WO2022145710A1 - 마이크로코커스 루테우스 유래 세포외 소포를 포함하는 신경발달 질환, 신경질환, 또는 정신질환 예방 또는 치료용 조성물 - Google Patents

마이크로코커스 루테우스 유래 세포외 소포를 포함하는 신경발달 질환, 신경질환, 또는 정신질환 예방 또는 치료용 조성물 Download PDF

Info

Publication number
WO2022145710A1
WO2022145710A1 PCT/KR2021/016633 KR2021016633W WO2022145710A1 WO 2022145710 A1 WO2022145710 A1 WO 2022145710A1 KR 2021016633 W KR2021016633 W KR 2021016633W WO 2022145710 A1 WO2022145710 A1 WO 2022145710A1
Authority
WO
WIPO (PCT)
Prior art keywords
disease
disorder
micrococcus luteus
diseases
neurodevelopmental
Prior art date
Application number
PCT/KR2021/016633
Other languages
English (en)
French (fr)
Inventor
김윤근
Original Assignee
주식회사 엠디헬스케어
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020210156079A external-priority patent/KR102670461B1/ko
Application filed by 주식회사 엠디헬스케어 filed Critical 주식회사 엠디헬스케어
Priority to CN202180088164.2A priority Critical patent/CN116806153A/zh
Priority to EP21915508.2A priority patent/EP4268836A1/en
Priority to JP2023539322A priority patent/JP2024501034A/ja
Publication of WO2022145710A1 publication Critical patent/WO2022145710A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/135—Bacteria or derivatives thereof, e.g. probiotics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/74—Bacteria

Definitions

  • the present invention relates to an extracellular vesicle derived from Micrococcus luteus and its use, and more particularly, to a neurodevelopmental disease, neurological disease, or mental disease prevention or It relates to a composition for treatment and the like.
  • neurologic diseases including cognitive dysfunction such as Alzheimer's disease, and motor dysfunction such as Parkinson's disease and Lou Gehrig's disease; neurodevelopmental disorders such as autism, attention deficit hyperactivity disorder, and the like; Psychiatric diseases such as anxiety disorders, depression, and schizophrenia are major diseases that determine the quality of human life and are a major problem in public health.
  • nerve cells causes abnormalities in the structure and function of brain-nerve tissue by abnormal death of nerve cells.
  • Neurological diseases such as chronic inflammatory demyelinating polyneuropathy and diabetic neuropathy, occur as a result of neuronal degeneration or neuroinflammation.
  • Kearns-Sayre syndrome (KSS), chronic progressive external ophthalmoplegia (CPEO), mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes (MELAS), MERRF syndrome ( Neurological diseases such as myoclonic epilepsy with ragged-red fibers (MERRF), neurogenic weakness with ataxia and retinitis pigmentosa (NARP), Leigh syndrome (LS), and mitochondrial recessive ataxia syndrome (MIRAS syndrome) also caused by degenerative changes in
  • Energy metabolism is the process of creating various substances by making energy necessary to perform cell functions. Proteins and lipids are produced in the endoplasmic reticulum (ER) through ATP made in mitochondria and supplied to necessary areas. Cells face various stresses from the moment they are created, and biological, chemical, physical, or mental stress induces endoplasmic reticulum (ER) stress, mitochondrial dysfunction, lysosomal damage, etc. abnormal substances are made in the cell, and the cells recognize this as a risk factor (danger signal) and induce an inflammatory response.
  • ER endoplasmic reticulum
  • ER endoplasmic reticulum
  • mitochondrial dysfunction mitochondrial dysfunction
  • lysosomal damage etc.
  • abnormal substances are made in the cell, and the cells recognize this as a risk factor (danger signal) and induce an inflammatory response.
  • Immunity is a defense mechanism of cells against biological, chemical, physical, and mental stress, and occurs through innate immunity and adaptive immunity. Recently, in relation to the pathogenesis of inflammatory diseases caused by immune dysfunction, a risk factor (danger signal) resulting from intracellular oxidative stress has been detected in the cytoplasmic pattern recognition receptor (PRR), Nucleotide-binding oligomerization domain (NLRP). It is known that NLRP3 protein forms an inflammasome and causes an inflammatory response and abnormal apoptosis. In particular, inflammation caused by activation of the NLRP3 inflammasome has become known as a key etiological mechanism of several neurodevelopmental diseases, neurological diseases, and psychiatric diseases.
  • PRR cytoplasmic pattern recognition receptor
  • NLRP3 protein forms an inflammasome and causes an inflammatory response and abnormal apoptosis.
  • inflammation caused by activation of the NLRP3 inflammasome has become known as a key etiological mechanism of several neurodevelopmental diseases
  • Microbiota or microbiome refers to a microbial community, including bacteria, archaea, and eukaryotes, present in a given habitat.
  • Bacterial-derived vesicles secreted locally are absorbed through epithelial cells of the mucous membrane to induce a local inflammatory response, and vesicles that have passed through epithelial cells are systemically absorbed through lymphatic vessels and distributed to each organ. Regulates immune and inflammatory responses.
  • vesicles derived from pathogenic Gram-negative bacteria such as Escherichia coli cause local colitis as pathogenic nanoparticles. It promotes inflammatory response and blood clotting, and is absorbed into muscle cells where insulin works, leading to insulin resistance and diabetes.
  • vesicles derived from beneficial bacteria can control diseases by regulating abnormalities in immune and metabolic functions caused by pathogenic vesicles.
  • Micrococcus luteus is a gram-positive bacterium belonging to the genus Micrococcus, and is a bacterium widely distributed in nature such as water, dust, soil, and the like. This bacterium is known to produce riboflavin when grown in toxic organic pollutants such as pyridine and to absorb ultraviolet light through lutein pigment. In addition, this fungus is isolated from dairy products and beer, grows in a dry environment or high salt environment, does not form spores, but is known to survive for a long time even at a refrigeration temperature such as a refrigerator.
  • the present inventors significantly inhibited the secretion of inflammatory mediators by pathogenic factors and abnormal immune function caused by pathogenic factors when micrococcus luteus-derived vesicles were treated in cells. It was confirmed that micrococcus luteus-derived vesicles were effectively inhibited. In addition, it was confirmed that Micrococcus luteus-derived vesicles regulate immune function by suppressing the secretion of inflammatory mediators through NLRP3 protein expression and NLRP3 inflammasome formation, which are related to the pathogenesis of various diseases.
  • the vesicles increase cellular homeostasis by activating eNOS (endothelial NO synthase), which is an important signal for cellular homeostasis.
  • eNOS endothelial NO synthase
  • the vesicles were treated in a mouse model of brain disease causing cognitive dysfunction by excessively inducing apoptosis of nerve cells, not only behavioral disorders related to cognitive functions but also abnormal protein deposition was inhibited.
  • Micrococcus luteus-derived vesicles increase proliferation and differentiation of neural stem cells, and inter-neuronal intergrity, and thus have therapeutic effects on neurodevelopmental diseases, neurological diseases or mental disorders.
  • BDNF brain-derived neurotrophic factor
  • an object of the present invention is to provide a pharmaceutical composition for preventing or treating a neurodevelopmental disease, a neurological disease, or a mental disease, comprising vesicles derived from Micrococcus luteus as an active ingredient.
  • the present invention is Micrococcus luteus ( Micrococcus luteus ) It is an object of the present invention to provide a food composition for preventing or improving neurodevelopmental disease, neurological disease, or mental disease, comprising vesicles derived from it as an active ingredient.
  • Another object of the present invention is to provide an inhalant composition for preventing or treating a neurodevelopmental disease, a neurological disease, or a mental disease, comprising vesicles derived from Micrococcus luteus as an active ingredient.
  • an object of the present invention is to provide a composition for drug delivery comprising vesicles derived from Micrococcus luteus as an active ingredient, for treatment of neurodevelopmental diseases, neurological diseases, or psychiatric diseases.
  • an object of the present invention is to provide a pharmaceutical composition for anti-aging, comprising vesicles derived from Micrococcus luteus as an active ingredient.
  • an object of the present invention is to provide a food composition for anti-aging, comprising a vesicle derived from Micrococcus luteus as an active ingredient.
  • an object of the present invention is to provide a pharmaceutical composition for preventing or treating a neurodevelopmental disease, a neurological disease, or a mental disease, comprising a vesicle derived from bacteria of the genus Micrococcus as an active ingredient.
  • the present invention provides a pharmaceutical composition for preventing or treating a neurodevelopmental disease, a neurological disease, or a psychiatric disease, comprising a micrococcus luteus -derived vesicle as an active ingredient provides
  • the present invention provides a food composition for preventing or improving neurodevelopmental diseases, neurological diseases, or mental diseases, comprising vesicles derived from Micrococcus luteus as an active ingredient.
  • the present invention provides an inhalant composition for preventing or treating neurodevelopmental diseases, neurological diseases, or mental diseases, comprising vesicles derived from Micrococcus luteus as an active ingredient.
  • the present invention provides a composition for drug delivery comprising a vesicle derived from Micrococcus luteus as an active ingredient, for the treatment of neurodevelopmental diseases, neurological diseases, or mental disorders.
  • the present invention provides a pharmaceutical composition for anti-aging, comprising a vesicle derived from Micrococcus luteus as an active ingredient.
  • the present invention provides a food composition for anti-aging, comprising micrococcus luteus -derived vesicles as an active ingredient.
  • the present invention provides a pharmaceutical composition for preventing or treating a neurodevelopmental disease, a neurological disease, or a psychiatric disease, comprising vesicles derived from bacteria of the genus Micrococcus as an active ingredient.
  • the neurological disease may be a neurodegenerative disease or an inflammatory neurological disease, but is not limited thereto.
  • the neurodegenerative disease is Alzheimer's disease, Parkinson's disease, amyotropic lateral sclerosis, Huntington's disease, epilepsy, Kearns -Kearns-Sayre syndrome (KSS), chronic progressive external ophthalmoplegia (CPEO), mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes (MELAS), MERRF syndrome (myoclonic epilepsy with It may be one or more diseases selected from the group consisting of ragged-red fibers; MERRF), NARP syndrome (neurogenic weakness with ataxia and retinitis pigmentosa; NARP), Leigh syndrome (LS), and MIRAS syndrome (mitochondrial recessive ataxia syndrome)
  • the present invention is not limited thereto.
  • the inflammatory neurological disease is one selected from the group consisting of multiple sclerosis, chronic inflammatory demyelinating polyneuropathy, and diabetic neuropathy. It may be the above disease, but is not limited thereto.
  • the mental disorder is major depressive disorder, bipolar disorder, anxiety disorder, schizophrenia, obsessive compulsive disorder, trauma
  • At least one disease selected from the group consisting of post-traumatic stress disorder, dissociative disorder, eating disorder, substance use disorder, and personality disorder can, but is not limited thereto.
  • the anxiety disorder is selected from the group consisting of panic disorder, social anxiety disorder, generalized anxiety disorder, and specific phobia. It may be one or more anxiety disorders, but is not limited thereto.
  • the personality disorder is paranoid personality disorder, antisocial personality disorder, borderline personality disorder, narcissistic personality disorder , avoidant personality disorder, and one or more personality disorders selected from the group consisting of dependent personality disorder, but is not limited thereto.
  • the neurodevelopmental disease is intellectual disability, communication disorder, autism spectrum disorder, attention deficit hyperactivity disorder (attention deficit hyperactivity disorder) , a specific learning disorder, and may be at least one selected from the group consisting of motor disorder, but is not limited thereto.
  • the neurodevelopmental disease, neurological disease, or mental disease may be due to a neurogenesis dysfunction, but is not limited thereto.
  • the neurodevelopmental disease, neurological disease, or mental disease may be mediated by NLRP3 inflammasome (NLR family pyrin domain containing 3 inflammasome), but is not limited thereto.
  • NLRP3 inflammasome NLR family pyrin domain containing 3 inflammasome
  • the composition may inhibit NLRP3 inflammasome formation, but is not limited thereto.
  • the vesicle may have an average diameter of 10 to 200 nm, but is not limited thereto.
  • the vesicle may be naturally secreted or artificially produced in Micrococcus luteus , but is not limited thereto.
  • the composition may inhibit the aging of the brain or nerve cells, but is not limited thereto.
  • the present invention includes the step of administering a composition comprising a vesicle derived from Micrococcus luteus as an active ingredient to an individual in need thereof, neurodevelopmental disease, neurological disease, or prevention or treatment of mental disease provide a way
  • the present invention provides the use of a composition comprising vesicles derived from Micrococcus luteus as an active ingredient for preventing or treating neurodevelopmental disease, neurological disease, or mental disease.
  • the present invention provides the use of micrococcus luteus -derived vesicles for the manufacture of a medicament for the treatment of neurodevelopmental diseases, neurological diseases, or mental diseases.
  • the present invention comprises the steps of administering a composition comprising a vesicle derived from Micrococcus luteus carrying a desired neurodevelopmental disease, neurological disease, or psychiatric treatment drug as an active ingredient to an individual in need thereof. It provides a drug delivery method for treating a neurodevelopmental disease, a neurological disease, or a psychiatric disease, comprising:
  • the present invention provides a drug delivery use of a composition comprising vesicles derived from Micrococcus luteus as an active ingredient for treating neurodevelopmental diseases, neurological diseases, or mental disorders.
  • the present inventors confirmed that when micrococcus luteus-derived vesicles were orally administered, vesicles were absorbed into blood vessels and distributed in brain tissue.
  • vesicles were treated with epithelial cells and inflammatory cells, secretion of inflammatory mediators caused by pathogenic factors was significantly inhibited, and when the cells were treated with the vesicles, NLRP3 protein expression and NF-kB ( p65) signal was confirmed to be inhibited.
  • NF-kB p65
  • BDNF gene expression suppressed by pathogenic factors was restored.
  • sirtuin 1 and sirtuin 7 genes, which are suppressed by pathogenic factors were restored when the vesicles were treated in neurons.
  • cognitive function was significantly restored.
  • the vesicles were administered to the neurological disease mouse model, it was confirmed that the neurogenesis was significantly restored.
  • the vesicles derived from Micrococcus luteus according to the present invention are Alzheimer's disease and Parkinson's disease.
  • amyotropic lateral sclerosis Huntington's disease, epilepsy, multiple sclerosis, chronic inflammatory demyelinating polyneuropathy, diabetic neuropathy neuropathy, autism spectrum disorder, attention deficit hyperactivity syndrome, major depressive disorder, bipolar disorder, anxiety disorder, schizophrenia ), obsessive compulsive disorder, post-traumatic stress disorder, dissociative disorder, eating disorder, substance use disorder, and personality disorder disorder
  • 1 is a view showing the results of measuring the fluorescence intensity in each organ by extracting each organ for each time after oral administration of micrococcus luteus-derived vesicles to mice.
  • FIG. 2 is a view showing the distribution of vesicles in brain tissue over time after oral administration of vesicles derived from Micrococcus luteus to mice.
  • MDH-101 EV micrococcus luteus-derived vesicle
  • Dex positive control drug dexamethasone
  • FIG. 4A and 4B show the dose dependence of Micrococcus luteus-derived vesicles on the inhibition of IL-8 secretion by E. coli-derived vesicles by administration of Micrococcus luteus-derived vesicles (MDH-101) to epithelial cells.
  • (a) is a diagram showing the experimental results
  • E. coli-derived vesicles E. coli EV
  • M. luteus EV Micrococcus luteus-derived vesicles
  • E. coli EV E. coli-derived vesicles
  • M. luteus EV Micrococcus luteus-derived vesicles
  • FIG. 7 is a view showing the immune function-regulating proteins NLRP3, T-bet from tissues isolated from mice administered with lipopolysaccharide (LPS), an inflammatory causative factor, in order to evaluate the effect of modulating immune function by Micrococcus luteus-derived vesicles (MlEV). , A diagram showing the results of confirming the ROR- ⁇ t expression pattern.
  • LPS lipopolysaccharide
  • MlEV Micrococcus luteus-derived vesicles
  • FIG. 8 is a view showing the results of confirming the effect of inhibiting the secretion of IL-1 ⁇ , an inflammatory mediator, by LPS by administering Micrococcus luteus-derived vesicles (M. luteus EV) to macrophages.
  • M. luteus EV Micrococcus luteus-derived vesicles
  • FIG. 9 is a view showing the innate immunity-related signals JNK and NF-kB (p65) in tissues isolated from mice administered with LPS, an inflammatory causative factor, in order to evaluate the effect of modulating the innate immune function by Micrococcus luteus-derived vesicles (MlEV). ) is a diagram showing the results of evaluating the degree of activation.
  • MlEV micrococcus luteus-derived vesicles
  • MDH-101 micrococcus luteus-derived vesicle
  • Dexamethasone a positive control drug dexamethasone
  • MDH-101 micrococcus luteus-derived vesicle
  • a ⁇ amyloid protein
  • MDH-101 micrococcus luteus-derived vesicle in cells to evaluate the effect of the micrococcus luteus-derived vesicle (MDH-101) on the expression of important neurotrophin and receptor-related genes in neurogenesis. It is a diagram showing the results of evaluating the effect of administering amyloid-beta protein (A ⁇ ), a causative factor, on the expression of neurotrophin and receptor genes, which are inhibited by A ⁇ .
  • a ⁇ amyloid-beta protein
  • FIG. 14 is a diagram showing an experimental protocol for evaluating the therapeutic efficacy of micrococcus luteus-derived vesicles (MDH-101) in a mouse model of brain disease (Tg-APP/PS1 mice) administered orally (WT+veh) : normal mouse group, Tg+veh: brain disease mouse group, Tg+MDH-101: mouse group in which Micrococcus luteus-derived vesicles (MDH-101) were orally administered to a brain disease mouse model, the same hereinafter).
  • MDH-101 Micrococcus luteus-derived vesicles
  • FIG. 16 is a water maze test for evaluating the therapeutic efficacy of Micrococcus luteus-derived vesicles (MDH-101) on learning ability in a Tg-APP/PS1 brain disease mouse model.
  • MDH-101 Micrococcus luteus-derived vesicles
  • FIG. 16 is a water maze test for evaluating the therapeutic efficacy of Micrococcus luteus-derived vesicles (MDH-101) on learning ability in a Tg-APP/PS1 brain disease mouse model.
  • MDH-101 Micrococcus luteus-derived vesicles
  • FIG. 17 shows the results of evaluating the therapeutic efficacy of Micrococcus luteus-derived vesicles (MDH-101) on the improvement of memory ability in a Tg-APP/PS1 brain disease mouse model by a passive avoidance test
  • MDH-101 Micrococcus luteus-derived vesicles
  • a ⁇ plaque fluorescence staining images and quantitative data in the parietal cortex, hippocampus, and Piriform cortex regions of the Tg-APP/PS1 brain disease mouse model pictures of A ⁇ plaque staining in the parietal lobe, hippocampus, and gourd cortex of the Tg+veh group (TG) and Tg+MDH-101 group (a), the number of A ⁇ plaques per unit area (b), and A ⁇ per unit area It is a figure which shows the area (C) of a plaque.
  • a ⁇ plaque fluorescence staining images and quantitative data in the parietal cortex, hippocampus, and Piriform cortex regions of the Tg-APP/PS1 brain disease mouse model pictures of A ⁇ plaque staining in the parietal lobe, hippocampus, and gourd cortex of the Tg+veh group (TG) and Tg+MDH-101 group (a), the number of A ⁇ plaques per unit area (b), and A ⁇ per unit area It is a figure
  • FIG. 19 is a marker of early neurogenesis in the brain showing the therapeutic efficacy of Micrococcus luteus-derived vesicles (MDH-101) on the proliferation of neural stem cells in the hippocampus of the Tg-APP/PS1 brain disease mouse model.
  • the Ki-76 expression of phosphorus is shown through staining.
  • the left side is a diagram showing the Ki-67 staining result, and the right side shows the Tg+veh group and Tg+MDH-101 group compared to the normal mouse group (WT+veh). It is a diagram showing the number of cells stained for Ki-67 in percentage (WT CON: normal mouse group, TG CON: brain disease mouse group, the same hereinafter).
  • MDH-101 Micrococcus luteus-derived vesicles
  • Tg-APP/PS1 brain disease mouse model related to the differentiation and migration of neural stem cells.
  • the results of evaluation through staining of the marker doublecortin (DCX) are shown.
  • the left side is a diagram showing the DCX staining results, and the right side is a diagram showing the average number of cells stained with DCX.
  • Figure 21 shows the therapeutic efficacy of Micrococcus luteus-derived vesicles (MDH-101) on the formation of dendrites of neurons in the hippocampus of the Tg-APP/PS1 brain disease mouse model.
  • MDH-101 Micrococcus luteus-derived vesicles
  • the present invention relates to vesicles derived from Micrococcus luteus and uses thereof.
  • the present inventors confirmed that when micrococcus luteus-derived vesicles were orally administered to mice, the vesicles were systemically absorbed and distributed in brain tissue (see Example 2).
  • the present invention provides a pharmaceutical composition for preventing or treating a neurodevelopmental disease, a neurological disease, or a psychiatric disease comprising Micrococcus luteus-derived vesicles as an active ingredient.
  • the present invention may provide a pharmaceutical composition for anti-aging, comprising a vesicle derived from Micrococcus luteus as an active ingredient.
  • extracellular vesicle refers to a structure made of a nano-sized membrane secreted by various bacteria, for example, endotoxin (lipopolysaccharide) , vesicles or outer membrane vesicles (OMVs) from gram-negative bacteria such as Escherichia coli, which also contain toxic proteins and bacterial DNA and RNA, and peptidoglycan ( There are vesicles derived from gram-positive bacteria such as micrococcus bacteria that also contain peptidoglycan and lipoteichoic acid.
  • endotoxin lipopolysaccharide
  • OMVs outer membrane vesicles
  • gram-negative bacteria such as Escherichia coli
  • peptidoglycan There are vesicles derived from gram-positive bacteria such as micrococcus bacteria that also contain peptidoglycan and lipoteichoic acid.
  • the extracellular vesicles or vesicles may collectively refer to all membrane structures naturally secreted or artificially produced in Micrococcus luteus , and in the present invention, MDH-101, MDH It can be variously expressed as -101 EV, M. luteus EV, or MlEV.
  • the vesicles are heat-treated or high-pressure treated in the Micrococcus luteus culture process, or the bacterial culture medium is centrifuged, ultra-high-speed centrifugation, high-pressure treatment, extrusion, sonication, cell lysis, homogenization, freeze-thaw, electroporation, mechanical degradation,
  • the separation may be performed using one or more methods selected from the group consisting of chemical treatment, filtration by a filter, gel filtration chromatography, pre-flow electrophoresis, and capillary electrophoresis. In addition, it may further include processes such as washing for removal of impurities, concentration of the obtained vesicles, and the like.
  • the vesicles separated by the method have a spherical shape, and have an average diameter of 10-200 nm, 10-190 nm, 10-180 nm, 10-170 nm, 10-160 nm, 10-150 nm, 10 to 140 nm, 10-130 nm, 10-120 nm, 10-110 nm, 10-100 nm, 10-90 nm, 10-80 nm, 10-70 nm, 10-60 nm, 10-50 nm, 20 to 200 nm, 20 to 180 nm, 20 to 160 nm, 20 to 140 nm, 20 to 120 nm, 20 to 100 nm, or 20 to 80 nm, preferably, 20 to 200 nm, It is not limited thereto.
  • the term “comprising as an active ingredient” means including an amount sufficient to achieve efficacy or activity of the Micrococcus luteus-derived vesicle.
  • neurodevelopmental disorders refers to all developmental disorders that appear related to developmental delay or damage of the central nervous system, including the brain. It is known as a disease caused by a developmental disability, for example, intellectual disability, communication disorder, autism spectrum disorder, attention deficit hyperactivity disorder. ), specific learning disorder, and motor disorder.
  • neurologic diseases refers to diseases caused by abnormalities in the nervous system, that is, the brain, spinal cord, nerves, etc.
  • the neurologic disease is a degenerative neurological disease or inflammatory It may be a neurological disease, and may be included without limitation if it is a disease or condition caused by damage to nerve cells.
  • the term “degenerative neurological disease” refers to a disease occurring in the brain among degenerative diseases that occur with aging, for example, Alzheimer's disease, Parkinson's disease. , amyotropic lateral sclerosis, Huntington's disease, epilepsy, Kearns-Sayre syndrome (KSS), chronic progressive external ophthalmoplegia (CPEO), Melas syndrome (mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes; MELAS), MERRF syndrome (myoclonic epilepsy with ragged-red fibers; MERRF), NARP syndrome (neurogenic weakness with ataxia and retinitis pigmentosa; NARP), Leigh syndrome syndrome (LS), and mitochondrial recessive ataxia syndrome (MIRAS).
  • inflammatory neurological disease refers to a disease that occurs under the influence of neuroinflammation occurring in the central nervous system, for example, multiple sclerosis, chronic inflammatory demyelinating polyneuropathy ( chronic inflammatory demyelinating polyneuropathy, and diabetic neuropathy.
  • Psychiatric Diseases refers to a pathological mental state that affects a person’s thoughts, emotions, and behavior, and refers to a state in which mental function is impaired, for example, For example, major depressive disorder, bipolar disorder, anxiety disorder, schizophrenia, obsessive compulsive disorder, post-traumatic stress disorder , dissociative disorder, eating disorder, substance use disorder, and personality disorder.
  • anxiety disorder refers to a mental disorder in which a person feels anxious for no reason or the degree of anxiety is excessive, for example, panic disorder, social anxiety disorder. anxiety disorder), generalized anxiety disorder, and specific phobia.
  • personality disorder used in the present invention refers to pathological emotions, thoughts and behaviors of an individual that gradually develop from childhood and solidify in adolescence or early adulthood, for example, paranoid Paranoid personality disorder, antisocial personality disorder, borderline personality disorder, narcissistic personality disorder, avoidant personality disorder, and dependent personality disorder (dependent personality disorder), etc. may be included.
  • the neurodevelopmental disease, neurological disease, or mental disease may be a disease caused by a neurogenesis dysfunction, and more specifically, caused by a mitochondrial dysfunction caused by various stresses or NLRP3 inflammasome It may be a disease due to a disorder of neurogenesis caused by neuronal damage mediated by , neuroinflammation and/or neurodegeneration.
  • neuralgenesis refers to a process in which nerve cells are generated from neural stem cells, and may include adult neurogenesis.
  • the term “mediated by NLRP3 inflammasome (NLR family pyrin domain containing 3 inflammasome)” means that the excessively formed NLRP3 inflammasome induces a neuroinflammatory response through various signal transduction pathways.
  • the Micrococcus luteus-derived vesicle can inhibit the NLRP3 inflammasome formation by inhibiting the signal transduction pathway priming the NLRP3 inflammasome formation. It is possible to effectively prevent, improve, or treat a neurodevelopmental disease, neurological disease, or mental disease mediated by inflammasome (NLR family pyrin domain containing 3 inflammasome).
  • anti-aging means to delay aging as much as possible by preventing and inhibiting aging. It can suppress the aging of the brain or nerve cells.
  • the content of the vesicles in the composition of the present invention can be appropriately adjusted depending on the symptoms of the disease, the degree of progression of the symptoms, the condition of the patient, etc., for example, 0.0001 to 99.9% by weight, or 0.001 to 50% by weight based on the total weight of the composition.
  • the content ratio is a value based on the dry amount from which the solvent is removed.
  • the pharmaceutical composition according to the present invention may further include suitable carriers, excipients and diluents commonly used in the preparation of pharmaceutical compositions.
  • the excipient may be, for example, at least one selected from the group consisting of a diluent, a binder, a disintegrant, a lubricant, an adsorbent, a humectant, a film-coating material, and a controlled-release additive.
  • the pharmaceutical composition according to the present invention can be prepared according to a conventional method, respectively, in powders, granules, sustained-release granules, enteric granules, liquids, eye drops, elsilic, emulsions, suspensions, alcohols, troches, fragrances, and limonaade.
  • tablets, sustained release tablets, enteric tablets, sublingual tablets, hard capsules, soft capsules, sustained release capsules, enteric capsules, pills, tinctures, soft extracts, dry extracts, fluid extracts, injections, capsules, perfusates, Warnings, lotions, pasta, sprays, inhalants, patches, sterile injection solutions, or external preparations such as aerosols can be formulated and used, and the external preparations are creams, gels, patches, sprays, ointments, warning agents , lotion, liniment, pasta, or cataplasma.
  • Carriers, excipients and diluents that may be included in the pharmaceutical composition according to the present invention include lactose, dextrose, sucrose, oligosaccharide, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • formulation it is prepared using commonly used diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants.
  • water diluted hydrochloric acid, diluted sulfuric acid, sodium citrate, monostearate sucrose, polyoxyethylene sorbitol fatty acid esters (Twinester), polyoxyethylene monoalkyl ethers, lanolin ethers, Lanolin esters, acetic acid, hydrochloric acid, aqueous ammonia, ammonium carbonate, potassium hydroxide, sodium hydroxide, prolamine, polyvinylpyrrolidone, ethyl cellulose, sodium carboxymethyl cellulose, etc.
  • water diluted hydrochloric acid, diluted sulfuric acid, sodium citrate, monostearate sucrose, polyoxyethylene sorbitol fatty acid esters (Twinester), polyoxyethylene monoalkyl ethers, lanolin ethers, Lanolin esters, acetic acid, hydrochloric acid, aqueous ammonia, ammonium carbonate, potassium hydroxide, sodium hydroxide, prolamine, polyvinylpyrrolidone,
  • sucrose solution other sugars or sweeteners may be used, and if necessary, a fragrance, colorant, preservative, stabilizer, suspending agent, emulsifying agent, thickening agent, etc. may be used.
  • Purified water may be used in the emulsion according to the present invention, and if necessary, an emulsifier, preservative, stabilizer, fragrance, etc. may be used.
  • Suspending agents such as acacia, tragacantha, methylcellulose, carboxymethylcellulose, sodium carboxymethylcellulose, microcrystalline cellulose, sodium alginate, hydroxypropylmethylcellulose, HPMC 1828, HPMC 2906, HPMC 2910 may be used in the suspending agent according to the present invention. and, if necessary, surfactants, preservatives, stabilizers, colorants, and fragrances may be used.
  • Injectables according to the present invention include distilled water for injection, 0.9% sodium chloride injection, ring gel injection, dextrose injection, dextrose + sodium chloride injection, PEG (PEG), lactated ring gel injection, ethanol, propylene glycol, non-volatile oil-sesame oil , solvents such as cottonseed oil, peanut oil, soybean oil, corn oil, ethyl oleate, isopropyl myristate, and benzene benzoate; Solubilizing aids such as sodium benzoate, sodium salicylate, sodium acetate, urea, urethane, monoethylacetamide, butazolidine, propylene glycol, tweens, nijeongtinamide, hexamine, and dimethylacetamide; Weak acids and their salts (acetic acid and sodium acetate), weak bases and their salts (ammonia and ammonium acetate), organic compounds, proteins, buffers such as albumin, pepton
  • the suppository according to the present invention includes cacao fat, lanolin, witepsol, polyethylene glycol, glycerogelatin, methyl cellulose, carboxymethyl cellulose, a mixture of stearic acid and oleic acid, Subanal, cottonseed oil, peanut oil, palm oil, cacao butter + Cholesterol, Lecithin, Lanet Wax, Glycerol Monostearate, Tween or Span, Imhausen, Monolene (Propylene Glycol Monostearate), Glycerin, Adeps Solidus, Butyrum Tego -G), Cebes Pharma 16, Hexalide Base 95, Cotomar, Hydroxote SP, S-70-XXA, S-70-XX75 (S-70-XX95), Hydro Hydrokote 25, Hydrokote 711, Idropostal, Massa estrarium, A, AS, B, C, D, E, I, T, Massa-MF, Masupol, Masupol-15, Neos
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations include at least one excipient in the extract, for example, starch, calcium carbonate, sucrose ) or lactose, gelatin, etc.
  • excipients for example, starch, calcium carbonate, sucrose ) or lactose, gelatin, etc.
  • lubricants such as magnesium stearate and talc are also used.
  • Liquid formulations for oral administration include suspensions, internal solutions, emulsions, syrups, etc.
  • various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories.
  • Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.
  • composition according to the present invention is administered in a pharmaceutically effective amount.
  • pharmaceutically effective amount means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is determined by the type, severity, drug activity, and type of the patient's disease; Sensitivity to the drug, administration time, administration route and excretion rate, treatment period, factors including concurrent drugs and other factors well known in the medical field may be determined.
  • the pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or may be administered in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiple times. In consideration of all of the above factors, it is important to administer an amount capable of obtaining the maximum effect with a minimum amount without side effects, which can be easily determined by a person skilled in the art to which the present invention pertains.
  • the pharmaceutical composition of the present invention may be administered to an individual by various routes. All modes of administration can be contemplated, for example, oral administration, subcutaneous injection, intraperitoneal administration, intravenous injection, intramuscular injection, paraspinal space (intrathecal) injection, sublingual administration, buccal administration, rectal insertion, vaginal It can be administered according to internal insertion, ocular administration, ear administration, nasal administration, inhalation, spraying through the mouth or nose, skin administration, transdermal administration, and the like.
  • the pharmaceutical composition of the present invention is determined according to the type of drug as an active ingredient along with several related factors such as the disease to be treated, the route of administration, the patient's age, sex, weight, and the severity of the disease.
  • the effective amount of the composition according to the present invention may vary depending on the patient's age, sex, and weight, and generally 0.001 to 150 mg, preferably 0.01 to 100 mg per kg of body weight, is administered daily or every other day, or 1 It can be administered in divided doses 1 to 3 times a day.
  • the dosage is not intended to limit the scope of the present invention in any way.
  • the present invention includes the step of administering a composition comprising a vesicle derived from Micrococcus luteus as an active ingredient to an individual in need thereof, neurodevelopmental disease, neurological disease, or prevention or treatment of mental disease provide a way
  • the present invention provides the use of a composition comprising vesicles derived from Micrococcus luteus as an active ingredient for preventing or treating neurodevelopmental disease, neurological disease, or mental disease.
  • the present invention provides the use of micrococcus luteus -derived vesicles for the manufacture of a medicament for the treatment of neurodevelopmental diseases, neurological diseases, or mental diseases.
  • “individual” means a subject in need of treatment for a disease, and more specifically, human or non-human primates, mice, rats, dogs, cats, horses, cattle, etc. It may be a mammal of, but is not limited thereto.
  • administration means providing a predetermined composition of the present invention to an individual by any suitable method.
  • prevention means any action that suppresses or delays the onset of a target disease
  • treatment means that the target disease and its metabolic abnormalities are improved or It means all actions that are beneficially changed
  • improvement means all actions that reduce the desired disease-related parameters, for example, the degree of symptoms by administration of the composition according to the present invention.
  • the present invention provides a food composition for preventing or improving neurodevelopmental diseases, neurological diseases, or mental diseases, comprising vesicles derived from Micrococcus luteus as an active ingredient.
  • the present invention can provide a food composition for anti-aging, comprising micrococcus luteus -derived vesicles as an active ingredient.
  • the food composition may be a health functional food composition, but is not limited thereto.
  • the vesicle of the present invention When the vesicle of the present invention is used as a food additive, it may be added as it is or may be used with other foods or food ingredients, and may be appropriately used according to a conventional method.
  • the mixed amount of the active ingredient may be appropriately determined according to the purpose of use (prevention, health or therapeutic treatment).
  • the antifoam of the present invention may be added in an amount of 15% by weight or less, or 10% by weight or less based on the raw material.
  • the amount may be less than the above range, and since there is no problem in terms of safety, the active ingredient may be used in an amount above the above range.
  • Examples of foods to which the above substances can be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, dairy products including ice cream, various soups, beverages, tea, drinks, There are alcoholic beverages and vitamin complexes, and includes all health functional foods in the ordinary sense.
  • the health beverage composition according to the present invention may contain various flavoring agents or natural carbohydrates as additional ingredients, as in a conventional beverage.
  • the above-mentioned natural carbohydrates are monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol.
  • natural sweeteners such as taumartin and stevia extract, synthetic sweeteners such as saccharin and aspartame, and the like can be used.
  • the proportion of the natural carbohydrate is generally about 0.01-0.20 g, or about 0.04-0.10 g per 100 mL of the composition of the present invention.
  • the composition of the present invention includes various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, Carbonating agents used in carbonated beverages, etc. may be contained.
  • the composition of the present invention may contain the pulp for the production of natural fruit juice, fruit juice beverage, and vegetable beverage. These components may be used independently or in combination. The proportion of these additives is not critical, but is generally selected in the range of 0.01-0.20 parts by weight per 100 parts by weight of the composition of the present invention.
  • the present invention provides an inhalant composition for preventing or treating neurodevelopmental diseases, neurological diseases, or mental diseases, comprising vesicles derived from Micrococcus luteus as an active ingredient.
  • inhalant compositions they may be formulated according to methods known in the art, using a suitable propellant, for example, dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • a suitable propellant for example, dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • a suitable propellant for example, dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • a suitable propellant for example, dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • the dosage unit may be determined by providing a valve to deliver a metered amount.
  • the present invention provides a composition for drug delivery comprising a vesicle derived from Micrococcus luteus as an active ingredient, for the treatment of neurodevelopmental diseases, neurological diseases, or mental disorders.
  • drug delivery refers to the delivery of drugs such as proteins, antibodies, high molecular compounds, low molecular weight compounds, siRNA, and oligonucleotides to the vesicle according to the present invention in order to deliver the drug to a specific organ, tissue, cell or organelle. It means any means or action to load and deliver.
  • the composition for drug delivery can deliver a drug to one or more organs selected from the group consisting of stomach, small intestine, large intestine, lung, liver, kidney, and brain, and preferably can deliver the drug to the brain, not limited
  • the present invention comprises the steps of administering a composition comprising a vesicle derived from Micrococcus luteus carrying a desired neurodevelopmental disease, neurological disease, or psychiatric treatment drug as an active ingredient to an individual in need thereof. It provides a drug delivery method for treating a neurodevelopmental disease, a neurological disease, or a psychiatric disease, comprising:
  • the present invention provides a drug delivery use of a composition comprising vesicles derived from Micrococcus luteus as an active ingredient for the treatment of neurodevelopmental diseases, neurological diseases, or mental disorders.
  • the present invention provides a pharmaceutical composition for preventing or treating a neurodevelopmental disease, a neurological disease, or a psychiatric disease, comprising vesicles derived from bacteria of the genus Micrococcus as an active ingredient.
  • Micrococcus luteus After culturing the Micrococcus luteus strain, its vesicles were isolated and characterized. Micrococcus luteus was sub-cultured in MRS (de Man-Rogosa and Sharpe) medium until the absorbance (OD 600) became 1.0 to 1.5 in an aerobic chamber at 37°C. Thereafter, the medium supernatant containing the strain was recovered, centrifuged at 10,000 g, 4° C. for 20 minutes, the strain was removed, and filtered through a 0.22 ⁇ m filter.
  • MRS de Man-Rogosa and Sharpe
  • the filtered supernatant was concentrated to a volume of 50 ml through microfiltration using a MasterFlex pump system (Cole-Parmer, US) with a 100 kDa Pellicon 2 Cassette filter membrane (Merck Millipore, US). Then, the concentrated supernatant was filtered again with a 0.22 ⁇ m filter. Thereafter, the protein was quantified using the BCA assay, and the following experiments were performed on the obtained vesicles.
  • Example 2 Pharmacokinetic properties of vesicles derived from Micrococcus luteus
  • Micrococcus luteus-derived vesicles stained with a fluorescent dye were orally administered to mice, and the fluorescence expressed in each organ was measured for 48 hours.
  • FIG. 1 when the organ distribution over time of vesicles derived from Micrococcus luteus stained with an image was evaluated, it was confirmed that the vesicles were distributed in various organs. In addition, as shown in FIG. 2, the vesicles were distributed in the brain tissue within 1 hour after oral administration, and it was confirmed that the vesicles were continuously distributed in the brain tissue until 24 hours.
  • Example 3 Anti-inflammatory effect of micrococcus luteus-derived vesicles in epithelial cells
  • E. coli-derived vesicles E. coli EV
  • an inflammatory factor were treated Accordingly, the secretion amount of IL-8, an inflammatory cytokine, was measured by ELISA (Enzyme-linked immunosorbent assay, R&D Systems).
  • ELISA Enzyme-linked immunosorbent assay, R&D Systems.
  • E. coli-derived vesicles were treated at a concentration of 1 ng/mL for 24 hours, and IL secreted into the medium The secretion amount of -8 was measured.
  • micrococcus luteus-derived vesicles had better anti-inflammatory efficacy than dexamethasone, a representative anti-inflammatory drug, as well as anti-inflammatory effects of Micrococcus luteus-derived vesicles disappeared during heat treatment. It was found that the inflammatory action is mediated by the protein contained in the vesicle.
  • Example 4 Anti-inflammatory effect of Micrococcus luteus-derived vesicles in inflammatory cells
  • E. coli-derived vesicles E. coli EV
  • TNF- ⁇ and IL-6 The secretion amount of TNF- ⁇ and IL-6 was measured by ELISA (R&D Systems) method.
  • Micrococcus luteus-derived vesicles were pretreated to macrophages at various concentrations (1, 10, 100 ⁇ g/mL) for 24 hours, and then E. coli-derived vesicles were treated at a concentration of 1 ng/mL for 24 hours and secreted into the medium.
  • the secretion amount of TNF- ⁇ and IL-6 was measured.
  • FIGS. 6A and 6B when micrococcus luteus-derived vesicles were pretreated, the secretion of TNF- ⁇ ( FIG. 6a ) and IL-6 ( FIG. 6b ) by E. coli-derived vesicles, an inflammatory causative factor, was reduced. It was confirmed that vesicles derived from Micrococcus luteus were dose-dependently inhibited. This means that Micrococcus luteus-derived vesicles efficiently inhibit the secretion of inflammatory mediators by inflammatory causative factors from inflammatory cells that induce inflammation in neurodevelopmental diseases, neurological diseases or mental diseases.
  • Example 5 Immune function modulating effect of Micrococcus luteus-derived vesicles on immune dysfunction caused by inflammatory factors
  • NLRP3 protein present in the cytoplasm is known as a key signaling pathway in the pathogenesis of neurodevelopmental diseases, neurological diseases, or psychiatric diseases.
  • NLRP3 NLR family pyrin domain containing 3
  • t-box protein expressed in T cells was confirmed by western blotting.
  • ROR- ⁇ t retineic-acid-receptor-related orphan nuclear receptor gamma
  • NLRP3 protein expression was significantly increased in the LPS-administered group (LPS) compared to the negative control group, and Micrococcus luteus-derived vesicles were administered to the LPS-administered group (LPS+). MlEV), it was confirmed that NLRP3 protein expression was remarkably suppressed similarly to the group administered with dexamethasone (LPS+Dex).
  • IL-1 ⁇ the effect on the secretion of IL-1 ⁇ was evaluated by pre-treating Micrococcus luteus-derived vesicles to macrophages by the method of Example 4, and then treating the macrophages with LPS.
  • FIG. 8 when the vesicles were pretreated, it was confirmed that the secretion of IL-1 ⁇ by LPS, an inflammatory factor, was dose-dependently inhibited from Micrococcus luteus-derived vesicles (M. luteus EV).
  • micrococcus luteus-derived vesicles efficiently inhibit the secretion of IL-1 ⁇ , an inflammatory mediator, secreted through the NLRP3 inflammasome from inflammatory cells that induce inflammation in neurodevelopmental diseases, neurological diseases, or mental diseases.
  • Example 6 Modulating effect of micrococcus luteus-derived vesicles on innate immune dysfunction caused by inflammatory factors
  • NLRP3 inflammasome Abnormalities in innate immune function against various metabolic stresses are known to be very important in the pathogenesis of neurodevelopmental diseases, neurological diseases, or psychiatric diseases.
  • the acquired immune responses of Th1 and Th17 to specific antigens are key to immune dysfunction, whereas in the pathogenesis of neurodevelopmental diseases, neurological diseases or mental diseases, various risk factors that induce innate immunity (danger signals) ), the NLRP3 inflammasome is formed and disease is recently revealed.
  • a priming process in which NLPR3 protein expression is induced by inflammatory factors such as LPS and TNF- ⁇ is important in advance.
  • mice were excised from mice administered with LPS by the method of Example 5, and signals JNK and NF-kB ( p65) was evaluated by western blotting. 50 ⁇ g of protein was used to measure the expression level of each protein, and the expression of the above protein was evaluated in the tissues of the mouse group administered with dexamethasone (Dex) or Micrococcus luteus-derived vesicles.
  • Dex dexamethasone
  • LPS LPS-administered group
  • MIEV Micrococcus luteus-derived vesicle
  • Example 7 Modulating effect of Micrococcus luteus-derived vesicles on the generation of innate immune cells by inflammatory factors
  • ILC3 immune cells through ROR- ⁇ t signaling are important in the pathogenesis of neurodevelopmental diseases, neurological diseases, or mental diseases caused by abnormalities in innate immune function against various stresses, which secrete IL-17, etc., and are involved in the pathogenesis of diseases This was recently revealed. In particular, it was found that ILC3 immune cells play a central role in the pathogenesis of multiple sclerosis, a representative inflammatory neurological disease.
  • LPS was administered to mice according to the method of Example 5, and the number of immune cells in the tissues was evaluated by flow cytometry.
  • the number of ILC3 cells secreting IL-17 was significantly increased compared to the negative control group, and the number of ILC3 cells increased by LPS was dexamethasone (Dex) and It was inhibited by Micrococcus luteus-derived vesicles (MIEV), and it was confirmed that the degree of inhibition was more significant when the vesicles were administered than when dexamethasone was administered. This means that the generation of innate immune cells induced by the NLRP3 inflammasome is efficiently inhibited by Micrococcus luteus-derived vesicles.
  • Example 8 Efficacy of Micrococcus luteus-derived vesicles in the regulation of cellular homeostasis against oxidative stress
  • NO nitric oxide
  • eNOS endothelial NO synthase
  • the degree of activation of eNOS signals after treating vascular endothelial cells with Micrococcus luteus-derived vesicles by the method described in Example 3 was evaluated.
  • As a method for evaluating the expression of signaling proteins cells were lysed using a lysis buffer and proteins were extracted, and proteins were quantified using a BCA protein assay kit (Thermo, USA). The degree of protein activation was evaluated using antibodies specific for p-ERK, ERK, p-eNOS, eNOS, and ⁇ -actin.
  • E. coli-derived vesicles E. coli
  • Dex dexamethasone
  • MDH-101 Micrococcus luteus-derived vesicles
  • Micrococcus luteus-derived vesicles regulate the pathogenesis of neurological or psychiatric diseases by activating eNOS and ERK signals, which are important for vascular endothelial homeostasis and vascular health.
  • Histone deacetylase is involved in the deacetylation of acetylated lysine residues of various proteins including histone proteins. Rather, it plays an important role in intracellular signaling processes.
  • HDACs are divided into classes I, II, III and IV, and sirtuin belonging to class III is known as a signaling protein that maintains cellular homeostasis in a low-calorie stress situation.
  • Sirtuin 1 which is present in the nucleus and cytoplasm, is an anti-aging protein that suppresses inflammation caused by metabolic stress as a deacetylase enzyme and increases cell survival
  • Sirtuin 5 (Sirt5) is a protein that exists in mitochondria, has demalonylase, desuccinylase, and deacetylase enzyme functions, and maintains mitochondrial function by regulating ammonia toxicity in mitochondria
  • Sirtuin 7 (Sirt7) is a protein that exists in neucleolus in the nucleus and has a deacetylase enzyme function to repair rDNA damage so that the protein can be properly produced in the ribosome.
  • Neurotrophins are a group of growth factor proteins that play a key role in the survival and function of differentiated neurons, as well as in the development of neural stem cells. Most mammalian brains, including humans, produce neurons during the fetal period, but adult neurogenesis occurs even after birth due to the presence of neural stem cells in the hippocampus. Neurotrophins related to the survival and function of neural stem cells and neurons include brain-derived neurotrophic factor (BDNF), neurotrophin-3 (NT3), NT4/5, and nerve growth factor (NGF).
  • BDNF brain-derived neurotrophic factor
  • NT3 neurotrophin-3
  • NGF nerve growth factor
  • BDNF is present in the central nervous system and peripheral nervous system, and is a protein that not only increases survival and synapse formation of neurons present in the brain and peripheral nervous system through TrkB receptors, but also induces proliferation and differentiation of neural stem cells.
  • Example 11 Cognitive function improvement effect of Micrococcus luteus-derived vesicles in brain disease mouse model
  • the Tg-APP/PS1 mouse is a mouse model that induces brain disease by overexpressing abnormal APP (amyloid precursor protein) and PS1 (presenilin 1) proteins.
  • a normal mouse group WT+veh
  • a sham-treated brain disease mouse group Tg+veh
  • micrococcus luteus-derived vesicles 50 ⁇ g/mouse were orally administered to a mouse model of brain disease, divided into brain disease mouse groups (Tg+MDH-101), and behavioral and histological examinations were performed.
  • Example 12 Learning ability improvement effect of Micrococcus luteus-derived vesicles in brain disease mouse model
  • the WT+veh group had the fastest time to find the hidden platform during the 5-day training period, and the Tg+MDH-101 group to which Micrococcus luteus-derived vesicles were administered was the WT+veh group. It showed similar learning ability, but the Tg-veh group showed the slowest learning time.
  • Example 13 Memory improvement effect of Micrococcus luteus-derived vesicles in brain disease mouse model
  • mice in the WT+veh and Tg+MDH-101 groups did not enter the dark space until 300 seconds passed during the experiment at the time points of 24, 72, and 120 hours, but Tg+ It was confirmed that the time to enter the dark space gradually increased for the mice of the veh group.
  • FIG. 17c when the mouse entered a dark space and received an electric shock, the mice in the WT + veh group were compared to the mice in the Tg + veh group in the case of the freezing time due to the shock.
  • mice of the Tg+MDH-101 group administered with micrococcus luteus-derived vesicles had no significant difference from the mice of the Tg+veh group. From the above results, it can be seen that Micrococcus luteus-derived vesicles have an effect of inhibiting memory loss induced by abnormal proteins.
  • Example 14 Efficacy of Micrococcus luteus-derived vesicles on abnormal plug formation in brain disease mouse model
  • Amyloid beta (A ⁇ ) plaque is a protein typically found in the brain of Alzheimer's disease patients.
  • a ⁇ plaque starts to accumulate in the mouse brain and is known to induce Alzheimer's symptoms.
  • the brain sections of the mouse models of Example 11 were fluorescently stained with Thioflavin-S dye to analyze A ⁇ plaques deposited in the brain tissue.
  • Example 15 Evaluation of adult neurogenesis efficacy of Micrococcus luteus-derived vesicles in a mouse model of brain disease
  • the Tg+veh group compared to the WT+veh group As shown in FIG. 19 , as a result of confirming the number of cells stained for Ki-67 by fluorescently staining Ki-67, which is known as a marker for neural stem cell proliferation, the Tg+veh group compared to the WT+veh group It was confirmed that the number of cells stained for Ki-67 was significantly reduced. On the other hand, the Tg+MDH-101 group administered with micrococcus luteus-derived vesicles significantly increased the number of Ki-67-stained cells compared to the Tg+veh group, and it was confirmed that the group recovered to a similar extent to the WT+veh group.
  • DCX double cortin
  • Micrococcus luteus-derived vesicles induce new neurogenesis in a mouse model of brain disease, and by generating new neurons, a therapeutic effect on neurodevelopmental diseases, neurological diseases or mental disorders caused by abnormal protein production It can be seen that represents
  • Example 16 Evaluation of neuronal dendrite formation ability of Micrococcus luteus-derived vesicles in a mouse model of brain disease
  • MAP2 microtubule-associated protein 2
  • the micrococcus luteus-derived vesicles of the present invention effectively inhibit the occurrence or course of neurodevelopmental diseases, neurological diseases or mental diseases.
  • the vesicle controls the formation of NLRP3 inflammasome, which is a key immune-related signaling substance in neurodevelopmental diseases, neurological diseases, or psychiatric diseases, thereby suppressing inflammation caused by various inflammatory factors, thereby inhibiting abnormal death of neural stem cells and neurons. And it was found.
  • the vesicle activates the eNOS signal and induces the generation of NO, which is a key signaling material for cellular homeostasis, and restores the expression of sirtuin 1 and sirtuin 7, which are suppressed by oxidative stress, to restore homeostasis of neural stem cells and neurons.
  • NO is a key signaling material for cellular homeostasis
  • sirtuin 1 and sirtuin 7 which are suppressed by oxidative stress
  • micrococcus luteus-derived vesicles of the present invention can be used for the improvement, prevention, or treatment of neurodevelopmental diseases, neurological diseases, or mental diseases.
  • the present inventors confirmed that when micrococcus luteus-derived vesicles were orally administered, vesicles were absorbed into blood vessels and distributed in brain tissue.
  • vesicles were treated with epithelial cells and inflammatory cells, secretion of inflammatory mediators caused by pathogenic factors was significantly inhibited, and when the cells were treated with the vesicles, NLRP3 protein expression and NF-kB ( p65) signal was confirmed.
  • eNOS signals inhibited by pathogenic factors were increased.
  • BDNF gene expression suppressed by pathogenic factors was restored.
  • the vesicles derived from Micrococcus luteus according to the present invention prevent neurodevelopmental diseases, neurological diseases, or mental diseases, It can be usefully used for the development of medicines or health functional foods for symptom improvement or treatment, as well as a drug delivery system for treating neurodevelopmental diseases, neurological diseases, or mental diseases. It is expected.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Mycology (AREA)
  • Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Food Science & Technology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Nutrition Science (AREA)
  • Organic Chemistry (AREA)
  • Polymers & Plastics (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Epidemiology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)

Abstract

본 발명은 마이크로코커스 루테우스 유래 세포외 소포 및 이의 용도에 관한 것으로, 보다 자세하게는 신경생성 장애 또는 신경 염증의 결과로 발생하는 알츠하이머병, 파킨슨병, 근위축성 측삭 경화증, 헌팅턴병, 뇌전증, 다발성경화증, 만성염증탈수초다발신경병증, 당뇨병성 신경병증, 자폐 스펙트럼 장애, 주의력결핍과잉행동장애, 우울장애, 양극성기분장애, 불안장애, 조현병, 강박장애, 외상후스트레스장애, 해리장애, 섭식장애, 물질사용장애, 성격장애 등의 질병을 효과적으로 치료할 수 있는 마이크로코커스 루테우스 유래 소포를 유효성분으로 포함하는 신경발달 질환, 신경질환, 또는 정신질환 개선, 예방, 또는 치료용 조성물 등에 관한 것이다.

Description

마이크로코커스 루테우스 유래 세포외 소포를 포함하는 신경발달 질환, 신경질환, 또는 정신질환 예방 또는 치료용 조성물
본 발명은 마이크로코커스 루테우스 유래 세포외 소포 및 이의 용도에 관한 것으로, 보다 구체적으로, 마이크로코커스 루테우스에서 유래하는 세포외 소포를 유효성분으로 포함하는 신경발달 질환, 신경질환, 또는 정신질환 예방 또는 치료용 조성물 등에 관한 것이다.
본 발명은 2020년 12월 28일에 출원된 대한민국 특허출원 제10-2020-0184337호 및 2021년 11월 12일에 출원된 대한민국 특허출원 제10-2021-0156079호에 기초한 우선권을 주장하며, 상기 출원들의 명세서 및 도면에 개시된 모든 내용은 본 출원에 원용된다.
21세기에 들어서면서 과거 전염병으로 인식되던 급성 감염성 질환의 중요성은 감소된 반면, 우리 몸의 주요 장기에 발생하는 면역기능 또는 대사기능 장애로 인한 만성 염증질환이 삶의 질 감소와 인간 수명을 결정하는 주요 질환으로 질병 패턴이 바뀌었다. 최근 연구에서 인간과 마이크로바이옴(microbiome)과의 부조화에 의해 면역기능 및 대사기능에 이상이 초래되어 만성 염증과 비정상적인 세포사멸이 발생하여 난치성 질병이 발생한다는 사실이 주목을 받고 있다. 특히, 21세기 고령사회에서 난치성 질환으로서, 알츠하이머병 등과 같은 인지 기능 장애, 파킨슨병, 루게릭병 등과 같은 운동기능 장애를 포함하는 신경질환(neurologic disease); 자폐성장애, 주의력결핍과잉행동장애 등과 같은 신경발달 질환(neurodevelopmental disorder); 불안장애, 우울증, 조현병 등과 같은 정신질환(psychiatric disease) 등이 인간 삶의 질을 결정하는 주요 질환으로서 국민 보건에 큰 문제가 되고 있다.
신경세포(뉴런)의 퇴행(neurodegeneration)은 신경세포의 비정상적인 사멸에 의해 뇌-신경조직의 구조 및 기능의 이상을 초래한다. 알츠하이머병(Alzheimer’s disease), 파킨슨병(Parkinson’s disease), 근위축성 측삭 경화증(amyotropic lateral sclerosis), 헌팅턴병(Huntington’s disease), 뇌전증(epilepsy), 다발성경화증(multiple sclerosis), 만성염증탈수초다발신경병증(chronic inflammatory demyelinating polyneuropathy), 및 당뇨병성 신경병증(diabetic neuropathy) 등의 신경질환은 신경세포의 퇴행 또는 신경염증의 결과로 발생한다. 뿐만 아니라 컨스-세이어증후군(Kearns-Sayre syndrome; KSS), 만성 진행성 외안근마비(chronic progressive external ophthalmoplegia; CPEO), 멜라스증후군(mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes; MELAS), MERRF증후군(myoclonic epilepsy with ragged-red fibers; MERRF), NARP증후군(neurogenic weakness with ataxia and retinitis pigmentosa; NARP), 리 증후군(Leigh syndrome; LS), 및 MIRAS증후군(mitochondrial recessive ataxia syndrome) 등과 같은 신경질환도 신경세포의 퇴행성 변화에 의해 발생한다.
최근에는 우울증, 자폐증, 정신분열증 등의 정신질환이 배앓이와 깊은 관련이 있음이 밝혀졌다. 배앓이는 설사와 변비를 동반하고, 반복되면 과민성대장증후군에 이르는데, 이는 장내세균의 불균형(gut microbial dysbiosis)과 연관이 있음이 밝혀졌다. 좋지 않은 음식, 항생제 사용 등으로 장내세균의 불균형이 초래되면, 장내 유해 미생물이 튼튼했던 대장 방어막에 균열을 초래하여 장 누출 현상이 일어나고, 이후 유해 세균 유래 독소가 전신적으로 흡수되어 우울증이 발생 혹은 악화된다고 보고되고 있다[Pharmacotherapy.2015 Oct;35(10):910-6].
신경발달 질환, 신경질환 및 정신질환의 병인 기전에 대한 연구 결과가 최근에 많이 나오면서 이들 질환의 분자 수준에서의 핵심적인 경로에 문제가 있음이 밝혀지고 있다. 질환의 병인과 관련된 핵심적인 병인 기전을 발견하여 이를 회복시키는 것은 많은 질환을 동시에 치료할 수 있는 희망을 제공한다. 세포는 여러 가지 스트레스에 반복적으로 노출이 되면서 세포 노화가 일어나고, 이 과정에서 세포의 면역기능 및 대사기능에 장애가 생기게 되면 세포는 비정상적으로 사멸하게 된다. 즉, 신경질환, 신경발달 질환, 및 정신질환의 핵심적인 병태생리는 신경 줄기세포의 비정상적인 사멸 또는 신경세포 간 연결성(inter-neuronal integrity) 장애의 결과로 발생한다.
에너지 대사(energy metabolism)는 세포의 기능을 수행하는데 필요한 에너지를 만들어서 여러 가지 물질을 만드는 것으로서 미토콘드리아에서 만들어진 ATP를 통해 소포체(endoplasmic reticulum, ER)에서 단백질과 지질을 만들어 필요한 영역으로 공급한다. 세포는 생기는 순간부터 여러 가지 스트레스에 직면하게 되는데, 생물학적, 화학적, 물리적, 또는 정신적 스트레스는 세포 내에서 소포체(ER) 스트레스, 미토콘드리아 기능 이상, 리소좀 손상(lysosomal damage) 등을 유도하고, 이로 인해 세포에서 비정상적인 물질을 만들게 되고, 세포는 이를 위험인자(danger signal)로 인지하여 염증반응을 유도하게 된다.
면역(immunity)은 생물학적, 화학적, 물리적, 정신적 스트레스에 대한 세포의 방어 기작으로, 선천면역(innate immunity)과 후천면역(adaptive immunity)을 통해 일어나게 된다. 최근 면역기능 이상에 의한 염증 질환의 병인과 관련해서 세포 내 산화 스트레스의 결과로 생기는 위험인자(danger signal)가 세포질 내의 패턴인식수용체(pattern recognition receptor; PRR)인 NLRP(Nucleotide-binding oligomerization domain)에 의해 인지되고, 이중 NLRP3 단백질은 inflammasome을 형성하여 염증반응과 비정상적인 세포사멸을 일으킨다는 사실이 알려졌다. 특히, NLRP3 inflammasome 활성화를 통해 발생하는 염증은 여러 신경발달 질환, 신경질환, 및 정신질환의 핵심적인 병인 기전으로 알려지게 되었다.
인체에 공생하는 미생물은 100조에 이르러 인간 세포보다 10배 많으며, 미생물의 유전자 수는 인간 유전자 수의 100배가 넘는 것으로 알려졌다. 미생물총(microbiota 또는 microbiome)은 주어진 거주지에 존재하는 진정세균(bacteria), 고세균(archaea), 및 진핵생물(eukarya)을 포함한 미생물 군집(microbial community)을 말한다.
우리 몸에 공생하는 세균 및 주변 환경에 존재하는 세균은 다른 세포로의 유전자, 저분자화합물, 단백질 등의 정보를 교환하기 위하여 나노미터 크기의 소포(vesicle)를 분비한다. 점막은 200 나노미터(nm) 크기 이상의 입자는 통과할 수 없는 물리적인 방어막을 형성하므로 점막에 공생하는 세균의 경우에는 점막을 통과하지 못하지만, 세균 유래 소포는 크기가 200 나노미터 크기 이하라서 비교적 자유롭게 점막의 상피세포를 통과하여 우리 몸에 흡수된다. 이와 같이, 세균 유래 소포는 세균에서 분비된 것이지만, 세균과 구성 성분, 체내 흡수율, 부작용 위험성 등이 서로 상이하며, 이로 인하여 세균 유래 소포를 사용하는 것은 살아있는 세균을 사용하는 것과는 전혀 상이하거나 현저한 효과를 나타낸다.
국소적으로 분비된 세균 유래 소포는 점막의 상피세포를 통해 흡수되어 국소 염증반응을 유도할 뿐만 아니라, 상피세포를 통과한 소포는 림프관을 통해 전신적으로 흡수되어 각 장기로 분포하고, 분포된 장기에서 면역 및 염증반응을 조절한다. 예를 들어, 대장균(Eshcherichia coli)과 같은 병원성 그람음성세균에서 유래하는 소포는 병원성 나노 입자로서 국소적으로 대장염을 일으키고, 혈관으로 흡수된 경우에는 혈관 내피세포에 흡수되어 염증반응을 유도하여 전신적인 염증반응 및 혈액응고를 촉진시키고, 또한 인슐린이 작용하는 근육세포 등에 흡수되어 인슐린 저항성과 당뇨병을 유발한다. 반면, 유익한 세균에서 유래하는 소포는 병원성 소포에 의한 면역기능 및 대사기능 이상을 조절하여 질병을 조절할 수 있다.
마이크로코커스 루테우스(Micrococcus luteus)는 마이크로코커스 속에 속하는 그람양성세균으로서, 물, 먼지, 토양 등과 같은 자연에 널리 분포하는 세균이다. 이 균은 피리딘과 같은 독성 유기오염물질에서 자랄 때 리보플라빈을 생성하고, 루테인 색소를 통해 자외선을 흡수하는 것으로 알려져 있다. 또한, 이 균은 유제품 및 맥주에서도 분리되고, 건조한 환경이나 고염 환경에서도 자라고, 포자(spore)를 형성하지는 않지만, 냉장고와 같은 냉장 온도에서도 장기간 생존하는 것으로 알려져 있다.
그러나 아직까지 마이크로코커스 루테우스 유래 소포를 신경발달 질환, 신경질환 또는 정신질환 치료에 응용한 사례는 보고된 바가 없다.
본 발명자들은 상기와 같은 종래의 문제점을 해결하기 위해 예의 연구한 결과, 마이크로코커스 루테우스 유래 소포를 세포에 처리하였을 때, 병원성 인자에 의한 염증성 매개체 분비를 현저히 억제하고, 병원성 인자에 의한 면역기능 이상을 마이크로코커스 루테우스 유래 소포가 효율적으로 억제하는 것을 확인하였다. 또한, 마이크로코커스 루테우스 유래 소포는 여러 질병의 병인과 관련된 NLRP3 단백질 발현 및 NLRP3 inflammasome 형성을 통한 염증성 매개체 분비를 억제하여 면역기능을 조절함을 확인하였다. 또한, 상기 소포는 세포의 항상성에 중요한 신호인 eNOS(endothelial NO synthase)를 활성화하여 세포의 항상성을 증가시킴을 확인하였다. 또한, 신경세포의 사멸을 과도하게 유도하여 인지 기능 장애를 일으키는 뇌질환 마우스 모델에 상기 소포를 처리하였을 때, 인지 기능과 관련된 행동 장애뿐만 아니라 비정상적인 단백질 침착을 억제함을 확인하였다. 또한, 상기 뇌질환 마우스 모델에서 마이크로코커스 루테우스 유래 소포가 신경 줄기세포의 증식 및 분화, 그리고 신경세포 간 연결성(inter-neuronal intergrity)을 증가시켜 신경발달 질환, 신경질환 또는 정신질환에 대한 치료 효과를 나타냄을 확인하였다. 또한, 상기 신경 생성(neurogenesis)에 의한 치료 효과는 마이크로코커스 루테우스 유래 소포가 신경세포에 작용하여 신경 생성을 유도하는 BDNF(brain-derived neurotrophic factor) 및 스트레스에 의한 세포 노화를 방지하는 sirtuin 단백질 발현을 증가시켜 일어남을 확인하였는바, 이에 기초하여 본 발명을 완성하였다.
이에, 본 발명은 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포를 유효성분으로 포함하는, 신경발달 질환, 신경질환, 또는 정신질환의 예방 또는 치료용 약학적 조성물을 제공하는 것을 목적으로 한다.
또한, 본 발명은 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포를 유효성분으로 포함하는, 신경발달 질환, 신경질환, 또는 정신질환의 예방 또는 개선용 식품 조성물을 제공하는 것을 목적으로 한다.
또한, 본 발명은 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포를 유효성분으로 포함하는, 신경발달 질환, 신경질환, 또는 정신질환의 예방 또는 치료용 흡입제 조성물을 제공하는 것을 목적으로 한다.
또한, 본 발명은 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포를 유효성분으로 포함하는, 신경발달 질환, 신경질환, 또는 정신질환 치료 약물 전달용 조성물을 제공하는 것을 목적으로 한다.
또한, 본 발명은 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포를 유효성분으로 포함하는, 항노화용 약학적 조성물을 제공하는 것을 목적으로 한다.
또한, 본 발명은 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포를 유효성분으로 포함하는, 항노화용 식품 조성물을 제공하는 것을 목적으로 한다.
또한, 본 발명은 마이크로코커스(Micrococcus) 속 세균 유래 소포를 유효성분으로 포함하는, 신경발달 질환, 신경질환, 또는 정신질환의 예방 또는 치료용 약학적 조성물을 제공하는 것을 목적으로 한다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.
상기와 같은 본 발명의 목적을 달성하기 위하여, 본 발명은 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포를 유효성분으로 포함하는, 신경발달 질환, 신경질환, 또는 정신질환의 예방 또는 치료용 약학적 조성물을 제공한다.
또한, 본 발명은 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포를 유효성분으로 포함하는, 신경발달 질환, 신경질환, 또는 정신질환의 예방 또는 개선용 식품 조성물을 제공한다.
또한, 본 발명은 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포를 유효성분으로 포함하는, 신경발달 질환, 신경질환, 또는 정신질환의 예방 또는 치료용 흡입제 조성물을 제공한다.
또한, 본 발명은 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포를 유효성분으로 포함하는, 신경발달 질환, 신경질환, 또는 정신질환 치료 약물 전달용 조성물을 제공한다.
또한, 본 발명은 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포를 유효성분으로 포함하는, 항노화용 약학적 조성물을 제공한다.
또한, 본 발명은 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포를 유효성분으로 포함하는, 항노화용 식품 조성물을 제공한다.
또한, 본 발명은 마이크로코커스(Micrococcus) 속 세균 유래 소포를 유효성분으로 포함하는, 신경발달 질환, 신경질환, 또는 정신질환의 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명의 일 구현예로, 상기 신경질환은 퇴행성 신경질환 또는 염증성 신경질환일 수 있으나, 이에 제한되지 않는다.
본 발명의 다른 구현예로, 상기 퇴행성 신경질환은 알츠하이머병(Alzheimer’s disease), 파킨슨병(Parkinson’s disease), 근위축성 측삭 경화증(amyotropic lateral sclerosis), 헌팅턴병(Huntington’s disease), 뇌전증(epilepsy), 컨스-세이어증후군(Kearns-Sayre syndrome; KSS), 만성 진행성 외안근마비(chronic progressive external ophthalmoplegia; CPEO), 멜라스증후군(mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes; MELAS), MERRF증후군(myoclonic epilepsy with ragged-red fibers; MERRF), NARP증후군(neurogenic weakness with ataxia and retinitis pigmentosa; NARP), 리 증후군(Leigh syndrome; LS), 및 MIRAS증후군(mitochondrial recessive ataxia syndrome)으로 이루어진 군으로부터 선택된 하나 이상의 질환일 수 있으나, 이에 제한되지 않는다.
본 발명의 또 다른 구현예로, 상기 염증성 신경질환은 다발성경화증(multiple sclerosis), 만성염증탈수초다발신경병증(chronic inflammatory demyelinating polyneuropathy), 및 당뇨병성 신경병증(diabetic neuropathy)으로 이루어진 군으로부터 선택된 하나 이상의 질환일 수 있으나, 이에 제한되지 않는다.
본 발명의 또 다른 구현예로, 상기 정신질환은 우울장애(major depressive disorder), 양극성기분장애(bipolar disorder), 불안장애(anxiety disorder), 조현병(schizophrenia) 강박장애 (obsessive compulsive disorder), 외상후스트레스장애(post-traumatic stress disorder), 해리장애(dissociative disorder), 섭식장애(eating disorder), 물질사용장애(substance use disorder), 및 성격장애(personality disorder)로 이루어진 군으로부터 선택된 하나 이상의 질환일 수 있으나, 이에 제한되지 않는다.
본 발명의 또 다른 구현예로, 상기 불안장애는 공황장애(panic disorder), 사회적불안장애(social anxiety disorder), 범불안장애(generalized anxiety disorder), 및 특정 공포증(specific phobia)으로 이루어진 군으로부터 선택된 하나 이상의 불안장애일 수 있으나, 이에 제한되지 않는다.
본 발명의 또 다른 구현예로, 상기 성격장애는 편집성 성격장애(paranoid personality disorder), 반사회적 성격장애(antisocial personality disorder), 경계성 성격장애(borderline personality disorder), 자기애 성격장애(narcissistic personality disorder), 회피성 성격장애(avoidant personality disorder), 및 의존성 성격장애(dependent personality disorder)로 이루어진 군으로부터 선택된 하나 이상 성격장애일 수 있으나, 이에 제한되지 않는다.
본 발명의 또 다른 구현예로, 상기 신경발달 질환은 지적장애(intellectual disability), 의사소통장애(communication disorder), 자폐 스펙트럼 장애(autism spectrum disorder), 주의력결핍/과잉행동장애(attention deficit hyperactivity disorder), 특정학습장애(specific learning disorder), 및 운동장애(motor disorder)로 이루어진 군으로부터 선택된 하나 이상일 수 있으나, 이에 제한되지 않는다.
본 발명의 또 다른 구현예로, 상기 신경발달 질환, 신경질환, 또는 정신질환은 신경생성의 장애(neurogenesis dysfunction)로 인한 것일 수 있으나, 이에 제한되지 않는다.
본 발명의 또 다른 구현예로, 상기 신경발달 질환, 신경질환, 또는 정신질환은 NLRP3 inflammasome(NLR family pyrin domain containing 3 inflammasome)에 의해 매개될 수 있으나, 이에 제한되지 않는다.
본 발명의 또 다른 구현예로, 상기 조성물은 NLRP3 inflammasome 형성을 억제할 수 있으나, 이에 제한되지 않는다.
본 발명의 또 다른 구현예로, 상기 소포는 평균 직경이 10 내지 200 nm일 수 있으나, 이에 제한되지 않는다.
본 발명의 또 다른 구현예로, 상기 소포는 마이크로코커스 루테우스(Micrococcus luteus)에서 자연적으로 분비 또는 인공적으로 생산될 수 있으나, 이에 제한되지 않는다.
본 발명의 또 다른 구현예로, 상기 조성물은 뇌 또는 신경세포의 노화를 억제할 수 있으나, 이에 제한되지 않는다.
또한, 본 발명은 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포를 유효성분으로 포함하는 조성물을 이를 필요로 하는 개체에 투여하는 단계를 포함하는, 신경발달 질환, 신경질환, 또는 정신질환의 예방 또는 치료 방법을 제공한다.
또한, 본 발명은 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포를 유효성분으로 포함하는 조성물의 신경발달 질환, 신경질환, 또는 정신질환 예방 또는 치료 용도를 제공한다.
또한, 본 발명은 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포의 신경발달 질환, 신경질환, 또는 정신질환 치료용 약제의 제조를 위한 용도를 제공한다.
또한, 본 발명은 목적하는 신경발달 질환, 신경질환, 또는 정신질환 치료 약물을 담지한 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포를 유효성분으로 포함하는 조성물을 이를 필요로 하는 개체에 투여하는 단계를 포함하는, 신경발달 질환, 신경질환, 또는 정신질환 치료 약물 전달 방법을 제공한다.
또한, 본 발명은 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포를 유효성분으로 포함하는 조성물의 신경발달 질환, 신경질환, 또는 정신질환 치료 약물 전달 용도를 제공한다.
본 발명자들은 마이크로코커스 루테우스 유래 소포를 경구 투여하였을 때, 소포가 혈관으로 흡수되어 뇌 조직에 분포함을 확인하였다. 또한, 상피세포 및 염증세포에 상기 소포를 처리하였을 때, 병원성 인자에 의한 염증성 매개체 분비를 현저히 억제하고, 세포에 상기 소포를 처리하였을 때, 병원성 인자에 의해 유도되는 NLRP3 단백질 발현 및 NF-kB(p65) 신호를 억제함을 확인하였다. 또한, 세포에 상기 소포를 처리하였을 때, 병원성 인자에 의해 억제되는 eNOS 신호를 증가시킴을 확인하였다. 또한, 신경세포에 상기 소포를 처리하였을 때, 병원성 인자에 의해 억제되는 BDNF 유전자 발현을 회복시킴을 확인하였다. 또한, 신경세포에 상기 소포를 처리하였을 때, 병원성 인자에 의해 억제되는 sirtuin 1 및 sirtuin 7 유전자 발현을 회복시킴을 확인하였다. 또한, 신경질환 마우스 모델에 상기 소포를 투여하였을 때, 인지 기능이 유의하게 회복됨을 확인하였다. 또한, 상기 신경질환 마우스 모델에 상기 소포를 투여하였을 때, 신경 생성이 유의하게 회복됨을 확인하였는바, 본 발명에 따른 마이크로코커스 루테우스 유래 소포는 알츠하이머병(Alzheimer’s disease), 파킨슨병(Parkinson’s disease), 근위축성측삭경화증(amyotropic lateral sclerosis), 헌팅턴병(Huntington’s disease), 뇌전증(epilepsy), 다발성경화증(multiple sclerosis), 만성염증탈수초다발신경병증(chronic inflammatory demyelinating polyneuropathy), 당뇨병성 신경병증(diabetic neuropathy), 자폐성장애(autism spectrum disorder), 주의력결핍과잉행동장애(attention deficit hyperactivity syndrome), 우울장애(major depressive disorder), 양극성기분장애(bipolar disorder), 불안장애(anxiety disorder), 조현병(schizophrenia), 강박장애(obsessive compulsive disorder), 외상후스트레스장애(post-traumatic stress disorder), 해리장애(dissociative disorder), 섭식장애(eating disorder), 물질사용장애(substance use disorder), 및 성격장애(personality disorder) 등의 신경발달 질환, 신경질환, 또는 정신질환을 예방, 증상 개선, 또는 치료하기 위한 의약품 또는 건강기능식품 등의 개발에 유용하게 이용될 수 있을 뿐만 아니라, 신경발달 질환, 신경질환, 또는 정신질환을 치료하기 위한 약물 전달 시스템으로서 유용하게 이용될 수 있을 것이다.
도 1은 마이크로코커스 루테우스 유래 소포를 마우스에 경구 투여한 후, 시간별로 각 장기를 적출하여 각 장기에서의 형광 세기를 측정한 결과를 나타낸 도면이다.
도 2는 마이크로코커스 루테우스 유래 소포를 마우스에 경구 투여한 후 뇌 조직에 소포가 분포하는 양상을 시간 경과에 따라 나타낸 도면이다.
도 3은 상피세포에 마이크로코커스 루테우스 유래 소포(MDH-101 EV) 또는 양성 대조 약물인 덱사메타손(Dexamethasone, Dex)을 투여하여 염증성 원인 인자인 대장균 유래 소포(E. coli EV)에 의한 염증성 매개체 분비 억제 효과를 평가하기 위한 실험 프로토콜을 나타낸 도면이다.
도 4a 및 도 4b는 상피세포에 마이크로코커스 루테우스 유래 소포(MDH-101)를 투여하여 대장균 유래 소포(E. coli)에 의한 염증성 매개체 IL-8 분비 억제에 대한 마이크로코커스 루테우스 유래 소포 용량 의존성(a)과 대조 약물인 덱사메타손(Dexamethasone)과의 효능을 비교한 실험결과(b)를 나타낸 도면이다.
도 5는 염증세포인 대식세포에 마이크로코커스 루테우스 유래 소포(M. luteus EV)를 투여하여 염증성 원인 인자인 대장균 유래 소포(E. coli EV)에 의한 염증성 매개체 분비 억제 효과를 평가하기 위한 실험 프로토콜을 나타낸 도면이다.
도 6a 및 도 6b는 대식세포에 마이크로코커스 루테우스 유래 소포(M. luteus EV)를 투여하여 대장균 유래 소포(E. coli EV)에 의한 염증성 매개체 TNF-α(a)와 IL-6(b)의 분비 억제 효과를 확인한 결과를 나타낸 도면이다.
도 7은 마이크로코커스 루테우스 유래 소포(MlEV)에 의한 면역기능 조절 효과를 평가하기 위하여, 염증성 원인 인자인 LPS(lipopolysaccharide)를 투여한 마우스로부터 분리한 조직에서 면역기능 조절 단백질인 NLRP3, T-bet, ROR-γt 발현 양상을 확인한 결과를 나타낸 도면이다.
도 8은 대식세포에 마이크로코커스 루테우스 유래 소포(M. luteus EV)를 투여하여 LPS에 의한 염증성 매개체 IL-1β의 분비 억제 효과를 확인한 결과를 나타낸 도면이다.
도 9는 마이크로코커스 루테우스 유래 소포(MlEV)에 의한 선천면역 기능 조절 효과를 평가하기 위하여, 염증성 원인 인자인 LPS를 투여한 마우스로부터 분리한 조직에서 선천면역 관련 신호인 JNK 및 NF-kB(p65)의 활성화 정도를 평가한 결과를 나타낸 도면이다.
도 10은 마이크로코커스 루테우스 유래 소포(MlEV)의 선천면역 세포 생성 조절 효과를 평가하기 위하여, 염증성 원인 인자인 LPS를 투여한 마우스로부터 분리한 조직에서 신경발달 질환, 신경질환, 또는 정신질환 병인과 관련된 ILC3(type 3 innate lymphoid cells)의 수를 유세포 분석을 통해 측정한 결과를 나타낸 도면이다.
도 11은 마이크로코커스 루테우스 유래 소포(MDH-101)가 세포의 항상성에 중요한 eNOS 신호에 미치는 효과를 평가하기 위하여, 세포에 마이크로코커스 루테우스 유래 소포(MDH-101) 또는 양성 대조 약물인 덱사메타손(Dexamethasone)을 투여하여 염증성 원인 인자인 대장균 유래 소포(E. coli)에 의해 억제되는 eNOS 신호에 미치는 영향을 평가한 결과를 나타낸 도면이다.
도 12는 마이크로코커스 루테우스 유래 소포(MDH-101)가 신경세포의 항상성에 중요한 sirtuin 유전자 발현에 미치는 효과를 평가하기 위하여, 세포에 마이크로코커스 루테우스 유래 소포(MDH-101)와 원인 인자인 베타-아밀로이드 단백질(Aβ)을 투여하여 Aβ에 의해 억제되는 sirtuin 유전자의 발현에 미치는 영향을 평가한 결과를 나타낸 도면이다.
도 13은 마이크로코커스 루테우스 유래 소포(MDH-101)가 신경 생성(neurogenesis)에 중요한 neurotrophin 및 수용체 관련 유전자 발현에 미치는 효과를 평가하기 위하여, 세포에 마이크로코커스 루테우스 유래 소포(MDH-101)와 원인 인자인 아밀로이드-베타 단백질(Aβ)을 투여하여 Aβ에 의해 억제되는 neurotrophin 및 수용체 유전자의 발현에 미치는 영향을 평가한 결과를 나타낸 도면이다.
도 14는 마이크로코커스 루테우스 유래 소포(MDH-101)를 경구 투여한 뇌질환 마우스 모델(Tg-APP/PS1 mice)에서 상기 소포의 치료 효능을 평가하기 위한 실험 프로토콜을 나타낸 도면이다 (WT+veh: 정상 마우스 그룹, Tg+veh: 뇌질환 마우스 그룹, Tg+MDH-101: 뇌질환 마우스 모델에 마이크로코커스 루테우스 유래 소포를(MDH-101) 경구 투여한 마우스 그룹, 이하 동일.).
도 15는 Tg-APP/PS1 뇌질환 마우스 모델에서 인지 기능에 대한 마이크로코커스 루테우스 유래 소포(MDH-101)의 치료 효능을 새로운 물체/위치 인지 테스트(novel object/location recognition test)로 평가한 결과를 나타낸 도면이다.
도 16은 마이크로코커스 루테우스 유래 소포를 Tg-APP/PS1 뇌질환 마우스 모델에서 학습 능력에 대한 마이크로코커스 루테우스 유래 소포(MDH-101)의 치료 효능을 수중미로 테스트(water maze test)로 평가한 결과를 나타낸 것으로, (a)는 수중미로 테스트의 프로토콜을 나타낸 도면이고, (b)는 5일간의 학습기간 동아 Hidden platform을 찾아가는 시간을 나타낸 결과를 나타낸 도면, (c)는 수통의 각 부분에 머문 시간을 나타낸 도면이다.
도 17은 Tg-APP/PS1 뇌질환 마우스 모델에서 기억 능력 개선에 대한 마이크로코커스 루테우스 유래 소포(MDH-101)의 치료 효능을 수동회피실험(passive avoidance test)으로 평가한 결과를 나타낸 것으로, (a)는 수동회피실험 프로토콜을 나타낸 도면이고, (b)는 어두운 공간(dark chamber)에 들어갔을 때 전기 충격을 받은 마우스가 dark chamber에 다시 들어가기까지 걸리는 시간을 측정한 결과를 나타낸 도면이고, (c)는 전기 충격을 받은 후 마우스가 얼어있는 시간(freezing time)을 나타낸 도면이다.
도 18은 Tg-APP/PS1 뇌질환 마우스 모델의 두정엽(Parietal cortex), 해마(Hippocampus), 및 조롱박피질(Piriform cortex) 지역에서의 아밀로이드 베타(Aβ) 플라그 형광 염색 이미지 및 정량 데이터를 비교한 결과로, Tg+veh 그룹(TG)과 Tg+MDH-101 그룹의 두정엽, 해마, 및 조롱박피질에서의 Aβ 플라그 염색 사진(a), 단위 면적 당 Aβ 플라그의 수(b), 및 단위 면적 당 Aβ 플라그의 면적(C)을 나타낸 도면이다.
도 19는 Tg-APP/PS1 뇌질환 마우스 모델의 해마(hippocampus)에서 신경 줄기세포의 증식에 대한 마이크로코커스 루테우스 유래 소포(MDH-101)의 치료 효능을 뇌에서 초기 신경 신생(neurogenesis)의 마커인 Ki-76 발현을 염색을 통해 확인한 결과를 나타낸 것으로, 좌측은 Ki-67 염색한 결과를 나타낸 도면이고, 우측은 정상 마우스 그룹(WT+veh) 대비 Tg+veh 그룹과 Tg+MDH-101 그룹에서 Ki-67에 염색된 세포의 수를 비율로 나타낸 도면이다 (WT CON: 정상 마우스 그룹, TG CON: 뇌질환 마우스 그룹, 이하 동일.).
도 20은 Tg-APP/PS1 뇌질환 마우스 모델의 해마(hippocampus)에서 신경 줄기세포의 분화 및 이동에 대한 마이크로코커스 루테우스 유래 소포(MDH-101)의 치료 효능을 신경 줄기세포의 분화 및 이동 관련 마커인 더블코르틴(doublecortin, DCX)의 염색을 통해 평가한 결과를 나타낸 것으로, 좌측은 DCX를 염색한 결과를 나타낸 도면이고, 우측은 DCX에 염색된 세포의 평균 수를 나타낸 도면이다.
도 21은 Tg-APP/PS1 뇌질환 마우스 모델의 해마(hippocampus)에서 신경세포의 수상돌기(dendrite) 형성에 대한 마이크로코커스 루테우스 유래 소포(MDH-101)의 치료 효능을 뇌 조직 신경세포의 MAP2 염색을 통해 평가한 결과를 나타낸 것으로, 좌측은 MAP2를 염색한 결과를 나타낸 도면이고, 우측은 MAP2 발현 수준을 나타낸 도면이다.
본 발명은 마이크로코커스 루테우스 유래 소포 및 이의 용도에 관한 것이다.
이하, 본 발명을 상세히 설명한다.
본 발명자들은 마이크로코커스 루테우스 유래 소포를 마우스에 경구 투여하였을 때 상기 소포가 전신적으로 흡수되어 뇌 조직에 분포함을 확인하였다 (실시예 2 참조).
또한, 상피세포 및 대식세포에 상기 소포를 처리하였을 때, 염증성 인자에 의한 염증성 매개체 IL-8, TNF-α, 및 IL-6의 분비를 현저히 억제함을 확인하였다 (실시예 3 및 4 참조).
또한, 신경발달 질환, 신경질환, 및 정신질환의 병인에서 핵심 신호전달 요소인 NLRP3 단백질 발현 및 NLRP3 inflammatosome에 의한 IL-1β 분비가 마이크로코커스 루테우스 유래 소포에 의해 현저히 억제되는 것을 확인하였다 (실시예 5 참조).
또한, NLRP3 inflammasome 형성을 프라이밍(priming)하는 신호인 JNK 및 NF-kB(p65) 신호전달 경로를 마이크로코커스 루테우스 유래 소포가 효율적으로 억제하는 것을 확인하였다 (실시예 6 참조).
또한, 세포의 항상성에 중요한 신호인 eNOS의 활성화가 염증성 인자에 의해선 억제되었으나, 마이크로코커스 루테우스 유래 소포에 의해 회복된 것을 확인하였다 (실시예 7 참조).
또한, 뇌질환 마우스 모델에 마이크로코커스 루테우스 유래 소포를 경구 투여하였을 때, 인지기능, 학습 능력 및 기억 능력이 정상 수준으로 회복되고, 비정상적인 단백질 침착도 억제되는 것을 확인하였다 (실시예 11 내지 14 참조).
또한, 상기 뇌질환 마우스 모델에서 마이크로코커스 루테우스 유래 소포를 경구 투여하였을 때, 신경 줄기세포의 증식, 이동, 및 분화가 정상 수준으로 회복되고, 신경세포 간 연결에 중요한 수상돌기 형성도 정상 수준으로 회복되는 것을 확인하였다 (실시예 15 및 16 참조).
또한, 신경세포에 비정상적인 단백질을 투여하였을 때, 비정상적인 단백질에 의해 감소되었던 신경 생성 매개체인 BDNF 유전자 발현이 정상 수준으로 회복되고, 세포의 항상성 관련 매개체인 sirtuin 1 및 sirtuin 7 유전자 발현도 정상 수준으로 회복되는 것을 확인하였다 (실시예 9 및 10 참조).
이에, 본 발명은 마이크로코커스 루테우스 유래 소포를 유효성분으로 포함하는 신경발달 질환, 신경질환, 또는 정신질환의 예방 또는 치료용 약학적 조성물을 제공한다.
또한, 본 발명은 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포를 유효성분으로 포함하는, 항노화용 약학적 조성물을 제공할 수 있다.
본 발명에서 사용되는 용어, “세포외 소포(Extracellular vesicle)” 또는 “소포(Vesicle)”란, 다양한 세균에서 분비되는 나노 크기의 막으로 된 구조물을 의미하며, 예를 들어, 내독소(lipopolysaccharide), 독성 단백질 및 세균 DNA와 RNA도 가지고 있는 대장균과 같은 그람음성균(gram-negative bacteria) 유래 소포 또는 외막 소포체(outer membrane vesicles, OMVs) 및 단백질과 핵산 외에도 세균의 세포벽 구성성분인 펩티도글리칸(peptidoglycan)과 리포테이코산(lipoteichoic acid)도 가지고 있는 마이크로코커스 세균과 같은 그람양성균(gram-positive bacteria) 유래 소포 등이 있다.
본 발명에 있어서, 상기 세포외 소포 또는 소포는 마이크로코커스 루테우스(Micrococcus luteus)에서 자연적으로 분비 또는 인공적으로 생산된 막으로 된 모든 구조물을 총칭할 수 있으며, 본 발명에 있어서, MDH-101, MDH-101 EV, M. luteus EV, 또는 MlEV로 다양하게 표시될 수 있다.
상기 소포는 마이크로코커스 루테우스 배양과정에서 열처리, 고압처리 하거나, 상기 세균 배양액을 원심분리, 초고속 원심분리, 고압처리, 압출, 초음파분해, 세포 용해, 균질화, 냉동-해동, 전기천공, 기계적 분해, 화학물질 처리, 필터에 의한 여과, 겔 여과 크로마토그래피, 프리-플로우 전기영동, 및 모세관 전기영동으로 이루어진 군에서 선택된 하나 이상의 방법을 사용하여 분리할 수 있다. 또한, 불순물의 제거를 위한 세척, 수득된 소포의 농축 등의 과정을 추가로 포함할 수 있다.
본 발명에서 상기 방법에 의하여 분리된 소포는 구형의 형태로, 평균 직경이 10 내지 200 nm, 10 내지 190 nm, 10 내지 180 nm, 10 내지 170 nm, 10 내지 160 nm, 10 내지 150 nm, 10 내지 140 nm, 10 내지 130 nm, 10 내지 120 nm, 10 내지 110 nm, 10 내지 100 nm, 10 내지 90 nm, 10 내지 80 nm, 10 내지 70 nm, 10 내지 60 nm, 10 내지 50 nm, 20 내지 200 nm, 20 내지 180 nm, 20 내지 160 nm, 20 내지 140 nm, 20 내지 120 nm, 20 내지 100 nm, 또는 20 내지 80 nm 일 수 있으며, 바람직하게는, 20 내지 200 nm 일 수 있으나, 이에 제한되지 않는다.
본 발명에서 사용되는 용어 "유효성분으로 포함하는"이란 상기 마이크로코커스 루테우스 유래 소포의 효능 또는 활성을 달성하는데 충분한 양을 포함하는 것을 의미한다.
본 발명에서 사용되는 용어 “신경발달 질환(neurodevelopmental disorders)"이란, 뇌를 포함한 중추신경계의 발달 지연 또는 손상과 관련되어 나타나는 모든 발달장애를 의미하는 것으로, 신경발달 질환은 심리·사회적인 문제보다는 뇌의 발달장애로 인해 발생하는 질환으로 알려져 있으며, 예를 들어, 지적장애(intellectual disability), 의사소통장애(communication disorder), 자폐 스펙트럼 장애(autism spectrum disorder), 주의력결핍/과잉행동장애(attention deficit hyperactivity disorder), 특정학습장애(specific learning disorder), 및 운동장애(motor disorder) 등이 포함될 수 있다.
본 발명에서 사용되는 용어, “신경질환(Neurologic Diseases)”이란 신경계 즉, 뇌, 척수, 신경 등에 이상이 생겨 발생하는 질환을 의미하는 것으로, 본 발명에 있어서, 상기 신경질환이란 퇴행성 신경질환 또는 염증성 신경질환일 수 있으며, 신경세포의 손상에 의해 발생되는 질환 또는 병태라면 제한되지 않고 포함될 수 있다.
본 발명에서 사용되는 용어, “퇴행성 신경질환”이란 나이가 들어감에 따라 발생하는 퇴행성 질환 중 뇌에서 발생하는 질환을 의미하는 것으로, 예를 들어, 알츠하이머병(Alzheimer’s disease), 파킨슨병(Parkinson’s disease), 근위축성 측삭 경화증(amyotropic lateral sclerosis), 헌팅턴병(Huntington’s disease), 뇌전증(epilepsy), 컨스-세이어증후군(Kearns-Sayre syndrome; KSS), 만성 진행성 외안근마비(chronic progressive external ophthalmoplegia; CPEO), 멜라스증후군(mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes; MELAS), MERRF증후군(myoclonic epilepsy with ragged-red fibers; MERRF), NARP증후군(neurogenic weakness with ataxia and retinitis pigmentosa; NARP), 리 증후군(Leigh syndrome; LS), 및 MIRAS증후군(mitochondrial recessive ataxia syndrome) 등이 포함될 수 있다.
본 발명에서 사용되는 용어, “염증성 신경질환”이란 중추신경계에서 발생하는 신경염증의 영향으로 발생하는 질환을 의미하는 것으로, 예를 들어, 다발성경화증(multiple sclerosis), 만성염증탈수초다발신경병증(chronic inflammatory demyelinating polyneuropathy), 및 당뇨병성 신경병증(diabetic neuropathy) 등이 포함될 수 있다.
본 발명에서 사용되는 용어, “정신질환(Psychiatric Diseases) ”이란, 사람의 사고, 감정, 행동 같은 것에 영향을 미치는 병적인 정신상태를 의미하는 것으로, 정신기능에 장애가 온 상태를 총칭하며, 예를 들어, 우울장애(major depressive disorder), 양극성기분장애(bipolar disorder), 불안장애(anxiety disorder), 조현병(schizophrenia), 강박장애 (obsessive compulsive disorder), 외상후스트레스장애(post-traumatic stress disorder), 해리장애(dissociative disorder), 섭식장애(eating disorder), 물질사용장애(substance use disorder), 및 성격장애(personality disorder) 등이 포함될 수 있다.
본 발명에서 사용되는 용어, “불안장애(anxiety disorder)”란 이유없이 불안을 느끼거나 불안의 정도가 지나친 정신장애를 의미하는 것으로, 예를 들어, 공황장애(panic disorder), 사회적불안장애(social anxiety disorder), 범불안장애(generalized anxiety disorder), 및 특정 공포증(specific phobia) 등이 포함될 수 있다.
본 발명에서 사용되는 용어 “성격장애(personality disorder)”란 어린 시절부터 서서히 발전하기 시작해 청소년기 또는 초기 성인에 공고화된 개인의 병리적인 정서, 사고 및 행동 양식을 의히마는 것으로, 예를 들어, 편집성 성격장애(paranoid personality disorder), 반사회적 성격장애(antisocial personality disorder), 경계성 성격장애(borderline personality disorder), 자기애 성격장애(narcissistic personality disorder), 회피성 성격장애(avoidant personality disorder), 및 의존성 성격장애(dependent personality disorder) 등이 포함될 수 있다.
본 발명에 있어서, 상기 신경발달 질환, 신경질환, 또는 정신질환은 신경생성의 장애(neurogenesis dysfunction)로 인한 질환일 수 있으며, 보다 구체적으로, 여러 가지 스트레스로 인한 미토콘드리아 기능 이상에 의해 초래되거나 NLRP3 inflammasome에 의해 매개되는 신경세포 손상, 신경염증 및/또는 신경퇴행에 의해 초래되는 신경생성의 장애로 인한 질환일 수 있다.
상기 “신경생성(neurogenesis)”은 신경줄기세포로부터 신경세포가 생성되는 과정을 의미하는 것으로, 성체 신경생성(adult neurogenesis)을 포함할 수 있다.
본 발명에서 사용되는 용어, “NLRP3 inflammasome(NLR family pyrin domain containing 3 inflammasome)에 의해 매개되는”이란 과도하게 형성된 NLRP3 inflammasome이 다양한 신호 전달 경로를 통해 신경염증 반응을 유도하여 초래된 신경 손상에 의해 발생되는 것을 의미하는 것으로, 본 발명의 일 실시예에 따르면, 상기 마이크로코커스 루테우스 유래 소포는 NLRP3 inflammasome 형성을 프라이밍(Priming)하는 신호 전달 경로를 억제함으로써 NLRP3 inflammasome 형성을 억제할 수 있으므로, 이를 통하여 NLRP3 inflammasome(NLR family pyrin domain containing 3 inflammasome)에 의해 매개되는 신경발달 질환, 신경질환, 또는 정신질환을 효과적으로 예방, 개선, 또는 치료할 수 있다.
본 발명에서 사용되는 용어 “항노화”란 노화를 방지하고 억제하여 노화를 최대한 지연시키는 것을 의미하는 것으로, 본 발명의 일 실시예 따르면, 상기 소포를 유효성분으로 포함하는 조성물은 신경생성 장애 억제를 통해 뇌 또는 신경세포의 노화를 억제할 수 있다.
본 발명의 조성물 내의 상기 소포의 함량은 질환의 증상, 증상의 진행 정도, 환자의 상태 등에 따라서 적절히 조절 가능하며, 예컨대, 전체 조성물 중량을 기준으로 0.0001 내지 99.9중량%, 또는 0.001 내지 50중량%일 수 있으나, 이에 한정되는 것은 아니다. 상기 함량비는 용매를 제거한 건조량을 기준으로 한 값이다.
본 발명에 따른 약학적 조성물은 약학적 조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형제 및 희석제를 더 포함할 수 있다. 상기 부형제는 예를 들어, 희석제, 결합제, 붕해제, 활택제, 흡착제, 보습제, 필름-코팅 물질, 및 제어방출첨가제로 이루어진 군으로부터 선택된 하나 이상일 수 있다.
본 발명에 따른 약학적 조성물은, 각각 통상의 방법에 따라 산제, 과립제, 서방형 과립제, 장용과립제, 액제, 점안제, 엘실릭제, 유제, 현탁액제, 주정제, 트로키제, 방향수제, 리모나아데제, 정제, 서방형정제, 장용정제, 설하정, 경질캅셀제, 연질캅셀제, 서방캅셀제, 장용캅셀제, 환제, 틴크제, 연조엑스제, 건조엑스제, 유동엑스제, 주사제, 캡슐제, 관류액, 경고제, 로션제, 파스타제, 분무제, 흡입제, 패취제, 멸균주사용액, 또는에어로졸 등의 외용제 등의 형태로 제형화하여 사용될 수 있으며, 상기 외용제는 크림, 젤, 패치, 분무제, 연고제, 경고제, 로션제, 리니멘트제, 파스타제 또는 카타플라스마제 등의 제형을 가질 수 있다.
본 발명에 따른 약학적 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 올리고당, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로오스, 미정질 셀룰로오스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다.
제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다.
본 발명에 따른 정제, 산제, 과립제, 캡슐제, 환제, 트로키제의 첨가제로 옥수수전분, 감자전분, 밀전분, 유당, 백당, 포도당, 과당, 디-만니톨, 침강탄산칼슘, 합성규산알루미늄, 인산일수소칼슘, 황산칼슘, 염화나트륨, 탄산수소나트륨, 정제 라놀린, 미결정셀룰로오스, 덱스트린, 알긴산나트륨, 메칠셀룰로오스, 카르복시메칠셀룰로오스나트륨, 카올린, 요소, 콜로이드성실리카겔, 히드록시프로필스타치, 히드록시프로필메칠셀룰로오스(HPMC) 1928, HPMC 2208, HPMC 2906, HPMC 2910, 프로필렌글리콜, 카제인, 젖산칼슘, 프리모젤 등 부형제; 젤라틴, 아라비아고무, 에탄올, 한천가루, 초산프탈산셀룰로오스, 카르복시메칠셀룰로오스, 카르복시메칠셀룰로오스칼슘, 포도당, 정제수, 카제인나트륨, 글리세린, 스테아린산, 카르복시메칠셀룰로오스나트륨, 메칠셀룰로오스나트륨, 메칠셀룰로오스, 미결정셀룰로오스, 덱스트린, 히드록시셀룰로오스, 히드록시프로필스타치, 히드록시메칠셀룰로오스, 정제쉘락, 전분호, 히드록시프로필셀룰로오스, 히드록시프로필메칠셀룰로오스, 폴리비닐알코올, 폴리비닐피롤리돈 등의 결합제가 사용될 수 있으며, 히드록시프로필메칠셀룰로오스, 옥수수전분, 한천가루, 메칠셀룰로오스, 벤토나이트, 히드록시프로필스타치, 카르복시메칠셀룰로오스나트륨, 알긴산나트륨, 카르복시메칠셀룰로오스칼슘, 구연산칼슘, 라우릴황산나트륨, 무수규산, 1-히드록시프로필셀룰로오스, 덱스트란, 이온교환수지, 초산폴리비닐, 포름알데히드처리 카제인 및 젤라틴, 알긴산, 아밀로오스, 구아르고무(Guar gum), 중조, 폴리비닐피롤리돈, 인산칼슘, 겔화전분, 아라비아고무, 아밀로펙틴, 펙틴, 폴리인산나트륨, 에칠셀룰로오스, 백당, 규산마그네슘알루미늄, 디-소르비톨액, 경질무수규산 등 붕해제; 스테아린산칼슘, 스테아린산마그네슘, 스테아린산, 수소화식물유(Hydrogenated vegetable oil), 탈크, 석송자, 카올린, 바셀린, 스테아린산나트륨, 카카오지, 살리실산나트륨, 살리실산마그네슘, 폴리에칠렌글리콜 4000, 6000, 유동파라핀, 수소첨가대두유(Lubri wax), 스테아린산알루미늄, 스테아린산아연, 라우릴황산나트륨, 산화마그네슘, 마크로골(Macrogol), 합성규산알루미늄, 무수규산, 고급지방산, 고급알코올, 실리콘유, 파라핀유, 폴리에칠렌글리콜지방산에테르, 전분, 염화나트륨, 초산나트륨, 올레인산나트륨, dl-로이신, 경질무수규산 등의 활택제;가 사용될 수 있다.
본 발명에 따른 액제의 첨가제로는 물, 묽은 염산, 묽은 황산, 구연산나트륨, 모노스테아린산슈크로스류, 폴리옥시에칠렌소르비톨지방산에스텔류(트윈에스텔), 폴리옥시에칠렌모노알킬에텔류, 라놀린에텔류, 라놀린에스텔류, 초산, 염산, 암모니아수, 탄산암모늄, 수산화칼륨, 수산화나트륨, 프롤아민, 폴리비닐피롤리돈, 에칠셀룰로오스, 카르복시메칠셀룰로오스나트륨 등이 사용될 수 있다.
본 발명에 따른 시럽제에는 백당의 용액, 다른 당류 혹은 감미제 등이 사용될 수 있으며, 필요에 따라 방향제, 착색제, 보존제, 안정제, 현탁화제, 유화제, 점조제 등이 사용될 수 있다.
본 발명에 따른 유제에는 정제수가 사용될 수 있으며, 필요에 따라 유화제, 보존제, 안정제, 방향제 등이 사용될 수 있다.
본 발명에 따른 현탁제에는 아카시아, 트라가칸타, 메칠셀룰로오스, 카르복시메칠셀룰로오스, 카르복시메칠셀룰로오스나트륨, 미결정셀룰로오스, 알긴산나트륨, 히드록시프로필메칠셀룰로오스, HPMC 1828, HPMC 2906, HPMC 2910 등 현탁화제가 사용될 수 있으며, 필요에 따라 계면활성제, 보존제, 안정제, 착색제, 방향제가 사용될 수 있다.
본 발명에 따른 주사제에는 주사용 증류수, 0.9%염화나트륨주사액, 링겔주사액, 덱스트로스주사액, 덱스트로스+염화나트륨주사액, 피이지(PEG), 락테이티드 링겔주사액, 에탄올, 프로필렌글리콜, 비휘발성유-참기름, 면실유, 낙화생유, 콩기름, 옥수수기름, 올레인산에칠, 미리스트산 이소프로필, 안식향산벤젠과 같은 용제; 안식향산나트륨, 살리실산나트륨, 초산나트륨, 요소, 우레탄, 모노에칠아세트아마이드, 부타졸리딘, 프로필렌글리콜, 트윈류, 니정틴산아미드, 헥사민, 디메칠아세트아마이드와 같은 용해보조제; 약산 및 그 염(초산과 초산나트륨), 약염기 및 그 염(암모니아 및 초산암모니움), 유기화합물, 단백질, 알부민, 펩 톤, 검류와 같은 완충제; 염화나트륨과 같은 등장화제; 중아황산나트륨(NaHSO3) 이산화탄소가스, 메타중아황산나트륨(Na2S2O5), 아황산나트륨(Na2SO3), 질소가스(N2), 에칠렌디아민테트라초산과 같은 안정제; 소디움비설파이드 0.1%, 소디움포름알데히드 설폭실레이트, 치오우레아, 에칠렌디아민테트라초산디나트륨, 아세톤소디움비설파이트와 같은 황산화제; 벤질알코올, 클로로부탄올, 염산프로카인, 포도당, 글루콘산칼슘과 같은 무통화제; 시엠시나트륨, 알긴산나트륨, 트윈 80, 모노스테아린산알루미늄과 같은 현탁화제를 포함할 수 있다.
본 발명에 따른 좌제에는 카카오지, 라놀린, 위텝솔, 폴리에틸렌글리콜, 글리세로젤라틴, 메칠셀룰로오스, 카르복시메칠셀룰로오스, 스테아린산과 올레인산의 혼합물, 수바날(Subanal), 면실유, 낙화생유, 야자유, 카카오버터+콜레스테롤, 레시틴, 라네트왁스, 모노스테아린산글리세롤, 트윈 또는 스판, 임하우젠(Imhausen), 모놀렌(모노스테아린산프로필렌글리콜), 글리세린, 아뎁스솔리두스(Adeps solidus), 부티룸 태고-G(Buytyrum Tego-G), 세베스파마 16(Cebes Pharma 16), 헥사라이드베이스 95, 코토마(Cotomar), 히드록코테 SP, S-70-XXA, S-70-XX75(S-70-XX95), 히드록코테(Hydrokote) 25, 히드록코테 711, 이드로포스탈(Idropostal), 마사에스트라리움(Massa estrarium, A, AS, B, C, D, E, I, T), 마사-MF, 마수폴, 마수폴-15, 네오수포스탈-엔, 파라마운드-B, 수포시로(OSI, OSIX, A, B, C, D, H, L), 좌제기제 IV 타입(AB, B, A, BC, BBG, E, BGF, C, D, 299), 수포스탈(N, Es), 웨코비(W, R, S, M ,Fs), 테제스터 트리글리세라이드 기제(TG-95, MA, 57)와 같은 기제가 사용될 수 있다.
경구 투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 추출물에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트(calcium carbonate), 수크로스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스티레이트 탈크 같은 윤활제들도 사용된다.
경구 투여를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜 (propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다.
본 발명에 따른 약학적 조성물은 약학적으로 유효한 양으로 투여한다. 본 발명에 있어서, "약학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효용량 수준은 환자 질환의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다.
본 발명에 따른 약학적 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있으며, 단일 또는 다중 투여될 수 있다. 상기한 요소들을 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 본 발명이 속하는 기술분야에 통상의 기술자에 의해 용이하게 결정될 수 있다.
본 발명의 약학적 조성물은 개체에게 다양한 경로로 투여될 수 있다. 투여의 모든 방식은 예상될 수 있는데, 예를 들면, 경구 복용, 피하 주사, 복강 투여, 정맥 주사, 근육 주사, 척수 주위 공간(경막내) 주사, 설하 투여, 볼점막 투여, 직장 내 삽입, 질 내 삽입, 안구 투여, 귀 투여, 비강 투여, 흡입, 입 또는 코를 통한 분무, 피부 투여, 경피 투여 등에 따라 투여될 수 있다.
본 발명의 약학적 조성물은 치료할 질환, 투여 경로, 환자의 연령, 성별, 체중 및 질환의 중등도 등의 여러 관련 인자와 함께 활성성분인 약물의 종류에 따라 결정된다. 구체적으로, 본 발명에 따른 조성물의 유효량은 환자의 나이, 성별, 체중에 따라 달라질 수 있으며, 일반적으로는 체중 1 kg 당 0.001 내지 150 mg, 바람직하게는 0.01 내지 100 mg을 매일 또는 격일 투여하거나 1일 1 내지 3회로 나누어 투여할 수 있다. 그러나 투여 경로, 비만의 중증도, 성별, 체중, 연령 등에 따라서 증감될 수 있으므로 상기 투여량이 어떠한 방법으로도 본 발명의 범위를 한정하는 것은 아니다.
또한, 본 발명은 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포를 유효성분으로 포함하는 조성물을 이를 필요로 하는 개체에 투여하는 단계를 포함하는, 신경발달 질환, 신경질환, 또는 정신질환의 예방 또는 치료 방법을 제공한다.
또한, 본 발명은 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포를 유효성분으로 포함하는 조성물의 신경발달 질환, 신경질환, 또는 정신질환 예방 또는 치료 용도를 제공한다.
또한, 본 발명은 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포의 신경발달 질환, 신경질환, 또는 정신질환 치료용 약제의 제조를 위한 용도를 제공한다.
본 발명에서 “개체”란 질병의 치료를 필요로 하는 대상을 의미하고, 보다 구체적으로는 인간 또는 비-인간인 영장류, 생쥐(mouse), 쥐(rat), 개, 고양이, 말, 및 소 등의 포유류일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서 “투여”란 임의의 적절한 방법으로 개체에게 소정의 본 발명의 조성물을 제공하는 것을 의미한다.
본 발명에서 “예방”이란 목적하는 질환의 발병을 억제하거나 지연시키는 모든 행위를 의미하고, “치료”란 본 발명에 따른 약학적 조성물의 투여에 의해 목적하는 질환과 그에 따른 대사 이상 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미하며, “개선”이란 본 발명에 따른 조성물의 투여에 의해 목적하는 질환과 관련된 파라미터, 예를 들면 증상의 정도를 감소시키는 모든 행위를 의미한다.
또한, 본 발명은 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포를 유효성분으로 포함하는, 신경발달 질환, 신경질환, 또는 정신질환의 예방 또는 개선용 식품 조성물을 제공한다.
또한, 본 발명은 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포를 유효성분으로 포함하는, 항노화용 식품 조성물을 제공할 수 있다.
상기 식품 조성물은 건강기능성 식품 조성물일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 소포를 식품 첨가물로 사용할 경우, 그대로 첨가하거나 다른 식품 또는 식품 성분과 함께 사용할 수 있고, 통상적인 방법에 따라 적절하게 사용할 수 있다. 유효성분의 혼합양은 사용 목적(예방, 건강 또는 치료적 처치)에 따라 적합하게 결정될 수 있다. 일반적으로, 식품 또는 음료의 제조시 본 발명의 소포는 원료에 대하여 15 중량% 이하, 또는 10 중량% 이하의 양으로 첨가될 수 있다. 그러나, 건강 및 위생을 목적으로 하거나 또는 건강 조절을 목적으로 하는 장기간의 섭취의 경우 상기 양은 상기 범위 이하일 수 있으며, 안전성 면에서 아무런 문제가 없기 때문에 유효성분은 상기 범위 이상의 양으로도 사용될 수 있다.
상기 식품의 종류에는 특별한 제한은 없다. 상기 물질을 첨가할 수 있는 식품의 예로는 육류, 소세지, 빵, 쵸코렛, 캔디류, 스넥류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 스프, 음료수, 차, 드링크제, 알콜 음료 및 비타민 복합제 등이 있으며, 통상적인 의미에서의 건강기능식품을 모두 포함한다.
본 발명에 따른 건강음료 조성물은 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 상술한 천연 탄수화물은 포도당 및 과당과 같은 모노사카라이드, 말토오스 및 수크로오스와 같은 디사카라이드, 덱스트린 및 시클로덱스트린과 같은 폴리사카라이드, 및 자일리톨, 소르비톨 및 에리트리톨 등의 당알콜이다. 감미제로서는 타우마틴, 스테비아 추출물과 같은 천연 감미제나, 사카린, 아스파르탐과 같은 합성 감미제 등을 사용할 수 있다. 상기 천연 탄수화물의 비율은 본 발명의 조성물 100 mL당 일반적으로 약 0.01-0.20g, 또는 약 0.04-0.10g 이다.
상기 외에 본 발명의 조성물은 여러 가지 영양제, 비타민, 전해질, 풍미제, 착색제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산 음료에 사용되는 탄산화제 등을 함유할 수 있다. 그 밖에 본 발명의 조성물은 천연 과일쥬스, 과일쥬스 음료 및 야채 음료의 제조를 위한 과육을 함유할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 크게 중요하진 않지만 본 발명의 조성물 100 중량부 당 0.01-0.20 중량부의 범위에서 선택되는 것이 일반적이다.
또한, 본 발명은 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포를 유효성분으로 포함하는, 신경발달 질환, 신경질환, 또는 정신질환의 예방 또는 치료용 흡입제 조성물을 제공한다.
흡입제 조성물의 경우, 당업계에 공지된 방법에 따라 제형화될 수 있으며, 적합한 추진제, 예를 들면, 디클로로플루오로메탄, 트리클로로플루오로메탄, 디클로로테트라플루오로에탄, 이산화탄소 또는 다른 적합한 기체를 사용하여, 가압 팩 또는 연무기로부터 에어로졸 스프레이 형태로 편리하게 전달할 수 있다. 가압 에어로졸의 경우, 투약 단위는 계량된 양을 전달하는 밸브를 제공하여 결정할 수 있다. 예를 들면, 흡입기 또는 취입기에 사용되는 젤라틴 캡슐 및 카트리지는 화합물 및 락토오즈 또는 전분과 같은 적합한 분말 기제의 분말 혼합물을 함유하도록 제형화할 수 있다.
또한, 본 발명은 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포를 유효성분으로 포함하는, 신경발달 질환, 신경질환, 또는 정신질환 치료 약물 전달용 조성물을 제공한다.
본 발명에서 사용되는 용어 “약물 전달”이란 특정 장기, 조직, 세포 또는 세포소기관으로 약물을 전달하기 위하여 본 발명에 따른 소포에 단백질, 항체, 고분자화합물, 저분자화합물, siRNA, 올리고뉴클레오티드 등의 약물을 로딩하여 전달하는 모든 수단 또는 행위를 의미한다.
본 발명에서, 상기 약물 전달용 조성물은 위, 소장, 대장, 폐, 간, 신장, 및 뇌로 이루어진 군으로부터 선택된 하나 이상의 장기에 약물을 전달할 수 있으며, 바람직하게는 뇌에 약물을 전달할 수 있으나, 이에 제한되지 않는다.
또한, 본 발명은 목적하는 신경발달 질환, 신경질환, 또는 정신질환 치료 약물을 담지한 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포를 유효성분으로 포함하는 조성물을 이를 필요로 하는 개체에 투여하는 단계를 포함하는, 신경발달 질환, 신경질환, 또는 정신질환 치료 약물 전달 방법을 제공한다.
또한, 본 발명은 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포를 유효성분으로 포함하는 조성물의 신경발달 질환, 신경질환, 또는 정신질환 치료 약물 전달 용도를 제공한다.
또한, 본 발명은 마이크로코커스(Micrococcus) 속 세균 유래 소포를 유효성분으로 포함하는, 신경발달 질환, 신경질환, 또는 정신질환의 예방 또는 치료용 약학적 조성물을 제공한다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
[실시예]
실시예 1. 마이크로코커스 루테우스 배양액에서 소포 분리
마이크로코커스 루테우스 균주를 배양한 후 이의 소포를 분리하여 특성을 분석하였다. 마이크로코커스 루테우스를 37℃ 호기성 챔버에서 흡광도(OD 600)가 1.0~1.5가 될 때까지 MRS(de Man-Rogosa and Sharpe) 배지에서 배양한 후 sub-culture하였다. 이후 균주가 포함되어 있는 배지 상등액을 회수하여 10,000 g, 4 ℃에서 20분 동안 원심분리하고 균주를 제거하고, 0.22μm 필터에 여과하였다. 여과한 상등액을 100 kDa Pellicon 2 Cassette 필터 멤브레인(Merck Millipore, US)으로 MasterFlex pump system(Cole-Parmer, US)를 이용하여 microfiltration을 통해 50 ㎖ 부피로 농축하였다. 이후 농축시킨 상등액을 다시 한 번 0.22 μm 필터로 여과하였다. 이후 BCA assay를 이용해 단백질을 정량하였고, 얻어진 소포에 대하여 하기 실험들을 실시하였다.
실시예 2. 마이크로코커스 루테우스 유래 소포의 약동학적 특성
마이크로코커스 루테우스 유래 소포의 약동학적 특성을 알아보기 위해, 형광 염색시약으로 염색한 마이크로코커스 루테우스 유래 소포를 마우스에 경구 투여하여 48시간 동안 각 장기에서 발현된 형광을 측정하였다.
도 1에 나타난 바와 같이, 형광 염색된 마이크로코커스 루테우스 유래 소포의 시간 경과에 따른 장기 분포를 이미지로 평가하였을 때, 상기 소포가 여러 장기에 분포함을 확인할 수 있었다. 또한, 도 2에 나타난 바와 같이, 상기 소포는 경구 투여 후 1시간 이내로 뇌 조직에 분포하여, 24시간까지 지속적으로 뇌 조직에 분포하는 것을 확인할 수 있었다.
실시예 3. 상피세포에서 마이크로코커스 루테우스 유래 소포의 항염증 효과
도 3에 나타난 바와 같이, 마이크로코커스 루테우스 유래 소포(MDH-101 EV)와 양성 대조 약물인 덱사메타손(Dexamethasone)을 상피세포에 전처리한 후, 염증성 인자인 대장균 유래 소포(E. coli EV)를 처리하여 염증성 사이토카인인 IL-8의 분비량을 ELISA(Enzyme-linked immunosorbent assay, R&D Systems)로 측정하였다. 구체적으로, 상피세포에 마이크로코커스 루테우스 유래 소포를 다양한 농도(1, 10, 100 ㎍/mL)로 24시간 전처리한 후 대장균 유래 소포를 1 ng/mL 농도로 24시간 처리하여 배지로 분비된 IL-8의 분비량을 측정하였다.
그 결과, 도 4a에 나타난 바와 같이, 마이크로코커스 루테우스 유래 소포에 의해 IL-8의 분비가 용량 의존적으로 억제됨을 확인하였다. 또한, 도 4b에 나타난 바와 같이, 대조 약물인 덱사메타손과 비교하였을 때, IL-8 분비 억제 효과가 대조 약물보다 우수하였고, 상기 소포에 열처리할 경우, IL-8 분비 억제 효과가 없어짐을 확인하였다. 상기 결과로부터, 마이크로코커스 루테우스 유래 소포가 대표적인 항염증 약물인 덱사메타손에 비해 항염증 효능이 더 우수함을 알 수 있었을 뿐만 아니라 마이크로코커스 루테우스 유래 소포에 의한 항염증 효능이 열처리 시 없어지는 것을 통해 항염증 작용이 소포 내에 포함된 단백질에 의해 매개됨을 알 수 있었다.
실시예 4. 염증세포에서 마이크로코커스 루테우스 유래 소포의 항염증 효과
도 5에 나타난 바와 같이, 마이크로코커스 루테우스 유래 소포(M. luteus EV)를 대표적인 염증세포인 대식세포에 전처리한 후, 염증을 유발하는 대장균 유래 소포(E. coli EV)를 처리하여 염증성 사이토카인 TNF-α 및 IL-6의 분비량을 ELISA(R&D Systems) 방법으로 측정하였다. 구체적으로, 마이크로코커스 루테우스 유래 소포를 다양한 농도(1, 10, 100 ㎍/mL)로 대식세포에 24시간 동안 전처리한 후, 대장균 유래 소포를 1 ng/mL 농도로 24시간 처리하여 배지로 분비된 TNF-α 및 IL-6의 분비량을 측정하였다.
그 결과, 도 6a 및 도 6b에 나타난 바와 같이, 마이크로코커스 루테우스 유래 소포를 전처리한 경우 염증성 원인 인자인 대장균 유래 소포에 의한 TNF-α(도 6a) 및 IL-6(도 6b)의 분비가 마이크로코커스 루테우스 유래 소포 용량 의존적으로 억제됨을 확인하였다. 이는 신경발달 질환, 신경질환 또는 정신질환에서 염증을 유도하는 염증세포에서 염증성 원인 인자에 의한 염증성 매개체의 분비를 마이크로코커스 루테우스 유래 소포가 효율적으로 억제함을 의미한다.
실시예 5. 염증성 인자에 의한 면역기능 이상에 대한 마이크로코커스 루테우스 유래 소포의 면역 기능 조절 효과
여러 가지 대사 스트레스에 대한 면역 반응은 신경질환 또는 정신질환의 병인에 매우 중요하다고 알려져 있다. 특히, 세포질에 존재하는 NLRP3 단백질은 신경발달 질환, 신경질환 또는 정신질환의 병인에 핵심적인 신호전달 경로로 알려져 있다. 마이크로코커스 루테우스 유래 소포에 의한 면역기능 조절 효과를 평가하기 위하여, 면역기능 이상을 유도하는 대표적인 원인 인자인 LPS(Lipopolysaccaride)를 마우스에 투여하여 조직에서 NLRP3(NLR family pyrin domain containing 3), t-bet(t-box protein expressed in T cells), ROR-γt(retineic-acid-receptor-related orphan nuclear receptor gamma)의 발현을 western blotting으로 확인하였다. 각 단백질의 발현량을 측정하기 위해 단백질 50 μg을 사용하였으며, 덱사메타손(Dexamethasone, Dex) 또는 마이크로코커스 루테우스 유래 소포를 투여한 마우스 그룹의 조직에서 위 단백질의 발현을 평가하였다.
그 결과, 도 7에 나타난 바와 같이, LPS를 투여한 그룹(LPS)에서는 음성 대조군에 비하여 NLRP3 단백질 발현이 현저히 증가되었고, LPS를 투여한 마우스에 마이크로코커스 루테우스 유래 소포를 투여한 그룹(LPS+MlEV)의 조직에서는 덱사메타손을 투여한 그룹(LPS+Dex)과 유사하게 NLRP3 단백질 발현이 현저히 억제됨을 확인하였다. 또한, LPS를 투여한 그룹(LPS)에서는 음성 대조군에 비하여 t-bet 및 ROR-γt 단백질 발현이 현저히 증가 되었고, 마이크로코커스 루테우스 유래 소포를 투여한 그룹(LPS+MlEV)에서는 덱사메타손을 투여한 그룹(LPS+Dex)보다 현저히 t-bet 및 ROR-γt 단백질 발현이 억제되었다. 이는 염증성 원인 인자에 의한 선천면역 기능 이상을 마이크로코커스 루테우스 유래 소포가 효율적으로 억제함을 의미한다.
또한, 상기 실시예 4의 방법으로 마이크로코커스 루테우스 유래 소포를 대식세포에 전처리한 후 대식세포에 LPS를 처리하여 IL-1β의 분비에 미치는 효능을 평가하였다. 도 8에 나타난 바와 같이, 상기 소포를 전처리한 경우, 염증성 인자인 LPS에 의한 IL-1β의 분비가 마이크로코커스 루테우스 유래 소포(M. luteus EV) 용량 의존적으로 억제됨을 확인하였다. 이는 신경발달 질환, 신경질환 또는 정신질환에서 염증을 유도하는 염증세포에서 NLRP3 inflammasome을 통해 분비되는 염증성 매개체인 IL-1β의 분비를 마이크로코커스 루테우스 유래 소포가 효율적으로 억제함을 의미한다.
실시예 6. 염증성 인자에 의한 선천 면역기능 이상에 마이크로코커스 루테우스 유래 소포의 조절 효과
여러 가지 대사 스트레스에 대한 선천 면역기능 이상은 신경발달 질환, 신경질환 또는 정신질환의 병인에 매우 중요하다고 알려져 있다. 면역질환의 병인에선, 특정 항원에 대한 Th1 및 Th17의 후천면역 반응이 면역기능 이상에 핵심적인 반면, 신경발달 질환, 신경질환 또는 정신질환의 병인에서는 선천 면역을 유도하는 여러 가지 위험 인자(danger signal)에 의해 NLRP3 inflammasome이 형성되어 질병이 발생함이 최근 밝혀졌다. 또한, 위험 인자에 의해 NLRP3 inflammasome이 형성되기 위해선, 선행적으로 LPS 및 TNF-α 등과 같은 염증성 인자에 의해 NLPR3 단백질 발현이 유도되는 프라이밍(Priming) 과정이 중요하다.
NLRP3 inflammasome 형성에 필수적인 NLRP3 프라이밍 과정에서 마이크로코커스 루테우스 유래 소포의 효능을 평가하기 위하여, 실시예 5의 방법으로 LPS를 투여한 마우스에서 조직을 적출하여 선천 면역기능 관련 신호인 JNK 및 NF-kB(p65)의 활성화 정도를 western blotting으로 평가하였다. 각 단백질의 발현량을 측정하기 위해 단백질 50 μg을 사용하였으며, 덱사메타손(Dexamethasone, Dex) 또는 마이크로코커스 루테우스 유래 소포를 투여한 마우스 그룹의 조직에서 위 단백질의 발현을 평가하였다.
그 결과, 도 9에 나타난 바와 같이, LPS를 투여한 그룹(LPS)에서는 음성 대조군에 비하여 JNK 및 p65 단백질의 인산화가 증가 되었고, 이는 덱사메타손(Dex) 및 마이크로코커스 루테우스 유래 소포(MIEV)에 의해 억제되었다. 이는 NLRP3 inflammasome 형성을 프라이밍(priming)하는 신호인 JNK 및 NF-kB(p65) 신호전달 경로를 마이크로코커스 루테우스 유래 소포가 효율적으로 억제하여 선천 면역기능 이상을 조절함을 의미한다.
실시예 7. 염증성 인자에 의한 선천 면역세포 생성에 마이크로코커스 루테우스 유래 소포의 조절 효과
여러 가지 스트레스에 대한 선천면역 기능 이상에 의한 신경발달 질환, 신경질환 또는 정신질환의 병인에 ROR-γt 신호를 통한 ILC3 면역세포가 중요하고, 이는 IL-17 등을 분비하여 질병의 병인에 관여함이 최근 밝혀졌다. 특히, 대표적인 염증성 신경질환인 다발성경화증(multiple sclerosis)의 병인에 ILC3 면역세포가 중심적인 역할을 담당함이 밝혀졌다. 마이크로코커스 루테우스 유래 소포가 ILC3 면역세포 생성에 미치는 효과를 평가하기 위하여, 실시예 5의 방법으로 LPS를 마우스에 투여하여 조직에서 면역세포 수를 유세포 분석(Flow cytometry) 방법으로 평가하였다.
그 결과, 도 10에 나타난 바와 같이, LPS를 투여한 그룹(LPS)에서는 음성 대조군에 비하여 IL-17을 분비하는 ILC3 세포가 현저히 증가하였으며, LPS에 의해 증가된 ILC3 세포 수는 덱사메타손(Dex) 및 마이크로코커스 루테우스 유래 소포(MIEV)에 의해 억제되었고, 소포를 투여한 경우가 덱사메타손을 투여한 경우보다 억제 정도가 더욱 현저함을 확인하였다. 이는 NLRP3 inflammasome에 의해 유도되는 선천 면역세포 생성이 마이크로코커스 루테우스 유래 소포에 의해 효율적으로 억제됨을 의미한다.
실시예 8. 산화 스트레스에 대한 세포의 항상성 조절에서 마이크로코커스 루테우스 유래 소포의 효능
세포가 여러 가지 스트레스에 반복적으로 노출 시, 이는 세포 내에서 산화 스트레스(oxidative stress)로 변환되어 세포 노화 및 사멸을 초래하여 신경발달 질환, 신경질환 또는 정신질환을 일으킨다. 신경발달 질환, 신경질환 및 정신질환의 병인에서 eNOS(endothelial NO synthase) 신호를 통해 생성되는 NO(nitric oxide)는 산화 스트레스의 주범인 활성 산소(reactive oxygen species, ROS) 작용을 억제하고, 세포의 항상성을 증가시키는 물질을 유도하여 세포의 항상성을 증가시키고 세포사멸을 억제한다.
산화 스트레스에 대한 세포의 항상성에 미치는 마이크로코커스 루테우스 유래 소포의 효과를 평가하기 위하여, 실시예 3에 기술된 방법으로 마이크로코커스 루테우스 유래 소포를 혈관 내피세포에 처리한 후, eNOS 신호의 활성화 정도를 평가하였다. 신호전달 단백질 발현을 평가하기 위한 방법으로, lysis buffer를 이용해 세포를 용해시키고 단백질을 추출하였으며, BCA protein assay kit(Thermo, USA)를 사용하여 단백질을 정량하였다. 단백질의 활성화 정도는 p-ERK, ERK, p-eNOS, eNOS, β-actin에 특이적인 항체를 사용하여 평가하였다.
그 결과, 도 11에 나타난 바와 같이, 세포 내 ERK 및 eNOS의 인산화가 염증성 인자인 대장균 유래 소포(E. coli)에 의해 억제되었지만, 덱사메타손(Dex) 및 마이크로코커스 루테우스 유래 소포(MDH-101)에 의해선 증가된 것을 확인할 수 있었다. 또한, 마이크로코커스 루테우스 유래 소포에 의한 eNOS 활성화는 상기 소포에 열처리한 경우 유도되지 않는 것을 확인할 수 있었다. 상기 결과로부터, 마이크로코커스 루테우스 유래 소포는 혈관 내피세포의 항상성 및 혈관 건강에 중요한 eNOS 및 ERK 신호를 활성화하여 신경질환 또는 정신질환의 병인을 조절함을 알 수 있다.
실시예 9. 신경세포 손상에서 마이크로코커스 루테우스 유래 소포의 효능
신경 줄기세포 및 신경세포가 여러 가지 스트레스에 반복적으로 노출 시, 세포 내에서는 산화 스트레스에 의해 유전자 손상이 초래되고, 이로 인하여 신경세포의 노화 및 비정상적인 신경세포의 사멸이 초래된다. 히스톤 탈아세틸화 효소(Histone deacetylase; HDAC)는 히스톤 단백질을 비롯하여 다양한 단백질의 아세틸화된 라이신(Lysine) 잔기의 탈아세틸화(deacetylation)에 관여함으로서, 염색질의 구조와 기능 조절을 통한 유전자 발현 조절뿐 아니라, 세포 내 신호전달 과정에서 중요한 역할을 담당한다. 이러한 HDAC는 클래스 I, II, III 및 IV로 나뉘며, 클래스 Ⅲ에 속하는 시르투인(Sirtuin)은 칼로리가 낮은 스트레스 상황에서 세포의 항상성을 유지하는 신호전달 단백질로 알려져 있다.
Sirtuin 단백질 중 sirtuin 1(Sirt1)은 핵과 세포질에 존재하며, deacetylase 효소로서 대사 스트레스로 인한 염증을 억제하고 세포의 생존을 증가시키는 항노화 단백질이고; Sirtuin 5(Sirt5)는 미토콘드리아에 존재하며, demalonylase, desuccinylase, deacetylase 효소 기능을 갖고 있고, 미토콘드리아에서 암모니아 독성을 조절하여 미토콘드리아 기능을 유지시키는 단백질이며; Sirtuin 7(Sirt7)은 핵 내의 인(neucleolus)에 존재하고 deacetylase 효소 기능을 갖고 있어 rDNA 손상을 복구하여 리보솜(ribosome)에서 단백질이 제대로 생성될 수 있도록 하는 단백질이다.
산화 스트레스에 대한 신경세포의 항상성에 미치는 마이크로코커스 루테우스 유래 소포의 효과를 평가하기 위하여, 실시예 3에 기술된 방법으로 마이크로코커스 루테우스 유래 소포를 신경세포에 처리한 후, sirtuin 유전자의 발현 양상을 평가하였으며, 음성 대조군으로 PBS를 사용하였다. 구체적으로, lysis buffer를 이용해 세포를 용해시키고 유전자를 추출하였으며, RT-PCR를 사용하여 유전자 발현을 정량하였다. 유전자 발현 정도는 하기 표 1에 나타낸 HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, Sirt1, Sirt5, 및 Sirt7 유전자의 mRNA에 대한 특이적인 프라이머를 사용하여 평가하였다.
명칭 구분 서열(5’→3’) 서열번호
HDAC1 FW CAGTGTGGCTCAGATTCCCT 1
RV GGGCAGCTCATTAGGGATCT 2
HDAC2 FW GGGACAGGCTTGGTTGTTTC 3
RV GAGCATCAGCAATGGCAAGT 4
HDAC3 FW AGAGAGGTCCCGAGGAGAAC 5
RV ACTCTTGGGGACACAGCATC 6
HDAC4 FW CAATCCCACAGTCTCCGTGT 7
RV CAGCACCCCACTAAGGTTCA 8
HDAC5 FW TGTCACCGCCAGATGTTTTG 9
RV TGAGCAGAGCCGAGACACAG 10
Sirt1 FW GATCCTTCAGTGTCATGGTTC 11
RV ATGGCAAGTGGCTCATCA 12
Sirt5 FW ATCGCAAGGCTGGCACCAAGAA 13
RV CTAAAGCTGGGCAGATCGGACT 14
Sirt7 FW GAGAGCGAGGATCTGGTGAC 15
RV CGTGTAGACAACCAAGTGCC 16
그 결과, 도 12에 나타난 바와 같이, 신경세포에 비정상적인 단백질인 베타-아밀로이드(Aβ)를 처리하였을 때, HDAC2 및 HDAC5 유전자 발현은 음성 대조군에 비해 유의하게 증가하였고, Sirt1, Sirt5, 및 Sirt7 유전자 발현은 음성 대조군에 비해 감소 되었다. 또한, Aβ 단백질에 의해 발현이 증가된 HDAC5 유전자는 마이크로코커스 루테우스 유래 소포를 처리하였을 때 발현이 유의하게 감소 되었고, Aβ 단백질에 의해 발현이 감소된 Sirt1 및 Sirt7 유전자는 상기 소포를 처리하였을 때 발현이 유의하게 증가 되었다. 상기 결과로부터, 마이크로코커스 루테우스 유래 소포는 Sirt1 및 Sirt7 유전자 발현을 통해 신경세포의 항상성을 증가시켜 대사 스트레스에 의한 염증 및 세포사멸을 억제함을 알 수 있다.
실시예 10. 신경 생성 억제에서 마이크로코커스 루테우스 유래 소포의 효능
신경 줄기세포 및 신경세포가 여러 가지 스트레스에 반복적으로 노출 시, 신경 생성 능력이 떨어진다. 뉴로트로핀(Neurotrophin)은 분화된 신경세포의 생존 및 기능뿐만 아니라, 신경 줄기세포의 발달에 핵심적인 역할을 하는 성장인자 단백질 군이다. 인간을 포함한 대부분의 포유류의 뇌는 태아 시기에 신경세포가 만들어지지만, 해마(hippocampus) 영역에 신경 줄기세포가 존재하여 태어난 이후에도 성체 신경생성(aldult neurogenesis)이 일어난다. 신경 줄기세포 및 신경세포의 생존 및 기능과 관련된 뉴로트로핀은 BDNF(brain-derived neurotrophic factor), NT3(neurotrophin-3), NT4/5, 및 NGF(nerve growth factor) 등이 대표적이다. 이 중 BDNF는 중추신경계와 말초신경계에 존재하고, TrkB 수용체를 통해 뇌와 말초신경계에 존재하는 신경세포의 생존 및 시냅스 형성을 증가시킬 뿐 아니라, 신경 줄기세포의 증식 및 분화를 유도하는 단백질이다.
산화 스트레스에 대한 신경 줄기세포 및 신경세포의 생존 및 기능에 미치는 마이크로코커스 루테우스 유래 소포의 효과를 평가하기 위하여, 실시예 3에 기술된 방법으로 마이크로코커스 루테우스 유래 소포를 신경세포에 처리한 후, 뉴로트로핀 및 이의 수용체인 TrkB 유전자의 발현 양상을 평가하였으며, 음성 대조군으로 PBS를 사용하였다. 구체적으로, lysis buffer를 이용해 세포를 용해시키고 유전자를 추출하였으며, RT-PCR를 사용하여 유전자 발현을 정량하였다. 유전자 발현 정도는 하기 표 2에 나타낸 BDNF, NT3, NT4/5, NGF, 및 TrkB 유전자의 mRNA 에 대한 특이적인 프라이머를 사용하여 평가하였다.
명칭 구분 서열(5’→3’) 서열번호
tBDNF FW TGGCTGACACTTTTGAGCAC 17
RV GTTTGCGGCATCCAGGTAAT 18
NT3 FW TACTACGGCAACAGAGACG 19
RV GTTGCCCACATAATCCTCC 20
NT4/5 FW GGCTCCATCCTGAACATCAT 21
RV GCCATGATCTACCTGCCTGT 22
NGF FW AGCATTCCCTTGACACAG 23
RV GGTCTACAGTGATGTTGC 24
TrkB FW AAGGACTTTCATCGGGAAGCTG 25
RV TCGCCCTCCACACAGACAC 26
그 결과, 도 13에 나타난 바와 같이, 신경세포에 비정상적인 단백질인 베타-아밀로이드(Aβ)를 처리하였을 때, BDNF, NT3, NT4/5, 및 NGF 유전자의 발현은 음성 대조군에 비해 유의하게 감소하였고, 이 중에서 BDNF 유전자의 발현은 마이크로코커스 루테우스 유래 소포를 처리하였을 때 음성 대조군과 유사한 정도로 회복되었다. 또한, BDNF 수용체인 TrkB 유전자 발현도 Aβ 단백질에 의해 억제되었고, 이는 상기 소포에 의해 음성 대조군 수준으로 회복되었다. 상기 결과로부터, 마이크로코커스 루테우스 유래 소포는 BDNF 및 TrkB 수용체 유전자 발현을 증가시켜 신경 줄기세포의 분화 및 분화 신경세포의 생존 및 기능을 증가시킨다는 것을 알 수 있다.
실시예 11. 뇌질환 마우스 모델에서 마이크로코커스 루테우스 유래 소포의 인지기능 개선 효과
Tg-APP/PS1 마우스는 비정상적인 APP(amyloid precursor protein) 및 PS1(presenilin 1) 단백질을 과발현시켜 뇌질환을 유도한 마우스 모델로, 6.5개월령부터 조직학적으로 탐지 가능한 비정상적인 단백질 플라그의 침착을 보이고, 7 ~ 8개월령의 시기에 인지 기능장애가 안정적으로 탐지되는 동물 모델이다. 마이크로코커스 루테우스 유래 소포의 인지 기능 개선 효과를 평가하기 위하여, 상기 마우스 모델을 이용하여 도 14에 나타낸 바와 같이, 정상 마우스 그룹(WT+veh), sham 치료 뇌질환 마우스 그룹(Tg+veh), 및 뇌질환 마우스 모델에 마이크로코커스 루테우스 유래 소포 50 μg/mouse을 경구 투여한 뇌질환 마우스 그룹(Tg+MDH-101)으로 나눠 행동검사 및 조직학적 검사를 수행하였다.
마이크로코커스 루테우스 유래 소포의 인지 기능 개선 효과를 평가하기 위해, 도 15에 나타난 바와 같이 WT+veh, Tg+veh, 및 Tg+MDH-101 각 그룹 별로 위치가 바뀐 물체 또는 새로운 물체에 노출시켜 10분 동안 물체를 탐색하는 시간을 측정하였다. 그 결과, 도 15에 나타낸 바와 같이, 2시간 또는 24시간 후 측정한 새로운 물체 인지 능력 테스트 (novel object recognition test)에서 WT+veh 및 Tg+MDH-101 그룹은 새로운 물체를 탐색하는 시간이 길지만, Tg+veh 그룹은 변화가 없음을 확인하였다. 또한, 위치 인지 능력 테스트(novel location recognition test)에서도 WT+veh 및 Tg+MDH-101 그룹은 위치가 이동된 물체를 탐색하는 시간이 길지만, Tg+veh에서는 변화가 없음을 확인하였다. 이는 마이크로코커스 루테우스 유래 소포가 비정상적인 단백질 생성에 의해 유도뇌는 뇌질환 마우스에서 단기 및 장기 인지 기능장애의 진행을 억제함을 의미한다.
실시예 12. 뇌질환 마우스 모델에서 마이크로코커스 루테우스 유래 소포의 학습능력 개선 효과
상기 실시예 11의 뇌질환 마우스 모델에서 마이크로코커스 루테우스 유래 소포의 학습능력 개선 효능을 평가하기 위해, 도 16a에 나타난 바와 같이, 5일 동안 수통 내의 숨겨진 플랫폼(platform)을 찾아가도록 훈련시킨 후, 숨겨진 플랫폼을 찾아가는 평가를 수행하였다.
그 결과, 도 16b에 나타난 바와 같이, 5일 간의 훈련기간 동안 숨겨진 플랫폼을 찾아가는 시간은 WT+veh 그룹이 가장 빠르고, 마이크로코커스 루테우스 유래 소포를 투여한 Tg+MDH-101 그룹은 WT+veh 그룹과 유사한 학습 능력을 보였으나, Tg-veh 그룹은 가장 느린 학습 시간을 보였다. 또한, 도 16c에 나타난 바와 같이, 숨겨진 플랫폼의 위치를 찾아 머무는 시간의 경우, WT+veh 그룹이 플랫폼 위치에 오랜 시간 머물렀고, 마이크로코커스 루테우스 유래 소포를 투여한 Tg+MDH-101 그룹은 Tg-veh 그룹에 비해 플랫폼 위치에 머문 시간이 유의하게 길게 나타났다. 상기 결과로부터, 마이크로코커스 루테우스 유래 소포는 뇌질환 마우스의 공간지각 학습 및 기억능력 회복에 치료 효과가 있는 것을 알 수 있다.
실시예 13. 뇌질환 마우스 모델에서 마이크로코커스 루테우스 유래 소포의 기억능력 개선 효과
상기 실시예 11의 뇌질환 마우스 모델에서 마이크로코커스 루테우스 유래 소포의 기억능력 개선 효능을 평가하기 위해, 도 17a에 나타난 바와 같이 마우스가 어두운 공간으로 들어갈 경우, 발에 전기 충격을 가해 chamber context와 연계시킨 공포와 불안을 학습시킨 후, 24, 72, 및 120 시간의 장기적인 시간동안 마우스가 공포/불안과 연관시켜 기억하는지 확인하는 시험을 진행하였다.
그 결과, 도 17b에 나타난 바와 같이, WT+veh 및 Tg+MDH-101 그룹의 마우스는 24, 72, 및 120 시간의 시점에서 실험이 진행되는 300초가 지나도록 어두운 공간에 들어가지 않았지만, Tg+veh 그룹의 마우스는 어두운 공간으로 들어가는 시간이 점차 빨라지는 것을 확인할 수 있었다. 또한, 도 17c에 나타낸 바와 같이, 마우스가 어두운 공간에 들어가 전기 충격을 받고 나왔을 때, 충격으로 인해 얼어있는 시간(freezing time)의 경우, WT+veh 그룹의 마우스는 Tg+veh 그룹의 마우스에 비해 얼어있는 시간이 유의하게 길었으나, 마이크로코커스 루테우스 유래 소포를 투여한 Tg+MDH-101 그룹의 마우스는 Tg+veh 그룹의 마우스와 유의한 차이가 없음을 확인할 수 있었다. 상기 결과로부터, 마이크로코커스 루테우스 유래 소포는 비정상적인 단백질에 의해 유도되는 기억능력 손실을 억제하는 효과가 있음을 알 수 있다.
실시예 14. 뇌질환 마우스 모델에서 비정상적인 플러그 형성에 미치는 마이크로코커스 루테우스 유래 소포의 효능 평가
아밀로이드 베타(Aβ) 플라그는 알츠하이머병 환자의 뇌에서 대표적으로 발견되는 단백질로, Tg-APP/PS1 마우스 모델에서는 마우스의 뇌에 Aβ 플라그가 축적되기 시작하며 알츠하이머 증상을 유도한다고 알려져 있다. 상기 실시예 11의 마우스 모델들의 뇌 절편을 Thioflavin-S 염료로 형광 염색을 수행하여 뇌 조직에 침착된 Aβ 플라그를 분석하였다.
그 결과, 도 18a에 나타난 바와 같이, 뇌의 두정엽(Parietal cortex), 해마(Hippocampus), 및 조롱박피질(Piriform cortex) 지역에 형성되어 있는 Aβ 플라그가 Tg+veh 그룹과 마이크로코커스 루테우스 유래 소포를 투여한 Tg+MDH-101 그룹 간에 차이가 있음을 확인할 수 있었다. 또한, 도 18b 및 도 18c에 나타난 바와 같이, Tg+veh 그룹에 비해 마이크로코커스 루테우스 유래 소포를 투여한 Tg+MDH-101 그룹은 뇌의 두정엽 및 해마 지역에 침착되는 단위 면적당 Aβ 플라그 수(도 18b)와 Aβ 플라그 면적(도 18c)이 유의하게 감소됨을 확인할 수 있었다. 상기 결과로부터, 마이크로코커스 루테우스 유래 소포는 비정상적인 단백질 과발현에 의한 뇌질환 마우스 모델에서 비정상적인 단백질 플라그의 형성을 억제하는 효과가 있음을 알 수 있다.
실시예 15. 뇌질환 마우스 모델에서 마이크로코커스 루테우스 유래 소포의 성체 신경생성(adult neurogenesis) 효능 평가
상기 실시예들을 바탕으로 마이크로코커스 루테우스 유래 소포를 투여한 뇌질환 마우스 모델에서 나타난 신경 기능 악화를 억제하는 기전을 규명하기 위해, 신경생성(neurogenesis)을 평가하였다.
도 19에 나타난 바와 같이, 신경 줄기세포 증식(neural stem cell proliferation) 마커로 알려진 Ki-67을 형광 염색하여 Ki-67에 염색된 세포 수를 확인한 결과, WT+veh 그룹에 비해 Tg+veh 그룹에서 Ki-67에 염색된 세포 수가 유의하게 감소한 것을 확인할 수 있었다. 반면, 마이크로코커스 루테우스 유래 소포를 투여한 Tg+MDH-101 그룹은 Tg+veh 그룹에 비해 Ki-67에 염색된 세포 수가 유의하게 증가하여 WT+veh 그룹과 유사한 정도로 회복된 것을 확인할 수 있었다.
또한, 신경 줄기세포의 분화 및 이동에서의 마이크로코커스 루테우스 유래 소포의 효능을 평가하기 위해, 신경 줄기세포의 분화 및 이동 관련 마커인 DCX(double cortin)을 형광 염색하였다. 그 결과, 도 20에 나타난 바와 같이, WT+veh 그룹에 비해 Tg+veh 그룹의 DCX 양성 세포 수가 유의하게 감소하였으며, 이는 마이크로코커스 루테우스 유래 소포를 투여한 Tg+MDH-101 그룹에서 유의하게 회복된 것을 확인할 수 있었다. 상기 결과로부터, 마이크로코커스 루테우스 유래 소포는 뇌질환 마우스 모델에서 새로운 신경생성(neurogenesis)을 유도하며, 새로운 신경세포를 생성함으로써 비정상적인 단백질 생성에 의한 신경발달 질환, 신경질환 또는 정신질환에 대해 치료 효과를 나타냄을 알 수 있다.
실시예 16. 뇌질환 마우스 모델에서 마이크로코커스 루테우스 유래 소포의 신경세포 수상돌기 형성능력 평가
상기 실시예들을 바탕으로 마이크로코커스 루테우스 유래 소포를 투여한 뇌질환 마우스 모델에서 나타난 신경 기능의 향상에 대한 작용기전을 규명하기 위해, 분화된 신경세포의 수상돌기(dendritic process) 형성능력을 평가하였다. 수상돌기의 형태 및 수의 변화는 신경세포 간 신호전달에 중요하기 때문에, 신경세포 특이적 세포골격 단백질으로 잘 알려진 미세소관 관련 단백질 2(Microtubule-associated protein 2; MAP2)의 발현을 이용해 평가하였다.
그 결과, 도 21에 나타난 바와 같이, WT+veh 그룹에 비해 Tg+veh 그룹에서 MAP2의 발현이 유의하게 감소되었으며, 이는 마이크로코커스 루테우스 유래 소포를 투여한 Tg+MDH-101 그룹에서 유의하게 회복된 것을 확인할 수 있었다. 상기 결과로부터, 마이크로코커스 루테우스 유래 소포는 신경세포의 수상돌기 형성을 통해 신경세포 간 연결성을 증가시켜 신경발달 질환, 신경질환, 또는 정신질환의 발생 또는 경과를 조절함을 알 수 있다.
상기 결과로부터, 본 발명의 마이크로코커스 루테우스 유래 소포는 신경발달 질환, 신경질환 또는 정신질환의 발생 또는 경과를 효율적으로 억제함을 알 수 있었다. 특히 상기 소포는 신경발달 질환, 신경질환 또는 정신질환의 핵심적인 면역 관련 신호전달 물질인 NLRP3 inflammasome 형성을 조절하여 여러 가지 염증성 인자에 의한 염증을 억제함으로써 신경 줄기세포 및 신경세포의 비정상적인 사멸을 억제함을 알 수 있었다. 또한, 상기 소포는 eNOS 신호를 활성화하여 세포의 항상성에 핵심 신호전달 물질인 NO 생성을 유도하여, 산화 스트레스에 의해 억제되는 sirtuin 1 및 sirtuin 7의 발현을 회복시켜 신경 줄기세포 및 신경세포의 항상성을 증가시킬 수 있으며, BDNF 발현을 증가시켜 신경 줄기세포의 증식 및 분화 뿐만 아니라 신경세포의 생존 및 신경세포 간 연결성을 증가시켜 신경발달 질환, 신경질환 및 정신질환을 효율적으로 치료할 수 있음을 알 수 있었다.
따라서, 본 발명의 마이크로코커스 루테우스 유래 소포는 신경발달 질환, 신경질환, 또는 정신질환의 개선, 예방, 또는 치료 용도로서 사용될 수 있을 것으로 기대된다.
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.
본 발명자들은 마이크로코커스 루테우스 유래 소포를 경구 투여하였을 때, 소포가 혈관으로 흡수되어 뇌 조직에 분포함을 확인하였다. 또한, 상피세포 및 염증세포에 상기 소포를 처리하였을 때, 병원성 인자에 의한 염증성 매개체 분비를 현저히 억제하고, 세포에 상기 소포를 처리하였을 때, 병원성 인자에 의해 유도되는 NLRP3 단백질 발현 및 NF-kB(p65) 신호를 억제함을 확인하였다. 또한, 세포에 상기 소포를 처리하였을 때, 병원성 인자에 의해 억제되는 eNOS 신호를 증가시킴을 확인하였다. 또한, 신경세포에 상기 소포를 처리하였을 때, 병원성 인자에 의해 억제되는 BDNF 유전자 발현을 회복시킴을 확인하였다. 또한, 신경세포에 상기 소포를 처리하였을 때, 병원성 인자에 의해 억제되는 sirtuin 1 및 sirtuin 7 유전자 발현을 회복시킴을 확인하였다. 또한, 신경질환 마우스 모델에 상기 소포를 투여하였을 때, 인지 기능이 유의하게 회복됨을 확인하였다. 또한, 상기 신경질환 마우스 모델에 상기 소포를 투여하였을 때, 신경 생성이 유의하게 회복됨을 확인하였는바, 본 발명에 따른 마이크로코커스 루테우스 유래 소포는 신경발달 질환, 신경질환, 또는 정신질환을 예방, 증상 개선, 또는 치료하기 위한 의약품 또는 건강기능식품 등의 개발에 유용하게 이용될 수 있을 뿐만 아니라, 신경발달 질환, 신경질환, 또는 정신질환을 치료하기 위한 약물 전달 시스템으로서 유용하게 이용될 수 있을 것으로 기대된다.

Claims (25)

  1. 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포를 유효성분으로 포함하는, 신경발달 질환, 신경질환, 또는 정신질환의 예방 또는 치료용 약학적 조성물.
  2. 제1항에 있어서.
    상기 신경질환은 퇴행성 신경질환 또는 염증성 신경질환인 것을 특징으로 하는, 약학적 조성물.
  3. 제2항에 있어서,
    상기 퇴행성 신경질환은 알츠하이머병(Alzheimer’s disease), 파킨슨병(Parkinson’s disease), 근위축성 측삭 경화증(amyotropic lateral sclerosis), 헌팅턴병(Huntington’s disease), 뇌전증(epilepsy), 컨스-세이어증후군(Kearns-Sayre syndrome; KSS), 만성 진행성 외안근마비(chronic progressive external ophthalmoplegia; CPEO), 멜라스증후군(mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes; MELAS), MERRF증후군(myoclonic epilepsy with ragged-red fibers; MERRF), NARP증후군(neurogenic weakness with ataxia and retinitis pigmentosa; NARP), 리 증후군(Leigh syndrome; LS), 및 MIRAS증후군(mitochondrial recessive ataxia syndrome)으로 이루어진 군으로부터 선택된 하나 이상의 질환인 것을 특징으로 하는, 약학적 조성물.
  4. 제2항에 있어서,
    상기 염증성 신경질환은 다발성경화증(multiple sclerosis), 만성염증탈수초다발신경병증(chronic inflammatory demyelinating polyneuropathy), 및 당뇨병성 신경병증(diabetic neuropathy)으로 이루어진 군으로부터 선택된 하나 이상의 질환인 것을 특징으로 하는, 약학적 조성물.
  5. 제1항에 있어서,
    상기 정신질환은 우울장애(major depressive disorder), 양극성기분장애(bipolar disorder), 불안장애(anxiety disorder), 조현병(schizophrenia) 강박장애 (obsessive compulsive disorder), 외상후스트레스장애(post-traumatic stress disorder), 해리장애(dissociative disorder), 섭식장애(eating disorder), 물질사용장애(substance use disorder), 및 성격장애(personality disorder)로 이루어진 군으로부터 선택된 하나 이상의 질환인 것을 특징으로 하는, 약학적 조성물.
  6. 제5항에 있어서,
    상기 불안장애는 공황장애(panic disorder), 사회적불안장애(social anxiety disorder), 범불안장애(generalized anxiety disorder), 및 특정 공포증(specific phobia)으로 이루어진 군으로부터 선택된 하나 이상의 불안장애인 것을 특징으로 하는, 약학적 조성물.
  7. 제5항에 있어서,
    상기 성격장애는 편집성 성격장애(paranoid personality disorder), 반사회적 성격장애(antisocial personality disorder), 경계성 성격장애(borderline personality disorder), 자기애 성격장애(narcissistic personality disorder), 회피성 성격장애(avoidant personality disorder), 및 의존성 성격장애(dependent personality disorder)로 이루어진 군으로부터 선택된 하나 이상 성격장애인 것을 특징으로 하는, 약학적 조성물.
  8. 제1항에 있어서,
    상기 신경발달 질환은 지적장애(intellectual disability), 의사소통장애(communication disorder), 자폐 스펙트럼 장애(autism spectrum disorder), 주의력결핍/과잉행동장애(attention deficit hyperactivity disorder), 특정학습장애(specific learning disorder), 및 운동장애(motor disorder)로 이루어진 군으로부터 선택된 하나 이상인 것을 특징으로 하는, 약학적 조성물.
  9. 제1항에 있어서,
    상기 신경발달 질환, 신경질환, 또는 정신질환은 신경생성의 장애(neurogenesis dysfunction)로 인한 것을 특징으로 하는, 약학적 조성물.
  10. 제1항에 있어서,
    상기 신경발달 질환, 신경질환, 또는 정신질환은 NLRP3 inflammasome(NLR family pyrin domain containing 3 inflammasome)에 의해 매개되는 것을 특징으로 하는, 약학적 조성물.
  11. 제1항에 있어서,
    상기 조성물은 NLRP3 inflammasome 형성을 억제하는 것을 특징으로 하는, 약학적 조성물.
  12. 제1항에 있어서,
    상기 소포는 평균 직경이 10 내지 200 nm인 것을 특징으로 하는, 약학적 조성물.
  13. 제1항에 있어서,
    상기 소포는 마이크로코커스 루테우스(Micrococcus luteus)에서 자연적으로 분비 또는 인공적으로 생산되는 것을 특징으로 하는, 약학적 조성물.
  14. 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포를 유효성분으로 포함하는, 신경발달 질환, 신경질환, 또는 정신질환의 예방 또는 개선용 식품 조성물.
  15. 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포를 유효성분으로 포함하는, 신경발달 질환, 신경질환, 또는 정신질환의 예방 또는 치료용 흡입제 조성물.
  16. 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포를 유효성분으로 포함하는, 신경발달 질환, 신경질환, 또는 정신질환 치료 약물 전달용 조성물.
  17. 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포를 유효성분으로 포함하는, 항노화용 약학적 조성물.
  18. 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포를 유효성분으로 포함하는, 항노화용 식품 조성물.
  19. 제18항에 있어서,
    상기 조성물은 뇌 또는 신경세포의 노화를 억제하는 것을 특징으로 하는, 식품 조성물.
  20. 마이크로코커스(Micrococcus) 속 세균 유래 소포를 유효성분으로 포함하는, 신경발달 질환, 신경질환, 또는 정신질환의 예방 또는 치료용 약학적 조성물.
  21. 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포를 유효성분으로 포함하는 조성물을 이를 필요로 하는 개체에 투여하는 단계를 포함하는, 신경발달 질환, 신경질환, 또는 정신질환의 예방 또는 치료 방법.
  22. 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포를 유효성분으로 포함하는 조성물의 신경발달 질환, 신경질환, 또는 정신질환 예방 또는 치료 용도.
  23. 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포의 신경발달 질환, 신경질환, 또는 정신질환 치료용 약제의 제조를 위한 용도.
  24. 신경발달 질환, 신경질환, 또는 정신질환 치료 약물을 담지한 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포를 유효성분으로 포함하는 조성물을 이를 필요로 하는 개체에 투여하는 단계를 포함하는, 신경발달 질환, 신경질환, 또는 정신질환 치료 약물 전달 방법.
  25. 마이크로코커스 루테우스(Micrococcus luteus) 유래 소포를 유효성분으로 포함하는 조성물의 신경발달 질환, 신경질환, 또는 정신질환 치료 약물 전달 용도.
PCT/KR2021/016633 2020-12-28 2021-11-15 마이크로코커스 루테우스 유래 세포외 소포를 포함하는 신경발달 질환, 신경질환, 또는 정신질환 예방 또는 치료용 조성물 WO2022145710A1 (ko)

Priority Applications (3)

Application Number Priority Date Filing Date Title
CN202180088164.2A CN116806153A (zh) 2020-12-28 2021-11-15 用于预防或治疗神经发育障碍、神经系统疾病或精神疾病的包含源自藤黄微球菌的细胞外囊泡的组合物
EP21915508.2A EP4268836A1 (en) 2020-12-28 2021-11-15 Composition for preventing or treating neurodevelopmental, neurological or psychiatric diseases, comprising extracellular vesicles derived from micrococcus luteus
JP2023539322A JP2024501034A (ja) 2020-12-28 2021-11-15 マイクロコッカス・ルテウス由来細胞外小胞を含む神経発達疾患、神経疾患、または精神疾患の予防または治療用組成物

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20200184337 2020-12-28
KR10-2020-0184337 2020-12-28
KR1020210156079A KR102670461B1 (ko) 2020-12-28 2021-11-12 마이크로코커스 루테우스 유래 세포외 소포를 포함하는 신경발달 질환, 신경질환, 또는 정신질환 예방 또는 치료용 조성물
KR10-2021-0156079 2021-11-12

Publications (1)

Publication Number Publication Date
WO2022145710A1 true WO2022145710A1 (ko) 2022-07-07

Family

ID=82260477

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/016633 WO2022145710A1 (ko) 2020-12-28 2021-11-15 마이크로코커스 루테우스 유래 세포외 소포를 포함하는 신경발달 질환, 신경질환, 또는 정신질환 예방 또는 치료용 조성물

Country Status (3)

Country Link
EP (1) EP4268836A1 (ko)
JP (1) JP2024501034A (ko)
WO (1) WO2022145710A1 (ko)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180019482A (ko) * 2016-08-16 2018-02-26 주식회사 엠디헬스케어 락토바실러스 속 세균 유래 소포를 포함하는 정신질환 예방 또는 치료용 조성물
US20190070225A1 (en) * 2016-03-14 2019-03-07 Holobiome, Inc. Modulation of the gut microbiome to treat mental disorders or diseases of the central nervous system
KR20190103962A (ko) * 2018-02-28 2019-09-05 주식회사 엠디헬스케어 마이크로코커스 속 세균 유래 나노소포 및 이의 용도
KR20200053531A (ko) * 2017-09-08 2020-05-18 에벨로 바이오사이언시즈, 인크. 박테리아 세포외 소포

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20190070225A1 (en) * 2016-03-14 2019-03-07 Holobiome, Inc. Modulation of the gut microbiome to treat mental disorders or diseases of the central nervous system
KR20180019482A (ko) * 2016-08-16 2018-02-26 주식회사 엠디헬스케어 락토바실러스 속 세균 유래 소포를 포함하는 정신질환 예방 또는 치료용 조성물
KR20200053531A (ko) * 2017-09-08 2020-05-18 에벨로 바이오사이언시즈, 인크. 박테리아 세포외 소포
KR20190103962A (ko) * 2018-02-28 2019-09-05 주식회사 엠디헬스케어 마이크로코커스 속 세균 유래 나노소포 및 이의 용도

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
CHOI JULI, KIM YOON-KEUN, HAN PYUNG-LIM: "Extracellular Vesicles Derived from Lactobacillus plantarum Increase BDNF Expression in Cultured Hippocampal Neurons and Produce Antidepressant-like Effects in Mice", EXPERIMENTAL NEUROBIOLOGY, vol. 28, no. 2, 30 April 2019 (2019-04-30), pages 158 - 171, XP055948204, ISSN: 1226-2560, DOI: 10.5607/en.2019.28.2.158 *
PHARMACOTHERAPY, vol. 35, no. 10, October 2015 (2015-10-01), pages 910 - 6

Also Published As

Publication number Publication date
EP4268836A1 (en) 2023-11-01
JP2024501034A (ja) 2024-01-10

Similar Documents

Publication Publication Date Title
WO2021256665A1 (ko) 락토바실러스 파라카세이 유래 소포를 포함하는 신경질환 또는 정신질환 예방 또는 치료용 조성물
WO2022154356A1 (ko) (7s)-(+)-시클로펜틸 카바믹산, 8,8-디메틸-2-옥소-6,7-디히드로-2h,8h-피라노[3,2-g]크로멘-7-일-에스테르를 유효성분으로 포함하는 안질환의 예방, 개선 또는 치료용 조성물
WO2016140527A1 (ko) 오스모틴 펩티드를 유효성분으로 함유하는 신경질환의 예방, 개선 또는 치료용 조성물
WO2018088862A1 (ko) 팥꽃나무 꽃 추출물 또는 이의 분획물을 유효성분으로 포함하는 신경퇴행성 질환 예방 또는 치료용 약학 조성물
KR20220094116A (ko) 마이크로코커스 루테우스 유래 세포외 소포를 포함하는 신경발달 질환, 신경질환, 또는 정신질환 예방 또는 치료용 조성물
WO2022145710A1 (ko) 마이크로코커스 루테우스 유래 세포외 소포를 포함하는 신경발달 질환, 신경질환, 또는 정신질환 예방 또는 치료용 조성물
WO2022145656A1 (ko) 마이크로코커스 루테우스 유래 세포외 소포를 포함하는 안질환 예방 또는 치료용 조성물
WO2022255744A1 (ko) 락토바실러스 플란타룸 유래 소포 및 이의 용도
WO2022124614A1 (ko) 스핀고모나스 세균 유래 소포를 포함하는 신경질환 또는 정신질환 예방 또는 치료용 조성물
WO2018106009A1 (ko) 단풍잎 추출물 또는 이의 분획물을 포함하는 염증성 안구질환 예방 또는 치료용 조성물
WO2014109587A1 (ko) 천연 추출물을 포함하는 당뇨합병증 또는 혈관부종의 예방 또는 치료용 약학적 조성물 및 건강기능식품 조성물
WO2022015033A1 (ko) 페디오코쿠스 이노피나투스 또는 이로부터 유래된 세포밖 소포체를 유효성분으로 포함하는 뇌질환의 치료용 조성물
WO2022145711A1 (ko) 마이크로코커스 루테우스 유래 세포외 소포를 포함하는 대사질환 예방 또는 치료용 조성물
WO2021033995A1 (ko) 초과 추출물을 함유하는 근육 감소 관련 질병의 예방, 개선, 또는 치료용 조성물
WO2015108372A1 (ko) 오스모틴을 포함하는 흥분독성 또는 시냅스 기능 장애에 의한 신경 질환의 예방 또는 치료용 조성물, 및 이를 이용한 신경 질환의 예방 또는 치료 방법
WO2021045567A1 (ko) 세포 유래 베시클을 이용한 침샘 질환 예방 또는 치료용 조성물
WO2021002642A1 (ko) 뱀독을 포함하는 류마티스 관절염의 예방 또는 치료용 조성물
WO2020106048A1 (ko) 퇴행성 신경질환의 예방 또는 치료용 약학 조성물
WO2019078381A1 (ko) 엔테로코커스 패칼리스, 이의 배양액 또는 이의 사균체를 유효성분으로 함유하는 근육감퇴, 약화 및 근위축 예방, 개선 또는 치료용 약학 조성물, 식품 조성물 및 식품첨가제
WO2024063223A1 (ko) 미토콘드리아 표적 화합물을 유효성분으로 포함하는 망막 변성 치료용 약학적 조성물
WO2022255553A1 (ko) 락토바실러스 파라카세이 유래 세포외소포를 포함하는 안질환 예방 또는 치료용 조성물
WO2022186658A1 (ko) D-리보-2-헥술로스를 유효성분으로 포함하는 사코페니아 예방, 개선 또는 치료용 조성물
WO2022255784A1 (ko) 락토바실러스 람노수스 유래 소포 및 이의 용도
WO2023140505A1 (ko) 할로푸지논을 유효성분으로 함유하는 신경퇴행성 또는 운동신경 질환 예방 또는 치료용 조성물
WO2022114528A1 (ko) 락토코커스 락티스 유래 소포를 포함하는 호산구성 염증질환 또는 th2 과민성 면역질환 예방, 치료, 또는 개선용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21915508

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2023539322

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 202180088164.2

Country of ref document: CN

WWE Wipo information: entry into national phase

Ref document number: 2021915508

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021915508

Country of ref document: EP

Effective date: 20230728