naturally-occurring and/or non- naturally-occurring internucleoside linkages.
  • the term “internucleoside linkage,” as used in the present disclosure, refers to a covalent linkage between adjacent nucleosides in an oligonucleotide.
  • an ASO described herein may include one or more modified nucleoside linkages known in the art, including, e.g., a phosphonoacetate (PACE, P(CR’R”) n COOR) or thiophosphonoacetate (thioPACE, (S)-P(CR’R”) n COOR) internucleoside linkage, wherein n is an integer from 0 to 6 and each of R’ and R” is independently selected from the group consisting of H, an alkyl and substituted alkyl.
  • PACE phosphonoacetate
  • S thiophosphonoacetate
  • the intemucleoside linkage of a nucleotide may be a phosphate group or a thiophosphate group. Methods of preparation of phosphorous- containing intemucleoside linkages are well known to those skilled in the art.
  • the ASOs described herein may have phosphodiester intemucleoside linkages, phosphorothioate intemucleoside linkages, or a combination thereof.
  • phosphodiester intemucleoside linkage refers to an intemucleoside linkage between two nucleosides formed by a phosphodiester group.
  • phosphorothioate internucleoside linkage refers to a modified internucleoside linkage in which one of the non-bridging oxygen atoms of the phosphodiester internucleoside linkage is replaced with a sulfur atom.
  • internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or can be prepared as separate enantiomers.
  • Representative intemucleoside linkages having a chiral center include, but are not limited to, alkylphosphonates and phosphorothioates.
  • ASOs of the present disclosure comprising intemucleoside linkages having one or more chiral center(s) can be prepared as populations of ASOs comprising stereorandom intemucleoside linkages, or as populations of ASOs comprising stereodefmed intemucleoside linkages.
  • stereodefmed intemucleoside linkage refers to an intemucleoside linkage in which the stereochemical designation of the phosphorus atom is controlled such that a specific amount of R p or S p of the intemucleoside linkage is present within an ASO strand.
  • the stereochemical designation of a chiral linkage can be defined by, for example, asymmetric synthesis.
  • An ASO having at least one stereodefmed intemucleoside linkage can be referred to as a stereodefmed ASO.
  • the present ASOs are fully stereodefmed.
  • the term “fully stereodefmed ASO,” as used in the present disclosure, refers to an ASO sequence having a defined chiral center (R p or S p ) in each intemucleoside linkage in the ASO.
  • the term “partially stereodefmed ASO,” as used in the present disclosure, refers to an ASO sequence having a defined chiral center (R p or S p ) in at least one intemucleoside linkage, but not in all of the intemucleoside linkages of the ASO. Therefore, a partially stereodefmed ASO can include linkages that are achiral or non-stereodefmed in addition to at least one stereodefmed linkage.
  • populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate intemucleoside linkages in a particular stereochemical configuration.
  • the particular configuration of the particular phosphorothioate linkage is present in at least 65%, 70%, 80%, 90%, or 99% of the molecules in the population.
  • Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art such as, for example, the methods described in Oka et ah, JACS (2003) 125:8307, Wan et ah, Nuc. Acid. Res.
  • chiral internucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.
  • ASO conjugates antisense oligonucleotide conjugates comprising one or more ASOs described herein.
  • ASO conjugate refers to an oligomeric compound comprising an antisense oligonucleotide that is covalently linked to one or more non-nucleotide moieties (conjugate moieties). Conjugation of an oligonucleotide to one or more conjugate moieties may improve the pharmacology or pharmacokinetic properties of the ASO.
  • the conjugate moiety may affect the activity, cellular distribution, cellular uptake, binding, absorption, tissue distribution, cellular distribution, charge, clearance, bioavailability, metabolism, excretion, permeability, and/or or stability of the ASO.
  • the conjugate moiety may help target the ASO to a specific region in the central nervous system.
  • the conjugate moiety may be a carbohydrate, a peptide (e.g., a cell surface receptor ligand), and/or a lipid (e.g., phospholipid).
  • PCT Patent Publications WO 1993/07883 and WO 2013/033230 provide suitable conjugate moieties for use with the ASOs of the present disclosure.
  • Certain conjugate groups and conjugate moieties have been described previously, for example, in the following references: thioether moiety, e.g., hexyl-S-tritylthiol (Manoharan et ah, Ann. NY. Acad. Sci. (1992) 660:306-309; Manoharan et ah, Bioorg. Med. Chem. Lett.
  • phospholipid e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac- glycero-3-H-phosphonate (Manoharan et ah, Tetrahedron Lett. (1995) 36:3651-4; Shea et ah, Nucl. Acids Res.
  • conjugation of an ASO of the present disclosure to a lipophilic moiety may increase the delivery of the ASO to cells of the central nervous system.
  • lipophilic moiety broadly refers to any compound or chemical moiety having an affinity for lipids.
  • the lipophilic moiety may generally comprise a saturated or unsaturated hydrocarbon chain, which may be cyclic or acyclic.
  • the hydrocarbon chain may comprise various substituents and/or one or more heteroatoms, such as an oxygen or a nitrogen atom.
  • the lipophilic moiety is a(n) aliphatic, cyclic, alicyclic, polycyclic, aromatic, or polyalicyclic compound.
  • the lipophilic moiety is a steroid (e.g., sterol).
  • Steroids include, without limitation, bile acids (e.g., cholic acid, deoxycholic acid and dehydrocholic acid), cortisone, digoxigenin, testosterone, cholesterol, and cationic steroids, such as cortisone.
  • cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA (1989) 86:6553-6), cholic acid moiety (Manoharan et al., Bioorg. Med. Chem. Lett. (1994) 4:1053-60), thiochole sterol moiety (Oberhauser et al., Nucl. Acids Res. (1992) 20:533-8), aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison- Behmoaras et al., EMBO J.
  • A is an adenine nucleobase
  • G is a guanine nucleobase
  • T is a thymine nucleobase
  • mC is a 5-methyl cytosine nucleobase
  • e is a 2’-MOE modified sugar
  • d is a 2’-deoxyribose sugar
  • 1 is a locked nucleic acid
  • b is a bridged nucleic acid
  • o is a phosphodiester intemucleoside linkage
  • s is a phosphorothioate intemucleoside linkage.
  • the ASOs of the present disclosure are gapmers.
  • the term “gapmer,” as used in the present disclosure, refers to an oligonucleotide comprising or consisting of an internal region positioned between two external regions, wherein the sugar moieties of the nucleosides comprising the internal region are chemically distinct from the sugar moieties of the nucleosides comprising the external region.
  • the term “gap” refers to the internal region of the oligonucleotide, while the term “wing” refers to the external regions.
  • a gapmer has a 5’ -wing, a gap, and a 3’ -wing. The three regions form a contiguous sequence.
  • each of the wing nucleosides differ from at least some of the sugar moieties of the gap nucleosides.
  • the nucleosides of the gap region of the ASOs of the present disclosure comprise entirely 2’-deoxyriboxyl nucleosides.
  • a gapmer may comprise one or more modified intemucleoside linkages and/or modified nucleobases that do not necessarily follow the gapmer pattern of sugar modifications.
  • the oligonucleotides of the present disclosure are gapmers that comprise MOE, BNA, LNA, or DNA modifications, or any combination thereof.
  • the gapmers comprise MOE, DNA, and BNA, MOE, DNA, and LNA, or BNA, DNA, and LNA modified sugar moieties.
  • the intemucleoside linkages between the oligonucleosides are phosphodiester or phosphorothioate intemucleoside linkages, or a combination thereof.
  • the lengths of the three gapmer regions may be notated using the notation [# of nucleosides in the 5’ wing]-[number of nucleosides in the gap]-[number of nucleosides in the 3’ wing].
  • a 4-10-4 gapmer comprises 4 linked nucleosides in each wing and 10 linked nucleosides in the gap.
  • an ASO of the present disclosure is a 3-10-3 LNA gapmer.
  • 3-10-3 LNA gapmers are 16 nucleobases in length, wherein the central gap segment comprises ten T - deoxynucleosides and each of the 5’ and 3’ wing segments comprises three LNA nucleosides.
  • all cytosine nucleobases throughout the 3-10-3 LNA gapmer are 5-methyl cytosines.
  • all intemucleoside linkages are phosphorothioate intemucleoside linkages.
  • an ASO of the present disclosure is a 3-11-3 LNA gapmer.
  • 3-11-3 LNA gapmers are 17 nucleobases in length, wherein the central gap segment comprises 11 2’- deoxynucleosides and each of the 5’ and 3’ wing segments comprises three LNA nucleosides.
  • all cytosine nucleobases throughout the 3-11-3 LNA gapmer are 5-methyl cytosines.
  • all intemucleoside linkages are phosphorothioate intemucleoside linkages.
  • an ASO of the present disclosure is a 4-10-4 MOE gapmer.
  • 4-10-4 gapmers are 18 nucleobases in length, wherein the central gap segment comprises ten T- deoxynucleosides and each of the 5’ and 3’ wing segments comprises four T -MOE nucleosides.
  • all cytosine nucleobases throughout the 4-10-4 MOE gapmer are 5-methyl cytosines.
  • all intemucleoside linkages are phosphorothioate intemucleoside linkages.
  • an ASO of the present disclosure is a 5-10-5 MOE gapmer.
  • 5-10-5 gapmers are 20 nucleobases in length, wherein the central gap segment comprises ten T -deoxynucleosides and is flanked by wing segments on both 5’ and 3’ end comprising five 2’-MOE nucleosides.
  • all cytosine nucleobases throughout the 5-10-5 MOE gapmer are 5-methyl cytosines.
  • all internucleoside linkages are phosphorothioate internucleoside linkages.
  • an ASO of the present disclosure is a 3LNA-2MOE- 10DNA-2MOE-3LNA gapmer, wherein each of the nucleosides at positions 1, 2, 3, 18, 19, and 20 of the oligonucleotide comprise an LNA modification, each of nucleosides at positions 4, 5, 16, and 17 of the oligonucleotide comprise a T -MOE modification, and each of the nucleosides at positions 6-15 are 2’-deoxynucleosides.
  • all internucleoside linkages are phosphodiester intemucleoside linkages.
  • the intemucleoside linkages between the nucleosides at positions 2 and 3, 4 and 5, 16 and 17 and 18 and 19 are phosphodiester intemucleoside linkages. In some embodiments, the intemucleoside linkages between the nucleosides at positions 2 and 3, 4 and 5, and 16 and 17 are phosphodiester intemucleoside linkages. In some embodiments, the intemucleoside linkages between the nucleosides at positions 2 and 3, 3 and 4, 4 and 5, 16 and 17 and 17 and 18 are phosphodiester intemucleoside linkages.
  • the intemucleoside linkages between the nucleosides at positions 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester intemucleoside linkages. In some embodiments, the remainder of the intemucleoside linkages are phosphorothioate intemucleoside linkages. In some embodiments, each cytosine nucleobase is a 5-methyl cytosine.
  • an ASO of the present disclosure is a 2BNA-3MOE- 10DNA-3MOE-2BNA gapmer, wherein each of nucleosides at positions 1, 2, 19, and 20 comprise a BNA modification, each of the nucleosides at positions 3, 4, 5, 16, 17, and 18 comprise a 2’-MOE modification, and each of the nucleosides at positions 6-15 are T - deoxynucleosides.
  • the intemucleoside linkages between the nucleosides at positions 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester intemucleoside linkages.
  • the intemucleoside linkages between the nucleosides at positions 2 and 3, 4 and 5, and 16 and 17 are phosphodiester intemucleoside linkages. In some embodiments, the intemucleoside linkages between the nucleosides at positions 2 and 3, 3 and 4, 4 and 5, 16 and 17 and 17 and 18 are phosphodiester intemucleoside linkages. In some embodiments, the intemucleoside linkages between the nucleosides at positions 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester intemucleoside linkages. In some embodiments, the remainder of the interncueloside linkages are phosphorothioate intemucleoside linkages.
  • each cytosine nucleobase is a 5-methyl cytosine.
  • an ASO of the present disclosure is a 3BNA-2MOE- 10DNA-2MOE-3BNA gapmer, wherein each of the nucleosides at positions 1, 2, 3, 18, 19, and 20 of the oligonucleotide comprise a BNA modification, each of nucleosides at positions 4, 5, 16, and 17 of the oligonucleotide comprise a 2’-MOE modification, and each of the nucleosides at positions 6-15 are 2’-deoxynucleosides.
  • the all internucleoside linkages are phosphodiester internucleoside linkages.
  • the intemucleoside linkages between the nucleosides at positions 2 and 3, 4 and 5, 16 and 17 and 18 and 19 are phosphodiester intemucleoside linkages. In some embodiments, the intemucleoside linkages between the nucleosides at positions 2 and 3, 4 and 5, and 16 and 17 are phosphodiester intemucleoside linkages. In some embodiments, the intemucleoside linkages between the nucleosides at positions 2 and 3, 3 and 4, 4 and 5, 16 and 17 and 17 and 18 are phosphodiester intemucleoside linkages.
  • the intemucleoside linkages between the nucleosides at positions 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester intemucleoside linkages. In some embodiments, the remainder of the intemucleoside linkages are phosphorothioate intemucleoside linkages. In some embodiments, each cytosine nucleobase is a 5-methyl cytosine.
  • an ASO of the present disclosure is a 2LNA-3MOE- 10DNA-3MOE-2LNA gapmer, wherein each of nucleosides at positions 1, 2, 19, and 20 comprise an LNA modification, each of the nucleosides at positions 3, 4, 5, 16, 17, and 18 comprise a 2’-MOE modification, and each of the nucleosides at positions 6-15 are T - deoxynucleosides.
  • the intemucleoside linkages between the nucleosides at positions 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester intemucleoside linkages.
  • the intemucleoside linkages between the nucleosides at positions 2 and 3, 4 and 5, and 16 and 17 are phosphodiester intemucleoside linkages. In some embodiments, the intemucleoside linkages between the nucleosides at positions 2 and 3, 3 and 4, 4 and 5, 16 and 17 and 17 and 18 are phosphodiester intemucleoside linkages. In some embodiments, the intemucleoside linkages between the nucleosides at positions 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester intemucleoside linkages. In some embodiments, the remainder of the interncueloside linkages are phosphorothioate intemucleoside linkages. In some embodiments, each cytosine nucleobase is a 5-methyl cytosine.
  • the present disclosure provides the ASOs listed in the following table and described in more detail below.
  • Table B Representative ASOs
  • an ASO of the present disclosure is a BNA/MOE gapmer compound, e.g., a compound described below.
  • Compound SNCA_ASO_01608 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of GCAGTTCTATCCCACTCATC (unmodified oligonucleotide SEQ ID NO: 4), wherein each of nucleosides 1-2 and 19-20 comprise a BNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phospho
  • Compound SNCA AS0 01608 is characterized by the following chemical notation: Gbs mCbs Aeo Geo Tes Tds mCds Tds Ads Tds mCds mCds mCds Ads mCds Teo mCeo Aes Tbs mCb (modified oligonucleotide SEQ ID NO: 18), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
  • Compound SNCA AS0 01608 is characterized by the following chemical structure (VI):
  • Compound SNCA_ASO_01613 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of AATAGCATCCTTCCACACCA (unmodified oligonucleotide SEQ ID NO: 5), wherein each of nucleosides 1-2 and 19-20 comprise a BNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
  • Compound SNCA ASO 01613 is characterized by the following chemical notation: Abs Abs Teo Aeo Ges mCds Ads Tds mCds mCds Tds Tds mCds mCds Ads mCeo Aeo mCes mCbs Ab (modified oligonucleotide SEQ ID NO: 19), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate internucleoside linkage.
  • Compound SNCA ASO 01613 is characterized by the following chemical structure (VII):
  • Compound SNCA_ASO_01615 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of ATCACCTTCAAACCCCTTTC (unmodified oligonucleotide SEQ ID NO: 6), wherein each of nucleosides 1-2 and 19-20 comprise a BNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
  • Compound SNCA ASO 01615 is characterized by the following chemical notation: Abs Tbs mCeo Aeo mCes mCds Tds Tds mCds Ads Ads Ads mCds mCds mCds mCeo Teo Tes Tbs mCb (modified oligonucleotide SEQ ID NO: 20), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
  • Compound SNCA_ASO_01609 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of CCGGTGCCATTACTCCCTTT (unmodified oligonucleotide SEQ ID NO: 7), wherein each of nucleosides 1-2 and 19-20 comprise a BNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
  • Compound SNCA AS0 01609 is characterized by the following chemical notation: mCbs mCbs Geo Geo Tes Gds mCds mCds Ads Tds Tds Ads mCds Tds mCds mCeo mCeo Tes Tbs Tb (modified oligonucleotide SEQ ID NO: 21), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
  • Compound SNCA AS0 01609 is characterized by the following chemical structure (IX):
  • Compound SNCA_ASO_01611 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of TTGCAGATAAACCATCCCAC (unmodified oligonucleotide SEQ ID NO: 8), wherein each of nucleosides 1-2 and 19-20 comprise a BNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
  • TTGCAGATAAACCATCCCAC unmodified oligonucleotide SEQ ID NO
  • Compound SNCA ASO 01611 is characterized by the following chemical notation: Tbs Tbs Geo mCeo Aes Gds Ads Tds Ads Ads mCds mCds Ads Tds mCeo mCeo mCes Abs mCb (modified oligonucleotide SEQ ID NO: 22), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate internucleoside linkage.
  • Compound SNCA ASO 01611 is characterized by the following chemical structure (X):
  • Compound SNCA_ASO_01614 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of AGTGCCAGACCCTTTCATTA (unmodified oligonucleotide SEQ ID NO: 9), wherein each of nucleosides 1-2 and 19-20 comprise a BNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methyl cytosine.
  • AGTGCCAGACCCTTTCATTA unmodified oligonucleotide SEQ ID NO: 9
  • Compound SNCA ASO 01614 is characterized by the following chemical notation: Abs Gbs Teo Geo mCes mCds Ads Gds Ads mCds mCds mCds Tds Tds mCeo Aeo Tes Tbs Ab (modified oligonucleotide SEQ ID NO: 23), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage. [0113] Compound SNCA ASO 016
  • Compound SNCA_ASO_01610 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of CCAAGTGCCAGACCCTTTCA (unmodified oligonucleotide SEQ ID NO: 10), wherein each of nucleosides 1-2 and 19-20 comprise a BNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
  • Compound SNCA ASO 01610 is characterized by the following chemical notation: mCbs mCbs Aeo Aeo Ges Tds Gds mCds mCds Ads Gds Ads mCds mCds mCds Teo Teo Tes mCbs Ab (modified oligonucleotide SEQ ID NO: 24), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
  • Compound SNCA ASO 01610 is characterized by the following chemical structure (XII): [0117] Compound SNCA_ASO_01612 is characterized as a 2BNA-3MOE-10DNA-
  • 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of GCAGATAAACCATCCCACTT (unmodified oligonucleotide SEQ ID NO: 11), wherein each of nucleosides 1-2 and 19-20 comprise a BNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
  • Compound SNCA ASO 01612 is characterized by the following chemical notation: Gbs mCbs Aeo Geo Aes Tds Ads Ads mCds mCds Ads Tds mCds mCeo Aeo mCes Tbs Tb (modified oligonucleotide SEQ ID NO: 25), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
  • Compound SNCA ASO 01612 is characterized by the following chemical structure (XIII):
  • Compound SNCA_ASO_01616 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of CGGTGCCATTACTCCCTTTC (unmodified oligonucleotide SEQ ID NO: 17), wherein each of nucleosides 1-2 and 19-20 comprise a BNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
  • Compound SNCA ASO 01616 is characterized by the following chemical notation: mCbs Gbs Geo Teo Ges mCds mCds Ads Tds Tds Ads mCds Tds mCds mCeo Teo Tes Tbs mCb (modified oligonucleotide SEQ ID NO: 26), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
  • Compound SNCA ASO 01616 is characterized by the following chemical structure (XIV): [0123] Compound SNCA_ASO_01790 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of GAACTGATGCCTCTACCTCC (unmodified oligonucleotide SEQ ID NO: 12), wherein each of nucleosides 1-2 and 19-20 comprise a BNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine
  • Compound SNCA AS0 01790 is characterized by the following chemical notation: Gbs Abs Aeo mCeo Tes Gds Ads Tds Gds mCds mCds Tds mCds Tds Ads mCeo mCeo Tes mCbs mCb (modified oligonucleotide SEQ ID NO: 27), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
  • Compound SNCA AS0 01790 is characterized by the following chemical structure (XV): [0126] Compound SNCA_ASO_01791 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of ACTGAACTGATGCCTCTACC (unmodified oligonucleotide SEQ ID NO: 23), wherein each of nucleosides 1-2 and 19-20 comprise a BNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine
  • Compound SNCA ASO 01791 is characterized by the following chemical notation: Abs mCbs Teo Geo Aes Ads mCds Tds Gds Ads Tds Gds mCds mCds Tds mCeo Teo Aes mCbs mCb (modified oligonucleotide SEQ ID NO: 28), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
  • Compound SNCA ASO 01791 is characterized by the following chemical structure (XVI): [0129] Compound SNCA_ASO_01792 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of
  • TACATGGCCAGAAACCACTT unmodified oligonucleotide SEQ ID NO: 14
  • each of nucleosides 1-2 and 19-20 comprise a BNA modification
  • each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification
  • each of nucleosides 6-15 are T - deoxynucleosides
  • the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17- 18 are phosphodiester intemucleoside linkages
  • the other intemucleoside linkages are phosphorothioate intemucleoside linkages
  • each cytosine is a 5-methyl cytosine.
  • Compound SNCA ASO 01792 is characterized by the following chemical notation: Tbs Abs mCeo Aeo Tes Gds Gds mCds mCds Ads Gds Ads Ads Ads mCds mCeo Aeo mCes Tbs Tb (modified oligonucleotide SEQ ID NO: 29), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
  • Compound SNCA ASO 01792 is characterized by the following chemical structure (XVII):
  • Compound SNCA_ASO_01793 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of
  • AAGCCAAGCCCAAACACTAA unmodified oligonucleotide SEQ ID NO: 15
  • each of nucleosides 1-2 and 19-20 comprise a BNA modification
  • each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification
  • each of nucleosides 6-15 are T - deoxynucleosides
  • the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17- 18 are phosphodiester intemucleoside linkages
  • the other intemucleoside linkages are phosphorothioate intemucleoside linkages
  • each cytosine is a 5-methyl cytosine.
  • Compound SNCA ASO 01793 is characterized by the following chemical notation: Abs Abs Geo mCeo mCes Ads Ads Gds mCds mCds mCds Ads Ads Ads mCds Aeo mCeo Tes Abs Ab (modified oligonucleotide SEQ ID NO: 30), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
  • Compound SNCA ASO 01793 is characterized by the following chemical structure (XVIII): [0135] Compound SNCA_ASO_01789 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of
  • each of nucleosides 1-2 and 19-20 comprise aBNA modification
  • each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification
  • each of nucleosides 6-15 are T - deoxynucleosides
  • the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17- 18 are phosphodiester intemucleoside linkages
  • the other intemucleoside linkages are phosphorothioate intemucleoside linkages
  • each cytosine is a 5-methyl cytosine.
  • Compound SNCA ASO 01789 is characterized by the following chemical notation: Tbs mCbs mCeo Aeo Aes Ads Gds Gds Ads Gds mCds Ads mCds mCds Ads Aeo mCeo mCes Abs Ab (modified oligonucleotide SEQ ID NO: 31), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
  • an ASO of the present disclosure is an LNA/MOE gapmer compound, e.g., a compound described below.
  • Compound SNCA_ASO_01618 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of GCAGTTCTATCCCACTCATC (unmodified oligonucleotide SEQ ID NO: 4), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
  • GCAGTTCTATCCCACTCATC unmodified oligonucleotide SEQ ID NO: 4
  • Compound SNCA ASO 01618 is characterized by the following chemical notation: Gls mClo Als Geo Tes Tds mCds Tds Ads Tds mCds mCds mCds Ads mCds Teo mCes Alo Tls mCl (modified oligonucleotide SEQ ID NO: 32), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
  • Compound SNCA ASO 01618 is characterized by the following chemical structure (XX):
  • Compound SNCA_ASO_01623 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of AATAGCATCCTTCCACACCA (unmodified oligonucleotide SEQ ID NO: 5), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
  • Compound SNCA ASO 01623 is characterized by the following chemical notation: Als Alo Tls Aeo Ges mCds Ads Tds mCds mCds Tds Tds mCds mCds Ads mCeo Aes mClo mCls A1 (modified oligonucleotide SEQ ID NO: 33), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage. [0144] Compound SN
  • 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of ATCACCTTCAAACCCCTTTC (unmodified oligonucleotide SEQ ID NO: 6), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the internucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
  • Compound SNCA ASO 01625 is characterized by the following chemical notation: Als Tlo mCls Aeo mCes mCds Tds Tds mCds Ads Ads Ads mCds mCds mCds mCeo Tes Tlo Tls mCl (modified oligonucleotide SEQ ID NO: 34), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate internucleoside linkage.
  • Compound SNCA ASO 01625 is characterized by the following chemical structure (XXII):
  • Compound SNCA_ASO_01619 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of CCGGTGCCATTACTCCCTTT (unmodified oligonucleotide SEQ ID NO: 7), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
  • Compound SNCA ASO 01619 is characterized by the following chemical notation: mCls mClo Gls Geo Tes Gds mCds mCds Ads Tds Tds Ads mCds Tds mCds mCeo mCes Tlo Tls T1 (modified oligonucleotide SEQ ID NO: 35), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
  • Compound SNCA ASO 01619 is characterized by the following chemical structure (XXIII):
  • Compound SNCA_ASO_01621 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of TTGCAGATAAACCATCCCAC (unmodified oligonucleotide SEQ ID NO: 8), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methyl cytosine.
  • TTGCAGATAAACCATCCCAC unmodified oligonucleotide SEQ ID NO: 8
  • Compound SNCA ASO 01621 is characterized by the following chemical notation: Tls Tlo Gls mCeo Aes Gds Ads Tds Ads Ads mCds mCds Ads Tds mCeo mCes mClo Als mCl (modified oligonucleotide SEQ ID NO: 36), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage.
  • Compound SNCA ASO 01621 is characterized by the following chemical structure (XXIV):
  • Compound SNCA_ASO_01624 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’ of AGTGCCAGACCCTTTCATTA (unmodified oligonucleotide SEQ ID NO: 9), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
  • AGTGCCAGACCCTTTCATTA unmodified oligonucleotide SEQ ID NO: 9
  • Compound SNCA ASO 01624 is characterized by the following chemical notation: Als Glo Tls Geo mCes mCds Ads Gds Ads mCds mCds Tds Tds Tds mCeo Aes Tlo Tls A1 (modified oligonucleotide SEQ ID NO: 37), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
  • Compound SNCA ASO 01624 is characterized by the following chemical structure (XXV): [0157] Compound SNCA_ASO_01620 is characterized as a 3LNA-2MOE-10DNA-
  • 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of CCAAGTGCCAGACCCTTTCA (unmodified oligonucleotide SEQ ID NO: 10), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
  • Compound SNCA AS0 01620 is characterized by the following chemical notation: mCls mClo Als Aeo Ges Tds Gds mCds mCds Ads Gds Ads mCds mCds mCds Teo Tes Tlo mCls A1 (modified oligonucleotide SEQ ID NO: 38), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
  • Compound SNCA AS0 01620 is characterized by the following chemical structure (XXVI):
  • Compound SNCA_ASO_01622 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of GCAGATAAACCATCCCACTT (unmodified oligonucleotide SEQ ID NO: 11), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
  • Compound SNCA ASO 01622 is characterized by the following chemical notation: Gls mClo Als Geo Aes Tds Ads Ads mCds mCds Ads Tds mCds mCeo Aes mClo Tls T1 (modified oligonucleotide SEQ ID NO: 39), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
  • Compound SNCA ASO 01622 is characterized by the following chemical structure (XXVII): [0163] Compound SNCA_ASO_01626 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of CGGTGCCATTACTCCCTTTC (unmodified oligonucleotide SEQ ID NO: 17), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytos
  • Compound SNCA ASO 01626 is characterized by the following chemical notation: mCls Glo Gls Teo Ges mCds mCds Ads Tds Tds Ads mCds Tds mCds mCeo Tes Tlo Tls mCl (modified oligonucleotide SEQ ID NO: 40), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
  • Compound SNCA ASO 01626 is characterized by the following chemical structure (XXVIII):
  • Compound SNCA_ASO_01823 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of GAACTGATGCCTCTACCTCC (unmodified oligonucleotide SEQ ID NO: 12), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
  • Compound SNCA ASO 01823 is characterized by the following chemical notation: Gls Alo Als mCeo Tes Gds Ads Tds Gds mCds mCds Tds mCds Tds Ads mCeo mCes Tlo mCls mCl (modified oligonucleotide SEQ ID NO: 41), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage. [0168] Compound SNCA
  • Compound SNCA_ASO_01824 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of ACTGAACTGATGCCTCTACC (unmodified oligonucleotide SEQ ID NO: 13), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
  • Compound SNCA ASO 01824 is characterized by the following chemical notation: Als mClo Tls Geo Aes Ads mCds Tds Gds Ads Tds Gds mCds mCds Tds mCeo Tes Alo mCls mCl (modified oligonucleotide SEQ ID NO: 42), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate internucleoside linkage.
  • Compound SNCA ASO 01824 is characterized by the following chemical structure (XXX):
  • Compound SNCA_ASO_01825 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of TACATGGCCAGAAACCACTT (unmodified oligonucleotide SEQ ID NO: 14), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
  • Compound SNCA ASO 01825 is characterized by the following chemical notation: Tls Alo mCls Aeo Tes Gds Gds mCds mCds Ads Gds Ads Ads Ads mCds mCeo Aes mClo Tls T1 (modified oligonucleotide SEQ ID NO: 43), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate internucleoside linkage.
  • Compound SNCA ASO 01825 is characterized by the following chemical structure (XXXI):
  • Compound SNCA_ASO_01826 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of
  • AAGCCAAGCCCAAACACTAA unmodified oligonucleotide SEQ ID NO: 15
  • each of nucleosides 1-3 and 18-20 comprise a LNA modification
  • each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification
  • each of nucleosides 6-15 are T - deoxynucleosides
  • the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18- 19 are phosphodiester intemucleoside linkages
  • the other intemucleoside linkages are phosphorothioate intemucleoside linkages
  • each cytosine is a 5-methyl cytosine.
  • Compound SNCA ASO 01826 is characterized by the following chemical notation: Als Alo Gls mCeo mCes Ads Ads Gds mCds mCds mCds Ads Ads Ads mCds Aeo mCes Tlo Als A1 (modified oligonucleotide SEQ ID NO: 44), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate internucleoside linkage.
  • Compound SNCA_ASO_01822 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of TCCAAAGGAGCACCAACCAA (unmodified oligonucleotide SEQ ID NO: 16), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are T - deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18- 19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
  • Compound SNCA ASO 01822 is characterized by the chemical notation Tls mClo mCls Aeo Aes Ads Gds Gds Ads Gds mCds Ads mCds mCds Ads Aeo mCes mClo Als A1 (modified oligonucleotide SEQ ID NO: 45), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage. [0180] Compound SNCA ASO 01822
  • An antisense oligonucleotide of the present disclosure may be synthesized by any method known in the art.
  • an ASO may be synthesized by in vitro transcription and purification (e.g., using commercially available in vitro RNA synthesis kits), by transcription and purification from cells (e.g., cells comprising an expression cassette/vector encoding the ASO), by use of an automated solid-phase synthesizer, and the like.
  • solid- phase oligonucleotide synthesis monomeric nucleoside units are added iteratively to a growing oligonucleotide chain covalently bound to a solid support.
  • electrophilic 3’ phosphoramidite monomeric units may be used.
  • any suitable electrophilic group can be used to covalently link two nucleosides.
  • the present ASOs may be purified following solid-phase synthesis through any method known in the art. For example, oligonucleotides may be precipitated from solution through treatment of the solution with ethanol and divalent cations.
  • the present ASOs may also be purified using, e.g., sizing columns, reverse-phase chromatography, high-performance liquid chromatography, and polyacrylamide gel electrophoresis.
  • compositions comprising an ASO described herein.
  • the composition is useful for treating a disease or disorder associated with expression or overexpression of alpha-synuclein, e.g., a synucleinopathy.
  • Compositions of the present disclosure may be formulated based upon the mode of delivery.
  • a pharmaceutical composition described herein may comprise a pharmaceutically acceptable excipient.
  • a pharmaceutically acceptable excipient can be liquid or solid, and may be selected with the planned manner of administration in mind so as to provide for the desired bulk, consistency, and other pertinent transport and chemical properties. Any known pharmaceutically acceptable carrier or diluent may be used, including, for example, water, saline solution, buffering agents, preservatives, and the like.
  • the ASOs of the present disclosure may be administered to a patient as a formulation in phosphate buffered saline (PBS).
  • PBS phosphate buffered saline
  • Example of pharmaceutically acceptable excipients include water, saline, buffer solution, or artificial cerebrospinal fluid.
  • the pharmaceutically acceptable excipient is preferably sterile.
  • the ASOs of the present disclosure may be administered as pharmaceutically acceptable salts.
  • a pharmaceutically acceptable salt is a salt of the ASOs of the present disclosure that is physiologically acceptable, and retains the desired biological activity of the ASO without having undesired toxicological effects.
  • the term ASO encompasses both the free acid form and salt forms (e.g., sodium salt form) of the oligonucleotides.
  • the ASOs of the present disclosure may be admixed, encapsulated (e.g., in a lipid nanoparticles), conjugated, or otherwise associated with other molecules, molecular structures, or mixtures of nucleic acids.
  • U.S. Patent Publication Number 2020/0385723 provides suitable pharmaceutical compositions for use with the ASOs of the present disclosure.
  • the ASOs of the present disclosure typically inhibit the activity of transcripts encoded by the SNCA gene in a mammalian cell, such as a human cell.
  • the cell is a neuronal cell.
  • the cell is a cell of the central nervous system (CNS), including cells of the motor cortex, frontal cortex, caudate, amygdala, pons, substantia nigra, putamen, cerebellar peduncle, corpus collosum, dorsal cochlear nucleus (DCN), entorhinal cortex (Ent Cortex), hippocampus, insular cortex, medulla oblongata, central gray matter, pulvinar, occipital cortex, cerebral cortex, temporal cortex, globus pallidus, superior colliculi, and basal forebrain nuclei.
  • CNS central nervous system
  • the present disclosure provides methods of down-regulating the abundance or activity of SNCA gene transcripts in cells or in tissues comprising contacting the cells or tissues with an effective amount of one or more of the ASOs or compositions of the disclosure.
  • the methods may be carried out in vitro or in vivo.
  • the ASOs of the present disclosure can be utilized for treatment or prophylaxis.
  • the ASOs of the present disclosure can be used as therapeutics in animals suspected of having a disease or disorder that can be treated by modulating the expression of the SNCA gene transcript and/or alpha-synuclein protein.
  • the animal may also be prone to having the disease or disorder associated with the expression of the SNCA gene, and is not necessarily suspected of having the disease or disorder.
  • the animal is treated by administering a therapeutically or prophylactically effective amount of one or more of the ASO compounds or pharmaceutical compositions of the present disclosure.
  • the animal is a mammal.
  • the animal is a human.
  • the ASOs described herein may be used to treat a neurodegenerative disease, such as Parkinson’s disease, Lewy body dementia, diffuse Lewy body disease, pure autonomic failure, multiple system atrophy, neuronopathic Gaucher’s disease, and Alzheimer’s disease. In general, a neurodegenerative disease results in the death of neurons.
  • a neurodegenerative disease results in the death of neurons.
  • the ASOs of the present disclosure ameliorate the symptoms of a disease or disorder associated with the expression of the SNCA gene. Amelioration may refer to a reduction in the severity or the frequency of occurrence of a symptom. Amelioration may also refer to a delay in the onset or progression of a symptom.
  • a symptom alleviated by treatment with the ASO is motor dysfunction, aggregation of alpha-synuclein, neurodegeneration, cognitive decline, or dementia. Amelioration of these symptoms may result in improved motor function, reduction of alpha-synuclein aggregations, reduced neurodegeneration, reduced or reversed cognitive decline, and/or reduced or reversed dementia.
  • a “therapeutically effective amount” of an ASO as disclosed herein is an amount sufficient to carry out a specifically stated purpose. Such an amount can be determined empirically and in a routine manner, in relation to the stated purpose. Certain factors may influence the dosage and timing required to effectively treat a subject, including, but not limited to, severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and one or more other diseases being present. Moreover, treatment of a subject with a therapeutically effective amount of a pharmaceutical composition can include a single treatment or a series of treatments. Estimates of effective dosages and in vivo half-lives for the ASOs of the present disclosure may be made using conventional methodologies or on the basis of in vivo testing using appropriate animal models. A therapeutically effective amount may alleviate the symptoms of a disease.
  • the ASOs or pharmaceutical compositions of the present disclosure are prepared for injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), intracranial, and the like).
  • the pharmaceutical composition is injected intrathecally or intracranially to the subject.
  • the ASOs of the present disclosure can be used for research purposes.
  • an ASO may be used to specifically inhibit the synthesis of the alpha-synuclein protein in cells and experimental animals.
  • ASO-mediated inhibition of alpha-synuclein synthesis can be used to perform functional analyses of alpha-synuclein protein.
  • kits and articles of manufacture comprising an ASO described herein.
  • Kits or articles of manufacture comprising an ASO of the present disclosure can be used to perform the methods described herein.
  • a kit or article of manufacture comprises at least one ASO in one or more containers.
  • kits or an article of manufacture described herein may be used for the treatment and/or prevention of a disease associated with the expression of the SNCA gene (e.g., a synucleinopathy).
  • the kit or article of manufacture may further comprise a container and a label or package insert on or associated with the container.
  • Suitable containers include, for example, bottles, vials, syringes, IV solution bags, etc.
  • the containers may be formed from a variety of materials such as glass or plastic, and may hold a composition which is by itself or combined with another composition effective for treating or preventing the disease and may have a sterile access port (for example the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle).
  • the kit or article of manufacture may further comprise a package insert indicating that the compositions can be used to treat a particular disease.
  • the article of manufacture or kit may further comprise a second (or third) container comprising a pharmaceutically-acceptable buffer, such as bacteriostatic water for injection (BWFI), phosphate-buffered saline, Ringer’s solution and dextrose solution. It may further include other materials desirable from a commercial and/or user standpoint, including other buffers, diluents, filters, needles, and syringes.
  • kits contain all of the components necessary and/or sufficient to perform a detection assay, including all controls, directions for performing assays, and any necessary software for analysis and presentation of results.
  • ASO can be readily incorporated into one of the established kit formats which are well known in the art.
  • the words “have” and “comprise,” or variations such as “has,” “having,” “comprises,” or “comprising,” will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers.
  • the term “approximately” or “about” as applied to one or more values of interest refers to a value that is similar to a stated reference value.
  • the term refers to a range of values that fall within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context.
  • the ASOs were constructed to be complementary to the sense strand of the genomic SNCA sequence (SEQ ID NO: 1) as well as the sequence of the mRNA transcribed from the SNCA gene (NC_000004.12: :89724099..89838324, SEQ ID NO: 2).
  • Sk-Mel-2 cells were cultured in Eagle’s minimum essential medium (EMEM) supplemented with 10% Fetal Bovine Serum (FBS).
  • EMEM Eagle’s minimum essential medium
  • FBS Fetal Bovine Serum
  • C57BL/6Tac mice (Taconic) were genetically engineered to introduce the entire wildtype human SNCA gene starting from its 5’UTR (SEQ ID NO: 1) into the mouse genome in place of the mouse SNCA gene and under the control of the mouse SNCA promoter.
  • C57BL/6Tac mice (Taconic) were genetically engineered to introduce the entire human SNCA gene starting from its 5’UTR (SEQ ID NO: 1) mutated in position A53T into the mouse genome in place of the mouse SNCA gene and under the control of the mouse SNCA promoter.
  • cortical neurons were collected from embryos removed from pregnant homozygous human SNCA knock-in mice at embryonic day 17.5. Cortical tissue of each embryo was dissected on ice-cold Hank’s Balanced Salt Solution. Pooled tissue was minced and digested with papain at 37 °C for 12 minutes. Digestion then was halted by the addition of 10% FBS/DMEM. The cells were triturated and resuspended in NeurobasalTM Plus media supplemented with GlutaMAXTM, 2% penicillin/streptomycin, and B-27TM Plus supplement.
  • Cells were seeded at a density of 15000 cells/well onto 384-well poly-L-lysine + boric acid coated plates in 40 pL supplemented NeurobasalTM media (containing B-27TM supplement and GlutaMAX). The neurons were then incubated for four days at 37°C under a 5% CO2 atmosphere.
  • neurons were treated with 300 nM of the given ASO.
  • neurons were treated with serial dilutions of the given ASO starting at 3 pM (1 ⁇ 2 log dilutions, 11 concentrations total).
  • the culture media was replaced with new NeurobasalTM media.
  • RNA was extracted from the cells using the TaqManTM Fast Advanced Cells-to- CT Kit (ThermoFisher). Cells were then washed in PBS and lysed in solution for five minutes at room temperature, with simultaneous DNase treatment. Lysis was terminated by treatment of the mixture with Stop Solution, followed by a two-minute incubation at room temperature.
  • Reverse transcription was conducted immediately after cell lysis using Fast Advanced RT Enzyme Mix (ThermoFisher).
  • the cDNA samples were then used for quantitative real-time PCR measurement using TaqManTM genotyping assays.
  • Specific probes and primers were used for SNCA mRNA quantification (Hs00240906_ml SNCA; ThermoFisher).
  • SNCA mRNA levels were adjusted to the measured levels of the housekeeping gen ePPIA (probe/primer PPIA_Mm02342430_gl; ThermoFisher).
  • the quantification cycle value (Ct) is defined as the number of cycles required for the fluorescent signal to exceed the background fluorescence.
  • the QuantStudioTM Real-Time PCR software program (Applied Biosystems, Foster City, CA) sets this threshold at ten standard deviations above the mean baseline fluorescence.
  • the comparative Ct method normalized the Ct value of a target gene to housekeeping genes before comparisons were made between samples. First, the difference between Ct values (ACt) of the target gene and the housekeeping gene was calculated for each sample, and then the difference in the ACt (AACt) was calculated between two samples (e.g., control and treatment). The fold-change in expression of the two samples was calculated as 2 DDa . The percentage of reduction was calculated by subtracting the value 1 to the 2 DDa of the ASO group mean of interest and by multiplying by 100, % reduction (1- 2-AACtASO group mean) x 100.
  • hSNCA mice received a single unilateral bolus injection of oligonucleotide at a dose of 30 nmol. Mice were anesthetized with isoflurane at a concentration of 4.5-5% and maintained during surgery with a concentration of 1.5-2% isoflurane. For pain management, buprenorphine at a dosage of 0.04 mg/kg was administered subcutaneously at least 30 minutes before injection. The scalps of the mice were shaved and, following loss of the pedal reflex, mice were placed in a stereotaxic frame (David Kopf Instruments, CA). The scalp was sterilized using three alternating wipes of Betadine and 70% ethanol.
  • mice were subcutaneously injected with 1 mL of warm sterile saline solution to aid rehydration and placed in their warm home cage.
  • a control group of mice was similarly dosed with saline vehicle control. Mice were observed until they regained consciousness and mobility to prevent potential adverse behavioral effects.
  • Drug tolerability was scored one hour following dosing. Animals dosed with non-tolerated compounds (tolerability score >8) were euthanized immediately following the one-hour evaluation.
  • ASO SNCA 00033 as previously described in PCT Patent Publication WO 2012/068405 was also tested as a comparator. In all instances, ASO SNCA 00033 has a 5-10-5 MOE gapmer pattern in which all of the internucleoside linkages are phosphorothioate internucleoside linkages and all cytosine residues are 5-methyl cytosines.
  • ASO solution was administered in 30m1 of artificial CSF over ⁇ 30 seconds.
  • the catheter was left in place and sealed to avoid diffusion of the CSF fluid.
  • Muscle and skin were sutured, and the rats were subcutaneously injected with 1 mL warm sterile saline to aid rehydration and placed in their warm home cage.
  • a control group of rats were similarly dosed with artificial CSF. Rats were observed until they regained consciousness and mobility to prevent potential adverse behavioral effects.
  • Drug tolerability was scored at one, three, and 24 hours post dosing. Animals dosed with non-tolerated compounds (tolerability score >8) were euthanized immediately following the one-hour evaluation.
  • mice were weighed on the injection day and three times per week until completion of the experiment. Any mice displaying intolerable health, behavioral observations, or weight loss of more than 20% of their initial body weight were immediately euthanized.
  • mice All mice were euthanized by anesthetic overdose. Animals were transcardially perfused in the left ventricle with 0.9 % saline. The thoracic aorta between the lungs and the liver was clamped with hemostatic forceps to block blood flow from the heart to the abdomen, but to allow blood to flow to the brain. The right ventricle was opened with scissors. A constant pressure of 100 to 120 mm Hg was maintained on the perfusion solution by connecting the solution bottle to a manometer-controlled air compressor. Perfusion was continued until the skull surface turned pale and perfusion solution exited the right ventricle. Following perfusion, brain tissues (cortex) and peripherical tissues (kidney and liver) were collected. Samples were cut into small pieces, mixed and aliquoted into three equal parts.
  • RNA extraction and mRNA quantification by qPCR were performed. From right cortex biopsies, RNA was extracted using RNeasy Mini Kit (Qiagen) with DNase treatment. Total RNA samples were quantified using a NanodropTM spectrophotometer and analyzed using TapeStation to determine the quality of the RNA (RIN). In qPCR quantification experiments, the RNA was first reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied BiosystemsTM).
  • the reaction was performed in a 100 pL final reaction volume, starting from 1000 ng of total RNA (to a final RNA concentration of 10 ng/pL)
  • Quantification of the human SNCA gene and the mouse PPIA housekeeping gene were performed from 40ng of total cDNA using QuantStudio 7 Flex (Applied BiosystemsTM), TaqManTM Universal PCR Master Mix (Applied BiosystemsTM, Ref. 4324020), and TaqManTM Gene Expression Assays in duplex (Hs00240906_ml in FAM fluorochrome and Mm02342430_gl in VIC fluorochrome).
  • qPCR analysis was performed in triplicate using the fast run mode. The Ct values of each qPCR plate were analyzed using Excel software.
  • hSNCA Protein Expression by Mass Spectrometry Analysis Mouse brain tissues were homogenized with Pecellys® (2x20s, 5000tr) in lysis buffer (PBS, Sigma Protease and Phosphatase Inhibitor Cocktail, 1% deoxycholate) at 150 mg/mL. Brain homogenates were then centrifuged (27000g, 4°C, 20 minutes) and supernatants collected. Brain samples were diluted in a denaturing buffer (ammonium bicarbonate 50mM, deoxycholate 1%) and then heated at 95°C for five minutes.
  • lysis buffer PBS, Sigma Protease and Phosphatase Inhibitor Cocktail, 1% deoxycholate
  • trypsin (lOpg) was added into each sample.
  • the tryptic digestion was performed in an ultrasonic bath (Branson 1200) for one minute followed by an incubation at 52 °C for 30 minutes.
  • the reaction was stopped by the addition of lpL of TCEP (0.5 M) and 1 pL of 100% formic acid followed by incubation at 95°C for five minutes.
  • the samples were then centrifuged at 30,000 g for 15 minutes.
  • Peptide digests were analyzed by a reversed-phase liquid chromatography tandem mass spectrometry (LC-MS/MS) using a Shimadzu LC system (Shimadzu) coupled online to a triple quadrupole mass spectrometer (Shimadzu 8060) operated in the MRM mode.
  • the specific peptides used to measure alpha-synuclein protein abundance were TVEGAGSIAAATGFVK (SEQ ID NO: 46) and TVEGAGNI AAAT GF VK (SEQ ID NO: 47).
  • the specific peptide used to measure GAPDH protein abundance was VGVNGFGR (SEQ ID NO: 48).
  • hSNCA Protein or alpha-sy nuclein Protein Expression by ELISA Mouse brain tissues were homogenized with Pecellys® (2x20s, 5000tr) in lysis buffer (PBS, Sigma Protease and Phosphatase Inhibitor Cocktail, 1% deoxycholate) at 150 mg/mL. Brain homogenates were then centrifuged (27000g, 4°C, 20 minutes) and supernatants collected. The quantification of a-synuclein in brain lysates were performed by using the U-PLEX Human a-Synuclein Kit (K151WKK) following manufacturer instruction.
  • the quantification of total a-synuclein in brain lysates were performed using the ELISA commercial kit from MSD®, U-PLEX Human a-Synuclein Kit (K151WKK).
  • the provided plate was pre-coated with capture antibody for a-synuclein.
  • the sample (brain lysates) was added to a solution containing the detection antibody (anti-a-synuclein) conjugated to an electroluminescent compound label (MSD SULFO-TAG).
  • MSD SULFO-TAG electroluminescent compound label
  • MSD® read buffer was added providing the appropriate chemical environment for electroluminescence and the plate was loaded into an MSD SECTOR® Imager for analysis. Inside the SECTOR Imager, a voltage applied to the plate electrodes caused the probes bound to the electrode surface to emit light. The instrument measured the intensity of emitted light to provide a quantitative measurement of a-synuclein present in the sample.
  • HPLC High Performance Liquid Chromatography
  • Plasma samples were weighed and grinded into MasterpureTM/Proteinase K 97/3 (V/V) buffer for 2x30 seconds at 6500rpm using a Precellys device.
  • Plasma samples (5pL) were diluted into MasterpureTM/ptoteinase K 97/3 (70pL). Plasma and tissue homogenates were incubated during 30 minutes at 55°C under soft agitation. Then, 10pL of KC1 3M solution was added into 50pL of tissue homogenates or plasma dilution, rapidly vortexed and sonicated for five minutes.
  • CSF samples (1 OpL) were diluted into hybridation buffer (Tris HC1 50 mM pH 8.5 / ACN 90/10) (45pL) and proteinase K (lpL) and were incubated during 15 minutes at 55°C. Prior to analysis, a hybridization step was undertaken with a fluorescently labelled peptide nucleic acid oligomer complementary to the quantified oligonucleotide. For calibration standards and tissue homogenates, 40 pL hybridation buffer was mixed with 10pL of fluorescent complementary probe and 10pL of calibration standards, quality control sample and study sample supernatants.
  • Example 1 mRNA Reduction in vitro following a Single Dose of ASO
  • Modified oligonucleotides complementary to the human SNCA nucleotide sequence were designed and tested in cultured Sk-Mel-2 cells for their selective efficacy in reducing SNCA mRNA levels.
  • Cultured Sk-Mel-2 cells at a density of 15000 cells per well were transfected using Lipofectamine 2000 (Invitrogen) with 20 nM or 2 nM concentrations of modified antisense oligonucleotides (ASOs).
  • This method relies on the signal amplification of a branched DNA (bDNA) probe that binds to a specific nucleotide sequence.
  • the probe-sets used were XM_005555421 (reactive to dog and human SNCA ) and NM_002046 (reactive to human GapDH ), which were designed by Affymetrix Inc./ThermoScientific and synthesized by Metabion International.
  • SVCN-RLUs were normalized to GapDH relative light units (RLUs) of respective wells. Values were normalized against wells treated with unspecific (Ahsal) ASOs.
  • the modified oligonucleotides tested in the above experiment are shown in Table C below.
  • Each modified oligonucleotide listed in Table C is complementary to the human SNCA nucleic acid sequence (SEQ ID NO: 1) and is a 5-10-5 MOE gapmer.
  • the gapmers are 20 nucleobases in length, wherein the central gap segment comprises ten 2’-deoxynucleosides and each of the wing segments comprises five 2’MOE nucleosides. All cytosines throughout each gapmer are 5-methyl cytosines, and all intemucleoside linkages are phosphorothioate internucleoside linkages.
  • the identified position in Table C corresponds to the “Start Site,” i.e., the 5’ nucleoside to which the gapmer is complementary in the human nucleic acid sequence (SEQ ID NO: 1).
  • Each modified oligonucleotide listed in Table D is complementary to the human SNCA nucleic acid sequence (SEQ ID NO: 1) and is a 4-10-4 MOE gapmer.
  • the gapmers are 18 nucleobases in length, wherein the central gap segment comprises ten T - deoxynucleosides, and the wing segments on both the 5’ and 3’ ends comprise four T -MOE nucleosides. All cytosines throughout each gapmer are 5-methyl cytosines, and all internucleoside linkages are phosphorothioate linkages.
  • Table D corresponds to the “Start Site,” i.e., the 5’ nucleoside to which the gapmer is complementary in the human SNCA nucleic acid sequence (SEQ ID NO: 1).
  • Each modified oligonucleotide listed in Table E is complementary to the human SNCA nucleic acid sequence (SEQ ID NO: 1) and is a 3-10-3 LNA gapmer.
  • the gapmers are 16 nucleobases in length, wherein the central gap segment comprises ten 2’-deoxynucleosides and each wing segments on the 5’ and 3’ ends comprise three LNA nucleosides. All cytosines throughout each gapmer are 5-methyl cytosines, and all internucleoside linkages are phosphorothioate linkages.
  • the identified position in Table E corresponds to the “Start Site,” i.e., the 5’ nucleoside to which the gapmer is complementary in the modified human nucleic acid sequence (SEQ ID NO: 1).
  • Each modified oligonucleotide listed in Table F is complementary to the human SNCA nucleic acid sequence (SEQ ID NO: 1) and is a 3-11-3 LNA gapmer.
  • the gapmers are 17 nucleobases in length, wherein the central gap segment comprises eleven T - deoxynucleosides and is flanked by wing segments on both 5’ and 3’ end comprising three LNA nucleosides. All cytosines residues throughout each gapmer are 5-methyl cytosines, and all internucleoside linkages are phosphorothioate linkages.
  • the identified position in Table F corresponds to the “Start Site” i.e. the 5’ nucleoside to which the gapmer is complementary in the human nucleic acid sequence (SEQ ID NO: 1).
  • Example 2 mRNA Reduction in vitro following a Single Dose of MOE-Modified ASO
  • Modified oligonucleotides complementary to the human SNCA nucleic acid sequence were designed and tested in vitro in primary cortical neurons for their selective efficacy in reducing SNCA mRNA levels. Neurons were treated with 300 nM of each antisense oligonucleotide. mRNA levels were quantified using qRT-PCR (TaqManTM) with the following probes:
  • PPIA_Mm02342430_g 1 Therm oF i sher (control) .
  • Each modified oligonucleotide listed in Table G and Table H is complementary to the human SNCA DNA (SEQ ID NO: 1) or mRNA (SEQ ID NO: 3) sequence.
  • the sequences in Table G are complementary to exons of the mRNA sequence, whereas the sequences in Table H are complementary to the introns of the mRNA sequence.
  • Each ASO is a 5-10-5 MOE gapmer that is 20 nucleobases in length, wherein the central gap segment comprises ten 2’-deoxynucleosides and the wing segments on both 5’ and 3’ ends comprise five T -MOE nucleosides.
  • MOE-Modified ASOs Complementary to SNCA RNA Introns
  • Example 3 mRNA Reduction in vitro following Multiple Doses of MOE-modified ASOs
  • Modified oligonucleotides complementary to the human SNCA nucleic acid sequence were tested in vitro in primary cortical neurons for their selective efficacy in reducing SNCA mRNA levels. Neurons were treated with multiple doses (3 mM; 1 ⁇ 2 log dilution; 11 concentrations) of the given antisense oligonucleotide.
  • the Hill coefficient which is the slope of the line in a Hill plot, was measured in order to observe the shape of the dose response curve for each ASO.
  • Each modified oligonucleotide listed in Table I, Table J, and Table K is complementary to human SNCA nucleic acid sequence SEQ ID NO: 1 and/or SEQ ID NO: 3.
  • the ASOs in Table J are designed to be complementary to introns in the SNCA mRNA sequence, whereas the ASOs in Tables I and K are designed to be complementary to exons in the SNCA mRNA sequence.
  • Each of the ASOs in Tables I, J, and K is a 5-10-5 MOE gapmer.
  • the gapmers are 20 nucleobases in length, wherein the central gap segment comprises ten T - deoxynucleosides and each of the flanking wing segments comprises five T -MOE nucleosides. All cytosines throughout each gapmer are 5-methyl cytosines, and all internucleoside linkages are phosphorothioate linkages.
  • the SNCA_ASO_01617 in Table J is a 5-10-5 MOE gapmer.
  • the gapmer is 20 nucleobases in length, wherein the central gap segment comprises ten T deoxynucleosides and is flanked by wing segments on both 5’ and 3’ end comprising five T -MOE nucleosides.
  • All cytosines residues throughout each gapmer are 5-methyl cytosines.
  • All internucleoside linkages are phosphorothioates linkages except between nucleosides 2 and 3, 3 and 4, 4 and 5, 16 and 17, and 17 and 18, which are phosphodiester linkages.
  • Each of the ASOs in Table L is a 3-2-10-2-3 LNA/MOE mixed gapmer.
  • the gapmers are 20 nucleobases in length, wherein the central gap segment comprises ten T - deoxynucleosides and each wing segment comprises three LNA nucleosides and two T -MOE nucleosides.
  • the ASO therefore comprises, from 5’ to 3’, 3 LNA nucleosides, two T -MOE nucleosides, 10 T -deoxynucleosides, two T -MOE nucleosides, and 3 LNA nucleosides.
  • cytosines residues throughout each gapmer are 5-methyl cytosines and all internucleoside linkages are phosphorothioate (PS) linkages except for the linkages between nucleosides 2 and 3, 4 and 5, 16 and 17, and 18 and 19, which are phosphodiester (PO) linkages.
  • PS phosphorothioate
  • Each ASO listed in Table M is a 2-3-10-3-2 BNA/MOE gapmer.
  • the gapmers are 20 nucleobases in length, wherein the central gap segment comprises ten T- deoxynucleosides and each wing segment comprises two BNA nucleosides and three T- MOE nucleosides.
  • Each ASO therefore comprises, from 5’ to 3’, two BNA nucleosides, three T -MOE nucleosides, 10 T -deoxynucleosides, three T -MOE nucleosides, and two BNA nucleosides.
  • cytosines throughout each gapmer are 5-methyl cytosines, and all 5 internucleoside linkages are phosphorothioate linkages except the linkages between nucleosides 3 and 4, 4 and 5, 16 and 17, and 17 and 18, which are phosphodiester (PO) linkages.
  • Example 4 Tolerability and Efficacy of Modified Oligonucleotides Complementary to Human SNCA in hSNCA Mice
  • Three-month-old hSNCA mice received a single bolus ICV injection of a modified oligonucleotide listed in the indicated table at a dose of 30 nmol.
  • Each modified oligonucleotide is complementary to the human SNCA genomic nucleic acid sequence (SEQ ID NO: 1).
  • the positions in the tables indicate the 5’ nucleoside to which the oligonucleotide is complementary in the human nucleic acid sequence (SEQ ID NO: 1).
  • the tolerability score is represented as the Functional
  • Each ASO in Table N is a 5-10-5 MOE gapmer as described above, in which all cytosines residues throughout each gapmer are 5-methyl cytosines and all internucleoside linkages are phosphorothioate (PS) linkages.
  • FIG. 4 is a bar graph that compares the tolerability of select 5-10-5 MOE gapmers. Compounds having an FOB of greater than ten were excluded from further assays. The structure of SNCA ASO 01617 is as described above. Table N. Tolerability of 5-10-5 MOE Gapmers in hSNCA Mice
  • Each ASO listed in Table O is a 5-10-5 MOE gapmer as described above, in which all cytosine residues throughout each gapmer are 5-methyl cytosines and all internucleoside linkages are phosphorothioate linkages.
  • FIG. 4 is a bar graph that compares the efficacy of select 5-10-5 MOE gapmers.
  • the structure of SNCA_ASO_01617 is as described above.
  • Each ASO listed in Table P is a 3-2-10-2-3 LNA/MOE mixed gapmer, except for SNCA_ASO_00033, which is a 5-10-5 MOE gapmer as described above, used as a comparator.
  • the LNA/MOE mixed gapmers are 20 nucleobases in length, wherein the central gap segment comprises ten 2’-deoxynucleosides and each wing segment comprises three LNA nucleosides and two T -MOE nucleosides.
  • the ASO therefore comprises, from 5’ to 3’, 3 LNA nucleosides, two T -MOE nucleosides, 10 2’-deoxynucleosides, two T -MOE nucleosides, and 3 LNA nucleosides. All cytosines residues throughout each gapmer are 5- methyl cytosines, and all intemucleoside linkages are phosphorothioate linkages. [0249] Further experimentation to determine the level of mRNA reduction was not performed for compounds 00937, 00938, 00941 and 00942 because they did not exhibit promising FOB results. The mice treated with these compounds were sacrificed.
  • FIG. 5 is a bar graph that compares the tolerability of select 3-2-10-2-3 LNA/MOE mixed gapmers. All cytosines throughout each gapmer are 5- methyl cytosines, and all intemucleoside linkages are phosphorothioate (PS) linkages except for the linkages between nucleosides 2 and 3, 4 and 5, 16 and 17, and 18 and 19, which are phosphodiester (PO) linkages. Table Q. Tolerability of 3-2-10-2-3 LNA/MOE Mixed Gapmers in hSNCA Mice
  • Each ASO listed in Table R is a 3-2-10-2-3 LNA/MOE gapmer. All cytosines residues throughout each gapmer are 5-methyl cytosines. All internucleoside linkages are phosphorothioate linkages except for the linkages between nucleosides 2 and 3, 4 and 5, and 16 and 17, which are phosphodiester linkages. Table R. Tolerability of 3-2-10-2-3- LNA/MOE Mixed Gapmers in hSNCA Mice
  • Each ASO listed in Table S is a 3-2-10-2-3 LNA/MOE gapmer. All cytosines residues throughout each gapmer are 5-methyl cytosines, and all intemucleoside linkages are phosphorothioate linkages except the linkages between nucleosides 2 and 3, 3 and 4, 4 and 5, 16 and 17, and 17 and 18, which are phosphodiester linkages.
  • Each ASO listed in Table T (aside from comparator SNCA AS0 00033) is a 3- 2-10-2-3 LNA/MOE mixed gapmer.
  • FIG. 5 is a bar graph that compares the efficacy of select 3-2-10-2-3 LNA/MOE mixed gapmers. All cytosines throughout each gapmer are 5- methyl cytosines, and all internucleoside linkages are phosphorothioate linkages except the linkages between nucleosides 2 and 3, 4 and 5, 16 and 17, and 18 and 19, which are phosphodiester linkages.
  • Each ASO in Table U is a 3-2-10-2-3 LNA/MOE gapmer. All cytosines throughout each gapmer are 5-methyl cytosines, and all internucleoside linkages are phosphorothioate linkages, except the linkages between nucleosides 2 and 3, 4 and 5, and 16 and 17, which are phosphodiester linkages. [0256] As shown below, the ASOs reduced the amount of human SNCA mRNA in mice two weeks post injection.
  • Each ASO in Table V is a 3-2-10-2-3 LNA/MOE gapmer. All cytosine residues throughout each gapmer are 5-methyl cytosines, and all internucleoside linkages are phosphorothioate linkages except the linkages between nucleosides 2 and 3, 3 and 4, 4 and 5, 16 and 17, and 17 and 18, which are phosphodiester linkages.
  • Each ASO listed in Table W (aside from comparator SNCA_ASO_00033) is a 2- 3-10-3-2 BNA/MOE gapmer.
  • FIG. 6 is a bar graph that compares the tolerability of select 2- 3-10-3-2 BNA/MOE gapmers.
  • the gapmers are 20 nucleobases in length, wherein the central gap segment comprises ten 2’-deoxynucleosides and each wing segment comprises two BNA nucleosides and three 2’-MOE nucleosides.
  • Each ASO therefore comprises, from 5’ to 3’, two BNA nucleosides, three 2’-MOE nucleosides, 102’-deoxynucleosides, three T - MOE nucleosides, and two BNA nucleosides.
  • All cytosines throughout each gapmer are 5- methyl cytosines, and all internucleoside linkages are phosphorothioate linkages except the linkages between nucleosides 3 and 4, 4 and 5, 16 and 17, and 17 and 18, which are phosphodiester linkages.
  • Each ASO listed in Table X (aside from comparator SNCA AS0 00033) is a 3- 2-10-2-3 BNA/MOE gapmer.
  • FIG. 6 is a bar graph that compares the efficacy of select 2-3- 10-3-2 BNA/MOE gapmers.
  • the gapmers are 20 nucleobases in length, wherein the central gap segment comprises ten 2’-deoxynucleosides and each wing segment comprises three BNA nucleosides and two 2’-MOE nucleosides.
  • Each ASO therefore comprises, from 5’ to 3’, three BNA nucleosides, two 2’-MOE nucleosides, 102’-deoxynucleosides, two 2’-MOE nucleosides, and three BNA nucleosides.
  • All cytosines throughout each gapmer are 5-methyl cytosines, and all intemucleoside linkages are phosphorothioate linkages except for the linkages between nucleosides 3 and 4, 4 and 5, 16 and 17, and 17 and 18, which are phosphodiester linkages.
  • Example 5 Tolerability, Efficacy and Biodistribution of Multiple Doses of Modified Oligonucleotides Complementary to Human SNCA in hSNCA Mice
  • Three-month-old hSNCA mice received a single bolus ICV injection of a modified oligonucleotide listed at doses described in the indicated tables.
  • hSNCA mice were divided into groups of six mice. A group of six mice received PBS as negative control for each experiment.
  • the tolerability score is represented as the Functional Observational Battery (FOB) score at one-hour post-injection.
  • FOB Functional Observational Battery
  • mice were sacrificed four weeks post-injection, except figures followed by an asterisk wherein analyzes were two weeks post-injection.
  • Cortical brain tissue was collected and the level of hSNCA mRNA was measured as described above and the level of alpha-synuclein protein was measured by ELISA kit as described above. Results are presented in the tables as percent reduction of the amount of SNCA mRNA and alpha-synuclein protein relative to vehicle (PBS) control groups. A value of 0% reduction indicates that the compound had no effect.
  • PBS vehicle
  • SNC A_ASO_01613 in Table Y is a 2-3-10-3-2 BNA/MOE gapmer as described above, in which the internucleoside linkages between nucleosides 3 and 4, 4 and 5, 16 and 17, and 17-18 are phosphodiester internucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
  • SNCA_ASO_01625 in Table Z is a 3-2-10-2-3 LNA/MOE gapmer as described above, in which the intemucleoside linkages between nucleosides 2 and 3, 4 and 5, 16 and 17, and 18 and 19 are phosphodiester intemucleoside linkages, the remaining intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
  • SNC A_ASO_01617 (SEQ ID NO: 1264) in Table AA is a 5-10-5 MOE gapmer wherein the central gap segment comprises ten T deoxynucleosides and is flanked by wing segments on both 5’ and 3’ end comprising five 2’MOE nucleosides.
  • all cytosines residues throughout each gapmer are 5-methyl cytosines, and all intemucleoside linkages are phosphorothioates linkages except between 2 and 3, 3 and 4, 4 and 5, 16 and 17, and 17 and 18 positions which are phosphodiester linkages.
  • FIG. 7 is a bar graph that compares the efficacy of SNCA_ASO_1613,
  • FIG. 8 is a bar graph that compares the efficacy of SNCA_ASO_1613, SNCA_ASO_1617 and SNCA_ASO_1625 based on the expression of alpha synuclein protein at different doses of 1, 5, 10, 30 or 100 nmol. Reductions in mRNA and protein levels were analyzed two weeks post injection.
  • SNCA_ASO_01613 is a 2-3-10-3-2 BNA/MOE gapmer as described above, in which the internucleoside linkages between nucleosides 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methyl cytosine;
  • FIG. 9 is a dot graph that represents the amount of ASO quantified per mg of cortex by HPLC fluorescence after a single ICY injection of multiple doses.
  • Table AB Dose effect of ASO Concentration in the Cortex of hSNCA mice
  • Example 6 Tolerability of of Modified Oligonucleotides in Rat [0269] Male Winstar rats received a single intrathecal bolus injection of oligonucleotide at a dose of 2.5 mg. Sterile saline syringes and nuclease free centrifuge tubes were used to prepare dosing solutions. The tubes containing ASO powder were briefly centrifuged before adding aCSF solution, then re-centrifuged for 10 minutes to fully dissolve the ASO powder. The solution was vortexed for ⁇ 1 min, stored at 4°C and filtered with a 0.22pm filter until use.
  • the tolerability score is represented as the Functional Observational Battery (FOB) score at one-hour, three-hour and twenty-four hours post injection.
  • FOB Functional Observational Battery
  • mice Three-month-old hSNCA mice, divided into groups of five to six mice each, received a single unilateral bolus injection of oligonucleotide SNCA AS0 1613 or SNCA_ASO_1617 at two doses of 10 and 50 nmol described in Table AD below. A group of three mice received PBS as a negative control for each experiment.
  • mice were sacrificed at different timepoint (2-6-12-20 weeks) post-injection.
  • Cortical, cerebellum and striatum brain tissue were collected and the level of hSNCA mRNA was measured by qRT-PCR as described above and the level of alpha synuclein protein was measured by ELISA kit as described above.
  • Results are presented in the tables as percent reduction of the amount of SNCA mRNA and alpha synuclein protein relative to vehicle (PBS) control groups. A value of 0% reduction indicates that the compound had no effect.
  • FIG. 11 is a dot graph that compares the SNCA-ASO-01617 and SNCA_ASO_01613 at the dose of lOnmol and 50 nmol in the cortex based on SNCA mRNA expression quantified by qRT-PCR as described above.
  • FIG. 12 is a dot graph a dots graph that compares the SNCA-ASO-01617 and SNCA ASO 01613 at the dose of lOnmol and 50 nmol in the cerebellum based on SNCA mRNA expression quantified by qRT-PCR as described above.
  • FIG. 13 is a dot graph a dots graph that compares the SNCA-ASO-01617 and SNCA_ASO_01613 at the dose of lOnmol and 50 nmol in the striatum based on SNCA mRNA expression quantified by qRT-PCR as described above.
  • Table AD PK/PD analysis at different timepoint in hSNCA mice
  • alpha-synuclein pathology was analyzed by measuring the level of the phosphorylated form (pS129) of alpha-synuclein with a commercial immunoassay kit (Cisbio, #6FSYNPEG) according to the manufacturer’s instructions.
  • This assay is based on a sandwich assay with two different specific antibodies, one binding the pS129 motif of alpha- synuclein and the other recognizing the alpha-synuclein protein, labelled with a donor or an acceptor dye.
  • FIG. 15 is a bar graph that represents the level of alpha-synuclein pathology (phosphorylated form) in primary neuronal culture measuring by a TR-FRET based immunoassay.
  • the level of phosphorylated alpha-synuclein was normalized by the level of alpha-tubulin and values were related to wells treated with vehicle (PBS). Seeded neurons were treated at DIV7 with a high dose (330nM) of specific ASOs (SNCA) or an unspecific ASO (Malatl) as described in Table AE below.
  • FIG. 16 is a bar graph that represents the level of alpha-synuclein pathology

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/EP2022/055770 2021-03-08 2022-03-07 Antisense oligonucleotides for inhibiting alpha-synuclein expression WO2022189363A1 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
EP22710115.1A EP4305168A1 (en) 2021-03-08 2022-03-07 Antisense oligonucleotides for inhibiting alpha-synuclein expression
IL305668A IL305668A (en) 2021-03-08 2022-03-07 Antisense oligonucleotides to inhibit alpha-synuclein expression
CN202280033253.1A CN117280032A (zh) 2021-03-08 2022-03-07 抑制α-突触核蛋白表达的反义寡核苷酸
CA3212650A CA3212650A1 (en) 2021-03-08 2022-03-07 Antisense oligonucleotides for inhibiting alpha-synuclein expression
AU2022234522A AU2022234522A1 (en) 2021-03-08 2022-03-07 Antisense oligonucleotides for inhibiting alpha-synuclein expression
PE2023002509A PE20240696A1 (es) 2021-03-08 2022-03-07 Oligonucleotidos antisentido para inhibir la expresion de la alfa-sinucleina
MX2023010535A MX2023010535A (es) 2021-03-08 2022-03-07 Oligonucleotidos antisentido para inhibir la expresion de la alfa-sinucleina.
JP2023554365A JP2024508956A (ja) 2021-03-08 2022-03-07 アルファ－シヌクレイン発現を阻害するためのアンチセンスオリゴヌクレオチド。

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP21315033 2021-03-08
EP21315033.7 2021-03-08
EP21306123 2021-08-17
EP21306123.7 2021-08-17

Publications (1)

Publication Number Publication Date
WO2022189363A1 true WO2022189363A1 (en) 2022-09-15

Family

ID=80738805

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2022/055770 WO2022189363A1 (en) 2021-03-08 2022-03-07 Antisense oligonucleotides for inhibiting alpha-synuclein expression

Country Status (10)

Country Link
EP (1) EP4305168A1 (es)
JP (1) JP2024508956A (es)
AU (1) AU2022234522A1 (es)
CA (1) CA3212650A1 (es)
CL (1) CL2023002644A1 (es)
IL (1) IL305668A (es)
MX (1) MX2023010535A (es)
PE (1) PE20240696A1 (es)
TW (1) TW202305132A (es)
WO (1) WO2022189363A1 (es)

Citations (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993007883A1 (en) 1991-10-24 1993-04-29 Isis Pharmaceuticals, Inc. Derivatized oligonucleotides having improved uptake and other properties
WO2011097643A1 (en) * 2010-02-08 2011-08-11 Isis Pharmaceuticals, Inc. Selective reduction of allelic variants
WO2012068405A2 (en) 2010-11-17 2012-05-24 Isis Pharmaceuticals, Inc. Modulation of alpha synuclein expression
WO2012109395A1 (en) * 2011-02-08 2012-08-16 Isis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
WO2013033230A1 (en) 2011-08-29 2013-03-07 Isis Pharmaceuticals, Inc. Oligomer-conjugate complexes and their use
WO2013159108A2 (en) * 2012-04-20 2013-10-24 Isis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
WO2014076196A1 (en) 2012-11-15 2014-05-22 Santaris Pharma A/S Anti apob antisense conjugate compounds
WO2014179620A1 (en) 2013-05-01 2014-11-06 Isis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
WO2014207232A1 (en) 2013-06-27 2014-12-31 Santaris Pharma A/S Antisense oligomers and conjugates targeting pcsk9
WO2017015555A1 (en) 2015-07-22 2017-01-26 Wave Life Sciences Ltd. Oligonucleotide compositions and methods thereof
WO2018154418A1 (en) * 2017-02-22 2018-08-30 Crispr Therapeutics Ag Materials and methods for treatment of early onset parkinson's disease (park1) and other synuclein, alpha (snca) gene related conditions or disorders
WO2019138057A1 (en) * 2018-01-12 2019-07-18 Roche Innovation Center Copenhagen A/S Alpha-synuclein antisense oligonucleotides and uses thereof
WO2019164562A2 (en) * 2017-11-09 2019-08-29 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing snca expression
US20200385723A1 (en) 2019-05-06 2020-12-10 University Of Massachusetts Anti-c9orf72 oligonucleotides and related methods

Patent Citations (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993007883A1 (en) 1991-10-24 1993-04-29 Isis Pharmaceuticals, Inc. Derivatized oligonucleotides having improved uptake and other properties
WO2011097643A1 (en) * 2010-02-08 2011-08-11 Isis Pharmaceuticals, Inc. Selective reduction of allelic variants
WO2012068405A2 (en) 2010-11-17 2012-05-24 Isis Pharmaceuticals, Inc. Modulation of alpha synuclein expression
WO2012109395A1 (en) * 2011-02-08 2012-08-16 Isis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
WO2013033230A1 (en) 2011-08-29 2013-03-07 Isis Pharmaceuticals, Inc. Oligomer-conjugate complexes and their use
WO2013159108A2 (en) * 2012-04-20 2013-10-24 Isis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
WO2014076196A1 (en) 2012-11-15 2014-05-22 Santaris Pharma A/S Anti apob antisense conjugate compounds
WO2014179620A1 (en) 2013-05-01 2014-11-06 Isis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
WO2014207232A1 (en) 2013-06-27 2014-12-31 Santaris Pharma A/S Antisense oligomers and conjugates targeting pcsk9
WO2017015555A1 (en) 2015-07-22 2017-01-26 Wave Life Sciences Ltd. Oligonucleotide compositions and methods thereof
WO2018154418A1 (en) * 2017-02-22 2018-08-30 Crispr Therapeutics Ag Materials and methods for treatment of early onset parkinson's disease (park1) and other synuclein, alpha (snca) gene related conditions or disorders
WO2019164562A2 (en) * 2017-11-09 2019-08-29 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing snca expression
WO2019138057A1 (en) * 2018-01-12 2019-07-18 Roche Innovation Center Copenhagen A/S Alpha-synuclein antisense oligonucleotides and uses thereof
US20200385723A1 (en) 2019-05-06 2020-12-10 University Of Massachusetts Anti-c9orf72 oligonucleotides and related methods

Non-Patent Citations (23)

* Cited by examiner, † Cited by third party
Title
"ACS Symposium Series", article "Carbohydrate Modifications in Antisense Research", pages: 40 - 65
"GenBank", Database accession no. NM 001146055.1
"UniProt", Database accession no. Q6IAU6
CROOKE ET AL., J PHARMACOL. EXP. THER., vol. 277, 1996, pages 923 - 37
ELLINGTON ET AL.: "Introduction to the synthesis and purification of oligonucleotides", CURR. PROTOC. NUCLEIC ACID CHEM., 2001
KABANOV ET AL., FEBSLETT, vol. 259, 1990, pages 327 - 30
LETSINGER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 6553 - 6
MANOHARAN ET AL., ANN. NY. ACAD. SCI., vol. 660, 1992, pages 306 - 309
MANOHARAN ET AL., BIOORG. MED. CHEM. LETT., vol. 3, 1993, pages 2765 - 70
MANOHARAN ET AL., BIOORG. MED. CHEM. LETT., vol. 4, 1994, pages 1053 - 60
MANOHARAN ET AL., NUCLEOSIDES & NUCLEOTIDES, vol. 14, 1995, pages 969 - 73
MANOHARAN ET AL., TETRAHEDRON LETT, vol. 36, 1995, pages 3651 - 4
MISHRA ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 1264, 1995, pages 229 - 37
NAKAMORI MASAYUKI ET AL: "Nucleic Acid-Based Therapeutics for Parkinson's Disease", NEUROTHERAPEUTICS, ELSEVIER INC, US, vol. 16, no. 2, 12 February 2019 (2019-02-12), pages 287 - 298, XP037018860, ISSN: 1933-7213, [retrieved on 20190212], DOI: 10.1007/S13311-019-00714-7 *
NISHINA ET AL., MOLECULAR THERAPY NUCLEIC ACIDS, vol. 4, 2015, pages e220
NISHINA ET AL., MOLECULAR THERAPY, vol. 16, 2008, pages 734 - 40
OBERHAUSER ET AL., NUCL. ACIDS RES., vol. 20, 1992, pages 533 - 8
OKA ET AL., JACS, vol. 125, 2003, pages 8307
SAISON-BEHMOARAS ET AL., EMBO J, vol. 10, 1991, pages 1111 - 8
SHEA ET AL., NUCL. ACIDS RES., vol. 18, 1990, pages 3777 - 83
SVINARCHUK ET AL., BIOCHIMIE, vol. 75, 1993, pages 49 - 54
WAN ET AL., NUC. ACID. RES., vol. 42, 2014, pages 13456
YAMADA ET AL., J. AM. CHEM. SOC., vol. 128, no. 15, 2006, pages 5251 - 61

Also Published As

Publication number Publication date
PE20240696A1 (es) 2024-04-10
MX2023010535A (es) 2023-09-19
TW202305132A (zh) 2023-02-01
CA3212650A1 (en) 2022-09-15
IL305668A (en) 2023-11-01
JP2024508956A (ja) 2024-02-28
EP4305168A1 (en) 2024-01-17
CL2023002644A1 (es) 2024-04-01
AU2022234522A1 (en) 2023-10-26

Similar Documents

Publication Publication Date Title
JP7354342B2 (ja) タウ発現を調節するための組成物
US11279933B2 (en) Antisense oligonucleotides for the treatment of leber congenital amaurosis
JP6983343B2 (ja) Ｔｇｆ−ｒシグナリング阻害剤としてのアンチセンス−オリゴヌクレオチド
US20220411796A1 (en) Compositions and methods for decreasing tau expression
WO2012138487A2 (en) Oligonucleotide modulation of splicing
JP2023536974A (ja) Ｌｐａ発現を阻害するための組成物及び方法
TW202012624A (zh) 用以調節atxn2 表達之寡核苷酸
JP2021048877A (ja) 脊髄性筋萎縮症におけるエクソン包含のための修飾アンチセンスオリゴマー
US11655472B2 (en) Antisense nucleic acid that induces skipping of exon 50
TW201837172A (zh) 抑制masp2之表現之核酸
AU2022234522A1 (en) Antisense oligonucleotides for inhibiting alpha-synuclein expression
JPWO2018221649A1 (ja) Ａｐｃｓの発現を抑制する核酸
US20220098595A1 (en) Nr2e3 expression reducing oligonucleotides, compositions containing the same, and methods of their use
CN117280032A (zh) 抑制α-突触核蛋白表达的反义寡核苷酸
JPWO2005074988A1 (ja) 神経細胞分化誘導剤
US20240360455A1 (en) Extra-hepatic delivery irna compositions and methods of use thereof
US20240200064A1 (en) Gene therapy for inflammatory conditions
US20230081388A1 (en) Antisense oligomers and methods for treating parkin-related pathologies
WO2024187102A2 (en) Compositions and methods for modulating c3
Kanatsu et al. Discovery and characterization of stereodefined PMO-gapmers targeting tau
WO2024187097A2 (en) Compositions and methods for modulating sptlc1
WO2023112931A1 (ja) ＡＴＮ１ ｍＲＮＡ又はｐｒｅ－ｍＲＮＡを標的とするアンチセンスオリゴヌクレオチド
KR20220139366A (ko) 안티센스 올리고뉴클레오티드 및 펜드리드 증후군 치료를 위한 이의 용도
US20140275207A1 (en) Antisense compounds and methods of use thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22710115

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 12023552426

Country of ref document: PH

WWE Wipo information: entry into national phase

Ref document number: 305668

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 2023554365

Country of ref document: JP

Ref document number: 3212650

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: MX/A/2023/010535

Country of ref document: MX

Ref document number: P6002237/2023

Country of ref document: AE

Ref document number: 002509-2023

Country of ref document: PE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112023018017

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: 202317066755

Country of ref document: IN

Ref document number: 202392515

Country of ref document: EA

Ref document number: AU2022234522

Country of ref document: AU

Ref document number: 2022234522

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2022710115

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2022710115

Country of ref document: EP

Effective date: 20231009

ENP Entry into the national phase

Ref document number: 2022234522

Country of ref document: AU

Date of ref document: 20220307

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 11202306533S

Country of ref document: SG

WWE Wipo information: entry into national phase

Ref document number: 202280033253.1

Country of ref document: CN

ENP Entry into the national phase

Ref document number: 112023018017

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20230905

WWE Wipo information: entry into national phase

Ref document number: 523450546

Country of ref document: SA

WWE Wipo information: entry into national phase

Ref document number: 523450546

Country of ref document: SA